role of the catecholamine and limbic systems in narcolepsy/cataplexy · 2013-12-13 · ii role of...
TRANSCRIPT
Role of the Catecholamine and Limbic Systems in Narcolepsy/Cataplexy
by
Christian Richard Burgess
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Graduate Department of Cell and Systems Biology University of Toronto
© Copyright by Christian Richard Burgess 2012
ii
Role of the catecholamine and limbic systems in
narcolepsy/cataplexy
Doctor of Philosophy, 2012
Christian Richard Burgess
Graduate Department of Cell & Systems Biology
University of Toronto
Abstract
In this thesis I investigated the neural circuits that trigger cataplexy in mice. Specifically,
I first addressed the theory that cataplexy is a REM sleep disorder. I then investigated a role for
the noradrenergic and dopaminergic systems in murine cataplexy. Finally, I addressed the role of
the amygdala in triggering cataplexy. From this work several specific conclusions can be drawn:
1. Cataplexy does not share a common executive mechanism with REM sleep, although the
two may share a common mechanism that generates muscle atonia. Muscle tone during
REM sleep and cataplexy is similar, however increasing REM sleep pressure does not
increase cataplexy and positive affective stimuli that can increase cataplexy tend to
decrease REM sleep.
2. Systemic manipulation of dopamine receptors can modulate cataplexy without affecting
behavioral state. Specifically, manipulation of D2-like dopamine receptors at specific
doses can modulate cataplexy while having no effect on sleep-wake state or sleep attacks,
and manipulation of D1-like receptors potently affects sleep-wake state and sleep attacks
without affecting cataplexy.
iii
3. Systemic modulation of noradrenergic activity in orexin KO mice is sufficient to
modulate cataplexy. Specifically, activation of excitatory α1 receptors reduces the
occurrence of cataplexy while blockade of these receptors exacerbates it.
4. Withdrawal of an endogenous α1-mediated noradrenergic drive from motor neurons
during wakefulness contributed to the loss of muscle tone during cataplexy. Re-
establishing this excitatory drive exogenously alleviated cataplexy-dependant muscle
atonia.
5. The amygdala is a critical part of the neural mechanism that triggers cataplexy in orexin
KO mice. Ablation of the amygdala resulted in significant decreases in both baseline
cataplexy and emotionally-induced cataplexy. The amygdala may trigger cataplexy
through direct projections to brainstem areas that regulate muscle atonia.
iv
Acknowledgments
I would first like to thank Dr. John Peever. John gave me an opportunity to pursue
research and has been a great supervisor and mentor over the last 7 years. The work in this thesis
would not be possible without his guidance.
Thanks to all the members of the Peever lab: Zoltan, Jimmy, Peter, Nicole, Lauren, Paul,
Arash, Jenn, Sharshi, Angie, Simon, Saba and Gavin. I would like to single out Dr. Patti Brooks
who was not only a great colleague but also a wonderful friend and roommate throughout my
time in the Peever lab, this thesis would not have been possible without her.
Approximately one third of the work in this thesis was completed in the department of
Neurology, Harvard Medical School, at Beth Israel Deaconess Medical Center. I would like to
thank Dr. Tom Scammell for the opportunity to study in his lab; he provided great mentorship
throughout our collaboration. I would also like to thank the other members of the Scammell lab:
Takatoshi, Mihoko, Daniel, Chloe, Phillip and LJ for their help and friendship during my time in
Boston.
I thank my supervisory committee, Dr. Vince Tropepe and Dr. Richard Stephenson, for
advice and guidance throughout my PhD. I also thank Dr. Barry Sessle, Dr. Junchul Kim, and
Dr. Chris Leonard for serving on my PhD thesis defense committee and Peggy Salmon, Ian
Buglass, Tamar Mamourian, Catherine Siu and Nalini Dominique for their assistance throughout
my PhD.
Thanks also to my parents, Tony and Camilla, my siblings, Erin, Robert, Elna, Shaina,
Marc, Andrew and April, my nephews, Luka and Ellington, and my best friend, Egan, for their
love and support.
v
Table of Contents
Acknowledgments.......................................................................................................................... iv
Table of Contents .............................................................................................................................v
List of Figures ................................................................................................................................ xi
List of Abbreviations ................................................................................................................... xiv
Chapter 1: Introduction ..............................................................................................................2
1.1 Narcolepsy ...........................................................................................................................2
1.1.1 Cataplexy .................................................................................................................2
1.1.2 Etiology ....................................................................................................................5
1.1.3 Treatment .................................................................................................................6
1.1.4 Animal models of narcolepsy/cataplexy ..................................................................7
1.1.5 Sleep states ...............................................................................................................8
1.1.6 The orexin system ..................................................................................................12
1.2 Neurobiology of cataplexy .................................................................................................17
1.2.1 The dopaminergic system ......................................................................................17
1.2.2 The noradrenergic system ......................................................................................22
1.2.3 The amygdala .........................................................................................................27
1.2.4 Other transmitter systems ......................................................................................32
1.2.5 Cataplexy as a manifestation of REM sleep ..........................................................34
1.2.6 Current model of cataplexy ....................................................................................35
1.3 Thesis overview .................................................................................................................38
Chapter 2: Methods..................................................................................................................40
2.1 Mice ...................................................................................................................................40
2.2 Surgical procedures ............................................................................................................40
2.3 Sleep recording ..................................................................................................................41
vi
2.4 Behavioral state analysis ....................................................................................................41
2.5 Histology ............................................................................................................................42
Chapter 3: REM sleep and Cataplexy are generated by Independent Mechanisms ................44
3.1 Abstract ..............................................................................................................................44
3.2 Introduction ........................................................................................................................44
3.3 Methods..............................................................................................................................45
3.3.1 Animals ..................................................................................................................45
3.3.2 Surgery ...................................................................................................................46
3.3.3 Electrophysiological recordings.............................................................................46
3.3.4 REM sleep deprivation protocol ............................................................................46
3.3.5 Wheel running and chocolate protocol ..................................................................47
3.3.6 Ultrasonic vocalizations and social reunion paradigm ..........................................48
3.3.7 Statistics .................................................................................................................48
3.4 Results ................................................................................................................................48
3.4.1 Muscles exhibit atonia during both REM sleep and cataplexy ..............................49
3.4.2 Putative positive emotions trigger cataplexy in mice ............................................52
3.4.3 Stimulating environments increase cataplexy but decrease REM sleep ................54
3.4.4 Increasing REM sleep pressure does not affect cataplexy .....................................57
3.5 Discussion ..........................................................................................................................64
3.5.1 REM sleep and cataplexy are similar states ...........................................................64
3.5.2 Muscle tone during REM sleep and cataplexy is similar .......................................64
3.5.3 Positive affective stimuli induce cataplexy and suppress REM sleep in mice ......66
3.5.4 REM sleep pressure does not significantly increase cataplexy .............................67
3.5.5 REM sleep and cataplexy do not share a common executive mechanism .............68
Chapter 4: Dopaminergic Regulation of Sleep and Cataplexy ................................................71
4.1 Abstract ..............................................................................................................................71
vii
4.2 Introduction ........................................................................................................................71
4.3 Methods..............................................................................................................................72
4.3.1 Animals ..................................................................................................................72
4.3.2 Surgery ...................................................................................................................73
4.3.3 Drug preparation ....................................................................................................73
4.3.4 Data acquisition .....................................................................................................74
4.3.5 Experimental protocols ..........................................................................................74
4.3.6 Data analysis ..........................................................................................................74
4.3.7 Statistical analysis ..................................................................................................75
4.4 Results ................................................................................................................................75
4.4.1 Orexin KO mice exhibit cataplexy and sleep attacks ............................................75
4.4.2 Amphetamine reduced cataplexy and sleep attacks in narcoleptic mice ...............78
4.4.3 D1-like receptors modulate sleep attacks but not cataplexy ..................................80
4.4.4 D2-like receptors modulate cataplexy but not sleep attacks ..................................84
4.5 Discussion ..........................................................................................................................88
4.5.1 Amphetamine alleviates cataplexy and sleep attacks ............................................88
4.5.2 A D2-like receptor mechanism modulates cataplexy ............................................89
4.5.3 A D1-like receptor mechanism modulates sleep attacks .......................................89
4.5.4 Physiological significance .....................................................................................90
Chapter 5: Noradrenergic Regulation of Cataplexy ................................................................93
5.1 Abstract ..............................................................................................................................93
5.2 Introduction ........................................................................................................................93
5.3 Methods..............................................................................................................................94
5.3.1 Animals ..................................................................................................................94
5.3.2 Surgical preparation ...............................................................................................95
5.3.3 Experimental procedures for sleep and microdialysis studies ...............................95
viii
5.3.4 Experimental paradigm ..........................................................................................98
5.3.5 Verification of probe location ................................................................................98
5.3.6 Data analysis ..........................................................................................................99
5.3.7 Statistical analysis ................................................................................................100
5.4 Results ..............................................................................................................................100
5.4.1 Focal activation of α1 receptors on trigeminal motor neurons increased masseter EMG activity in freely behaving mice ..................................................100
5.4.2 Masseter muscles experienced atonia during cataplexy ......................................103
5.4.3 Cataplexy is affected by changes in noradrenergic activity .................................105
5.4.4 Drug manipulations targeted trigeminal motor neurons ......................................107
5.4.5 Loss of noradrenergic drive to motor neurons is not sufficient for triggering cataplexy ..............................................................................................................112
5.4.6 Restoration of noradrenergic activity increased muscle tone during cataplexy ..114
5.5 Discussion ........................................................................................................................117
5.5.1 The noradrenergic system regulates cataplexy ....................................................117
5.5.2 Withdrawal of noradrenergic drive promotes cataplexy ......................................118
5.5.3 Noradrenaline could act at REM sleep generating sites to modulate cataplexy ..119
5.5.4 Other circuits involved in cataplexy ....................................................................120
5.5.5 Conclusions ..........................................................................................................121
Chapter 6: Role for the Amygdala in Triggering Cataplexy .................................................123
6.1 Abstract ............................................................................................................................123
6.2 Introduction ......................................................................................................................123
6.3 Methods............................................................................................................................124
6.3.1 Animals ................................................................................................................124
6.3.2 Surgery .................................................................................................................125
6.3.3 Experimental protocol ..........................................................................................125
ix
6.3.4 Data acquisition and analysis ...............................................................................126
6.3.5 Histology ..............................................................................................................126
6.3.6 Anterograde tracing .............................................................................................127
6.3.7 Statistical analysis ................................................................................................127
6.4 Results ..............................................................................................................................127
6.4.1 The amygdala is anatomically well positioned to regulate cataplexy ..................127
6.4.2 Amygdala lesions reduced cataplexy under baseline conditions .........................128
6.4.3 Amygdala lesions decreased cataplexy triggered by a positive stimulus ............128
6.4.4 Amygdala lesions decreased cataplexy triggered by a strong positive stimulus .133
6.5 Discussion ........................................................................................................................135
6.5.1 The amygdala is an important part of the cataplexy inducing circuitry ..............135
6.5.2 Interventions affected sleep-wake behavior.........................................................136
6.5.3 Conclusions ..........................................................................................................139
Chapter 7: Discussion ............................................................................................................141
7.1 Overview ..........................................................................................................................141
7.2 Cataplexy as a REM sleep phenomenon ..........................................................................141
7.3 Dopaminergic regulation of cataplexy .............................................................................141
7.4 Noradrenergic regulation of cataplexy .............................................................................142
7.5 The role of the amygdala in triggering cataplexy ............................................................144
7.6 General model of the mechanisms underlying cataplexy ................................................148
7.7 Limitations .......................................................................................................................150
7.8 Future directions ..............................................................................................................151
7.9 Summary ..........................................................................................................................152
References ....................................................................................................................................154
x
List of Tables
Table 6-1: Sleep-wake architecture in amygdala-lesioned mice ................................................ 132
xi
List of Figures
Figure 1.1: Raw traces of EMG activity during an episode of cataplexy. ...................................... 4
Figure 1.2: Sleep-wake regulation in rodents ............................................................................... 10
Figure 1.3: Brainstem mechanisms regulating REM sleep atonia ................................................ 11
Figure 1.4: Orexin projections ...................................................................................................... 14
Figure 1.5: Dopamine projections................................................................................................. 19
Figure 1.6: Noradrenaline projections .......................................................................................... 24
Figure 1.7: A simplified schematic of major inputs and outputs of the amygdala ....................... 29
Figure 1.8: Model of how the orexin (hypocretin) system could prevent the loss of muscle tone in
response to positive emotions ....................................................................................................... 37
Figure 3.1: REM sleep and cataplexy occur in similar amounts during the dark period .............. 50
Figure 3.2: Muscle tone during REM sleep and cataplexy. .......................................................... 51
Figure 3.3: USVs are associated with cataplexy in orexin KO mice ............................................ 53
Figure 3.4: Wheel running and chocolate increased cataplexy and decreased REM sleep .......... 55
Figure 3.5: Stimulating environments increased waking and decreased NREM sleep during the
dark period .................................................................................................................................... 56
Figure 3.6: Selective REM sleep deprivation reduced both NREM and REM sleep ................... 59
Figure 3.7: REM sleep deprivation had no effect on behavioral state over the following dark
period ............................................................................................................................................ 60
Figure 3.8: REM sleep accrued a deficit during the deprivation that was in part recovered over
the following dark period .............................................................................................................. 61
xii
Figure 3.9: Cataplexy was reduced at the beginning of the dark period following deprivation ... 62
Figure 3.10: Wakefulness during the dark period was not significantly affected by REM sleep
deprivation .................................................................................................................................... 63
Figure 3.11: Cataplexy and REM sleep are generated by different mechanisms ......................... 69
Figure 4.1: Cataplexy, sleep attacks and sleep-wake behavior in narcoleptic mice ..................... 77
Figure 4.2: Amphetamine decreased sleep, sleep attacks and cataplexy ...................................... 79
Figure 4.3: Inactivation of D1-like receptors increased sleep attacks .......................................... 82
Figure 4.4: Activation of D1-like receptors decreased sleep attacks ............................................ 83
Figure 4.5: Activation of D2-like receptors increased cataplexy ................................................. 86
Figure 4.6: Blockade of D2-like receptors decreased cataplexy................................................... 87
Figure 5.1: Microdialysis probe insertion into the trigeminal motor nucleus............................... 97
Figure 5.2: Phenylephrine application increased muscle tone in freely behaving mice ............. 102
Figure 5.3: Muscles experienced atonia during cataplexy .......................................................... 104
Figure 5.4: Cataplexy is sensitive to changes in noradrenergic tone .......................................... 106
Figure 5.5: Drug manipulations targeted trigeminal motor neurons........................................... 109
Figure 5.6: Targeted drug manipulations did not affect sleep-wake architecture ....................... 110
Figure 5.7: Targeted drug manipulations did not influence cataplexy ....................................... 111
Figure 5.8: Loss of noradrenergic drive contributes to muscle atonia during cataplexy ............ 113
Figure 5.9: Stimulating α1 receptors on motor neurons increased muscle tone during sleep in
orexin KO mice ........................................................................................................................... 115
xiii
Figure 5.10: Activation of α1 receptors on motor neurons elevated muscle tone during cataplexy
..................................................................................................................................................... 116
Figure 6.1: The central nucleus of the amygdala projects to brainstem regions that regulate REM
sleep ............................................................................................................................................ 129
Figure 6.2: Excitotoxic lesions of the amygdala ......................................................................... 130
Figure 6.3: Amygdala lesions reduce cataplexy in orexin KO mice .......................................... 131
Figure 6.4: Amygdala lesions reduced cataplexy in orexin KO mice even when accounting for
changes in wakefulness ............................................................................................................... 134
Figure 6.5: Hypothesized model of the neural pathways through which positive emotions trigger
cataplexy ..................................................................................................................................... 138
Figure 7.1: Dopaminergic control of cataplexy. ......................................................................... 143
Figure 7.2: Noradrenergic control of cataplexy. ......................................................................... 145
Figure 7.3: Amygdaloid control of cataplexy ............................................................................. 147
Figure 7.4: General schematic of cataplexy mechanisms ........................................................... 149
xiv
List of Abbreviations
ºC degree Celsius
5-HT serotonin
aCSF artificial cerebral spinal fluid
AMPA α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid
A.U. arbitrary units
AW active wake
BF basal forebrain
BLA basolateral nucleus of the amygdala
CeA central nucleus of the amygdala
ChAT choline acetyl-transferase
CNS central nervous system
DA dopamine
DAT dopamine transporter
DR dorsal raphe
DREADDS designer receptors exclusively activated by designer drugs
EEG electroencephalogram
EMG electromyogram
g grams
GABA γ-aminobutryic acid
GHB γ-hydroxybuterate
h hours
Hz hertz
ICV Intracerebral ventricular
k kilo
KO knockout
L litre
LC locus coeruleus
LDT lateral dorsal tegmentum
LH lateral hypothalamus
LM left masseter
i.p. intraperitoneal
u micro
LPT lateral pontine tegmentum
m metre
M molar
MCH melanin concentrating hormone
NA noradrenaline
xv
NARP neuronal activity regulated pentraxin
NET noradrenaline transporter
NPY neuropeptide Y
NREM non-rapid eye movement
OX1R orexin receptor 1
OX2R orexin receptor 2
PE phenylephrine
PFC prefrontal cortex
PPT pedunculopontine tegmentum
QW quiet wake
REM rapid eye movement
RM right masseter
s seconds
SEM standard error of the mean
SLD sublateraldorsal nucleus
SN substantia nigra
TER terazosin
TMN tuberomammillary nucleus
USV ultrasonic vocalization
vlPAG ventrolateral periaquaductal gray
VLPO ventral lateral preoptic area
VMM ventral medial medulla
VTA ventral tegmental area
WR wheel running
1
Chapter 1: Introduction
2
Chapter 1: Introduction
1.1 Narcolepsy
Narcolepsy is a debilitating sleep disorder with symptoms including excessive daytime
sleepiness, fragmented nighttime sleep, sleep paralysis, hypnogogic hallucinations, and episodes
of muscle atonia during wakefulness (Gelineau, 1880). This combination of hypersomnolence
and episodes of muscle weakness was first described by Westphal in 1877 and given its name by
Gelineau in 1880 (Gelineau, 1880, Mignot, 2001, Schenck et al., 2007). Loewenfeld, in 1902,
termed these periods of muscle atonia “cataplexy” (Mignot, 2001).
The prevalence of narcolepsy is approximately 1 in 2000 individuals, although this can be
variable depending on ethnicity and method of estimation (Mignot, 1998, Overeem et al., 2001).
Narcolepsy onset is most common during adolescence but can occur throughout life, including in
childhood. Excessive daytime sleepiness is generally the first symptom to be recognized, with
cataplexy developing later (Overeem et al., 2011). Narcolepsy symptoms can be treated with
moderate efficacy but persist throughout and affects patients’ quality of life.
1.1.1 Cataplexy
The majority of the work presented in this thesis investigates the most unique symptom
of narcolepsy: cataplexy. It is the sudden loss of postural muscle tone during waking that can
result in full postural collapse and last from a few seconds to several minutes; patients typically
remain conscious during cataplexy. Loss of muscle tone can be complete or partial, and most
often affects the muscles of the face, neck and legs, although all muscles can be affected even in
a single episode (Guilleminault et al., 1974, Overeem et al., 2011). Cataplexy can occur at any
time while the patient is awake although it is most often elicited by positive emotions, with
laughing excitedly being one of the best triggers in most patients; however, other triggers
including anger, fear and stress can also elicit cataplexy in human narcoleptics (Nishino and
Kanbayashi, 2005, Overeem et al., 2011). This can be debilitating for human patients with
narcolepsy and can impair their ability to perform even relatively simple tasks, such as driving
(Guilleminault et al., 1974).
3
With the exception of symptomatic cataplexy (i.e. episodes that fit the definition of
cataplexy but are associated with other abnormalities) caused by damage to hypothalamic or
brainstem regions, cataplexy is only seen in narcolepsy (Nishino and Kanbayashi, 2005).
However, cataplexy only occurs in ~70% of narcoleptics (Sasai et al., 2009). It is unclear
whether narcolepsy with and without cataplexy are caused by different mechanisms but there is
some evidence to suggest this is the case; narcoleptics with cataplexy have almost undetectable
levels of orexin in their cerebral spinal fluid, while those without cataplexy often have normal or
only slightly suppressed levels (Nishino et al., 2001, Ripley et al., 2001, Bassetti et al., 2010).
Because cataplexy onset is sudden and emotionally-triggered it has been hypothesized
that changes in autonomic activity may have a role in triggering it (Guilleminault et al., 1986).
Human patients with narcolepsy show no autonomic changes at cataplexy onset, although they
do show a drop in heart rate and a slight increase in blood pressure during cataplexy (Donadio et
al., 2008). During cataplexy patients continue to breathe although the breathing is interrupted by
periods of apnea (Guilleminault et al., 1974). Electroencephalographic (EEG) activity is wake-
like during an episode of cataplexy, consistent with the patient maintaining consciousness, while
electromyographic (EMG) activity is reduced, consistent with the loss of muscle tone
(Guilleminault et al., 1974, Rubboli et al., 2000) (Figure 1.1). In addition to reduced muscle
tone, the H-reflex is abolished during cataplexy in human patients (Guilleminault et al., 1998).
The H-reflex is a reaction of a muscle after electrical stimulation of sensory fibers in the nerves
that innervate the muscle. The H-reflex is present and normal during waking in narcoleptics but
is abolished during cataplexy and REM sleep (Stahl et al., 1980, Overeem et al., 1999, Overeem
et al., 2004).
Cataplexy is thought to be the manifestation of REM sleep during waking, as REM sleep
is the only state where muscle atonia is seen in healthy humans (Rechtschaffen and Dement,
1967). Many of the observations regarding cataplexy mentioned above support this theory;
however, it does not account for certain aspects of cataplexy, including the fact that it is
emotionally induced. Alternative theories exist including that cataplexy is an atavistic expression
of tonic immobility, a defense mechanism present in some animals that involves loss of muscle
tone (Overeem et al., 2002). The mechanisms that trigger cataplexy are unclear.
4
Figure 1.1: Raw traces of EMG activity during an episode of cataplexy.
Muscle tone is abruptly lost at cataplexy onset in the mouse (top), dog (middle) and human
(bottom). Cataplexy episodes affect most postural muscles and at the end of an episode muscle
tone is quickly regained. (Neck, cervical portion of the trapezius; Delt., deltoid; W.Ext., wrist
extensor; APB, abductor pollicis brevis; Parasp., paraspinal musculature at the level of the
insertion of the twelfth rib; Ret. Abd., rectus abdominis; Quadr., quadriceps; Tib.A., tibialis
anterior; R, right; L, left.)
Modified from (Rubboli et al., 2000) and (Wu et al., 1999)
5
1.1.2 Etiology
Narcolepsy was first linked with posterior hypothalamic abnormalities by Constantin von
Economo in 1917 (Mignot, 2001). He made this assertion based on an outbreak of encephalitis
lethargica that resulted in hypothalamic damage and in many cases induced hypersomnolence
and cataplexy. Clinical research in human narcolepsy and basic research using a canine model of
narcolepsy began to elucidate the mechanisms responsible for the symptoms of the disorder but
the neural mechanism from which narcolepsy results remained unclear (Nishino et al., 1994,
Guilleminault et al., 1998). In 1998, two labs independently discovered a pair of hypothalamic
neuropeptides termed orexin A and B (or hypocretin 1 and 2), which have since been
demonstrated to have a key role in the regulation of wakefulness (de Lecea et al., 1998, Sakurai
et al., 1998). The following year another pair of discoveries implicated these peptides in the
etiology of narcolepsy with cataplexy. First, Dr. Yanagisawa’s group at the University of Texas
Southwestern produced an orexin ligand knockout (KO) mouse which expressed a phenotype
strikingly similar to narcolepsy, including sudden episodes of complete muscle atonia (Chemelli
et al., 1999). Then Dr. Mignot’s group at Stanford demonstrated that the canine model of
narcolepsy, which had been an important model for research into the neurobiology of narcolepsy
for the previous 20 years, resulted from a mutated orexin receptor (Lin et al., 1999). A link
between the orexin system and human narcolepsy followed when two publications independently
demonstrated the loss of orexin neurons in narcoleptic patients using post-mortem
immunostaining (Peyron et al., 2000, Thannickal et al., 2000).
Further research has demonstrated that orexin neurons are lost in human narcolepsy with
cataplexy, rather than an inability to produce orexin peptides. For example, gliosis has been
demonstrated in the region of orexin neurons (Thannickal et al., 2003) and neurotransmitters co-
localized with orexin are also lost in narcolepsy, while chemically identified non-orexin neurons
remain unaffected (Blouin et al., 2005, Crocker et al., 2005). This evidence strongly suggests that
loss of hypothalamic orexin neurons underlies human narcolepsy.
The process of orexin neuron loss is thought to be autoimmune in nature. An association
with the human leukocyte antigen gene HLA DQB1*0602 suggests an autoimmune origin
(Carlander et al., 1993, Mignot et al., 1994, Dolenc-Grosel and Vodusek, 2002). Gene linkage
studies have also found associations with other immune related genes, such as T-cell receptor α,
6
supporting this assertion (Hallmayer et al., 2009). Recently, an increase in narcolepsy
prevalence has been demonstrated in several populations, and has been linked with the H1N1
pandemic (Dauvilliers et al., 2010, Bardage et al., 2011, Han et al., 2011, Marcus, 2011, Partinen
et al., 2012). It is unknown whether the flu itself, the vaccine, or an unrelated trigger has caused
this increase but further investigation of the phenomenon may shed light on the autoimmune
nature of orexin cell loss. The extensive and selective nature of orexin neuron loss in narcolepsy
strongly suggests an autoimmune origin, rather than an alternative explanation such as
neurodegeneration or neurotoxicity, however there is no definitive evidence for this (Black et al.,
2002, Scammell, 2006).
It is unknown how the loss of orexin neurons leads to the symptoms of narcolepsy;
however, investigations into the normal role for the orexin system, the underlying neurobiology
of narcolepsy, and treatments for narcolepsy have all provided useful contributions to our
understanding of this disorder.
1.1.3 Treatment
Narcolepsy has traditionally been treated with a combination of stimulants for excessive
daytime sleepiness and tricyclic antidepressants for cataplexy (Ahmed and Thorpy, 2010).
Stimulants such as methamphetamine and methylphenidate effectively manage sleepiness by
increasing release and decreasing reuptake of monoamines (Nishino et al., 1998b, Kanbayashi et
al., 2000, Wisor et al., 2001). Modafinil is an effective treatment for sleepiness in narcolepsy but
the mechanism by it which increases alertness is unclear. Recent evidence suggests it may act
via a dopaminergic mechanism (Scammell and Matheson, 1998, Wisor et al., 2001, Golicki et
al., 2010). Clomipramine and imipramine have been used to effectively treat cataplexy, likely by
reducing noradrenergic uptake (Black and Guilleminault, 2001). Sodium oxybate, the sodium
salt of gamma-hydroxybutyrate (GHB), is the only effective treatment for excessive sleepiness,
cataplexy, and fragmented sleep (Owen, 2008, Huang and Guilleminault, 2009, Poryazova et al.,
2011). Sodium oxybate has been hypothesized to act via activation of GABAB receptors and
perhaps also through activation of GHB receptors, however the precise mechanism by which it
treats narcolepsy is not known; recent evidence suggests it may too act via a dopaminergic
mechanism (Howard and Feigenbaum, 1997, Schmidt-Mutter et al., 1999, Thorpy, 2005, Owen,
2008, Huang and Guilleminault, 2009).
7
Recent novel approaches for narcolepsy treatment include histamine H3 receptor inverse-
agonists. H3 inverse-agonists presumably act at auto-receptors on histamine neurons to increase
histamine release, thereby increasing arousal. H3 inverse agonists have been demonstrated to be
effective for the treatment of excessive sleepiness in narcoleptic patients, dogs and mice but
further testing is required to evaluate their efficacy in treating cataplexy (Parmentier et al., 2007,
Guo et al., 2009, Lin et al., 2011, Inocente et al., 2012).
Since narcolepsy results from selective loss of orexin neurons, restoration of orexinergic
signaling could be the most effective treatment. Orexin receptor agonists, cell transplant, or gene
therapy are all candidate therapies for narcolepsy. Intracerebral ventricular (ICV) application of
an orexin receptor agonist in orexin KO mice resulted in increased wakefulness and reduced
cataplexy establishing a strong rationale for development of these drugs for human patients
(Mieda et al., 2004). Some small molecule agonists have been developed but they cannot cross
the blood brain barrier, while orexin peptides themselves have limited therapeutic potential due
to their short half-life (Deadwyler et al., 2007). A nasal spray application technique has been
tested and has shown promising preliminary results in humans and non-human primates
(Deadwyler et al., 2007, Baier et al., 2011). Orexin gene therapy has been tested in orexin KO
mice with some promising results. Inducing orexin expression in the hypothalamus and zona
incerta, using viral vectors, reduced symptoms of narcolepsy (Liu et al., 2008, Liu et al., 2011a).
Cell transplant and gene therapy in humans each produce significant challenges that could
complicate their effectiveness as a long-term treatment of narcolepsy (Arias-Carrion and
Murillo-Rodriguez, 2009). Much of what is known of the underlying neurobiology of cataplexy
is derived from the treatments that effectively alleviate this symptom of narcolepsy.
1.1.4 Animal models of narcolepsy/cataplexy
There are a number of both naturally occurring and engineered animal models of
narcolepsy with which to study the neurobiology of cataplexy (Scammell et al., 2009). These
models all have good face validity (they demonstrate sleepiness and cataplexy), predictive
validity (human narcolepsy treatments reduce symptoms in animal models), and construct
validity (lack of a functional orexin system). The first animal model of narcolepsy to be studied
was the naturally occurring canine model, with a mutation in an orexin receptor resulting in
sleepiness and severe cataplexy elicited by social interaction and palatable food (Mitler, 1975,
8
Mitler et al., 1976, Darke and Jessen, 1977, Mitler and Dement, 1977). Since the discovery of
the orexin peptides, genetically engineered mouse models of narcolepsy have been developed
(Chemelli et al., 1999). Orexin ligand KO, receptor KO, constitutive receptor KO, and orexin-
neuron ablated models all demonstrate sleepiness and cataplexy (Hara et al., 2001, Willie et al.,
2003, Mochizuki et al., 2004, Kantor et al., 2009, Mochizuki et al., 2011).
Studies in this thesis utilized an orexin KO mouse model of narcolepsy to study the
underlying neurobiology of cataplexy and hypersomnolence. We chose this model as it was well
characterized, had clear episodes of cataplexy, and closely mimicked the human narcolepsy
phenotype (Mochizuki et al., 2004). Details of the production of these mice can be found in
Chemelli et al. (1999). In brief, a specific targeting vector was used to replace exon 1 of the
prepro-orexin gene, the precursor gene for both orexin peptides. The founder mice for the
colony used in these studies were obtained from the Yanagisawa lab at the University of Texas
Southwestern Medical Center, having already been back-crossed to a C57B6/J background.
Chemelli et al. (1999) and later Mochizuki et al. (2004) thoroughly characterized the narcolepsy
phenotype in these mice, including chronic sleepiness, sleep attacks and cataplexy (Chemelli et
al., 1999, Mochizuki et al., 2004). These mice have been used extensively to investigate both
narcolepsy and the normal physiological role of orexin peptides, and serve as a useful model to
investigate the underlying neurobiology of narcolepsy/cataplexy.
1.1.5 Sleep states
As narcolepsy is a disorder of sleep and wakefulness, it is important to know some of the
basic features of sleep in order to understand the symptoms of narcolepsy. Sleep is a period of
relative quiescence that has been observed in all animal species yet investigated. Sleep is
thought to serve an important function although it remains unclear what function, or functions,
sleep is required for. Sleep appears to be homeostatically regulated (a sleep “debt” is accrued
during waking that dissipates during the next sleep phase), supporting the assertion that it is
critical to certain biological processes (Leemburg et al., 2010). It is a combination of circadian
and homeostatic processes that regulate the sleep-wake cycle (Borbely, 1982). As this thesis
focuses on investigations in mice, the remainder of this section will be specific to rodent sleep.
Sleep consists of two separate states: non-rapid eye movement (NREM) and rapid eye
movement (REM), or paradoxical sleep. Under normal conditions, REM sleep follows NREM
9
sleep and the sleep cycle has a duration between 5 and 15 minutes. There are several brain
nuclei that promote wakefulness and arousal. During waking, the noradrenergic, serotonergic,
and cholinergic brainstem neurons, dopaminergic, orexinergic, and histaminergic
midbrain/hypothalamic neurons, and cholinergic, GABAergic basal forebrain neurons actively
promote arousal through projections to the thalamus and/or cortex. During sleep, a collection of
GABAergic neurons in the ventrolateral preoptic area (VLPO) inhibit these arousal centers
(Saper et al., 2010) (Figure 1.2). During REM sleep, melanin concentrating hormone (MCH)
neurons in the hypothalamus and cholinergic neurons in the brainstem trigger a “REM sleep
switch” in the pons that permits entrance into this state (Saper et al., 2010). There are still some
aspects of these mechanisms that remain unclear but this model of sleep-state control provides
the most current understanding of the neurobiology of sleep.
A notable difference between NREM and REM sleep is the level of muscle tone. Muscle
tone has a stereotypical pattern across the sleep-wake cycle: it is generally high during waking,
reduced during NREM sleep, and further reduced during REM sleep (Burgess et al., 2008).
During REM sleep, the complete lack of muscle tone is termed REM sleep atonia, and can be
punctuated by brief muscle twitches. The underlying neurobiology regulating REM sleep atonia
in rodents has been an area of intense investigation (Boissard et al., 2002, Boissard et al., 2003,
Lu et al., 2006b) (Figure 1.3). Motor neurons are actively inhibited during REM sleep by
GABAergic/glycinergic pre-motor neurons in the spinal cord and medial medulla. These pre-
motor neurons receive excitatory glutamatergic inputs from the sublateral dorsal nucleus (SLD)
of the pons, which becomes disinhibited during REM sleep. Lesions of this area can cause REM
sleep without atonia, and may contribute to sleep-related movement disorders such as REM sleep
behavior disorder (Lu et al., 2006b). When muscle tone is required, the SLD is inhibited by
GABAergic neurons in the ventrolateral periaquaductal gray/lateral pontine tegmentum
(vlPAG/LPT) (Boissard et al., 2002, Boissard et al., 2003, Lu et al., 2006b). During the different
sleep/wake states this pontine “switch” receives modulatory inputs from
monoaminergic/orexinergic neurons (that promote muscle tone) or cholinergic/MCH neurons
(that promote muscle atonia). Cataplexy and REM sleep both involve muscle atonia but it is
unclear whether these mechanisms are responsible for both states, or a unique atonia-generating
circuitry underlies cataplexy.
10
Figure 1.2: Sleep-wake regulation in rodents
During waking brainstem, midbrain, hypothalamic, and basal forebrain nuclei are active (top).
These areas provide excitatory input to the thalamus and cortex to promote arousal and
wakefulness. When the mouse enters sleep, GABAergic neurons in the ventrolateral preoptic
area become active (bottom). These neurons inhibit arousal promoting wake-active neurons to
permit the entrance into sleep. (Ach, acetylcholine; OX, orexin; HA, histamine, DA; dopamine;
5-HT, serotonin; NA, noradrenaline)
11
Figure 1.3: Brainstem mechanisms regulating REM sleep atonia
A. During normal waking, arousal-promoting nuclei directly and indirectly inhibit the sublateral
dorsal nucleus (SLD) to suppress muscle atonia. The orexin system has a number of projections
through which it promotes muscle tone. B. During REM sleep, monoaminergic and orexin
nuclei are inhibited, thus disinhibiting the SLD. In addition, REM sleep-promoting systems such
as acetylcholine and MCH may activate the SLD. The SLD then activates inhibitory pre-motor
neurons in the medulla and spinal cord which inhibit motor neurons leading to muscle atonia.
(NA, noradrenaline; 5-HT, serotonin; vlPAG, ventrolateral periaquaductal gray; LPT, lateral
pontine tegmentum; SLD, sublateral dorsal nucleus; MM, medial medulla; Ach, acetylcholine;
MCH, melanin-concentrating hormone; Green arrows represent excitatory pathways; Red lines
represent inhibitory pathways)
12
1.1.6 The orexin system
The orexin system is composed of two peptides (orexin A and B) derived from a common
precursor peptide (prepro-orexin) and two G-protein coupled receptors (OX1R and OX2R) (de
Lecea et al., 1998, Sakurai et al., 1998). Orexin receptor binding increases intracellular Ca2+
predominantly by a Gq protein coupled receptor mechanism. Orexin A binds equally to both
receptors while orexin B shows 10-fold greater affinity for OX2R, both peptides contribute to the
normal physiological role for the orexin system (de Lecea et al., 1998, Sakurai et al., 1998). The
general term orexin will be used to refer to both ligands in this thesis. Orexin neurons also
contain other neurotransmitters, including glutamate and dynorphin (Chou et al., 2001). The
normal physiological role of these transmitters or whether they have a role in
narcolepsy/cataplexy is unclear.
Orexin is only synthesized in neurons of the lateral hypothalamus but these neurons have
widespread projections throughout the central nervous system (CNS). Orexinergic axons and
synapses are present throughout the cortex, forebrain, amygdala, hypothalamus, and brainstem
(Peyron et al., 1998) (Figure 1.4). The orexin system densely innervates many brain areas that
are important in sleep and arousal, including sending its densest projections to the noradrenergic
locus coeruleus (LC) where orexin release has excitatory effects that promote behavioral arousal
(Peyron et al., 1998, van den Pol et al., 2002, Espana et al., 2005, Chen et al., 2010). In addition
orexin neurons innervate several other regulators of sleep-wake state, including the serotonergic
dorsal raphe (DR) and cholinergic basal forebrain/LDT/PPT. Orexin neurons also receive inputs
from various brain areas that are important for the control of behavioral arousal. Several of these
inputs are from sleep-promoting regions (e.g.: the VLPO) or are reciprocal projections from
wake promoting regions (e.g.: BF, DR, and LDT) that could function to promote the
maintenance of behavioral states (Sakurai et al., 2005).
The orexin system also projects to a number of other sites that regulate different types of
arousal. Projections to the ventral tegmental area (VTA) where orexin peptides activate both
dopaminergic and non-dopaminergic neurons, could modulate stimuli-specific arousal, reward
and motivation as the VTA has a role in motivation and processing emotionally salient stimuli
(Nakamura et al., 2000, Narita et al., 2006). Also of note is the demonstration that orexin
13
neurons directly innervate both spinal and cranial motor neurons (Yamuy et al., 2004, McGregor
et al., 2005).
Orexin receptors have a broad expression pattern throughout the brain (Marcus et al.,
2001). In situ hybridization for orexin receptor mRNA has demonstrated widespread and
sometimes non-overlapping expression for both known receptors. OX1R is highly expressed in
the brainstem noradrenergic and cholinergic neurons and the amygdala, among other areas.
OX2R is highly expressed in the cortex, paraventricular hypothalamus and ventral hypothalamus,
among other areas (Marcus et al., 2001). The widespread distribution of orexin receptors and
projections suggests a number of functions for the orexin system.
One function of the orexin system is to establish and maintain a waking state. The
finding that loss of orexin neurons leads to narcolepsy is a clear indication that the orexin system
has a role in sleep-wake regulation and arousal (Peyron et al., 2000, Thannickal et al., 2000).
Studies investigating the normal role of the orexin system have demonstrated that orexin is a key
regulator of behavioral state. Both gain and loss of function experiments have demonstrated that
orexin promotes transitions into and maintenance of wakefulness. Mice lacking a functional
orexin system (i.e. orexin ligand knockout mice) demonstrate behavioral state instability and the
inability to maintain long waking bouts (Mochizuki et al., 2004). Application of orexin peptides
into the brain of mice can increase waking and specifically the length of waking bouts, while
orexin receptor antagonists can induce sleepiness (Mieda et al., 2004, Neubauer, 2010).
14
Figure 1.4: Orexin projections
While orexin neurons are exclusively located in the lateral hypothalamus they project widely
throughout the brain and spinal cord. Projections to arousal-related nuclei allow the orexin
system to regulate sleep-wake state. In addition, the orexin neurons project to the cortex,
thalamus, and may be auto-excitatory. (5-HT, serotonin; DA, dopamine; HA, histamine; NA,
noradrenaline; Ach, acetylcholine; GABA, γ-aminobutryic acid)
15
Recently, more selective techniques have confirmed a role for the orexin system in
wakefulness. Activation of excitatory designer receptors exclusively activated by designer drugs
(DREADDs; exogenous receptors selectively expressed on orexin neurons) on orexin neurons
results in increased wakefulness; while activation of inhibitory DREADDs on orexin neurons
suppressed wakefulness (Sasaki et al., 2011). Optogenetic targeting of orexin neurons, which is
both highly selective and acting at short temporal scales, suggests a role in switching from sleep
to wake. Optogenetic stimulation of orexin neurons in rats resulted in an increased probability of
arousal from both NREM and REM sleep; while optogenetic inhibition of orexin neurons in mice
resulted in short latency entrances into NREM sleep (Adamantidis et al., 2007, Tsunematsu et
al., 2011). The orexin system has a key role in regulating sleep-wake state; the perturbation of
this system leads to narcolepsy, an imbalance between sleep-wake states, and is a useful tool to
study the mechanisms and pathways that normally balance behavioral state.
The orexin system also has a role in motor control. Orexin neuron activity and peptide
release is highest during periods of movement in rats (Kiyashchenko et al., 2002, Lee et al.,
2005, Mileykovskiy et al., 2005). Orexin neurons project directly to both cranial and spinal
motor neurons and also to subcortical motor-related structures, and administration of orexin can
increase locomotion in rodents (Peyron et al., 1998, Thorpe and Kotz, 2005, Samson et al.,
2010). Orexin receptor activation directly on motor neurons has an excitatory effect; it has been
demonstrated to act both pre and post-synaptically to increase motor neuron excitability (Peever
et al., 2003, Yamuy et al., 2004, McGregor et al., 2005). Many symptoms of narcolepsy involve
a decoupling of motor control and behavioral state. In healthy humans, motor activity is high
during waking, suppressed during sleep, and further suppressed during REM sleep muscle
atonia. During cataplexy and sleep paralysis, atonia occurs during wakefulness. Narcoleptics
also have an increased prevalence of sleep-related movement disorders such as REM sleep
behavior disorder, which is increased movement and muscle tone during REM sleep (Wierzbicka
et al., 2009, Franceschini et al., 2011). While the orexin system promotes waking and motor
activity, these findings suggest that the orexin system may help to establish a balance between
behavioral state and proper motor control. In the absence of this stabilizer narcolepsy develops.
While the location of the orexin neuron field (in the lateral hypothalamus) and some early
studies suggested a role for orexin in feeding, subsequent studies have elucidated a key role for
the orexin system in the promotion and maintenance of wakefulness (Sakurai et al., 1998). It is
16
important to note however that the orexin system has been implicated in a number of other
behaviors including energy homeostasis (as orexin neurons receive inputs from local NPY and
POM C neurons, and are responsive to leptin and ghrelin peptides) and addiction/reward
(through interaction with the VTA) (Cason et al., 2010, Moorman and Aston-Jones, 2010, Ponz
et al., 2010a, Quarta et al., 2010, Sakurai and Mieda, 2011, Nixon et al., 2012). Research into
the natural role for the orexin system has implicated these peptides in a number of behaviors.
The afferent and efferent connections formed by the orexin system position it to integrate
disparate systems and behaviors, including metabolism, stress, emotion, pain, motion, and
arousal (Berridge et al., 2010, Chiou et al., 2010, Kuwaki and Zhang, 2010, Teske et al., 2010,
van Dijk et al., 2011).
The loss of orexin neurons results in the symptoms of narcolepsy (Peyron et al., 2000,
Thannickal et al., 2000). This assertion is supported by the finding that hypothalamic damage,
affecting the region of orexin neurons, can result in narcolepsy symptoms (Nishino and
Kanbayashi, 2005). The mechanisms that trigger the loss of muscle tone in response to positive
emotions (i.e. cataplexy) are present in healthy individuals and may lead to momentary muscle
weakness, the feeling that one is “weak with laughter” (Overeem et al., 1999, Overeem et al.,
2004). In healthy individuals it is hypothesized that the orexin system counteracts this
momentary weakness and prevents cataplexy, whereas in the absence of the orexin system (i.e.
narcolepsy) there is no counter to the muscle weakness and cataplexy occurs. The observation
that orexin application to narcoleptic mice (ICV injection) and dogs (ICV/IV application) can
reduce severity of cataplexy supports this hypothesis (Fujiki et al., 2003, Mieda et al., 2004).
However, why the symptoms of narcolepsy occur as a result of the loss of orexin is unknown.
Orexin projections and receptor patterns in the brain indicate some potentially important
downstream targets of orexin that could play a role in cataplexy. Willie et al. (2003) investigated
behavioral differences in OX2R KO mice and orexin KO mice, showing that OX2R KO had
similar excessive sleepiness to the ligand KO model but significantly less cataplexy (Willie et al.,
2003). This suggests that the loss of orexin signaling may trigger sleepiness through an OX2R-
mediated mechanism while cataplexy is triggered through both OX2R and OX1R mechanisms.
Histamine neurons of the ventral hypothalamus express OX2Rs and have a well established role
in the promotion of wake and arousal, indicating that orexin loss may promote sleepiness
through histaminergic projections (Huang et al., 2001, Marcus et al., 2001, Shigemoto et al.,
17
2004). Meanwhile, OX1Rs are strongly expressed in the noradrenergic neurons and the
amygdala, perhaps implicating these areas more in the expression of cataplexy (Marcus et al.,
2001). This is however speculative, as the OX2R KO mouse still had some cataplexy and the
OX2R-mutated canine model reliably shows cataplexy despite intact OX1Rs (Reilly, 1999).
1.2 Neurobiology of cataplexy
This thesis will focus primarily on the roles of the dopaminergic system, noradrenergic
system, and the amygdala in the regulation of cataplexy. Therefore a review of these three
systems will be provided, with emphasis on the organization and general function of each system
as it relates to cataplexy. While the noradrenergic, dopaminergic and amygdaloid systems all
provide a strong rationale for investigation with respect to cataplexy, they are not the only
transmitter systems involved; therefore, a brief review of other brain areas and transmitter
systems implicated in the regulation of cataplexy is also included.
1.2.1 The dopaminergic system
Dopamine is a catecholamine neurotransmitter synthesized in numerous nuclei
throughout the brain. Dopamine is synthesized in neurons from the amino acid L-tyrosine. It is
then packaged into vesicles by the vesicular monoamine transporter (Molinoff and Axelrod,
1971, Erickson et al., 1992). After release into the synaptic cleft, uptake of dopamine is
mediated by the dopamine transporter, DAT, which allows dopamine to be taken up either by
glial or pre-synaptic cells (Geffen et al., 1976, Gainetdinov and Caron, 2003). Pharmacological
manipulation of DAT is implicated in the arousing effects of CNS stimulants (Fumagalli et al.,
1998, Nishino et al., 1998b, Wisor et al., 2001).
Nine dopaminergic cell fields have been demonstrated in the mammalian brain.
Designated A8-A16, these cells are located in the mesencephalon, diencephalon, and olfactory
bulb (Figure 1.5). Dopamine neurons have widespread projections throughout the CNS
(Bjorklund and Dunnett, 2007a). The densest projections are from midbrain dopamine neurons
in the A8 (reticular formation), A9 (substantia nigra (SN)) and A10 (ventral tegmental area
(VTA)), to the striatum, limbic system and cortex (Eaton et al., 1994, Bjorklund and Dunnett,
2007a). Diencephalic cell fields, including the A11 (dorsal hypothalamus), A12 (arcuate
nucleus), A13 (zona incerta), A14 (periventricular nucleus) and A15 (ventral hypothalamus),
18
have projections to the pituitary, hypothalamus, and spinal cord (Skagerberg et al., 1988,
Bjorklund and Dunnett, 2007b, a). The A16 neurons are located in the olfactory bulb. The
projections from diencephalic dopaminergic cell fields are not as well established as those from
midbrain cell fields, though it is known that they provide the dopaminergic projections to the
spinal cord (Skagerberg et al., 1982).
Dopamine acts directly on two different receptor types. D1-like (including receptors D1
and D5) are G-protein coupled receptors (Gas) that are generally expressed on post-synaptic
neurons (Missale et al., 1998). Dopamine binding stimulates adenylate cyclase activity which
initiates intracellular signaling cascades. For the D1 receptor these cascades include production
of cAMP, followed by activation of protein kinase A (PKA), and then phosphoralation of various
proteins and ion channels. The general effect of D1 receptor activation is depolarization of the
affected cell (Missale et al., 1998).
D2-like receptors (including receptors D2, D3, and D4) are G-protein coupled receptors
(Gai) that are generally inhibitory. D2-like receptor activation inhibits cAMP production through
inhibition of adenylate cyclase (Missale et al., 1998). D2-like receptors can act as auto-receptors
on dopamine neurons to decrease neuron excitability (Westerink et al., 1990).
Dopamine receptors are expressed in many structures throughout the CNS. D1 and D2
receptors are the most abundant, while D4 and D5 receptors are not expressed in great numbers
in the rodent CNS (Meador-Woodruff et al., 1989, Mansour et al., 1990). Dopamine receptors
are most abundant in the striatum and limbic system, including the amygdala. They are also
expressed in the cortex, forebrain, hypothalamus and brainstem. Both D1-like and D2-like
receptors can be expressed either pre or post-synaptically and are rarely co-expressed on the
same neurons (Missale et al., 1998). The widespread projections of dopamine neurons and
locations of dopamine receptors allow the dopamine system to contribute to a wide range of
functions that relate to cataplexy, including emotion, sleep-wake state and motor control.
19
Figure 1.5: Dopamine projections
The nine distinct dopaminergic cell fields (A8-16; blue triangles) in the mammalian brain project
throughout the CNS. Dopamine neurons project to the cortex, limbic system, striatum, and both
cranial & spinal motor neurons (designated by blue arrows). These projections position the
dopaminergic system to modulate many behaviors including motivation, emotion, and
movement.
Modified from (Kvetnansky et al., 2009)
20
1.2.1.1 Functions
The dopaminergic system has many functions. Dopamine neurons in the VTA project,
through the mesolimbic pathway, to the limbic system. The mesocortical pathway regulates
emotion and motivation through projections to the PFC. Another major dopaminergic pathway,
the nigrostriatal pathway, controls movement through dopamine release into the basal ganglia
(Bjorklund and Dunnett, 2007a). These three pathways from midbrain dopamine nuclei are
functionally important connections in the brain and their loss can have devastating effects, for
example the loss of substantia nigra (SN) dopamine in Parkinson’s disease (Clarenbach, 2000).
Dopamine has an established role in reward, motivation and processing of emotions.
Areas in the limbic system and striatum, including the amygdala, PFC, and nucleus accumbens,
express high concentrations of dopamine receptors and receive dense innervations from midbrain
dopamine neurons (Loughlin and Fallon, 1983, Meador-Woodruff et al., 1989, Meador-
Woodruff et al., 1991). These midbrain dopamine neurons increase activity in response to
certain types of both positive and aversive stimuli (Steinfels et al., 1983b, Strecker et al., 1983).
Current evidence suggests that dopaminergic transmission in the limbic system modulates
processing of emotionally salient stimuli. The functional connections between the VTA, nucleus
accumbens, amygdala and PFC have not been entirely elucidated, but changes in dopaminergic
transmission within this circuit could be important in psychological disorders, such as
schizophrenia (Laviolette, 2007). As previously mentioned, the orexin system shares reciprocal
projections with the VTA that may regulate dopaminergic transmission; changes in the
functional VTA-limbic circuit in response to the lack of orexin could be important in
emotionally-induced cataplexy (Aston-Jones et al., 2010, Moorman and Aston-Jones, 2010).
Early unit recording studies of midbrain dopamine neurons did not show significant
differences in firing across the sleep-wake cycle (Miller et al., 1983, Steinfels et al., 1983a).
This finding led to the hypothesis that dopamine did not play a role in determining behavioral
state. However, this now does not appear to be the case. Most stimulants, which increase
behavioral arousal, act via a dopaminergic mechanism (Nishino et al., 1998b, Scammell and
Matheson, 1998, Kanbayashi et al., 2000, Wisor et al., 2001). Furthermore, selective
pharmacological activation or antagonism of dopamine receptors can modulate sleep-wake
behavior in rodents (Monti et al., 1988, Monti et al., 1989, Monti et al., 1990, Monti and Monti,
21
2007). In addition, identified dopamine neurons increase Fos expression during wakefulness
(A11 and ventral periaquaductal gray (vPAG)) and REM sleep recovery (A13) (Leger et al.,
2010). Lu and colleagues demonstrated that 50% of vPAG dopamine neurons express Fos
during waking; these neurons have a functional role in waking as selective lesions of dopamine
neurons in the vPAG suppressed wakefulness (Lu et al., 2006a). These findings suggest that the
dopamine system does have a functional role in determining behavioral state, specifically in
promoting waking behavior.
The majority of dopaminergic nuclei do not project directly to motor neurons (Bjorklund
and Dunnett, 2007b, a). The exception to this is the dopaminergic A11 neurons. It was
previously reported that these neurons project to the ventral horn of the spinal cord where they
synapse onto motor neurons (Bjorklund and Skagerberg, 1979, Skagerberg et al., 1982, Lindvall
et al., 1983, Skagerberg and Lindvall, 1985). Our lab recently showed that A11 neurons
innervate the trigeminal motor nucleus as well. These projections have a functional role, as
activation of the A11 region leads to D1 receptor-mediated excitation of masseter muscle activity
(JJ Fraigne and JH Peever, unpublished data). Previous studies in our lab have implicated the
dopamine system in regulating muscle tone during waking. Dopamine provides an endogenous
excitatory drive to motor neurons during waking that acts via a D1 receptor mechanism, while a
D2 receptor mediated inhibitory drive is present during sleep. Of interest, activation of D1
receptors on trigeminal motor neurons during REM sleep partially reversed REM sleep muscle
atonia, suggesting that withdrawal of a dopaminergic drive could contribute to muscle atonia
during cataplexy (NA Yee and JH Peever, unpublished data). The dopamine system contributes
to the regulation of emotion, arousal and muscle tone, suggesting that it could have a role in
triggering cataplexy.
1.2.1.2 Established role in cataplexy
Early studies in canine narcolepsy demonstrated a clear role for the dopamine system in
regulating cataplexy. Systemic application of selective D2-like receptor agonists exacerbated
cataplexy while antagonists reduced severity of attacks (Nishino et al., 1991). These results have
been shown to be consistent with different compounds and methods of application (Mignot et al.,
1993, Okura et al., 2000). As mentioned, D2-like receptors can act as auto-receptors on
dopamine neurons to affect dopamine release (Svensson et al., 1987, Westerink et al., 1990),
22
therefore to elucidate the mechanism through which systemic drug applications were acting,
focal perfusion of D2 receptor drugs was performed into different dopaminergic brain areas
(Reid et al., 1996, Honda et al., 1999b, Okura et al., 2004). Perfusion of D2 agonists into the
VTA, SN and diencephalic dopamine cell groups all exacerbated cataplexy, presumably by
decreasing dopamine release at targets of these neurons (Reid et al., 1996, Honda et al., 1999b,
Okura et al., 2004). Dopamine groups have projections directly to motor neurons, downstream
to brainstem areas that regulate arousal and muscle tone, and/or upstream to the limbic system
and cortex, which provides a number of possible mechanisms through which the dopaminergic
system could modulate cataplexy.
Studies in human narcoleptics have demonstrated an altered striatal dopaminergic system.
Neuroimaging showed that narcoleptic patients have increased D2-like receptor binding in the
striatum that correlates with cataplexy (Eisensehr et al., 2003). Similarly, dopamine receptor
expression is altered in narcoleptic dogs, with higher receptor density in the ventral striatum and
amygdala (Bowersox et al., 1987) In addition, many of the effective treatments for narcolepsy
act via a dopaminergic mechanism, including amphetamines, modafinil, and possibly sodium
oxybate (Nishino et al., 1998b, Wisor et al., 2001, Wisor and Eriksson, 2005). Therefore,
dopamine appears to have a central role in both human and canine narcolepsy, and one that is
strongly linked with cataplexy. The canine model of narcolepsy results from a mutation in OX2R
rather than a more general loss of orexin signaling, but these studies have not been replicated in a
murine model of narcolepsy that more closely mimics human narcolepsy. Whether endogenous
and/or exogenous dopamine activity mediates these effects on cataplexy at the limbic system,
REM sleep circuitry, or directly on motor neurons is unknown.
1.2.2 The noradrenergic system
Noradrenaline is a catecholamine neurotransmitter. It is synthesized from dopamine by
the catalyst dopamine beta-hydroxylase (Molinoff and Axelrod, 1971). Noradrenaline is
transported into vesicles by the vesicular monoamine transporter (Erickson et al., 1992). After
noradrenaline is released into the synaptic cleft, it is taken up by glia or presynaptic neurons by
the noradrenergic transporter, NET, where it is repackaged into vesicles or broken down by
monoamine oxidase (Gainetdinov and Caron, 2003). As with DAT, NET is a target for CNS
stimulants (Xu et al., 2000).
23
There are seven noradrenergic nuclei in the mammalian brain. Designated A1-A7, these
nuclei are located in the pons and medulla (Dahlstroem and Fuxe, 1964, Dahlstrom and Fuxe,
1964, Swanson and Hartman, 1975) (Figure 1.6). The A6, generally referred to as the locus
coeruleus, contains ~45% of the noradrenergic neurons in the rodent brain and has projections
throughout the brain, including to the cortex, basal forebrain, hypothalamus, midbrain and
brainstem (Dahlstroem et al., 1964, Swanson and Hartman, 1975). The other nuclei provide the
major noradrenergic projections to the brainstem and spinal cord (Grzanna and Fritschy, 1991).
These projections allow the noradrenergic system to regulate levels of arousal, attention, and
stress. Projections to both cranial and spinal motor neurons allow noradrenaline to modulate
motor neuron excitability directly. The noradrenergic system receives some of the densest
efferents from hypothalamic orexin neurons, with the A4, A5, A6 (LC) and A7 also expressing
high levels of OX1R (Peyron et al., 1998, Marcus et al., 2001), suggesting that this system could
contribute to the symptoms of narcolepsy.
Noradrenaline acts at three main families of receptors: α1 receptors are expressed post-
synaptically and act to increase neuron excitability through a Gq protein coupled receptor that
acts via a phospholipase C-IP3 mechanism to ultimately increase intracellular Ca2+. The α1
receptors are the most abundant adrenergic receptors in the mammalian brain. These receptors
are present in the cortex, amygdala, and motor nuclei, among other areas. α1 receptors are not
present on noradrenergic neurons themselves (McCune et al., 1993, Garcia-Sainz et al., 1999).
Due to a previously established role in both cataplexy and motor control, this thesis will focus on
the α1 receptor mediated role for noradrenaline (Mignot et al., 1988b, a, Chan et al., 2006).
α2 receptors are expressed both pre- and post-synaptically and activation of these
receptors leads to inhibition through a Gi protein coupled receptor; activation of α2 receptors
inhibits both intracellular Ca2+ and cAMP production. β receptors are generally post-synaptic and
increase neuron excitability through a Gs protein coupled receptor; activation of β receptors
results in increased adenylate cyclase, which increases production of cAMP, which ultimately
causes phosphorylation of calcium channels (Piascik and Perez, 2001). α2 and β receptors are
present on noradrenergic cells where they act to modulate NA release (Buscher et al., 1999).
24
Figure 1.6: Noradrenaline projections
The seven distinct noradrenergic nuclei (A1-7; black triangles with red projections) in the
mammalian brain project throughout the CNS. The A6 (locus coeruleus (LC)) is the largest
population of noradrenergic neurons in the rodent brain. Noradrenaline neurons project to the
cortex, hypothalamus, and brainstem, as well as to both cranial & spinal motor neurons. These
projections position the noradrenergic system to affect many behaviors including cognition, sleep
and motor control.
Modified from (Kvetnansky et al., 2009)
25
1.2.2.1 Functions
One function of the noradrenergic system is to regulate behavioral arousal (Berridge and
Waterhouse, 2003). Neurons in the LC fire in a state-dependent manner in dogs and mice;
neuron activity is highest during periods of active waking, decreased in quiet waking, further
decreased in NREM sleep and almost silent during REM sleep (Wu et al., 1999, Takahashi et al.,
2010). This suggests that parts of the noradrenergic system may be important in regulating
sleep-wake states. In support of this, many drugs that act via a noradrenergic mechanism
promote wake and suppress sleep (Kuczenski and Segal, 1997, Kanbayashi et al., 2000, Rothman
et al., 2001, Willie et al., 2003). However, studies disagree on whether lesions of noradrenergic
neurons or complete noradrenergic depletion affect sleep-wake architecture (Hunsley and
Palmiter, 2003, Hunsley et al., 2006, Li and Nattie, 2006, Blanco-Centurion et al., 2007).
Recently it has been suggested that the noradrenergic system and the LC specifically may play a
role in maintenance of sustained attention rather than waking per se (Gompf et al., 2010). Other
noradrenergic nuclei express Fos activity after spontaneous waking and REM sleep deprivation,
while the LC expresses Fos in response to novel environments but not spontaneous waking
(Leger et al., 2009). These other noradrenergic regions are perhaps more likely to have a role in
the regulation of sleep-wake state and/or cataplexy.
Another way the noradrenergic system contributes to general arousal is through the stress
response. Stressful stimuli induce noradrenergic release from the LC which acts at several
upstream brain areas, including the amygdala (Tanaka et al., 1991). Noradrenaline can act at
several receptor types in multiple sub-nuclei within the amygdala, modulating activity and
responses to incoming sensory information (Ferry et al., 1999). The central nucleus of the
amygdala in turn activates the LC through projections containing corticotrophin-releasing factor
(Wallace et al., 1989, Van Bockstaele et al., 1998). This circuit could provide the necessary
arousal and other behavioral and autonomic changes to respond to stressful conditions. As both
the amygdala and the LC have connections with the orexin system, and cataplexy can be
triggered by emotional stimuli, this circuit could contribute to cataplexy.
Some noradrenergic nuclei project to both cranial and spinal motor neurons, which
express noradrenergic receptors (Shao and Sutin, 1991). The A5 and A7 nuclei most densely
innervate cranial motor pools and the spinal cord ventral horn (Commissiong et al., 1978,
26
Guyenet, 1980, Westlund et al., 1983, Card et al., 1986, Grzanna et al., 1987, Bruinstroop et al.,
2011). Numerous studies have demonstrated that noradrenaline has an α1 receptor-mediated
excitatory affect on facial, hypoglossal, trigeminal and lumbar motor neurons (Fung and Barnes,
1981, Larkman and Kelly, 1992, Chan et al., 2006, Lu et al., 2007). Our lab has previously
demonstrated the importance of the noradrenergic system in regulating masseter muscle tone
across the sleep-wake cycle in rats. Perfusion of noradrenergic receptor agonists and antagonists
by reverse-microdialysis onto trigeminal motor neurons elucidated an α1 receptor mediated
excitatory waking drive that is withdrawn during sleep (S Mir and JH Peever, unpublished data).
As the noradrenergic system has a role in both motor control and arousal it is an interesting
target for investigations into the underlying circuits regulating cataplexy.
1.2.2.2 Established role in cataplexy
As with the dopaminergic system, pharmacological evidence strongly suggests a role for
the noradrenergic system in mediating cataplexy. Tricyclic antidepressants effectively treat
cataplexy in humans, dogs and mice, with those compounds that are more selective for
noradrenaline being more effective, at least in canine narcolepsy (Babcock et al., 1976,
Schachter and Parkes, 1980, Mignot et al., 1993, Willie et al., 2003). Experiments with more
selective noradrenergic receptor agonists and antagonists have demonstrated that α1 receptor
activation reduces cataplexy in dogs, while antagonism exacerbates it (Mignot et al., 1988a,
Nishino et al., 1990, Renaud et al., 1991, Mignot et al., 1993). In addition, altered expression of
adrenergic receptors has been identified in canine narcolepsy, with elevated α1 receptor binding
in the amygdala and α2 receptor binding in the LC (Mignot et al., 1988b, Mignot et al., 1989,
Nishino et al., 1990).
More evidence for the involvement of the noradrenergic system in cataplexy comes from
studies utilizing single unit recordings in freely behaving narcoleptic dogs: presumptive
noradrenergic neurons of the LC ceased firing during cataplexy (Wu et al., 1999). More
recently, it was shown that high-frequency optogenetic stimulation of the LC in wildtype mice
caused behavioral arrests similar to cataplexy (Carter et al., 2010). While these two results
initially seem paradoxical, it has been proposed that this high frequency stimulation of the LC
would lead to a depletion of noradrenaline from synapses, and thus a situation similar to the
cessation of cell firing (McGregor and Siegel, 2010). This has led to the hypothesis that
27
withdrawal of excitatory noradrenergic input to motor neurons is responsible for the loss of
muscle tone during cataplexy, although this has never been directly tested.
1.2.3 The amygdala
The amygdala, or amygdaloid complex, is a collection of nuclei in the medial temporal
lobe. It is comprised of a number of different nuclei with extensive intra and internuclear
connections (Sah et al., 2003). Different classification systems have been used and the amygdala
can be subdivided into between three and thirteen different nuclei. Five commonly separated
subnuclei include the lateral nucleus, the basolateral nucleus (BLA), the central nucleus (CeA),
the medial nucleus and the cortical nucleus. There are also a group of GABAergic interneurons
within the region of the amygdala, termed the intercalated cells that contribute to intra-
amygdaloid signaling (Sah et al., 2003). The nuclei in the amygdaloid complex have many
connections between them (Pitkanen et al., 1997, Pitkanen et al., 2003). These connections are
important for the processing of incoming sensory information. In general terms sensory
information enters the amygdala through the lateral and BLA, then follows a lateral to medial
progression, to the CeA, which is the primary output nucleus of the amygdala (Sah et al., 2003)
(Figure 1.7).
Afferents to the amygdala can be divided into two different groups based on the
information encoded by the inputs. Cortical and thalamic inputs carry sensory information to
most nuclei within the amygdala. Hypothalamic and brainstem inputs carry behavioral and
autonomic information to the amygdala, though predominantly only to the CeA. The amygdala
processes these primary sensory inputs, as well as polymodal inputs from the PFC, and
behavioral inputs, and then communicates with the brainstem, hypothalamus and ventral striatum
to induce appropriate responses to the incoming stimuli (Romanski and LeDoux, 1993, Updyke,
1993, Brinley-Reed et al., 1995, Sah et al., 2003).
The remainder of this overview will focus on the morphology and physiology of CeA, as
it is the only nucleus to receive projections from and innervate the brainstem, where muscle
atonia is generated (Hopkins and Holstege, 1978, Wallace et al., 1989, 1992, Fung et al., 2011,
Xi et al., 2011). In addition to being the primary output nucleus of the amygdala, the CeA has
also been proposed as an integrator of amygdala activity. The CeA both sends inputs to and
receives innervations from the other major amygdaloid nuclei (Pitkanen et al., 1997, Sah et al.,
28
2003). Organization even within just the CeA is complex, as it can be subdivided into at least
three sub-nuclei and contains numerous cell types and transmitters. Projections from the CeA to
the midbrain and brainstem include neurons that contain enkephalin, dynorphin, neurotensin,
substance P, somatostatin, corticotrophin releasing factor, glutamate and GABA (Sah et al.,
2003). The organization of the CeA and heterogeneity of the neuronal population within it
suggest the ability to process many different types of stimuli and affect a wide range of
behavioral and autonomic responses.
29
Figure 1.7: A simplified schematic of major inputs and outputs of the amygdala
The amygdala receives many inputs including from all sensory systems. These inputs are
processed through projections within and between different amygdala nuclei. The major outputs
of the amygdala establish appropriate reactions to the incoming stimuli. (LA, lateral nucleus;
BLA, basolateral nucleus; ITC, intercalated cells, CeA, central nucleus; DA, dopamine; NA,
noradrenaline; 5-HT, serotonin; Ach, acetylcholine)
30
1.2.3.1 Functions
The amygdala is part of a larger collection of brain areas that process emotion: the limbic
system. The limbic system contains the amygdala, prefrontal cortex, hypothalamus,
hippocampus, and areas of the thalamus. These areas share connections and are important for
processing sensory information, assigning valence, motivation, emotional memory, and generally
ensure appropriate arousal, endocrine and autonomic responses to emotional stimuli (LeDoux,
2000, Siegel and Boehmer, 2006, Boissy et al., 2007, Murray, 2007). Lesions in the region of
the amygdala, as in Kluver-Bucy syndrome, result in flat affect or placidity (Horel et al., 1975,
Baron-Cohen et al., 2000, Murray, 2007).
The majority of amygdala research has focused on its role in fear learning and response.
For example, the amygdala is critical for fear conditioning, with lesions of the BLA resulting in
an inability to learn conditioned fear and lesions in the CeA resulting in a lack of fear response
(Prather et al., 2001, Sah et al., 2003, Phelps and LeDoux, 2005). However, the amygdala has
also been linked with positive emotion. Neuroimaging shows increased amygdala activity in
response to positive emotional stimuli in humans, including photographs, music, and smiling
faces (Garavan et al., 2001, Boissy et al., 2007). The amygdala also encodes positive affective
associations in non-human primates and rodents; amygdala firing is correlated with anticipation
of rewards and contributes to learning the valence of specific positive stimuli (Nishijo et al.,
1988, Schoenbaum et al., 1998, Baxter et al., 2000, Baxter and Murray, 2002, Paton et al., 2006).
Many studies have established the amygdala as a key part of the circuit that processes both
positive and aversive emotionally salient stimuli, which have both been demonstrated to trigger
cataplexy in some narcolepsy patients (Overeem et al., 2011).
The amygdala has also been implicated in the regulation of REM sleep, particularly
changes in REM sleep in response to emotional stimuli. Pharmacological inhibition of the
amygdala after inescapable shock suppressed the normal increase in REM sleep in rats,
indicating that at least after stressful stimuli the amygdala functions to promote REM sleep
(Tang et al., 2005, Sanford et al., 2006, Liu et al., 2009). However, lesions of the amygdala in
non-human primates resulted in no significant changes to REM sleep, bringing into question
whether the amygdala has a role in normal sleep-wake behavior (Benca et al., 2000). The
amygdala is anatomically positioned to regulate REM sleep, as the CeA of the amygdala sends
31
both excitatory and inhibitory projections to the brainstem. Of particular interest is the finding
that there are glutamatergic projections from the CeA to the sublateraldorsal nucleus (SLD), a
key regulator of REM sleep and muscle atonia (Boissard et al., 2003, Fung et al., 2011, Xi et al.,
2011). Whether the amygdala has a functional role in the normal regulation of REM sleep is
unclear; however, as the amygdala is implicated in emotion and has projections to REM sleep-
generating brain areas, it is an interesting target for cataplexy research.
1.2.3.2 Established role in cataplexy
In the context of cataplexy, the limbic system is important as positive emotions, and
particularly laughter, are the most reliable trigger of cataplexy in human narcolepsy (Siegel and
Boehmer, 2006, Overeem et al., 2011). Even in animal models of narcolepsy, positive emotions
may trigger cataplexy; the play or food-elicited cataplexy tests have been used extensively in
narcoleptic dogs, where social play or palatable food are given to dogs in order to increase
cataplexy (Siegel et al., 1986, Mignot et al., 1988a). In murine models of narcolepsy access to
palatable food, social play, or a running wheel have been demonstrated to increase cataplexy
(Espana et al., 2007, Clark et al., 2009, Scammell et al., 2009). These data suggest a role for the
limbic system in mediating cataplexy but few studies have directly addressed this.
Orexin strongly projects to the limbic system and recent evidence from clinical studies
suggests that human narcoleptics may have abnormal limbic activity in response to certain
stimuli. An fMRI study demonstrated decreased hypothalamic activity and increased amygdala
activity in response to humorous stimuli in narcoleptics when compared to controls (Schwartz et
al., 2008). A separate experiment used a game to assess activity in reward related brain regions
in narcolepsy patients; reduced activity in the VTA and PFC were seen in narcolepsy patients
versus controls, perhaps due to the lack of orexinergic drive to these areas (Ponz et al., 2010a).
Evidence also suggests morphological differences in the amygdala in narcolepsy, with a 17%
decrease in amygdala volume compared to controls (Brabec et al., 2011). While these studies
tell us little about a functional role for the limbic system in cataplexy, they do highlight
abnormalities in areas that are important in emotion and reward processing, thus providing a
rationale for the investigation of the amygdala and other limbic areas in regulating cataplexy.
A more convincing link between cataplexy and limbic system activity was demonstrated
in canine narcolepsy: unit recording in the amygdala showed a subpopulation of neurons that
32
increased their firing at cataplexy onset and decreased their firing when normal activity was
resumed (Gulyani et al., 2002). Unit recording studies in narcoleptic dogs have provided some
of the clearest data to date regarding which brain areas are involved in generating cataplexy;
however, these studies are correlative and do not infer a functional role for the neurons recorded.
Each of the studies outlined here has correlated amygdala activity with aspects of narcolepsy and
cataplexy, but no studies have investigated a functional role for the limbic system in the
triggering of cataplexy.
A possible, though highly speculative, link between the amygdala and cataplexy is the
aforementioned hypothesis that cataplexy is an atavistic expression of tonic immobility
(Overeem et al., 2002). Tonic immobility is a defense mechanism, like freezing in rodents, and
is present in some animals, most notably sharks, rabbits, chickens and guinea pigs. The amygdala
mediates many fear responses including freezing responses in rodents. Freezing is mediated by
projections from the CeA to the ventral periaquaductal gray (vPAG) and is very different from
cataplexy in that muscle tone generally remains high (Reese et al., 1984, Oliveira et al., 2004).
Tonic immobility is mediated by projections from the CeA to the ventral lateral periaquaductal
gray (vlPAG) and can be similar to cataplexy (Leite-Panissi et al., 2003). The vlPAG has also
recently been implicated in the control of REM sleep-related muscle atonia in rodents (Boissard
et al., 2002). While humans, mice and most dogs do not naturally express tonic immobility, it is
possible that the loss of the orexin system uncovers this dormant behavior. It is unclear whether
cataplexy is related to tonic immobility but if so the amygdala would play a central role in the
initiation of cataplexy. In general, this also functionally links the amygdala with circuits that are
able to generate the loss of muscle tone normally seen only during REM sleep, at least in a small
group of animals, though it is unknown if this plays a functional role in cataplexy.
1.2.4 Other transmitter systems
While this thesis focuses predominantly on the noradrenergic, dopaminergic and
amygdaloid regulation of cataplexy a number of other transmitter systems and brain regions have
been implicated in this behavior. In this section I will provide a brief overview of some of the
other systems involved in cataplexy, including the serotonergic, cholinergic, and histaminergic
systems.
33
Unlike the dopaminergic and noradrenergic systems, serotonin does not appear to play an
important role in cataplexy. While serotonin receptor agonists suppress canine cataplexy,
antagonism did not exacerbate cataplexy (Nishino et al., 1995a). It was originally hypothesized
that because firing of serotonin neurons in the dorsal raphe nucleus is suppressed during REM
sleep, just as LC neurons are, that serotonin would have a role in cataplexy (Trulson and Jacobs,
1979, Jacobs et al., 1981, Trulson and Trulson, 1982). However, subsequent studies have shown
that firing of dorsal raphe neurons is not suppressed to REM sleep levels during cataplexy (Wu et
al., 2004). These data do not support a strong role for the serotonergic system in cataplexy;
however, due to its established role in mood/emotion and motor control a role in cataplexy
cannot be ruled out without further investigation. The role of the serotonergic system has not
been investigated in murine narcolepsy.
Histamine neurons are important in the maintenance of arousal and receive strong
innervations from orexin neurons (Monnier et al., 1967, Lin et al., 1988, Monti et al., 1991,
Monti, 1993, Peyron et al., 1998). It has been hypothesized that the loss of orexinergic
excitation of histamine neurons may underlie the excessive sleepiness in narcolepsy; studies
demonstrating decreased CSF histamine in human narcolepsy support this claim (Kanbayashi et
al., 2009, Nishino et al., 2009, Scammell and Mochizuki, 2009). More recently, selective genetic
tools have been used to address the role for histamine in sleepiness; mice with a transcriptionally
disrupted OX2R were created, which lack a functional OX2R, but in the presence of cre-
recombinase, transcription and receptor expression is rescued (Mochizuki et al., 2011). When
orexin receptors were selectively expressed in the posterior hypothalamus (where histamine
neurons are located), the excessive sleepiness normally seen in these mice was rescued
(Mochizuki et al., 2011). However, unit recording of presumptive histamine neurons in
narcoleptic dogs has shown that histamine neurons do not decrease firing during cataplexy (when
compared to waking), suggesting that histamine is not involved in cataplexy (John et al., 2004).
Thus it is evident that histamine has a key role in the maintenance of arousal and perhaps
consciousness but the histaminergic system likely does not contribute to cataplexy.
Cholinergic neurons in both the pons (PPT/LDT) and basal forebrain are involved in the
regulation of sleep and wakefulness, particularly REM sleep (McCarley, 2004, Lu et al., 2006b).
Both canine and murine models of narcolepsy have altered cholinergic systems, with increased
PPT/LDT neurons in canine narcolepsy and increased ChAT staining intensity in LDT neurons
34
in murine narcolepsy (Nitz et al., 1995, Kalogiannis et al., 2010). Systemic injection of drugs
that increase cholinergic drive increased cataplexy in narcoleptic dogs; this effect may be
mediated by pontine regions that generate REM sleep, as activation of muscarinic receptors
specifically in the pontine reticular formation increased cataplexy in dogs (Reid et al., 1994a,
Reid et al., 1994b, Reid et al., 1994c). Importantly, these findings have recently been replicated
in a murine model of narcolepsy (Kalogiannis et al., 2011). Cataplexy was also affected by
manipulation of basal forebrain activity although few cataplexy active neurons were detected
there (Nishino et al., 1995b, Nishino et al., 1998a, Reid et al., 1998).
1.2.5 Cataplexy as a manifestation of REM sleep
Similarities between cataplexy and REM sleep have led researchers to hypothesize that
cataplexy is the intrusion of REM sleep into wakefulness. Loss of muscle tone, theta rich EEG
activity, and reduced H-reflex are all common features of cataplexy and REM sleep. Recently, a
number of studies have shown key differences between cataplexy and REM sleep suggesting that
they do not share the same “executive mechanism”. Nishino et al. (2000) demonstrated that
REM sleep has an ultradian rhythm while cataplexy does not; REM sleep is homeostatically
regulated while cataplexy can be triggered at any time with positive affective stimuli in
narcoleptic dogs (Nishino et al., 2000). Lesions of pontine regions that suppress REM sleep lead
to increased REM sleep but no change in the occurrence of cataplexy (Kaur et al., 2009). In
addition, a number of pharmacological interventions can suppress cataplexy while having no
affect on REM sleep (Okura et al., 2000). These studies demonstrate key differences between
the regulation of REM sleep and cataplexy that suggest they have different executive
mechanisms; however, these two states may share a common mechanism at or near the level of
the motor neuron that ultimately triggers muscle atonia.
As mentioned previously, much of the circuitry that regulates muscle tone during REM
sleep in rodents has been elucidated. The monoaminergic-cholinergic hypothesis of REM sleep
has been updated to include a glutamatergic-GABAergic switch that is modulated by these
brainstem arousal systems. There is a REM sleep-off area in the pons (vlPAG/LPT)) that
actively inhibits a group of glutamatergic REM sleep-on neurons (SLD), this forms the basis for
the “flip-flop switch” model of REM sleep control (Boissard et al., 2002, Boissard et al., 2003,
Lu et al., 2006b). Neurons in the SLD likely project directly to both inhibitory interneurons in
35
the spinal cord as well as GABAergic/glycinergic neurons in the medulla; both the glycinergic
interneurons and medullary neurons inhibit motor neurons to induce muscle atonia (Boissard et
al., 2002, Boissard et al., 2003, Lu et al., 2006b). If the loss of muscle tone during cataplexy is
generated by the same mechanism as REM sleep muscle atonia, one would expect neuron
activity to be the same in these regions during both states. In narcoleptic mice, lesions in the
region of the vlPAG lead to an increase in REM sleep but no observed change in cataplexy,
while unit recording in the pons revealed REM-active neurons but no cataplexy-active neurons
(Kaur et al., 2009, Thankachan et al., 2009). These studies seem to indicate that REM-
generating circuits are not involved in triggering cataplexy. However, unit recording of
medullary neurons (in the nucleus magnocellularis) in freely behaving narcoleptic dogs
demonstrated a population of neurons that were highly active during both REM sleep and
cataplexy, these neurons could be responsible for sending inhibitory projections that suppress
muscle tone (Siegel et al., 1991). In addition, as mentioned previously, direct manipulation of
pontine regions that regulate REM sleep atonia with cholinergic agonists can exacerbate
cataplexy (Kalogiannis et al., 2011). Whether the circuits responsible for REM sleep atonia also
trigger loss of muscle tone in cataplexy is unknown, and warrants further research.
The similarities between REM sleep and cataplexy have led to the hypothesis that
cataplexy is the intrusion of REM sleep phenomena into wakefulness (Rechtschaffen and
Dement, 1967). While some recent data challenge this, it has not been investigated whether
increasing physiological need or pressure for one of these states can promote the occurrence of
the other in animal models of narcolepsy. Orexin KO mice represent an excellent model to
investigate the relationship between REM sleep and cataplexy.
1.2.6 Current model of cataplexy
The current understanding of the neural circuitry that triggers cataplexy has been
summarized into a working model (Siegel and Boehmer, 2006). The authors propose that in
response to positive emotions, the limbic system inhibits noradrenaline and serotonin systems
that normally activate motor neurons. Brainstem inhibitory networks are simultaneously
recruited that actively inhibit motor neurons leading to muscle atonia (Figure 1.8). Under normal
conditions (i.e. orexin system intact), orexin counters this influence and prevents the loss of
muscle tone. This model provides a good framework for understanding cataplexy; however, it is
36
based predominantly on pharmacological and unit recording data, and few of the elements of the
model have been functionally demonstrated.
This model treats the limbic system as a “black box” and marginalizes the role of the
dopaminergic system. Whether the limbic system has a functional role in triggering cataplexy
has not been investigated. Whether the monoaminergic-excitatory and brainstem-inhibitory
systems have a functional role in mediating the loss of muscle tone during cataplexy is unknown.
The goal of this thesis is to address some of these fundamental questions in narcolepsy research
in a way that improves the current model of the mechanisms that trigger cataplexy.
37
Figure 1.8: Model of how the orexin (hypocretin) system could prevent the loss of muscle
tone in response to positive emotions
This model demonstrates how the loss of muscle tone (i.e. cataplexy) could be triggered by
positive emotions when a functional orexin/hypocretin system is absent. In this model positive
emotions trigger limbic system activity that inhibits monoaminergic brainstem nuclei. At the
same time inhibitory circuits are recruited by acetylcholine that further suppress motor neuron
excitability. In a healthy individual, the intact orexin/hypocretin system counteracts this loss of
muscle tone, but one could imagine in the absence of orexinergic excitation motor neurons
would be inhibited and disfacilitated leading to loss of muscle tone.
From (Siegel and Boehmer, 2006)
38
1.3 Thesis overview
As detailed above, the mechanisms that regulate cataplexy remain unclear. Cataplexy is
thought to be the intrusion of REM sleep atonia into wakefulness and is triggered by strong
positive emotions. What is responsible for the loss of muscle tone, how this relates to REM
sleep atonia, and why positive emotions can act as a trigger for cataplexy are all questions that
remain unanswered.
These experiments will help elucidate the neural mechanisms responsible for cataplexy
using freely behaving orexin KO mice. Behavioral studies, whole animal pharmacology, local
perfusion of drugs via reverse-microdialysis, neuronal tracing and cell-specific lesions will be
used to identify key components of the underlying neurobiology of cataplexy. Specific research
objectives of this thesis are as follows:
1. Further characterize the narcoleptic phenotype in orexin KO mice and investigate the
relationship between cataplexy and REM sleep (Chapter 3).
2. Characterize the role for the noradrenergic and dopaminergic systems in the regulation of
murine cataplexy using systemic pharmacology (Chapters 4 and 5).
3. Determine whether a change in noradrenergic drive to motor neurons contributes to the
loss of muscle tone during cataplexy (Chapter 5).
4. Characterize the role of the amygdala in triggering cataplexy, particularly cataplexy
elicited by positive emotions (Chapter 6).
39
Chapter 2: Methods
This thesis includes studies using multiple techniques and approaches, performed at
multiple institutions (University of Toronto and Harvard University). This chapter will explain
the general methods that were common to all experiments performed. Detailed accounts of the
methods used in each experiment, including all equipment and reagents used are presented in the
individual chapters.
40
Chapter 2: Methods
2.1 Mice
All of the research presented in this thesis was performed in freely behaving wildtype or
orexin KO mice. All procedures and experimental protocols were approved by the University of
Toronto’s Animal Care Committee or by the Institutional Animal Care and Use Committees of
Beth Israel Deaconess Medical Center and Harvard Medical School, and were in accordance
with the Canadian Council on Animal Care and the National Institutes of Health Guide for the
Care and Use of Laboratory. Animals were cared for under the supervision of the support staff of
the Bioscience Support Facility (University of Toronto, Toronto, Canada) or the CLS Animal
Research Facility (Center for Life Sciences Boston, Boston, Massachusetts). All animals were
maintained at a room temperature of 21-23 °C on a 12:12 light:dark cycle. Food and water were
available ad libitum. Mice were group-housed with up to five same-sex siblings in plastic cages
(dimensions 28cm x 16cm x 12cm, Nalgene Labware) on standard cob bedding.
These studies utilized orexin KO mice and wildtype littermates. Orexin KO mice were
obtained from Dr. Masashi Yanigasawa’s lab at the University of Texas Southwestern Medical
Center, where the mouse line was generated (Chemelli et al., 1999). These founder mice were
backcrossed several generations on a C57Black/6 background. The majority of both orexin KO
and wildtype mice used in these studies were obtained from heterozygous-heterozygous mating
pairs. Orexin KO mice were genotyped using PCR with genomic primers 5'-
GACGACGGCCTCAGACTT CTTGGG, 3'-TCACCCCCTTGGGATAG CCCTTCC, and 5’-
CCGCTATCAGGACATAGCG TTGGC (with forward primers being specific for either
wildtype or KO mice and the reverse primer being common to both).
2.2 Surgical procedures
To record brain and muscle activity in mice, we implanted electroencephalogram (EEG)
and electromyogram (EMG) electrodes. Sterile surgery was performed under isoflurane (1-2%;
University of Toronto) or ketamine/xylazine (100 and 10 mg/kg i.p.; Harvard University)
anesthesia. Effective depth of anesthesia was determined by the abolishment of the pedal
withdrawal reflex.
41
Mice were placed in a stereotaxic apparatus and the skin was retracted to expose the skull
surface. The skull was leveled, so that bregma and lamba were in the same horizontal plane.
EEG recordings were obtained using two stainless steel micro-screws (1mm anterior and 1.5mm
lateral to bregma; 3mm posterior and 1.5mm lateral to bregma). EMG electrodes consisted of
multistranded stainless steel wires that were sutured onto the neck and/or masseter muscles. All
electrodes were attached to a micro-strip connector, which was affixed onto the mouse’s head
with dental cement. After surgery, mice were given 0.5 mL of 0.9% saline, ketoprofen (3mg/kg;
s.c.; University of Toronto) or meloxicam (5mg/kg; s.c.; Harvard University).
2.3 Sleep recording
In order to record sleep-wake state and behavior, mice were housed in a specifically
designed containment system. This caging system was housed inside a sound-attenuated,
ventilated, and illuminated chamber that obviated visual, olfactory and auditory disturbances.
Sleep-wake state and muscle activity were recorded by attaching a lightweight cable to a plug on
the mouse’s head. This was then connected to a data amplifier system. The EEG signal was
amplified 1000 times and band-pass filtered between 1 and 30-100 Hz. EMG signals were
amplified 1000 times and band-pass filtered between 30 Hz and 100-1000 Hz. All
electrophysiological signals were digitized at 256-1000Hz, monitored and stored on a computer.
In experiments with orexin KO mice, infra-red video recordings were also captured and synced
to the electrophysiological recordings.
2.4 Behavioral state analysis
We used both EEG and EMG signals (neck and/or masseter muscles) as well as video to
identify up to six distinct behavioral states: active wake, quiet wake, NREM sleep, REM sleep,
sleep attacks, and cataplexy. Active wake was characterized by high frequency, low voltage
EEG signals coupled with high levels of EMG activity. Quiet wake was characterized by high
frequency, low voltage EEG signals but in the absence of overt motor activity. NREM sleep was
characterized by high amplitude, low frequency EEG signals and minimal EMG activity. REM
sleep was characterized by low amplitude, high frequency theta EEG activity and very low EMG
levels (i.e., REM atonia) interspersed by periodic muscle twitches. Sleep attacks, sudden
transitions into sleep that have been observed in these mice, were characterized by gradual loss
42
of muscle tone, NREM-like EEG characteristics and automatic behavior (i.e. chewing) in the
masseter muscles.
Cataplexy was classified as a sudden loss of EMG activity, in neck and/or masseter
muscles, following at least 40 seconds of active waking and with a duration of at least 10
seconds. Cataplexy was scored using both electrophysiological and video recordings. This
definition is consistent with the consensus definition of murine cataplexy (Scammell et al.,
2009). We also scored the transitions between behavioral states; however we did not include
these data in our analyses. Sleep states were visually identified, analyzed, and scored in Spike 2
or Sleepsign for Animals.
2.5 Histology
In order to determine microdialysis probe location, brain lesion area, or neuronal
projections, histology was performed. At the end of each experiment mice were anesthetized via
isoflurane or ketamine-xylazine and sacrificed. The brain was removed and placed in
paraformaldehyde or formalin for 24 hours and then cryoprotected in 20-30% sucrose (in 0.1M
PBS) for 48 hours. The brain was then frozen in finely crushed dry-ice and transversely
sectioned in 30-40µm slices using a microtome. Brain sections were stained and mounted on
slides. Tissue sections were viewed using a microscope and photographed. The locations of
probe tracts, lesions, or projections were then plotted on a standardized stereotaxic map of the
mouse brainstem (Paxinos and Franklin, 2001).
43
Chapter 3: REM sleep and Cataplexy are
generated by Independent Mechanisms
Other researchers contributed to this work:
Petri Takala, BSc: Assisted with USV experiments and counting USVs.
LJ Agostinelli, BSc: Assisted with selective REM sleep deprivation/gentle handling.
Takatoshi Mochizuki, PhD: Assisted with setting up counts for wheel running experiments.
John Yeomans, PhD: Assisted with experimental design for the USV experiments.
44
Chapter 3: REM sleep and Cataplexy are generated by Independent Mechanisms
3.1 Abstract
It is hypothesized that cataplexy is the manifestation of REM sleep muscle atonia during
wakefulness. Some recent studies have challenged this hypothesis, suggesting instead that REM
sleep and cataplexy may be generated by unique neural mechanisms. Here we used a series of
experiments to investigate some aspects of REM sleep and cataplexy and determine whether the
two states share an underlying neural mechanism. We observed several phenotypic similarities
between the two states, including frequency of occurrence and suppression of muscle tone. If
they share a common mechanism, stimuli that increase propensity for one state may increase the
other as well. We therefore sought to promote either state and observe changes in the other.
Increasing the propensity for cataplexy by using specific environmental stimuli caused a
reduction in REM sleep. We then increased REM sleep propensity, by selectively depriving
mice of REM sleep, and observed a short-term reduction in cataplexy. These results suggest that
cataplexy and REM sleep are not generated by the same neural mechanism, although they may
share a common muscle atonia-generating mechanism.
3.2 Introduction
Narcolepsy is characterized by excessive daytime sleepiness and cataplexy, the sudden
loss of postural muscle tone during waking (Gelineau, 1880). Narcolepsy with cataplexy results
from the loss of orexin containing neurons in the lateral hypothalamus, but the underlying neural
circuitry responsible for cataplexy is unclear (Peyron et al., 2000, Thannickal et al., 2000,
Thannickal et al., 2003). Cataplexy shares some characteristic features with REM sleep, leading
to the hypothesis that cataplexy is the intrusion of REM sleep atonia into wakefulness
(Rechtschaffen and Dement, 1967, Siegel et al., 1991, Chemelli et al., 1999).
Numerous lines of evidence suggest that cataplexy and REM sleep share a common
mechanism. Cataplexy and REM sleep share a similar phenotype, including theta-rich EEG and
loss of muscle tone (Chemelli et al., 1999). Some pharmacological evidence suggests that they
are regulated by a similar mechanism, as tricyclic antidepressants that are used to treat cataplexy
45
also reduce REM sleep (Babcock et al., 1976, Gervasoni et al., 2002, Willie et al., 2003). In
addition, in narcoleptic canines a population of neurons in the medial medulla thought to be
important for generating muscle atonia are active only during REM sleep and cataplexy (Siegel
et al., 1991). Recently, however, several studies have suggested that cataplexy and REM sleep
are distinct behavioral states: neurons in the pons, an area recently shown to be important in the
regulation of REM sleep, fire most during waking and REM sleep but not during cataplexy in
orexin KO mice, REM sleep follows an ultradian pattern while cataplexy does not, and systemic
pharmacological manipulation of the dopamine system can induce changes in cataplexy without
affecting REM sleep (Nishino et al., 2000, Okura et al., 2000, Thankachan et al., 2009, Burgess
et al., 2010).
Using a series of experiments investigating motor aspects, regulation and triggering of
REM sleep and cataplexy, we addressed whether these two states share a common mechanism or
are two different, unique behavioral states. We observed that episodes of REM sleep and
cataplexy have similar frequency of occurrence, duration and levels of muscle tone. We then
demonstrated that potentially positive affective stimuli increased cataplexy in mice, while these
same stimuli decreased REM sleep. Finally, because REM sleep is homeostatically regulated,
we investigated whether increasing REM sleep pressure would promote cataplexy. We found
REM sleep deprivation resulted in a short-term decrease in cataplexy. Our data suggest that
cataplexy and REM sleep are unique states with different executive mechanisms, though they
may share a similar atonia-generating mechanism.
3.3 Methods
These studies were approved by the Institutional Animal Care and Use Committees of
Beth Israel Deaconess Medical Center and Harvard Medical School and were carried out in
accordance with the National Institutes of Health Guide for the Care and Use of Laboratory
Animals and were approved by the University of Toronto’s animal care committee and were in
accordance with the Canadian Council on Animal Care.
3.3.1 Animals
We used 43 orexin KO mice (29 male and 14 female), 12-30 weeks of age and weighing
26-34g. Mice were genotyped using PCR with genomic primers 5’-
46
GACGACGGCCTCAGACTTCTTGGG, 3’ TCACCCCCTTGGGATAGCCCTTCC, and 5’-
CCGCTATCAGGACATAGCGTTGGC (with forward primers being specific for either wildtype
or KO mice and the reverse primer being common to both).
3.3.2 Surgery
We anesthetized mice with isoflurane (1-2%; University of Toronto) or
ketamine/xylazine (100 and 10 mg/kg i.p.; Harvard University) and placed them in a stereotaxic
alignment system (Model 1900, Kopf). We then implanted mice with electrodes for recording the
EEG and EMG. In brief, stainless steel screws were implanted for frontoparietal EEG recordings
(1.5 mm lateral and 1 mm anterior to bregma; 1.5 mm lateral and 3 mm posterior to bregma).
EMG electrodes were made from fine, multi-stranded stainless steel wire (AS131, Cooner Wire,
Chatsworth, CA), which were sutured into the masseter or neck muscles. All electrodes were
attached to a micro-strip connector affixed to the animal's head with dental cement. After
surgery, mice were given 0.5 mL of 0.9% saline, ketoprofen (3mg/kg; s.c.; University of
Toronto) or meloxicam (5mg/kg; s.c.; Harvard University).
3.3.3 Electrophysiological recordings
Behavioral state and muscle activity were recorded by attaching a lightweight cable to a
plug on the mouse’s head, which was connected to an amplifier system. The EEG was amplified
1000 times and band-pass filtered between 0.3 and 100 Hz. EMG signals were amplified 1000
times and band-pass filtered between 30 Hz and 100 Hz. All electrophysiological signals were
digitized between 256-1000Hz (Spike 2 Software, 1401 Interface, CED Inc.), monitored and
stored on a computer. Infra-red video recordings were also captured and synced to the
electrophysiological recordings. Raw EMG signals were full-wave rectified and quantified in
arbitrary units (A.U.). Average EMG activity for masseter muscle activity was quantified in 5s
epochs for each behavioral state.
3.3.4 REM sleep deprivation protocol
In order to determine if REM sleep pressure affected the occurrence of cataplexy, we
selectively deprived orexin KO mice of REM sleep. REM deprivation experiments were
performed at Harvard University with the assistance of LJ Agostinelli and under the supervision
47
of Dr. Scammell (Department of Neurology, Beth Israel Deaconess Medical Center). Two weeks
after surgery, we transferred mice to recording cages in a sound-attenuated chamber with a 12:12
light-dark cycle (30 lux daylight-type fluorescent tubes with lights on at 07:00), constant
temperature (23 ±1°C), and with food and water available ad libitum. The recording cable was
attached to a low torque electrical swivel, fixed above the cage that allowed free movement.
Mice were habituated to the cables for 4 days before the experiments and remained connected
throughout the study. We first recorded baseline sleep-wake behavior across 24 hours using
EEG/EMG and infrared video recordings. During this control recording, all procedures were the
same as during the deprivation day protocol. Following the control recording, we then performed
selective REM sleep deprivation on half of the mice during the last 4 hours of the light period
(15:00-19:00) by visually identifying REM sleep using EEG/EMG criteria and then waking mice
from sleep using gentle handling. A paired mouse was also aroused regardless of what state it
was currently in to serve as a sham deprivation (i.e. a similar number of arousals without the
same loss of REM sleep). After 3 days of recovery, the mice reversed roles such that mice in the
sham group were now deprived of REM sleep, while those previously deprived served as shams.
3.3.5 Wheel running and chocolate protocol
In order to establish whether presumptive positive affective stimuli could increase
cataplexy we provided running wheels and chocolate to orexin KO mice. Wheel running
experiments were performed at Harvard University under the supervision of Dr. Scammell.
These mice served as a control for experiments detailed in chapter 6, therefore they had received
bilateral amygdala PBS injections during EEG/EMG implantation surgery. This intervention did
not appear to affect behavior. We first examined baseline sleep-wake behavior across 24 hours
using EEG, EMG and infrared video recordings. We then studied mice under two conditions that
should increase cataplexy: access to a running wheel, and to a running wheel plus chocolate. We
placed a low torque, polycarbonate running wheel (Fast-Trac, Bio-Serv, Frenchtown, NJ) in each
cage and recorded wheel rotations using a photodetector beneath each wheel (designed and
constructed by Dr. Mochizuki). Running wheels increase cataplexy in orexin KO mice (Espana
et al., 2007), and this style of wheel was chosen because it does not interfere with the EEG
recording cable. After 7 days of habituation to the wheel, we recorded sleep/wake behavior and
wheel rotations. The next night, we gave mice 3g of milk chocolate (Hershey’s) at dark onset
and recorded sleep-wake behavior and wheel running activity over the next 12 hours (19:00-
48
7:00). We chose to use chocolate because chocolate has been used as a reward in rodent operant
studies (Holahan et al., 2011, King et al., 2011), and cataplexy in mice and dogs is increased by
palatable food (Siegel et al., 1986, Clark et al., 2009).
3.3.6 Ultrasonic vocalizations and social reunion paradigm
Ultrasonic vocalization (USV) experiments were performed at the University of Toronto
in collaboration with Dr. Yeomans (Department of Psychology, University of Toronto). USVs
have been proposed as a measure of affect in rodents. In order to investigate whether stimuli that
evoke USVs would also increase cataplexy, we subjected female orexin KO mice to a social
reunion paradigm; female mice were used as males will respond to social reunion with
aggressive behaviors, while females respond positively. Social reunion is an effective method to
elicit USVs in mice (Irie et al., 2012). At 12:00, seven hours before testing, female mouse pairs
were separated, with one mouse remaining in the home cage while the other was placed in an
identical cage with fresh bedding and food. At the beginning of the testing session (19:00), the
separated mouse was re-introduced into the home cage. Video and audio recordings were taken
for 20 minutes after the reunion. Cataplexy was identified by an experienced observer, blinded
to the genotype of the mouse pair, using videography. We were not able to use the consensus
definition of murine cataplexy to identify arrests because of the absence of EEG/EMG
(Scammell et al., 2009). Therefore, all sudden postural collapses of greater than 10 seconds were
classified as cataplexy. USVs were quantified by an observer experienced in scoring digital
acoustic wave patterns (Petri Takala), using Avisoft SASLab Pro software (Avisoft Bioacoustics,
Berlin, Germany).
3.3.7 Statistics
The statistical tests used for analysis are included in the text of the results section. All
statistical analyses were computed using SigmaStat (SPSS Inc., Chicago, IL) and applied a
critical α value of p<0.05. Data are presented as mean ± SEM.
3.4 Results
Cataplexy in orexin KO mice occurred almost exclusively during the dark period (n=9;
Figure 3.1), whereas REM sleep occurred during both the dark and light periods. During the
49
time when cataplexy occurs, amounts of REM sleep and cataplexy are similar: during the dark
period orexin KO mice spent 2.6% of the time in cataplexy and 3.5% of the time in REM sleep.
The average duration of each bout of REM sleep and cataplexy was similar during the dark
period (61 ± 3s vs. 66 ± 5s; paired t-test; p=0.394), while the number of bouts was also similar
(25 ± 3 vs. 18 ± 4; p=0.230).
3.4.1 Muscles exhibit atonia during both REM sleep and cataplexy
In orexin KO mice (n=11), we analyzed masseter muscle EMG to quantify muscle tone
during cataplexy and REM sleep. Masseter muscle tone during cataplexy was lower than REM
sleep muscle tone (t-test, p=0.024; Figure 3.2A and B). During REM sleep, muscles exhibit
phasic muscle twitches on a background of muscle atonia; by comparing the frequency of muscle
twitches during REM sleep and cataplexy, we observed that these twitches generally did not
occur during cataplexy (p=0.001; Figure 3.2A and C) and those that were detected were
significantly smaller in amplitude (p=0.010; Figure 3.2D). Removing phasic twitch activity from
our measure of muscle tone during REM sleep demonstrated that the suppression of masseter
muscle tone during REM sleep atonia and cataplexy was similar (p=0.557; Figure 3.2E).
50
Figure 3.1: REM sleep and cataplexy occur in similar amounts during the dark period
A. Cataplexy occurred almost exclusively during the dark period, but REM sleep and cataplexy
occurred in similar amounts during the dark period. B and C. The frequency and duration of
REM sleep and cataplexy episodes was similar during the dark period. *, p<0.05.
51
Figure 3.2: Muscle tone during REM sleep and cataplexy.
A. Raw traces demonstrating masseter muscle tone during REM sleep and cataplexy. Phasic
muscle twitches (see arrows) were largely absent during cataplexy. B. Overall EMG tone during
cataplexy was lower than during REM sleep. C and D. Muscle twitches that occurred during
REM sleep were largely absent during cataplexy, and those that remained were smaller in
amplitude. E. Muscle tone during cataplexy was similar to levels during REM sleep atonia.
A.U., arbitrary units; *, p<0.05.
52
3.4.2 Putative positive emotions trigger cataplexy in mice
To investigate the relationship between cataplexy and emotion in orexin KO mice, we
looked at the association between USVs and cataplexy. It is hypothesized that USVs are a
measure of affect in rodents (Knutson et al., 2002, Burgdorf et al., 2007, Wang et al., 2008).
Because we were interested in whether USVs are associated with cataplexy, all experiments were
performed in orexin KO mice. Using a social reunion paradigm previously demonstrated to
induce USVs (data not shown), we observed cataplexy in 56% of testing sessions and a trend
towards more vocalizations during sessions where cataplexy was observed (Figure 3.3A). Mice
that tended to vocalize more spent increased time in cataplexy; there was a positive correlation
between total number of USVs and total time spent in cataplexy across the recording period
(R2=0.55; P=0.001. Figure 3.3B).
In order to investigate whether there was a temporal relationship between USVs and
cataplexy onset, we separated USVs into time bins based on when in the recording period they
occurred: those that occurred during the first 2 minutes post-reunion, those that occurred in the
minute preceding an episode of cataplexy, and those that occurred any other time across the
recording period. Despite many USVs being emitted at the beginning of the testing session,
cataplexy was not associated with these USVs, as no episodes of cataplexy were observed in the
2 minutes post-reunion. There was, however, a trend towards more USVs being emitted in the
minute preceding an episode of cataplexy than on average across the rest of the recording period
(Figure 3.3C). When we looked at individual episodes of cataplexy, we observed that only 29%
of episodes were immediately (<1 min) preceded by USVs, although the average latency
between the last USV and the onset of cataplexy was very short (9 ± 4s) in these episodes,
suggesting that there may be a temporal relationship between USVs and cataplexy in specific
cases. These results suggest that emotionally salient stimuli increase cataplexy in orexin KO
mice.
53
Figure 3.3: USVs are associated with cataplexy in orexin KO mice
A. Orexin KO mice show increased vocalizations in testing sessions in which cataplexy
occurred. B. In testing sessions during which cataplexy occurred, total numbers of vocalizations
across the recording period positively correlate with total time spent in cataplexy (n=19 testing
sessions). C. In the one minute preceding a cataplectic attack, mice had more USVs than they
did on average throughout the rest of the recording period. This suggests that there may be a
loose temporal relationship between the occurrence of USVs and the onset of cataplexy.
54
3.4.3 Stimulating environments increase cataplexy but decrease REM
sleep
To determine whether cataplexy inducing conditions could lead to changes in the
occurrence of REM sleep we gave orexin KO mice access to a running wheel and chocolate.
These stimuli together significantly increased amounts of cataplexy by 92% (n=8; 2.6 ±0.4% vs.
5.0 ±0.6%; RM ANOVA; p<0.001). Wheel running (WR) alone increased frequency of
cataplexy by 83% (18 ±4 vs. 33 ±6; p=0.013; Figure 3.4B), while the average duration of
cataplexy was reduced (66 ±5s vs. 40 ±6s; p<0.001; Figure 3.4C). Chocolate in addition to WR
increased the frequency of cataplexy by 272% when compared to baseline conditions (18 ±4 vs.
67 ±10; p<0.001, Figure 3.4B); the average duration of cataplexy was reduced (66 ±5s vs. 34
±2s; p=0.006; Figure 3.4C). These stimulating environments increased cataplexy while
simultaneously decreasing amounts of REM sleep by 54% (3.5 ± 0.4% vs. 1.6 ±0.3%; p<0.001;
Figure 3.4D) and 89% (3.5 ± 0.4% vs. 0.4 ±0.2%; p<0.001) during the WR and WR and
chocolate conditions, respectively. WR alone decreased the frequency of REM sleep by 48% (25
± 3% vs. 13 ±2%; p<0.001; Figure 3.4E) while having no effect on duration of bouts (61 ± 3s vs.
55 ±4s; p=0.731). WR in addition to chocolate decreased the frequency of REM sleep by 84%
(25 ± 3% vs. 4 ±2%; p<0.001; Figure 3.4E) while not significantly affecting the duration of
REM sleep bouts (61 ± 3s vs. 38 ±8s; p=0.061; Figure 3.4F). These data demonstrate that
stimuli that increase the probability of cataplexy decrease REM sleep amounts.
Both WR and WR and chocolate conditions also affected NREM and wake amounts.
Waking during the dark period was significantly increased by 20% under the WR condition (RM
ANOVA; p<0.001; Figure 3.5A) and by 38% under the WR and chocolate condition (p<0.001).
WR and chocolate had such a potent wake promoting effect that orexin KO mice maintained
wakefulness for 90% of the dark period despite chronic sleepiness. NREM sleep was reduced
under stimulating conditions, decreasing by 42% (p<0.001) and 85% (p<0.001) during the WR
and WR and chocolate conditions, respectively (Figure 3.5B). Because cataplexy occurs during
waking it is possible that the increases in cataplexy observed with environmental stimuli are due
to increased waking; however, this is unlikely to be the case as the increase in wake is not
proportional to the increase in cataplexy (ex: a 38% increase in waking vs. 92% in cataplexy).
We also expressed cataplexy with respect to the amount of waking in each condition (i.e.
cataplexy/wake %) and see no changes in the significance of observed trends (data not shown).
55
Figure 3.4: Wheel running and chocolate increased cataplexy and decreased REM sleep
A, B and C. Wheel running (WR) and WR with chocolate increased cataplexy during the dark
period in orexin KO mice. Increases were due to an increase in the number of episodes of
cataplexy as the average duration of cataplexy bouts decreased with these stimuli. D, E, and F.
Wheel running (WR) and WR with chocolate decreased REM sleep in orexin KO mice. The
observed decrease was due to a decrease in the number of bouts of REM sleep. * denotes a
significant difference from baseline; ** denotes a significant difference from baseline and WR;
p<0.05.
56
Figure 3.5: Stimulating environments increased waking and decreased NREM sleep during
the dark period
A and B. Wheel running (WR) and WR with chocolate increased amounts of wakefulness and
decreased amounts of NREM sleep during the dark period in orexin KO mice. * denotes a
significant difference from baseline; ** denotes a significant difference from baseline and WR;
p<0.05.
57
3.4.4 Increasing REM sleep pressure does not affect cataplexy
To test whether increasing REM sleep pressure can increase the occurrence of cataplexy,
we selectively REM sleep-deprived orexin KO mice (n=10) for 4 hours prior to the onset of the
dark period. During the 4-hour deprivation period, REM sleep was significantly decreased
compared to baseline (2-way RM ANOVA, p<0.001; Figure 3.6A). This decrease was due to
significantly fewer (p<0.001; Figure 3.6B) and shorter bouts of REM sleep (p<0.001; Figure
3.6C). However, the deprivation was not completely selective as there was a significant decrease
in NREM sleep (p<0.001; Figure 3.6D) and an increase in waking (p<0.001; Figure 3.6E). To
control for this loss of sleep, a sham deprivation was performed that resulted in the same loss of
NREM sleep and increase in waking, while losing less REM sleep over the deprivation period
(Sham group vs. Deprivation group, p<0.001; Baseline vs. Sham group, p<0.001; Figure 3.6).
As previously demonstrated, cataplexy rarely occurs during the light period; we nonetheless
analyzed it during the deprivation period and did not observe significant changes in the amount
of cataplexy (Figure 3.6A).
After selective REM sleep deprivation there was no significant difference observed
between groups during any sleep state when averaged across the entire 12 hour dark period (RM
ANOVA, p>0.05 for all comparisons; Figure 3.7A and B). Cataplexy was not significantly
different across groups either, with similar amounts of cataplexy, bouts and durations of attacks
being observed in all groups (Figure 3.7B-D). When viewed over a full 12-hour period, the 4-
hour REM sleep deprivation did not have an effect on cataplexy.
Rebound after selective deprivation could act at shorter timescales than 12 hours. In
order to determine if state-specific rebounds were occurring at shorter timescales, we
investigated cumulative loss plots across the entire recording period. Figures 3.8A and 3.9A
demonstrate the deficit in REM sleep and cataplexy compared to baseline that is accumulated
and regained over the entire recording period (including one hour of pre-deprivation baseline
recording and 4 hours of the next light period). A negative slope confers a loss of that particular
state compared to baseline recording, a positive slope confers a gain of that particular state, while
a slope parallel to the x-axis means no change. Figure 3.8A demonstrates that a REM sleep
deficit was accrued in both the sham and deprivation groups, although the magnitude of the
deficit was greater in the deprivation group. Interestingly, figure 3.9A demonstrates that
cataplexy seems to accrue a deficit during the first part of the dark period, perhaps while some
58
sleep is being regained, then a small rebound in cataplexy is observed toward the end of the dark
period in the deprivation group. These observations suggest that shorter timescales are required
to investigate the effects of REM sleep deprivation on cataplexy.
Observing changes in REM sleep and cataplexy in one hour intervals demonstrated some
effects of selective REM sleep deprivation. Focusing first on REM sleep, we observed
significant loss of REM sleep in the deprived group, and to a lesser extent in the sham group,
during the deprivation. There was a significant rebound in REM sleep during the first hour of
the dark period in both the deprivation and sham groups (RM ANOVA, p<0.05; Figure 3.8B),
indicating that our intervention did cause an expected homeostatic rebound in REM sleep. The
deprivation group showed another increase in REM sleep during the third hour of the dark
period.
The amount of cataplexy observed was decreased in both the sham and deprivation
groups during the first and third hour of the dark period when compared to control mice (RM
ANOVA, p<0.05; Figure 3.9B). This would indicate that increasing REM sleep pressure inhibits
cataplexy. Over the remainder of the dark period we did not observe any changes in the amount
of cataplexy, except between 5:00-6:00 when there was a significant increase in cataplexy only
in the REM sleep deprived group. As mentioned previously, it is possible that changes in
cataplexy could be a product of changes in the amount of waking. This does not appear to
account for the effects seen here, as wakefulness was not affected at any point during the dark
period following deprivation (Figure 3.10). In agreement with this, calculating cataplexy
amounts relative to waking (i.e. cataplexy/wake %) did not change the significance of the results
(data not shown). It is possible that the deprivation led to a change in general arousal and
perhaps locomotion, which caused a change in the amount of cataplexy; however, we could not
measure these parameters.
59
Figure 3.6: Selective REM sleep deprivation reduced both NREM and REM sleep
A. REM sleep was significantly reduced in the REM deprivation group when compared to
baseline and sham deprivation groups. Cataplexy was rarely observed during the 4h deprivation
period. B and C. Both the number and the average duration of REM sleep bouts were decreased
in the REM sleep deprivation group. D. Deprivation was not selective to just REM sleep as
NREM sleep amount was also reduced in both the sham and deprivation groups compared to
baseline, with a concomitant increase in wakefulness. *, p<0.05 compared to baseline; **,
p<0.05 compared to baseline and sham groups.
60
Figure 3.7: REM sleep deprivation had no effect on behavioral state over the following
dark period
A and B. Over the entire dark period there was no significant difference in wake, NREM sleep,
REM sleep or cataplexy in either the sham or deprivation group compared to baseline. C and D.
There was no difference in the occurrence or duration of cataplexy periods during the dark
period in sham or deprivation groups when compared to baseline.
61
Figure 3.8: REM sleep accrued a deficit during the deprivation that was in part recovered
over the following dark period
A. A deficit in REM sleep is accrued in both the sham and deprivation groups during the
deprivation, although the magnitude of the deficit is greater in the deprivation group. This deficit
is then partially recovered over the ensuing dark period. B. Hourly amounts of REM sleep
demonstrated successful REM sleep deprivation and a brief REM sleep rebound in both the REM
sleep deprived group and sham group. *, p<0.05 compared to Sham and REM Dep groups; #,
p<0.05 compared to REM Dep group; $, p<0.05 when compared to Control group.
62
Figure 3.9: Cataplexy was reduced at the beginning of the dark period following
deprivation
A. In both the sham and deprivation groups a cataplexy deficit is accrued during the first part of
the dark period. B. Hourly amounts of cataplexy demonstrating a short term decrease in
cataplexy during the first part of the dark period. Only between 5:00 and 6:00 was cataplexy
significantly greater in the REM deprivation group. *, p<0.05 compared to Sham and REM Dep
groups; $, p<0.05 when compared to Control and Sham groups.
63
Figure 3.10: Wakefulness during the dark period was not significantly affected by REM
sleep deprivation
The amount of wake was significantly elevated in the sham and REM sleep deprivation group
during the first three hours of the deprivation, but was not different at any point during the dark
period. *, p<0.05 compared to Sham and REM Dep groups; $, p<0.05 when compared to
Control group.
64
3.5 Discussion
Cataplexy and REM sleep share many common features, including theta-rich EEG, loss
of muscle tone and reduction of the H-reflex (Guilleminault et al., 1974, Guilleminault et al.,
1998, Chemelli et al., 1999, Overeem et al., 2004). This has led to the hypothesis that cataplexy
is the expression of REM sleep atonia during wakefulness. Here we performed a series of
experiments to address the relationship between REM sleep and cataplexy in orexin KO mice in
order to shed light on whether they share a common mechanism. We observed some
phenotypic similarities between REM sleep and cataplexy; however, increasing propensity for
either cataplexy or REM sleep did not increase occurrence of the other state, as might be
expected if they were generated by the same mechanism.
3.5.1 REM sleep and cataplexy are similar states
We first observed the natural occurrence and characteristics of REM sleep and cataplexy.
REM sleep occurs both during the light and dark periods, though generally more during the light
period, the normal sleeping period for mice. Cataplexy occurs almost exclusively during the
dark period. During the dark period both states occur in similar amounts, with both the number
of episodes and the average duration of episodes being similar. These data demonstrate
similarities between REM sleep and cataplexy in orexin KO mice that suggest these states may
be regulated by similar mechanisms. It is difficult to compare amounts of cataplexy observed
between labs as recording conditions (cage, tether, etc.), techniques (whether EMG, EEG, and
video were used), and the mice themselves (number of backcrosses, background, etc.) may
change the expression of cataplexy; however, these values are within the range of values
observed previously in orexin-deficient mice (Chemelli et al., 1999, Mochizuki et al., 2004,
Espana et al., 2007, Kalogiannis et al., 2011).
3.5.2 Muscle tone during REM sleep and cataplexy is similar
We observed that muscle tone during episodes of cataplexy was similar to REM sleep,
only with an absence of muscle twitches. Although human narcoleptics sometimes report muscle
twitches during cataplexy, this finding is supported by work in narcoleptic canines demonstrating
a lack of rapid eye movements and phasic activity, common during REM sleep, during cataplexy
65
(Siegel et al., 1991, Siegel et al., 1992, Overeem et al., 2011). Several different brainstem
regions have been proposed as generators of muscle atonia (Boissard et al., 2002, Boissard et al.,
2003, Lu et al., 2006b). Siegel and colleagues demonstrated that a population of neurons in the
medial medulla thought to be involved in generating REM sleep atonia were active only during
REM sleep and cataplexy, suggesting that these neurons could ultimately be responsible for
atonia during both states (Siegel et al., 1991). In addition, they demonstrated a population of
cells in the medial mesopontine region that are active during waking and REM sleep but not
during cataplexy, which could be responsible for the phasic activity seen during REM sleep but
absent during cataplexy (Siegel et al., 1992).
The mechanisms generating REM sleep atonia are still unclear but recent work has
suggested a number of brain regions and a combination of inhibition and disfacilitation of motor
neurons (Soja et al., 1991, Kohlmeier et al., 1997, Boissard et al., 2002, Boissard et al., 2003,
Morrison et al., 2003a, Fenik et al., 2004, Fenik et al., 2005b, a, Sood et al., 2005, Chan et al.,
2006, Lu et al., 2006b, Brooks and Peever, 2008, Burgess et al., 2008). Our lab has
demonstrated a key role for GABAergic and glycinergic mechanisms in regulating muscle
atonia, while glutamatergic inputs to motor neurons are responsible for muscle twitches during
REM sleep (Brooks and Peever, 2008, Burgess et al., 2008). Selective activation of the
inhibitory mechanisms, without recruitment of the excitatory inputs, may generate atonia during
cataplexy. Further investigation of REM sleep atonia-generating brain regions during cataplexy
is needed to determine whether the loss of muscle tone during these two states is caused by the
same mechanism.
A limitation of this study is that only one muscle was investigated and the activity
averaged over the entire episode of each state. Recent work has shown that different types of
muscles can be differentially suppressed during REM sleep and that muscle tone may change
subtly over the course of a single episode of REM sleep or cataplexy (Fraigne and Orem, 2011,
Kalogiannis et al., 2011). A more detailed analysis of several different muscles during cataplexy
may yield different results.
66
3.5.3 Positive affective stimuli induce cataplexy and suppress REM
sleep in mice
Laughter is reported to be the best trigger for cataplexy in human patients (Gelineau,
1880, Overeem et al., 2011). Positive affect also causes cataplexy in narcoleptic canines, as
social play and palatable food are good triggers of cataplexy (Mitler and Dement, 1977, Baker et
al., 1982, Kushida et al., 1985, Siegel et al., 1986). It is more difficult to determine the
emotional state of mice; however, using a proposed correlate of affect in rodents (USVs) we
show that emotionally salient stimuli increased cataplexy in orexin KO mice (Knutson et al.,
2002, Burgdorf et al., 2007). We then used this finding to promote cataplexy with other
rewarding stimuli (WR and chocolate). Mice will bar press for access to a running wheel and for
palatable food, indicating that they value these stimuli (Holahan et al., 2011, King et al., 2011)
and it has been previously demonstrated that access to a running wheel and palatable food each
separately can increase cataplexy in orexin KO mice (Espana et al., 2007, Clark et al., 2009).
We observed that these stimuli increased the occurrence of cataplexy while they significantly
reduced REM sleep. If REM sleep and cataplexy were generated by the same neural
mechanisms, one might expect stimuli that promote cataplexy to also promote REM sleep.
These stimuli may have actively suppressed REM sleep circuits while simultaneously activating
cataplexy circuits.
A number of methodological limitations restrict the conclusions that can be drawn from
these experiments, including that chocolate contains a number of compounds, including caffeine
which powerfully affects sleep-wake regulation that could be responsible for the observed effects
on cataplexy rather than positive affect. This concern has been partly addressed by another
study, using a different food stimulus that also observed a link between palatable food and
cataplexy in orexin KO mice (Clark et al., 2009). In addition, caffeine has been demonstrated to
increase wakefulness in orexin KO mice while having no significant effect on cataplexy (Willie
et al., 2003). A further limitation of this study is that the observed relationship between USVs
and cataplexy is preliminary and correlative, making strong conclusions difficult. In addition,
we found both USVs and cataplexy to be widely variable between mice, requiring a large
number of testing sessions and a large number of mice to make meaningful conclusions beyond
those made here. As mentioned previously, we did not have EEG/EMG data to score episodes of
cataplexy; this may have led to incorrect identification, particularly as orexin KO mice exhibit
67
rapid transitions into NREM sleep (i.e. sleep attacks) that could be mistaken for cataplexy. We
don’t think this is the case as the intervention (i.e. social reunion) is alerting and was performed
at the onset of the dark period when mice are generally alert. Mochizuki et al (2004)
demonstrated that orexin KO mice can maintain wakefulness for ~45 minutes after a cage
change, while we only measured for 20 minutes post-reunion (Mochizuki et al., 2004). Despite
these limitations, the implications of this simple experiment are interesting, particularly as the
circuits responsible for USVs have been characterized, and may overlap with the circuits that
ultimately trigger cataplexy (Burgdorf et al., 2007).
3.5.4 REM sleep pressure does not significantly increase cataplexy
We observed that increasing REM sleep pressure did not increase cataplexy over the
following dark period. Cataplexy was initially suppressed during the dark period after REM
deprivation; however, there was one time point toward the end of the dark period that showed an
increase in cataplexy only in the REM deprivation group. It is unclear if this increase resulted
from the REM sleep deprivation, a homeostatic rebound-like response to the decreased cataplexy
at the start of the dark period, or an unrelated phenomenon. A recent study in human patients
with narcolepsy also investigated the relationship between increasing REM sleep pressure and
cataplexy. Vu and colleagues performed two nights of selective REM sleep deprivation in human
patients with narcolepsy and observed no change in cataplexy or other REM sleep related
narcolepsy symptoms (i.e. hallucinations and sleep paralysis), while they observed a normal
REM sleep homeostatic rebound (Vu et al., 2011). If REM sleep and cataplexy were generated
by the same neural mechanisms, one might expect interventions that promote a REM sleep
rebound to increase cataplexy. REM sleep deprivation did not appear to significantly increase
cataplexy in orexin KO mice or human narcolepsy patients.
Our investigation of whether REM sleep pressure can increase the occurrence of
cataplexy has methodological limitations that make more detailed analysis difficult. While we
successfully reduced REM sleep, the intervention was not selective as NREM sleep was also
affected. We did observe a REM sleep rebound in the deprived group indicating there was
increased REM sleep pressure, and previous studies have demonstrated as little as two hour of
REM sleep deprivation is enough to result in a rebound (Shea et al., 2008). However, it is
possible that a longer term deprivation may be required to uncover effects on cataplexy. There
68
are automated, selective REM deprivation protocols that could be used to address these concerns
and may yield different findings. In addition, a less stressful approach to increasing REM sleep,
like increasing ambient temperature, could be used to investigate the effects of increased REM
pressure on cataplexy (Szymusiak et al., 1980, Amici et al., 1998, Baker et al., 2005).
3.5.5 REM sleep and cataplexy do not share a common executive
mechanism
The experiments and analyses described in this chapter were designed to address the
question of whether REM sleep and cataplexy share a common mechanism. Our data suggest
that REM sleep and cataplexy are unique behavioral states that do not share an executive
mechanism. Given the similar loss of muscle tone during cataplexy and REM sleep it is possible
they share the same mechanisms that ultimately generate muscle atonia. In support of this it has
been previously demonstrated that REM sleep atonia-promoting neurons in the medulla fire
selectively during REM sleep and cataplexy in narcoleptic dogs (Siegel et al., 1991). We
propose that the mechanisms that generate REM sleep and cataplexy converge at brain regions
demonstrated to generate muscle atonia (Figure 3.11).
An alternative proposal to the theory that cataplexy is a disorder of REM sleep is that it is
an atavistic expression of tonic immobility (TI) (Overeem et al., 2002). TI is a defense
mechanism seen in some animals (ex: sharks, guinea pigs, chickens, and rabbits, though not
humans or mice) that can be similar to cataplexy. During periods of TI, animals can show both
stereotyped postures and flaccidity, or loss of muscle tone; they also show a wake-like EEG
activity, awareness of their external environment, and reduced heart rate (Klemm, 1971a, b).
Studies suggest amygdala projections to the brainstem regions that generate muscle atonia during
REM sleep are involved in TI (Klemm, 1976, Leite-Panissi et al., 2003). In addition, muscle
twitches and phasic eye movements, defining features of REM sleep that are largely absent
during cataplexy, are absent during TI (Braun and Pivik, 1983, Overeem et al., 2002). Our data
could support the hypothesis that cataplexy is an atavistic expression of TI, that ultimately
triggers loss of muscle tone through brainstem REM sleep atonia-generating sites.
69
Figure 3.11: Cataplexy and REM sleep are generated by different mechanisms
The mechanisms that regulate cataplexy and REM sleep are unique. While REM sleep is
homeostatically regulated, cataplexy can be triggered by positive affective stimuli. We propose
that both systems ultimately trigger loss of muscle tone by activating muscle atonia-generating
regions in the pons, resulting in inhibition of motor neurons and loss of muscle tone. Green
arrows indicate excitatory projections and red lines indicate inhibitory projections.
70
Chapter 4: Dopaminergic Regulation of Sleep
and Cataplexy
This chapter has been adapted from a published manuscript in the journal Sleep (Burgess et al.
2010)
Other researchers contributed to this work:
Gavin Tse, MSc: Assisted with the wild type mouse amphetamine experiments
Lauren Gillis, BSc: Genotyped mice and assisted with the organization of the mouse colony
71
Chapter 4: Dopaminergic Regulation of Sleep and Cataplexy
4.1 Abstract
Narcolepsy is characterized by excessive sleepiness and cataplexy, the sudden loss of
postural muscle tone during waking. The mechanisms that underlie sleepiness and cataplexy are
unclear; however, there is evidence that dysregulation of the dopaminergic system may have a
role. To establish whether the dopaminergic system plays a role in murine narcolepsy,
cataplexy, sleep attacks and sleep-wake behavior were monitored after injection of saline,
amphetamine or specific dopamine receptor modulators. Amphetamine (2mg/kg) decreased
sleep attacks and cataplexy, suggesting that dopamine transmission could modulate such
behaviors. Specific dopamine receptor modulation also affected sleep attacks and cataplexy.
Activation and blockade of D1-like receptors decreased and increased sleep attacks, respectively,
without affecting cataplexy. Pharmacological activation of D2-like receptors increased
cataplexy and blockade of these receptors potently suppressed cataplexy. Manipulation of D2-
like receptors did not affect sleep attacks. We found that cataplexy is modulated by a D2-like
receptor mechanism, whereas dopamine modulates sleep attacks by a D1-like receptor
mechanism. These results support a role for the dopamine system in regulating sleepiness and
cataplexy in murine narcolepsy and suggest that cataplexy and REM sleep can be differentially
regulated.
4.2 Introduction
Narcolepsy is characterized by excessive daytime sleepiness, cataplexy, hypnagogic
hallucinations and sleep paralysis (Siegel and Boehmer, 2006). Excessive sleepiness and
cataplexy, the involuntary loss of postural muscle tone during waking, are the most debilitating
symptoms of the disorder (Siegel and Boehmer, 2006). Although loss of orexin neurons
underlies narcolepsy, the specific neurochemical mechanisms that trigger sleepiness and
cataplexy are still unknown (Peyron et al., 2000, Thannickal et al., 2000, Thannickal et al., 2003,
Blouin et al., 2005).
Abnormalities in dopaminergic neurotransmission may contribute to both sleepiness and
cataplexy. For example, clinical studies demonstrate that human narcoleptics have an altered
striatal dopaminergic system. Specifically, brain imaging studies show that narcoleptics have
72
increased D2-like receptor binding that is tightly correlated with cataplexy (Eisensehr et al.,
2003). Drugs used to treat human narcolepsy and other sleep disorders affect the dopamine
system. For example, amphetamine, modafinil and gamma-hydroxybutyrate, which are used to
treat sleepiness and cataplexy, have effects on the dopamine system (e.g., dopamine re-
uptake/release and receptor expression) (Howard and Feigenbaum, 1997, Schmidt-Mutter et al.,
1999, Wisor et al., 2001, Wisor and Eriksson, 2005). Animal studies also show that sleep and
cataplexy can be manipulated by the dopamine system (Bagetta et al., 1988, Monti et al., 1988,
Monti et al., 1989, Monti et al., 1990, Ongini et al., 1993, Isaac and Berridge, 2003).
Pharmacological manipulation of D2-like, but not D1-like, receptors in dopaminergic brain areas
(e.g. substantia nigra and ventral tegmental area) modulates cataplexy in narcoleptic dogs (Reid
et al., 1996, Honda et al., 1999b, Okura et al., 2004). Sleep too is controlled by dopaminergic
mechanisms. For example, loss of wake-active dopamine cells in the ventral periaquaductal gray
promotes sleep in rats (Lu et al., 2006a).
Despite evidence linking the dopamine system and narcolepsy symptoms, it is unknown
if manipulation of dopamine receptors affects sleep or cataplexy in murine narcolepsy. Here, we
used orexin KO mice, which serve as a model of human narcolepsy (Chemelli et al., 1999,
Mochizuki et al., 2004), to determine if modulation of dopamine receptors can affect cataplexy
and sleep attacks (Chemelli et al., 1999). We show that cataplexy is predominantly mediated by
D2-like receptors, whereas sleep attacks are modulated by a D1-like receptor mechanism. These
data demonstrate that dopaminergic mechanisms contribute to narcolepsy symptoms and further
establish the orexin KO mouse as a useful model for studying the mechanisms underlying
sleepiness and cataplexy.
4.3 Methods
All procedures and experimental protocols were approved by the University of Toronto’s
animal care committee and were in accordance with the Canadian Council on Animal Care.
4.3.1 Animals
Experiments used male, orexin KO mice on a C57BL/6 background (n=17; age: 15.1 ±
1.0 weeks; mass: 29.2 ± 0.8g) and male wildtype littermates (n=21; age: 15.9 ± 0.8 weeks; mass:
28.1 ± 0.9g). Mice were genotyped using PCR with genomic primers 5'-GACGACGGCCTCAG
ACTTCTTGGG, 3'-TCACCCCCTTGGG ATAGCCCTTCC, and 5’-CCGCTATCAGGACATA
73
GCGTTGGC (with forward primers being specific for either wildtype or KO mice and the
reverse primer being common to both).
4.3.2 Surgery
Mice were anesthetized using isoflurane (1-2%) and implanted with EEG and EMG
electrodes. EEG recordings were obtained using four stainless steel micro-screws (1mm anterior
±1.5mm lateral to bregma; 3mm posterior ±1.5mm lateral to bregma). EMG electrodes were
made from multistranded stainless steel (AS131, Cooner Wire, Chatsworth, CA) wires, which
were sutured onto both neck and left/right masseter muscles. All electrodes were attached to a
micro-strip connector (CLP-105-02-L-D, Electrosonic, Toronto, ON), which was affixed onto
the animal’s head with dental cement (Ketac-cem, 3M, London, ON). After surgery, mice were
given 0.9% saline and ketoprofen (3mg/kg). Mice were individually housed in a sound-
attenuated and ventilated chamber on a 12:12 light-dark cycle (110 Lux; lights on 7:00, lights off
19:00) for 10-12 days post surgery. Food and water were available ad libitum.
4.3.3 Drug preparation
The following drugs were used to modify dopaminergic transmission: quinpirole (0.125
and 0.5mg/kg; a D2-like receptor agonist; Tocris, Ellisville, MO), eticlopride (0.25 and 1mg/kg;
a D2-like receptor antagonist; Sigma Aldrich, Oakville, ON), SKF 38393 (5 and 20mg/kg; a D1-
like receptor agonist; Tocris), SCH 23390 (0.25 and 1mg/kg; a D1-like receptor antagonist;
Tocris) and amphetamine (2mg/kg; Sigma Aldrich). Drugs were made from frozen stock
solutions before each i.p. injection. Dose ranges were chosen based on previous studies
demonstrating behavioral effects in mice (Gessa et al., 1985, Zarrindast and Tabatabai, 1992,
Tirelli and Witkin, 1995, Ralph and Caine, 2005).
In this study we refer to D1-like or D2-like dopamine receptors. D1-like receptors
include D1 and D5 receptors while D2-like receptors include D2, D3, and D4 receptors. The
drugs used are selective for either D1-like or D2-like receptors. Ki values for quinpirole are 4.8,
24, 30 and 1900nM at D2, D3, D4 and D1 receptors, respectively. Ki values for eticlopride are
0.50 and 0.16nM at D2 and D3 receptors, respectively. Ki values SKF 38393 are 1, 0.5, 150,
5000 and 1000nM for D1, D5, D2, D3 and D4 receptors, respectively. Ki values for SCH 23390
are 0.2, 0.3, 1100, 800 and 3000nM at D1, D5, D2, D3 and D4 receptors, respectively.
74
4.3.4 Data acquisition
Sleep-wake state and muscle activity were recorded by attaching a lightweight cable to
the plug on the mouse’s head, which was connected to a Physiodata Amplifier system (Grass
15LT, Astro Med, Brossard, QC). The EEG activity was amplified 1000 times and band-pass
filtered between 1 and 100 Hz. EMG signals were amplified 1000 times and band-pass filtered
between 30 Hz and 1 kHz. All electrophysiological signals were digitized at 500Hz (Spike 2
Software, 1401 Interface, CED Inc.) and monitored and stored on a computer. Infra-red video
recordings were captured and synchronized with the electrophysiological recordings to couple
motor behavior with EEG and EMG recordings.
4.3.5 Experimental protocols
Mice were placed in a round plexi-glass cage (diameter: 20cm) and given 24 hours to
habituate to this new environment. After this period, mice were connected to the recording
apparatus and given another 48 hours to habituate at which point a habituation injection (i.e.,
saline) was given. In one group of mice, a single dose of amphetamine (n=12) was given and
sleep, cataplexy and sleep attacks recorded. In another group of mice (n=26), dopamine drug
injections were given, each separated by 48 hours; injections were given in random order. All
injections (0.3mL i.p.) were given at the onset of the dark phase (i.e., 19:00) and behavior
monitored for the following 4 hours.
4.3.6 Data analysis
Data was collected for 4 hours after injections and was scored, using EEG, EMG (neck
and masseter) and video. Each of the 5 second epochs was scored as wake, non-rapid eye
movement (NREM) sleep, rapid eye movement (REM) sleep, cataplexy, sleep attack or
transition state (e.g., NREM-REM). Sleep attacks were classified as a gradual loss of neck
muscle tone associated with NREM-like EEG characteristics and automatic behavior. In
narcoleptic mice, automatic behavior is defined as chewing, which we confirmed by both
videography and masseter EMG recordings. Cataplexy was classified as a sudden loss of
skeletal muscle tone in both neck and masseter following at least 40 seconds of active waking
and with a duration of at least 10 seconds (Scammell et al., 2009). Both videography and
electrophysiological recordings were used to identify sleep-wake behavior, cataplexy and sleep
attacks.
75
The frequency and duration of cataplexy and sleep attacks, as well as the total time spent
in cataplexy/sleep attacks was determined for each drug and compared to the saline treatment.
To determine the total time spent in cataplexy, we summed the duration of each cataplectic
attack across the 4-hour recording period. For narcoleptic and wildtype mice the time spent in
each sleep-wake state for all drug treatments was determined and compared to the saline
treatment. NREM and REM latency was defined as the time from drug administration to the first
bout of each state.
4.3.7 Statistical analysis
The statistical tests used for each analysis are included in the results section.
Comparisons between frequency (i.e., number of bouts), duration and total time spent in
cataplexy/sleep attacks were made using one-way repeated measures analysis of variance (RM
ANOVA). Drug effects on sleep-wake state were made using a two-way RM ANOVA.
Differences in sleep-wake behaviors between narcoleptic and wildtype mice were determined
using 2-way ANOVA. All statistical analyses used SigmaStat (SPSS Inc.) and applied a critical
2-tailed α value of p<0.05. Data are presented as mean ± SEM.
4.4 Results
4.4.1 Orexin KO mice exhibit cataplexy and sleep attacks
During the 4-hour recording period (i.e., 19:00-23:00), orexin KO mice had an average of
1.9 ± 0.7 (range: 1-5) episodes of cataplexy that lasted 50 ± 11s (range: 10-140s). Cataplectic
attacks occurred during periods of alert wakefulness and were characterized by postural collapse
and loss of skeletal muscle tone with a theta-dominant, waking-like EEG pattern (Figure 4.1A
and C). Cataplectic episodes were terminated by re-entrance into wakefulness, with mice
resuming normal motor behaviors such as grooming or eating. During control conditions, 12%
of narcoleptic mice (2 of 17 mice) did not present with cataplexy.
Orexin KO mice also exhibited sleep attacks. Even though sleep attacks also occurred
during active wakefulness, they differed from cataplexy because they were characterized by
gradual loss of posture and muscle tone and because EEG activity patterns were NREM sleep-
like in nature (Figure 4.1B and C). Another feature separating sleep attacks and cataplexy was
automatic behavior. In orexin KO mice, automatic behavior was defined as chewing, which was
visualized by repeated jaw movements and masseter EMG activity. Automatic behavior was
76
common during sleep attacks, but never observed during cataplexy. Sleep attacks were more
frequent than cataplexy episodes, and on average mice exhibited 4.7 ± 1.0 (range: 2-9) episodes
that lasted 30 ± 3s (range: 10-70s).
Narcoleptic mice also had abnormal sleep-wake architecture (Figure 4.1D). Compared
to wildtype littermates, orexin KO mice had more REM sleep (KO: 5.3 ± 0.8% and wildtype: 1.7
± 0.4%; 2-way ANOVA, p=0.001) and more transitions into and out of sleep (p=0.009), while
they spent the same amount of time in wakefulness (p=0.839) and NREM sleep (p=0.499; Figure
1D).
77
Figure 4.1: Cataplexy, sleep attacks and sleep-wake behavior in narcoleptic mice
A and B. Raw EEG and EMG traces demonstrating the defining features of cataplexy and sleep
attacks. C. Raw EEG and EMG traces showing masseter activity during cataplexy and a sleep
attack. Note that muscle tone is absent during cataplexy, but cyclic during the sleep attack; this
rhythmicity represents automatic chewing behavior, which is common in sleep attacks. D.
Orexin knockout mice have significantly more REM sleep and a greater number of sleep-wake
transitions than wildtype (wildtype) mice. * denotes p<0.05 when compared to wildtype mice.
78
4.4.2 Amphetamine reduced cataplexy and sleep attacks in narcoleptic
mice
We aimed to determine if amphetamine, which increases brain dopamine levels (Sharp et
al., 1987), affects sleep and cataplexy in narcoleptic mice. Amphetamine stimulated wakefulness
and suppressed sleep in both orexin KO and wildtype mice (n=6, 2-way RM ANOVAs;
wildtype: p<0.001, KO: p<0.001; Figure 4.2A and B). It increased wakefulness by 41% above
saline levels in orexin KO mice (p<0.001) but decreased NREM and REM sleep by 52% and
69%, respectively (NREM: p<0.001 and REM: p=0.002 Figure 4.2A). Amphetamine
administration potently suppressed time spent in sleep attacks by 61% (RM ANOVA; p=0.032;
Figure 4.2C). This reduction was due to a decrease in sleep attack frequency (44% below
saline; RM ANOVA; p=0.030; Figure 4.2D) as duration of individual attacks was unaffected by
amphetamine treatment (RM ANOVA; p=0.289; Figure 4.2E). Amphetamine also suppressed
cataplexy, decreasing the number of episodes by 67% of saline levels (RM ANOVA, p=0.042;
Figure 4.2G) without affecting the average duration of individual episodes (RM ANOVA,
p=0.149; Figure 4.2H).
79
Figure 4.2: Amphetamine decreased sleep, sleep attacks and cataplexy
A. Amphetamine increased wakefulness and decreased both NREM and REM sleep in
narcoleptic mice. B. Amphetamine increased wakefulness, decreased NREM sleep and
abolished REM sleep in wildtype mice. C-E. Amphetamine decreased total time spent in sleep
attacks (C) and attack frequency (D), but had no significant affect on sleep attack duration (E).
F-H. Amphetamine reduced the frequency of cataplectic episodes (G), but had no statistical
effect on the total time spent in cataplexy (F) or episode duration (H). * denotes p<0.05 when
compared to saline.
80
4.4.3 D1-like receptors modulate sleep attacks but not cataplexy
First, we aimed to determine if blockade of excitatory D1-like receptors would reduce
wakefulness and promote sleep in narcoleptic mice. Compared to saline treatment, low doses of
the D1-like receptor antagonist (SCH 23390; 0.25mg/kg) had no effect on sleep-wake amounts
(n=5; 2-way RM ANOVA, p>0.05; Figure 4.3A) or sleep latency (RM ANOVA, p=0.279).
However, a higher dose of SCH 23390 (1mg/kg) decreased wakefulness by 25% (2-way RM
ANOVA, p=0.016) and increased NREM sleep by 122% (p=0.024). Neither high nor low doses
of SCH 23390 had significant effects on REM sleep amounts (2-way RM ANOVA, p=0.963;
Figure 4.3A). Blockade of D1-like receptors also promoted sleepiness because sleep latency
decreased from 1735 ± 717s (i.e., saline treatment) to 172 ± 17s following treatment with a high
dose of SCH 23390 (RM ANOVA, p=0.033; data not shown).
Sleep attacks were affected by D1-like receptor blockade. Compared to saline treatment,
low doses of SCH 23390 (0.25mg/kg) had no effect on sleep attacks (RM ANOVA, p=0.101;
Figure 4.3C); however, higher doses (1mg/kg) increased the total time spent in sleep attacks (RM
ANOVA, p=0.009; Figure 4.3C) by increasing the number of sleep attacks by 88% (RM
ANOVA, p=0.022; Figure 4.3D); this drug dose had no effect on the duration of individual
attacks (RM ANOVA; p=0.265; Figure 4.3E). Blockade of D1-like receptors had no significant
effect on cataplexy (RM ANOVA, p=0.870; Figure 4.3F-H).
Next, we wanted to determine if D1-like receptor activation would increase wakefulness
and decrease sleep in narcoleptic mice. Compared to saline treatment, both low (5mg/kg) and
high doses (20mg/kg) of SKF 38393 increased wakefulness by 25% (n=6; 2-way RM ANOVA,
p<0.001) and 23% (p<0.001), while decreasing NREM sleep by 88% (p<0.001) and 76%
(p<0.001; Figure 4.4A). Neither high nor low drug doses had significant effects on REM sleep
even though REM amounts decreased by 92% (p=0.157) and 98% (p=0.127). Activation of D1-
like receptors also promoted arousal because sleep latency increased from 1768 ± 785s (i.e.,
saline) to 10789 ± 932s (RM ANOVA, p<0.001) and 11374 ± 1056s (p<0.001) following
treatment of 5mg/kg and 20mg/kg of SKF 38393 (data not shown).
Both high and low doses of SKF 38393 potently suppressed sleep attacks in narcoleptic
mice (RM ANOVA, p=0.004; Figure 4.4C). Compared to saline treatment, high and low doses
of SKF 38393 decreased the number of sleep attacks by 77% (p=0.004; Figure 4.4D) and 58%
81
(RM ANOVA, p=0.022), but neither dose had an effect on duration of attacks (p=0.560; Figure
4.4E). High and low doses of SKF 38393 completely abolished sleep attacks in 83% and 33% of
narcoleptic mice. Neither high nor low doses of SKF 38393 had significant effects on cataplexy
(RM ANOVA, p=0.549; Figure 4.4F-H).
Lastly, we aimed to determine if D1-like receptor manipulation similarly affects sleep-
wake behavior in wildtype and narcoleptic mice. In wildtype mice, SCH 23390 administration
(1.0mg/kg) decreased wakefulness by 13% (n=4; 2-way RM ANOVA, p=0.003) and increased
NREM sleep by 73% (p=0.002; Figure 4.3B); whereas receptor activation by SKF 38393
treatment (20mg/kg) increased wakefulness by 23% (n=5; 2-way RM ANOVA, p=0.002) and
decreased NREM sleep by 87% (p=0.005; Figure 4.4B). Neither intervention had significant
effects on REM sleep amounts (SCH 23390: p=0.853; SKF 38393: p=0.706). The impact of D1-
like receptor manipulation on sleep-wake behavior was similar in wildtype and orexin KO mice
(2-way ANOVA; SCH 23390: p=0.295; SKF 38393: p=0.341).
82
Figure 4.3: Inactivation of D1-like receptors increased sleep attacks
A. In narcoleptic mice, SCH 23390 (D1-like antagonist; 1mg/kg) increased NREM sleep and
decreased wakefulness. B. In wildtype mice, SCH 23390 also increased NREM sleep and
decreased wakefulness. C-E. SCH 23390 (1mg/kg) increased both the total time spent in sleep
attacks (C) and sleep attack frequency (D), but had no affect on attack duration (E). F-H. SCH
23390 treatment had no affect on time spent in cataplexy (F) or on cataplexy frequency (G) or
duration (H). * denotes p<0.05 when compared to saline.
83
Figure 4.4: Activation of D1-like receptors decreased sleep attacks
A. In narcoleptic mice, SKF 38393 (D1-like agonist) decreased NREM sleep and increased
wakefulness. B. In wildtype mice, SKF 38393 also decreased NREM sleep and increased
wakefulness. C-E. SKF 38393 treatment decreased both the time spent in sleep attacks (C) and
attack frequency (D), but had no affect on sleep attack duration (E). F-H. SKF 38393 had no
affect on time spent in cataplexy (F) or on cataplexy frequency (G) or duration (H). * denotes
p<0.05 when compared to saline.
84
4.4.4 D2-like receptors modulate cataplexy but not sleep attacks
We administered quinpirole (0.125 and 0.5mg/kg) to activate D2-like receptors and
eticlopride (0.25 and 1mg/kg) to inactivate them, in order to determine if D2-like receptors
influence sleep and cataplexy. Neither high nor low doses of quinpirole affected amounts of
sleep or wakefulness (n=7; 2-way RM ANOVA, p=0.262; Figure 4.5A); these interventions also
had no effect on sleep attacks (RM ANOVA, p=0.357; Figure 4.5C-E). However, quinpirole had
potent effects on cataplexy. The highest dose (0.5mg/kg) increased the number of cataplexy
episodes by 172% above baseline levels (RM ANOVA, p=0.030; Figure 4.5G), without affecting
cataplexy duration (RM ANOVA, p=0.107; Figure 4.5H). Even though this dose increased the
total time spent in cataplexy by 174%, this effect was not statistically significant (RM ANOVA,
p=0.193; Figure 4.5F). Activation of D2-like receptors with a modest quinpirole dose
(0.125mg/kg) had no measurable effect on either the duration (RM ANOVA, p=0.058) or
frequency (RM ANOVA, p=0.931) of attacks.
Blockade of D2-like receptors with low doses (0.25mg/kg) of eticlopride decreased
wakefulness by 18% (n=7; 2-way RM ANOVA, p=0.026; Figure 4.6A), increased NREM sleep
by 90% (p=0.039), but had no effect on REM sleep (p=0.922). High doses of eticlopride
(1mg/kg) had no detectable effects on sleep-wake behavior in narcoleptic mice (2-way RM
ANOVA, p=0.366; Figure 4.6A). Even though high and low doses did not affect sleep attacks
(RM ANOVA, p=0.758; Figure 4.6C-E), they had robust suppressive effects on cataplexy.
Compared to saline treatment, high doses of eticlopride reduced the total time spent in cataplexy
by 97% (RM ANOVA, p=0.024; Figure 4.6D); this decrease was attributable to the 88%
reduction in the number of cataplectic attacks (RM ANOVA, p=0.029; Figure 4.6G). The
duration of cataplectic episodes was not affected by high doses (RM ANOVA, p=0.240; Figure
4.6H) even though episode duration was suppressed by 78% below baseline levels. Although
partial blockade of D2-like receptors by low eticlopride doses tended to suppress the frequency
(RM ANOVA, p=0.104; Figure 4.6G) and duration (RM ANOVA, p=0.240; Figure 4.6H) of
cataplectic episodes, these effects were not statistically significant.
Finally, we aimed to determine if effects of D2-like receptor manipulation on sleep-wake
behavior were similar in wildtype and orexin KO mice. In wildtype mice, neither quinpirole
(0.5mg/kg) nor eticlopride (1.0mg/kg) affected sleep-wake amounts (2-way RM ANOVA;
quinpirole: n=6, p=0.840; eticlopride: n=6, p=0.469; Figure 4.5B and Figure 4.6B). The
85
influence of D2-like receptor manipulation on sleep-wake behavior was similar in wildtype and
orexin KO mice (2-way ANOVA; quinpirole: p=0.849; eticlopride: p=0.366).
86
Figure 4.5: Activation of D2-like receptors increased cataplexy
A. Quinpirole (D2-like receptor agonist) had no affect on sleep-wake behavior in narcoleptic
mice. B. Quinpirole also had no affect on sleep-wake behavior in wildtype mice. C-E.
Quinpirole had no effect on the total time spent in sleep attacks (C) or on the frequency (D) or
duration of attacks (E). F-H. Quinpirole did not significantly increase the total time spent in
cataplexy (F), but at 0.5mg/kg it increased cataplexy frequency (G) without affecting duration
(H). * denotes p<0.05 when compared to saline.
87
Figure 4.6: Blockade of D2-like receptors decreased cataplexy
A. In narcoleptic mice, 0.25mg/kg of eticlopride (D2-like antagonist) increased NREM sleep and
decreased wakefulness, but at 1mg/kg it had no effect on sleep-wake behavior. B. Eticlopride
had no effect on sleep-wake behavior in wildtype mice. C-E. Eticlopride had no effect on the
total time spent in sleep attacks (C) or on the frequency (D) or duration of attacks (E). F-G.
Eticlopride (1mg/kg) decreased both the total time spent in cataplexy (F) and its frequency (G)
without affecting the duration of cataplectic episodes (H). * denotes p<0.05 when compared to
saline.
88
4.5 Discussion
We demonstrate that the dopaminergic system modulates cataplexy and sleep attacks in a
murine model of narcolepsy. Specifically, we showed that amphetamine suppresses both
cataplexy and sleep attacks, suggesting that dopamine transmission could modulate these
behaviors. We then showed that pharmacological activation of D2-like receptors triggers
cataplexy and blockade of these receptors suppresses it. Manipulation of D2-like receptors did
not influence sleep attacks. We also showed that activation and blockade of D1-like receptors
decreased and increased sleep attacks, respectively; however, manipulation of D1-like receptors
did not affect cataplexy. Our results suggest that dopamine transmission modulates cataplexy
and sleep attacks by different receptor mechanisms.
4.5.1 Amphetamine alleviates cataplexy and sleep attacks
We found that amphetamine suppressed cataplexy, sleep attacks and sleep. One
mechanism by which amphetamine may exert its effects is by modulating dopamine
transmission. Numerous studies show that systemic amphetamine application elevates dopamine
levels and it is hypothesized that this elevation underlies amphetamine’s arousal-promoting
effects (Sharp et al., 1987, Di Chiara and Imperato, 1988, Wisor et al., 2001). Indeed,
amphetamine and modafinil, both of which affect dopaminergic transmission, are clinically
effective treatments for sleepiness and sleep attacks (Nishino et al., 1998b, Scammell and
Matheson, 1998, Wisor et al., 2001).
Amphetamine-induced changes in dopamine levels may also contribute to the
suppression of cataplexy in narcoleptic mice. This assertion is supported by the fact that both
systemic amphetamine administration and direct manipulation of dopaminergic nuclei modulate
cataplexy in narcoleptic dogs (Shelton et al., 1995, Reid et al., 1996, Honda et al., 1999b, Okura
et al., 2004). However, because amphetamine also increases levels of both serotonin and
noradrenaline, it is possible that amphetamine-induced changes in cataplexy are mediated by
multiple monoaminergic systems (Rothman and Baumann, 2006). Indeed, clomipramine, a
tricyclic antidepressant that affects dopaminergic, noradrenergic and serotonergic transmission,
reduces cataplexy without affecting sleep attacks in orexin KO mice (Willie et al., 2003).
89
4.5.2 A D2-like receptor mechanism modulates cataplexy
This study showed that D2-like receptors play a significant role in regulating murine
cataplexy. Dopamine receptor modulation of cataplexy showed specificity for the D2-like
receptor as neither D1-like receptor activation nor blockade affected cataplexy even though D1
drugs have pronounced effects on sleep. A D2-like receptor mechanism has also been linked to
canine narcolepsy; Nishino et al. (1991) demonstrated that activation of D2-like receptors
increased cataplexy and blockade of these receptors decreased it in narcoleptic dogs (Nishino et
al., 1991). It is noteworthy that D2 drugs modulate cataplexy in both canine and murine
narcolepsy because canine narcolepsy results from an OX2R mutation, whereas the murine
model used here results from loss of orexin itself. This is an important observation because it
indicates that D2 drugs modulate cataplexy by an orexin-independent mechanism (Lin et al.,
1999). We suggest that D2 drugs exert their effects on dopamine cells themselves. This is
supported by the fact that D2-like receptor agonists promote cataplexy when applied directly
onto dopaminergic neurons (Reid et al., 1996, Honda et al., 1999b, Okura et al., 2004). D2 drugs
could act by manipulating auto-receptors on dopamine neurons to affect dopamine release, which
has been shown to affect behavioral arousal (Svensson et al., 1987, Westerink et al., 1990, Olive
et al., 1998). Changes in dopamine transmission could in turn affect the activity of
noradrenergic, serotonergic and cholinergic cells, which have been implicated in the regulation
of cataplexy (Mignot et al., 1993, Reid et al., 1994a, Reid et al., 1994b, Reid et al., 1994c,
Nishino et al., 1995a, Nishino et al., 1995b, Wu et al., 1999, Kalogiannis et al., 2010,
Kalogiannis et al., 2011).
4.5.3 A D1-like receptor mechanism modulates sleep attacks
This study confirms a role for dopaminergic neurotransmission in regulating sleep-wake
behavior. We showed that stimulation of D1-like receptors suppressed sleep attacks and
promoted wakefulness in orexin KO mice. Conversely, we demonstrated that blockade of
excitatory D1-like receptors not only triggered sleepiness by reducing the latency from
wakefulness to NREM sleep, it also increased NREM sleep amounts and sleep attacks. These
findings suggest that a dopaminergic drive acting on D1-like receptors stimulates wakefulness.
Wake-active dopamine cells in the ventral periaquaductal gray could be one source of this
excitatory drive because lesioning these dopamine cells increased sleep in rats (Lu et al., 2006a).
It is unlikely that dopamine-mediated suppression of sleep attacks and sleepiness acts on the
90
orexin system because 1) dopamine inhibits rather than excites wake-promoting orexin neurons
and 2) KO mice do not synthesize orexin (Li and van den Pol, 2005, Yamanaka et al., 2006).
This is also supported by the fact that modafinil’s wake-promoting effects are stronger in orexin
KO than wildtype mice (Willie et al., 2005).
There is evidence that D2-like drugs modulate sleep-wake behavior (Monti et al., 1988,
Monti et al., 1989, Nishino et al., 1991, Ongini et al., 1993). We confirmed that blockade of D2-
like receptors can influence sleep-wake amounts. However, we did not observe sleep-wake
effects with injection of a D2-like receptor agonist. Previous studies have shown that quinpirole
does not impact sleep-wake regulation in a monotonic dose-dependent fashion; instead, only low
(0.015mg/kg) or high (1mg/kg or greater) doses modulate sleep-wake behavior (Monti et al.,
1988). We used mid-range doses (0.125 and 0.5mg/kg) and therefore did not expect changes in
sleep-wake behaviors. Indeed, we used this approach to determine whether D2 drugs could
affect cataplexy independent of sleep-wake regulation. We found that D2 drugs can modulate
cataplexy with negligible effects on sleep and sleep attacks, while D1 drugs modulate sleep and
sleep attacks without affecting cataplexy. This observation illustrates that sleep attacks and
cataplexy are controlled by distinct mechanisms.
4.5.4 Physiological significance
Narcolepsy and REM sleep share some physiological and behavioral similarities, the
most salient example being the loss of postural muscle tone. This similarity has led to the
hypothesis that narcolepsy is a REM sleep disorder and that a faulty REM sleep mechanism
underlies cataplexy. However, we show that dopamine drugs can manipulate REM sleep and
cataplexy independently. Okura et al (2000) also show that D2 antagonists reduce cataplexy
without affecting REM sleep in narcoleptic dogs (Okura et al., 2000). Although REM sleep
atonia and cataplexy may be caused by the same mechanism (i.e., at the motor neuron level), our
data suggest that REM sleep and cataplexy are triggered by distinct mechanisms (Siegel et al.,
1991). Two other pieces of experimental data support this claim. First, Thankachan et al. (2009)
demonstrated that putative REM sleep-generating cells only discharge during REM sleep but
never during cataplexy in narcoleptic mice; and second, Nishino et al. (2000) showed in
narcoleptic dogs that REM sleep follows an ultradian rhythm whereas cataplexy does not
(Nishino et al., 2000, Thankachan et al., 2009).
91
As stated previously, it is impossible to discern where D2 drugs are acting to modulate
cataplexy. However, previous studies provide strong evidence that these drugs act at auto-
receptors on dopamine neurons in the VTA, SN and diencephalic dopamine nuclei (Svensson et
al., 1987, Meador-Woodruff et al., 1989, Westerink et al., 1990, Reid et al., 1996, Honda et al.,
1999a, Okura et al., 2004). By manipulating dopamine release from the VTA and SN, these
drugs could modulate cataplexy via projections (both direct and indirect) to downstream arousal-
related neurons (Luppi et al., 1995). For example: noradrenergic neurons cease firing during
cataplexy and, unlike dopamine neurons in the VTA and SN, project directly to spinal motor
neurons and REM sleep atonia-generating circuits (Luppi et al., 1995, Wu et al., 1999).
The A11, a diencephalic dopamine cell group, projects directly to motor neurons (Bjorklund
and Skagerberg, 1979, Lindvall et al., 1983, Skagerberg and Lindvall, 1985). This suggests that
D2 drugs could modulate cataplexy by manipulating dopamine release directly on motor neurons
(Skagerberg et al., 1982, Okura et al., 2004). Indeed our lab has demonstrated a role for
dopamine receptors on motor neurons in the maintenance of REM sleep atonia (JJ Fraigne, NA
Yee, and JH Peever unpublished data). A11 dopamine neurons also project to the pontine
region that generates muscle atonia during REM sleep (termed the SLD in rodents) (Boissard et
al., 2002, Lu et al., 2006b, Leger et al., 2010). Activity of A11 neurons suggests that they have a
role in inhibiting the SLD during waking (Leger et al., 2010). Therefore the presumptive
reduction in dopamine release from the A11 when a D2 receptor agonist is applied could both
disfacilitate motor neurons and disinhibit SLD neurons to promote cataplexy.
92
Chapter 5: Noradrenergic Regulation of
Cataplexy
93
Chapter 5: Noradrenergic Regulation of Cataplexy
5.1 Abstract
Narcolepsy is characterized by hypersomnolence and cataplexy, the loss of postural
muscle tone during waking. The neural mechanisms that trigger the decoupling of state and
appropriate muscle tone during cataplexy are unknown although it is hypothesized that cataplexy
is the intrusion of REM sleep atonia into wakefulness. Noradrenergic locus coeruleus neurons
cease firing during cataplexy. The correlation between cessation of neuron activity and loss of
muscle tone has lead to the hypothesis that withdrawal of noradrenergic excitation from motor
neurons (i.e. disfacilitation) underlies cataplexy-dependent muscle atonia. Here we establish a
role for the noradrenergic system in regulating murine cataplexy and directly test this hypothesis
by blocking and facilitating noradrenergic drive on motor neurons during cataplexy. We
demonstrate that there is a withdrawal of noradrenergic tone during cataplexy and this
withdrawal is necessary but not sufficient to induce complete muscle atonia. These data
demonstrate an important role for the noradrenergic system in cataplexy and suggest that it is
directly affecting motor neuron excitability and neural circuits upstream of motor neurons,
perhaps REM sleep atonia-generating brainstem regions, to cause cataplexy.
5.2 Introduction
Cataplexy, a symptom of the sleep disorder narcolepsy, is a motor pathology that is
characterized by the rapid, involuntary loss of postural muscle tone that interrupts normal waking
behaviors (Siegel and Boehmer, 2006). Cataplexy can last from seconds to minutes and can be
either mild and partially impair movement or severe and cause complete postural collapse.
Breakdown in the orexin system is linked to narcolepsy in humans, dogs, and mice; loss of
orexin cells, inability to produce orexin or dysfunctional orexin receptors can all result in
cataplexy (Chemelli et al., 1999, Peyron et al., 2000, Thannickal et al., 2000, Hara et al., 2001,
Hungs et al., 2001, Thannickal et al., 2003, Mochizuki et al., 2004, Blouin et al., 2005). While
cataplexy is thought to result from the intrusion of REM sleep atonia into wakefulness, the
specific neurochemical cue that silences motor neurons during cataplexy is unknown.
The noradrenergic system plays a key role in mediating cataplexy. Drugs that affect CNS
noradrenergic tone or noradrenergic receptors impact cataplexy in both humans and dogs with
94
narcolepsy (Babcock et al., 1976, Mignot et al., 1988b, a, Mignot et al., 1993, Nishino et al.,
1993, Moller and Ostergaard, 2009, Ahmed and Thorpy, 2010). High frequency optogenetic
manipulation of LC neurons in normal mice triggers behavioral arrests that mimic cataplexy
(Carter et al., 2010). Changes in noradrenergic cell activity are also tightly linked to cataplexy in
narcoleptic canines; LC neurons cease firing at cataplexy-onset, when muscle tone is lost (Wu et
al., 1999). As motor neurons express noradrenergic receptors and noradrenergic neurons both
project and provide an endogenous excitatory drive to motor neurons, it has been hypothesized
that withdrawal of noradrenergic drive to motor neurons could underlie the loss of muscle tone
during cataplexy (Fung and Barnes, 1987, Grzanna et al., 1987, Lai et al., 1989, Shao and Sutin,
1991, Kwiat and Basbaum, 1992, Larkman and Kelly, 1992, Fung et al., 1994, Wu et al., 1999,
Fenik et al., 2005b, Chan et al., 2006).
Here we use a mouse model of narcolepsy (Chemelli et al., 1999, Mochizuki et al., 2004)
to test directly whether the loss of noradrenergic input to motor neurons is responsible for
cataplexy. We first confirm a role for the noradrenergic system in murine cataplexy using
systemic pharmacology. By blocking and activating α1 adrenergic receptors directly on motor
neurons we show that loss of noradrenergic drive is not sufficient to induce cataplexy-dependent
muscle atonia. These data refute the hypothesis that withdrawal of noradrenergic drive from
motor neurons causes the loss of muscle tone during cataplexy; other sites where withdrawal of
noradrenaline could exert cataplexy-inducing affects are also discussed.
5.3 Methods
All procedures and experimental protocols were approved by the University of Toronto’s
animal care committee and were in accordance with the Canadian Council on Animal Care.
5.3.1 Animals
Mice were housed individually and maintained on a 12:12 light dark cycle with both food
and water available ad libitum. These experiments used 19 orexin KO male mice (age: 14.2 ±
0.8 weeks; mass: 28.2 ± 0.8g) on a C57BL/6 background. Mice were genotyped using PCR with
genomic primers 5'-GACGACGGCCTCAGACTTCTTGGG, 3'-
TCACCCCCTTGGGATAGCCCTTCC, and 5’-CCGCTATCAGGACATAGCGTTGGC (with
forward primers being specific for either wildtype or KO mice and the reverse primer being
common to both).
95
5.3.2 Surgical preparation
To implant EEG electrodes, EMG electrodes and a microdialysis guide cannula, sterile
surgery was performed under isoflurane anesthesia (1-2%). Effective depth of anesthesia was
determined by the abolition of the pedal withdrawal reflex. Body temperature was monitored
with a probe (TC-1000, CWE Inc., Ardmor, PA) and maintained at 37 ± 1ºC.
For microdialysis studies, mice were placed in a stereotaxic apparatus (Model 962, Kopf,
Los Angeles, CA). The skin was retracted to expose the skull surface. The skull was positioned
so that bregma and lamba were in the same horizontal plane. To implant a microdialysis probe
into the left trigeminal motor nucleus, a stereotaxic drill (Model 1471, Kopf) was used to drill a
~1mm hole 5.10 mm caudal and 1.37 mm lateral to bregma. A microdialysis guide cannula
(MD2255, BASi, West Lafayette, IN) was slowly lowered 4.0 mm below the skull surface by
stereotaxic manipulation and secured in place with dental cement (Ketac-cem, 3M, London,
ON).
EEG recordings were obtained using two stainless steel micro-screws (1mm anterior and
1.5mm lateral to bregma; 3mm posterior and 1.5mm lateral to bregma). EMG electrodes
consisted of multistranded stainless steel (AS131, Cooner Wire, Chatsworth, CA) wires that
were sutured onto neck and masseter muscles. All electrodes were attached to a micro-strip
connector (CLP-105-02-L-D, Electrosonic, Toronto, ON), which was affixed onto the animal’s
head with dental cement (Ketac-cem, 3M). Following surgery, mice were given 0.9% saline and
ketoprofen (3mg/kg; s.c.). Mice were individually housed in a sound-attenuated and ventilated
chamber for 9-12 days post surgery.
5.3.3 Experimental procedures for sleep and microdialysis studies
During experiments, animals were housed in a movement-responsive caging system that
eliminates the need for a commutator or liquid swivel (25cm height, 20cm diameter; Raturn;
BASi). This caging system was housed inside a sound-attenuated, ventilated, and illuminated
(lights on: 110 lux) chamber.
Sleep-wake state and muscle activity were recorded by attaching a lightweight cable to
the microstrip connector on the mouse’s head, which was connected to a Physiodata Amplifier
system (Grass 15LT, Astro Med, Brossard, QC). The EEG was amplified 1000 times and band-
pass filtered between 0.3 and 100 Hz. EMG signals were amplified 1000 times and band-pass
96
filtered between 30 Hz and 100 Hz. All electrophysiological signals were digitized at 1000Hz
(Spike 2 Software, 1401 Interface, CED Inc.), monitored and stored on a computer. Infra-red
video recordings were also captured and synchronized to the electrophysiological recordings.
A microdialysis probe was used to exogenously perfuse α1 noradrenergic receptor
modulators directly onto motor neurons. Under isoflurane anesthesia, the microdialysis stylet
was removed from the guide cannula, and a microdialysis probe (MD-2211, BASi) was lowered
into the left trigeminal motor nucleus. The microdialysis probe was connected to FEP teflon
tubing (inside diameter=0.12mm; Eicom, Japan), which was connected to a 1mL gastight syringe
(MDN-0100, BASi) via a zero dead-space liquid switch (UniSwitch Liquid Switch Syringe
Selector, BASi). The probe was continually perfused with filtered (0.2µm Nylon, Fisher
Scientific, Ottawa, ON) artificial cerebral spinal fluid (aCSF: 125mM NaCl, 5mM KCl, 24mM
NaHCO3, 2.5mM CaCl2, 1.25mM MgSO2) at a flow rate of 1ul/min with a syringe pump and
controller (MD-1001 and MD-1020, BAS).
Phenylephrine (Sigma Aldrich, Oakville, ON), an α1 receptor agonist, was prepared fresh
in aCSF immediately before each experiment. Terazosin (Sigma Aldrich), an α1 noradrenergic
receptor antagonist was prepared from a stock solution. For injection studies, drugs were diluted
with saline to the desired concentration (phenylephrine: 5 and 10mg/kg; terazosin: 5 and
10mg/kg). For microdialysis studies, drugs were diluted with aCSF to the desired concentration
(phenylephrine: 0.2mM, 1mM, 5mM; terazosin: 1mM) and filtered immediately before use. We
used these concentrations of phenylephrine and terazosin because previous data showed that they
can successfully affect motor neuron excitability during natural motor behaviors in rats (Chan et
al., 2006) (Mir and Peever, unpublished data).
97
Figure 5.1: Microdialysis probe insertion into the trigeminal motor nucleus
Probe insertion into the trigeminal motor nucleus allowed for focal perfusion of pharmacological
agents onto trigeminal motor neurons. Some of these motor neurons innervate the masseter
muscles. We then measured masseter EMG activity as our index of motor neuron excitability.
EEG screws were implanted in the skull to record neural activity. A headplug was affixed onto
the mouse’s head to allow recording of EEG and EMG.
98
5.3.4 Experimental paradigm
Mice were placed in a round plexi-glass cage and given 24 hours to habituate to this new
environment. After this period, mice were connected to the recording tether and given at least
another 48 hours to habituate to this condition before the injection procedures. A saline injection
was given on the first night after this period to habituate to systemic injections. All injections
(0.3mL i.p.) were given at the onset of the dark phase (i.e., 19:00) and drug doses were
randomized. Each mouse only received one injection per day and no more than five treatments
in total. As terazosin has a longer half life than phenylephrine, data were collected and analyzed
for 3 hours after phenylephrine administration and 6 hours after terazosin administration
(Hengstmann and Goronzy, 1982, Sonders, 1986).
To investigate noradrenaline’s role in regulating muscle tone during cataplexy, we
microdialyzed an α1 receptor agonist or antagonist into the left trigeminal motor pool. Before
this, mice were placed into the sleep recording chamber and tethered for EEG and EMG
recordings. Mice were given 48 hours to habituate to the recording environment before the
microdialysis probe was inserted. Under isoflurane anesthesia, the microdialysis probe was
inserted between 11:00-12:00 and aCSF was perfused. Perfusion of aCSF (for baseline
recordings) or candidate drugs (phenylephrine or terazosin) began at 19:00. Each drug was
applied continuously for 2-4 hours and an aCSF washout period followed every drug period.
Drugs were perfused during the dark phase (19:00-7:00) to maximize the amount of cataplexy
recorded.
5.3.5 Verification of probe location
We used three criteria to demonstrate that microdialysis probes were both functional and
located in the motor nucleus. First, we demonstrated that microdialysis probe insertion into the
motor nucleus induced a robust increase in only left masseter muscle EMG activity, without
affecting the EMG activity of the right masseter muscle. Second, at the end of experiments,
0.01mM α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA, a non-NMDA
receptor agonist; Tocris, Ellisville, MO) was perfused into the motor nucleus, which induced a
rapid and potent increase in basal levels of left masseter muscle tone without affecting right
masseter EMG activity. This result verified that: 1) motor neurons were viable and able to
99
respond to excitation; 2) microdialysis probes were functional at the end of each experiment;
and, 3) probes were located within the motor nucleus. Third, we used post-mortem histological
analysis to demonstrate that microdialysis probes were physically located within the motor
nucleus.
At the end of each experiment, mice were anesthetized via isoflurane and sacrificed. The
brain was removed and placed in 4% paraformaldehyde (in 0.1M PBS) for 24 hours and then
30% sucrose (in 0.1M PBS) for 48 hours. The brain was then frozen and sectioned in 40µm
slices using a microtome (SM2000R, Leica, Depew, NY). Brain sections were then mounted on
slides and dried before being stained with Neutral Red. Tissue sections were viewed using a
microscope (BX50Wi, Olympus, Center Valley, PA) and photographed (Q-color 3, Olympus).
The location of microdialysis probe lesion tracts were then plotted on a standardized stereotaxic
map of the mouse brainstem (Paxinos and Franklin, 2001).
5.3.6 Data analysis
We used both EEG and EMG signals (right masseter and neck muscles) as well as video
to identify five distinct behavioral states: active wake, quiet wake, NREM sleep, REM sleep,
and cataplexy. Active wake was characterized by high-frequency, low-voltage EEG signals
coupled with high levels of EMG activity. Quiet wake was characterized by high frequency, low
voltage EEG signals and the absence of overt motor activity. NREM sleep was characterized by
high amplitude, low frequency EEG signals and minimal EMG activity. REM sleep was
characterized by low amplitude, high frequency theta EEG activity and very low EMG levels
(i.e., REM sleep atonia) interspersed by periodic muscle twitches. Cataplexy was classified as a
sudden loss of muscle tone, in neck and right masseter muscles, following at least 40 seconds of
active waking and with a duration of at least 10 seconds. Sleep states were visually identified in
5 second epochs and scored in Spike 2 (CED) with the Sleepscore v1.01 script.
Raw EMG signals were full-wave rectified and quantified in arbitrary units (A.U.).
Average EMG activity for left and right masseter and neck muscle activity was quantified in 5
second epochs for each behavioral state. When noradrenergic agents were applied onto the left
trigeminal motor nucleus, EMG data were not analyzed for the first 15 minutes of perfusion
because the flow latency from the syringe to the microdialysis probe was 8-10 minutes. Each
mouse served as its own control.
100
Spectral analysis was performed using EEG Band Detect v1.06 in Spike 2. The EEG was
windowed using a Hamming function and subjected to a fast Fourier transform to yield the
power spectrum. The power within four frequency bands was recorded as absolute power and as
a percentage of the total power of the signal that was calculated over each 5-sec epoch. The band
limits used were (delta) 0.5-4 Hz, (theta) 4.25-8 Hz, 8.25-12 Hz and 12.25-16 Hz.
5.3.7 Statistical analysis
The statistical tests used for analysis are included in the text of the results section. All
statistical analyses were computed using SigmaStat (SPSS Inc., Chicago, IL) and applied a
critical α value of p<0.05. Data are presented as mean ± SEM.
5.4 Results
5.4.1 Focal activation of α1 receptors on trigeminal motor neurons
increased masseter EMG activity in freely behaving mice
To determine whether reverse-microdialysis of specific drugs is a useful technique for
investigating motor neuron excitability in freely behaving mice, as it has proven to be in rats, we
administered phenylephrine (PE) at concentrations of 0.2mM, 1.0mM and 5.0mM to wildtype
mice. PE increased muscle tone during quiet waking, NREM sleep and REM sleep. There was
no effect on muscle tone during active waking with any dose of the drug, likely because
endogenous noradrenergic drive is high during this state.
During quiet waking, PE increased left masseter muscle tone (p=0.011, one-way RM
ANOVA; n=9; Figure 5.2A) by 4.4 ± 5.5% (p=0.789), 9.1 ± 4.3 (p=0.507), and 23.6 ± 5.8%
(p=0.008) compared to baseline during perfusion of 0.2mM, 1.0mM and 5.0mM respectively;
however, this increase was only significant under the 5mM treatment. During NREM sleep, PE
increased left masseter muscle tone (p<0.001, one-way RM ANOVA; n=9) by 9.6 ± 3.1%
(p=0.102), 12.6 ± 3.8% (p=0.054), and 25.7 ± 6.0% (p<0.001) compared to baseline with
perfusion of 0.2mM, 1.0mM and 5.0mM, respectively. During REM sleep, PE increased left
masseter muscle tone (P<0.001, one-way RM ANOVA; n=9) by 7.3 ± 2.2% (p=0.157), 12.0 ±
2.6% (p=0.006), and 26.1 ± 2.6% (p<0.001) compared to baseline with perfusion of 0.2mM,
1.0mM and 5.0mM respectively. We did not see a significant increase in right masseter or neck
101
muscle tone during any behavioral state with application of PE at any concentration (Figure 5.2B
and C). Activation of α1 receptors on trigeminal motor neurons with PE increased masseter
muscle tone in freely behaving mice during quiet waking, NREM sleep and REM sleep. This
demonstrates that we can focally manipulate motor neuron excitability in freely behaving mice,
making this a useful model to study the effects of neurotransmitters on motor neurons during
specific motor behaviors, such as cataplexy.
102
Figure 5.2: Phenylephrine application increased muscle tone in freely behaving mice
A. Phenylephrine dose-dependently increased left masseter muscle tone during sleep and quiet
waking. B. Right masseter muscle tone was not affected by this intervention. C. Raw traces
demonstrating EEG and EMG (left and right masseter) activity with phenylephrine application. *
denotes p<0.05 when compared to saline.
103
5.4.2 Masseter muscles experienced atonia during cataplexy
Narcoleptic mice (n=8) had episodes of cataplexy throughout the recording period.
Cataplexy was characterized by abrupt behavioral arrest and postural collapse. During each
episode, EMG tone decreased while EEG activity remained wake-like. Immediately after
cataplexy, muscle tone returned to waking levels and mice resumed normal behaviors (Figure
5.3A). During a baseline 6-hour recording period, narcoleptic mice had an average of 3 ± 1
cataplectic episodes that lasted 66 ± 15s.
It is hypothesized that cataplexy results from the intrusion of REM sleep atonia into
waking. However, it is unknown if postural muscles experience atonia or if they simply have
reduced muscle tone during cataplexy. Therefore, we quantified levels of masseter and neck
muscle tone during cataplexy and REM sleep muscle atonia. We found that EMG tone rapidly
decreased at cataplexy onset and returned at cataplexy offset (n=8; RM ANOVA, p<0.01 for
both neck and masseter muscles; Figure 5.3B). Levels of both masseter and neck muscle tone
remained at levels comparable to REM sleep atonia during cataplexy (REM vs. cataplexy; paired
t-test, masseter: p=0.663, neck: p=0.202; Figure 5.3C and D). These results illustrate that
muscles experience atonia during cataplexy and that the trigeminal motor system is a good index
for determining how motor neurons are controlled during cataplexy.
104
Figure 5.3: Muscles experienced atonia during cataplexy
A. Example EEG and EMG (neck and masseter) traces showing loss of skeletal muscle tone
during an episode of cataplexy in a orexin knockout mouse. B. Group data showing that neck
and masseter muscle tone are lost during cataplectic attacks. EMG tone was maximal during
waking periods before and after each attack, but minimal during cataplexy. C. EEG and EMG
traces demonstrating that muscle tone reached similar levels during REM sleep and cataplexy.
D. Group data (n=8) showing that levels of muscle tone were comparable during REM sleep and
cataplexy. This observation demonstrates that masseter and neck muscles experience muscle
atonia during cataplexy. * indicates p<0.001; A.U., arbitrary units; values are plotted as means +
SEM.
105
5.4.3 Cataplexy is affected by changes in noradrenergic activity
Changes in noradrenergic tone influence cataplexy in narcoleptic humans and dogs
(Babcock et al., 1976, Mignot et al., 1988b, a, Mignot et al., 1993, Zaharna et al., 2010);
however, it is unknown if noradrenergic receptor manipulation also modulates cataplexy in
narcoleptic mice. To determine if a noradrenergic mechanism influences cataplexy, we injected
different doses of either an α1 receptor agonist (5 and 10mg/kg phenylephrine) or antagonist (5
and 10mg/kg terazosin). We found that stimulation of α1 receptors (a single 10mg/kg dose of
phenylephrine) reduced amounts of cataplexy by 90% (n=6; RM ANOVA, p=0.04; Figure 5.4A).
This decrease was caused by a 92% reduction in the number of cataplectic episodes (p=0.01,
Figure 5.4B); the duration of cataplexy episodes was unaffected by this intervention (p=0.33;
data not shown). Although 5mg/kg of phenylephrine reduced overall cataplexy amounts by 73%
and reduced the number of episodes by 67%, these reductions were not statistically significant
(n=6; RM ANOVA, p>0.05 for both variables; Figure 5.4A and B).
In contrast, we found that α1 receptor antagonism increased cataplexy. A single injection
of terazosin (10mg/kg) robustly increased the number of cataplectic episodes by 92% (n=6; RM
ANOVA, p=0.04; Figure 5.4D) despite having no significant effect on the total amount of time
spent in cataplexy (p=0.208; Figure 5.4C) or episode duration (p=0.13; data not shown). A
5mg/kg dose of terazosin had no effect on either the number or duration of cataplectic episodes
(n=6; RM ANOVA, p>0.05 for both variables; Figure 5.4D). These data indicate that systemic
changes in noradrenergic receptor activation affect cataplexy in mice.
106
Figure 5.4: Cataplexy is sensitive to changes in noradrenergic tone
A and B. Systemic administration of a α1 receptor agonist (5 and 10 mg/kg phenylephrine)
decreased cataplexy by reducing the number of cataplexy attacks. C and D. Systemic
administration of a α1 antagonist (5 and 10mg/kg terazosin) increased the number of cataplexy
attacks. * indicates p<0.05 ; values are plotted as means + SEM.
107
5.4.4 Drug manipulations targeted trigeminal motor neurons
Postmortem histology showed that all microdialysis probes (1 probe per mouse)
terminated in the left trigeminal motor pool (Figure 5.5A and B). We also showed that probe
insertion caused an immediate, but transient activation of only left masseter muscle tone (n=11;
RM ANOVA, p=0.003; Figure 5.5C). Right masseter muscle activity was not affected by this
intervention (RM ANOVA, p=0.144), indicating that probe insertion selectively influences
trigeminal motor neurons in the targeted motor pool. In addition, we perfused 0.01mM AMPA
at the end of experiments. AMPA application caused marked motor neuron activation that
increased left masseter EMG tone (n=7; paired t-test, p=0.03) without affecting right masseter
muscle activity (paired t-test, p=0.271; Figure 5.5D). We also wanted to determine if brain
regions surrounding the trigeminal motor pool were affected by drug interventions. The
sublaterodorsal nucleus (SLD) is located immediately adjacent (~0.2mm dorsomedial) to the
trigeminal motor pool and it plays a role in regulating REM sleep (Boissard et al., 2002, Boissard
et al., 2003, Lu et al., 2006b). Increased noradrenergic transmission at the SLD region has been
shown to suppress REM sleep (Crochet and Sakai, 1999b). Therefore we hypothesized that drug
application would not affect sleep and cataplexy if SLD function was unaffected.
Sleep-wake architecture was unaffected by manipulation of α1 receptors at the trigeminal
motor pool. Phenylephrine perfusion (1mM) did not influence amounts of REM sleep or NREM
in narcoleptic mice (aCSF vs. phenylephrine: 2-way RM ANOVA, p=0.124; Figure 5.6A).
However, this intervention did reduce EEG theta power during REM sleep in these mice (2-way
RM ANOVA, p=0.023; Figure 5.6B). Antagonism of α1 receptors by terazosin (1mM) perfusion
had no effect on either sleep-wake amounts (n=4; aCSF vs. terazosin: 2-way RM ANOVA,
p=0.069) or EEG spectral power during REM sleep (2-way RM ANOVA, p=0.611; Figure 5.6C
and D). We suggest that local REM-generating circuits are largely unaffected by noradrenergic
receptor manipulation at the trigeminal motor nucleus.
Because the SLD region is hypothesized to control the loss of muscle tone during
cataplexy, we also wanted to verify that drug manipulations did not affect amounts of cataplexy.
Phenylephrine perfusion had no effect on the total amount of time spent in cataplexy (paired t-
test, p=0.991; Figure 5.7A), nor did it affect the number (p=0.800) or duration (p=0.280) of
attacks (data not shown). This intervention also had no affect on EEG spectral power during
cataplexy (2-way RM ANOVA, p=0.939; Figure 5.7B). Similarly, terazosin application had no
108
effect on the total amount of cataplexy (paired t-test, p=0.471; Figure 5.7C) or the number
(p=0.270) or duration (p=0.440) of attacks (data not shown). It also did not influence EEG
spectral power during individual cataplectic attacks (2-way RM ANOVA, p=0.369; Figure
5.7D). Together, these findings indicate that drug manipulations at the trigeminal motor nucleus
had negligible impact on the cell systems triggering cataplexy.
109
Figure 5.5: Drug manipulations targeted trigeminal motor neurons
A. A histological example demonstrating the location of a microdialysis probe tract in the
trigeminal motor pool. B. Microdialysis probe locations in the left trigeminal motor pool in the
11 mice used in these studies. C. EMG traces from left (LM) and right masseter (RM) muscles
showing dialysis probe insertion into the left trigeminal nucleus caused a brief, but transient
increase in left masseter EMG tone. Group data showing that probe placement at the trigeminal
motor pool increased left masseter muscle tone. D. Left and right masseter EMG traces showing
that AMPA perfusion into the left motor pool potently increased left (but not right) masseter
EMG tone. Group data showing that this drug intervention significantly increases only left
masseter tone. Right masseter tone is unaffected by this manipulation, which indicates that drug
intervention preferentially targeted motor neurons in the left trigeminal motor pool. * indicates
p<0.05; A.U., arbitrary units; values are plotted as means + SEM.
110
Figure 5.6: Targeted drug manipulations did not affect sleep-wake architecture
A. Stimulation of adrenergic receptors (by phenylephrine perfusion) at the trigeminal motor pool
did not affect amounts of REM sleep, suggesting that adjacent REM generating circuits are
unaffected by this intervention. B. Group data showing the EEG theta power (plotted as % total
power) decreased during REM sleep during phenylephrine application. C. Terazosin perfusion
did not affect amounts of wakefulness, NREM or REM sleep. D. Group data showing that
terazosin perfusion at the trigeminal pool did not influence EEG power spectra during REM
sleep. * indicates p<0.05; values are plotted as means + SEM.
111
Figure 5.7: Targeted drug manipulations did not influence cataplexy
A. Compared to baseline, activation of α1 receptors (by phenylephrine perfusion) at the
trigeminal motor pool had no effect on cataplexy amounts. B. This intervention also had no
effect on EEG spectral power (plotted as % total power) during cataplectic attacks. C.
Antagonism of α1 receptors by terazosin perfusion at the trigeminal motor pool also had no effect
on amounts of cataplexy. D. This drug manipulation also had no affect on EEG spectral power
(plotted as % total power) during cataplectic attacks. These results indicate that noradrenergic
receptor manipulation at the trigeminal nucleus has no measureable influence on the neural
circuits that trigger cataplectic episodes. * indicates p<0.05; values are plotted as means + SEM.
112
5.4.5 Loss of noradrenergic drive to motor neurons is not sufficient for
triggering cataplexy
Since LC neurons stop firing during cataplexy in narcoleptic dogs, it has been
hypothesized that loss of noradrenergic drive to motor neurons underlies cataplexy. However, it
is unknown if changes in noradrenergic excitation of motor neurons actually contributes to
muscle atonia during cataplexy. Therefore, we aimed to determine: 1) if there is an endogenous
noradrenergic drive at the trigeminal motor pool during normal waking and 2) if loss of this
excitatory drive triggers cataplexy in narcoleptic mice.
First, we identified the presence of an endogenous noradrenergic drive onto trigeminal
motor neurons during normal periods of wakefulness. We found that antagonism of α1-
adrenergic receptors by terazosin perfusion (1mM) at the left trigeminal motor pool markedly
suppressed left masseter muscle tone during waking (n=4; p=0.03). Specifically, we showed that
receptor antagonism reduced waking masseter tone by 33% in the 30s period before cataplexy
and by 31% in the 30s period after cataplexy (paired t-test, before cataplexy: p=0.004; after
cataplexy: p=0.053; Figure 5.8A). However, this intervention had no effect on right masseter
activity (Figure 5.8B).
Second, we showed that noradrenergic drive onto trigeminal motor neurons was lost
during cataplexy episodes. Although α1 receptor antagonism significantly reduced left masseter
tone during periods of waking immediately preceding and following cataplectic attacks, this
same intervention had no effect on masseter muscle tone during cataplexy (p=0.210; Figure
5.8A). This observation suggests that noradrenergic excitation of motor neurons is negligible
during cataplexy.
Finally, we showed that loss of noradrenergic drive is not entirely responsible for
triggering muscle atonia during cataplexy. Although we found that α1 receptor blockade at the
trigeminal motor pool reduced masseter muscle tone during normal waking, it did not reduce
tone to the same levels that occurred during cataplexy (p=0.020; Figure 5.8C). Together, these
findings indicate that an endogenous noradrenergic drive maintains waking levels of masseter
tone; however, loss of this drive is not the only mechanism responsible for muscle atonia during
cataplexy.
113
Figure 5.8: Loss of noradrenergic drive contributes to muscle atonia during cataplexy
A. Waking levels of left masseter muscle tone are significantly reduced by α1 receptor
antagonism (terazosin) at the left trigeminal motor pool (n=4). However, this same intervention
had no effect on masseter muscle tone during cataplexy, demonstrating that the waking
noradrenergic drive is withdrawn during cataplexy. B. α1 receptor manipulation at the left
trigeminal motor pool affected left masseter muscle tone, but has no impact on right masseter
muscle tone. C. Antagonism of α1 receptors on trigeminal motor neurons (by terazosin perfusion)
reduced waking masseter muscle tone, but it did not lower it to cataplectic levels, indicating that
loss of noradrenergic drive is not the only mechanism triggering muscle atonia during cataplexy.
* indicates p<0.05; A.U., arbitrary units; values are plotted as means + SEM.
114
5.4.6 Restoration of noradrenergic activity increased muscle tone during
cataplexy
Our final goal was to determine if muscle atonia during cataplexy could be prevented by
restoring noradrenergic drive onto motor neurons. However, we first wanted to determine if
activating α1 receptors on motor neurons could prevent the natural loss of masseter tone during
sleep in orexin KO mice. Phenylephrine perfusion increased masseter tone by 30 ± 5% (n=9;
paired t-test, p=0.001) during NREM sleep and by 35 ± 9% during REM sleep in narcoleptic
mice (p=0.008; Figure 5.9A and B). These results demonstrate that loss of muscle tone during
sleep can be rescued by restoring noradrenergic drive to α1 receptors on motor neurons.
To determine if loss of noradrenergic drive underlies muscle atonia during cataplexy, we
pharmacologically restored this excitatory drive to motor neurons during cataplexy. We found
that activating α1 receptors at the left trigeminal motor pool increased left masseter tone and
prevented complete muscle atonia during cataplexy (n=9; aCSF vs. phenylephrine: paired t-test,
p=0.001; Figure 5.10A and B). Specifically, we found that receptor activation increased masseter
tone by 93 ± 33% above baseline cataplexy levels (p=0.001; Figure 5.10). In fact, phenylephrine
perfusion increased left masseter muscle tone to levels not significantly different from normal
waking (cataplexy baseline vs. cataplexy phenylephrine; 1-way ANOVA on Ranks, p>0.05;
Figure 5.10C), However, this targeted intervention had no effect on either right masseter (Figure
5.10B) or neck muscle tone (data not shown). Muscle atonia in both muscle groups remained
completely intact during cataplexy, illustrating that drug manipulation only influenced the
trigeminal motor nucleus, and not the circuitry regulating muscle atonia. Together, these results
show that restoration of noradrenergic drive to motor neurons significantly elevates muscle tone
during cataplexy.
115
Figure 5.9: Stimulating α1 receptors on motor neurons increased muscle tone during sleep
in orexin KO mice
A. EEG and EMG traces showing that stimulating α1 receptors at the trigeminal motor pool
increased masseter tone during both NREM (top trace) and REM (bottom trace) sleep in
narcoleptic mice. B. Group data (n=9) showing that phenylephrine perfusion is capable of
increasing masseter muscle tone during NREM and REM sleep in narcoleptic mice. * indicates
p<0.05; A.U., arbitrary units; values are plotted as means + SEM.
116
Figure 5.10: Activation of α1 receptors on motor neurons elevated muscle tone during
cataplexy
A. EEG and EMG traces showing that muscle tone is increased by restoring noradrenergic
activity at the left trigeminal motor pool. Compared to control (i.e., aCSF), phenylephrine
perfusion onto motor neurons in the left trigeminal nucleus prevented atonia in the left masseter
muscle during cataplexy, but atonia persists in right masseter and neck muscles. B. Group data
(n=9) showing that left masseter tone is significantly increased during cataplexy when
phenylephrine is perfused at the left trigeminal motor pool. C. Group data showing that
phenylephrine perfusion restored masseter muscle tone to near waking levels during cataplexy. *
indicates p<0.05; A.U., arbitrary units; values are plotted as means + SEM.
117
5.5 Discussion
The neural mechanisms and transmitter systems that underlie cataplexy remain unclear.
Withdrawal of activity of the noradrenergic system has been correlated with, but has not been
demonstrated to trigger, the loss of muscle tone during cataplexy (Wu et al., 1999). This study is
important because it establishes a direct link between the noradrenergic system and the loss of
muscle tone in cataplexy. We identified an endogenous noradrenergic drive during waking that
is withdrawn during cataplexy. We then demonstrated that muscle tone during cataplexy could
be increased by applying an exogenous excitatory noradrenergic drive to motor neurons. This
study is the first to directly test the hypothesis that withdrawal of noradrenergic drive to motor
neurons underlies the loss of muscle tone during cataplexy and establishes a functional role for
the noradrenergic system in the regulation of cataplexy in orexin KO mice.
5.5.1 The noradrenergic system regulates cataplexy
Using specific α1 receptor activation and blockade we established that the noradrenergic
system modulates cataplexy in narcoleptic mice. Systemic activation of α1 receptors
significantly reduced the severity of cataplexy. This finding is in agreement with previous
studies demonstrating that tricyclic antidepressants, which act in part via a noradrenergic
mechanism, are one of the most effective treatments for cataplexy in narcoleptic humans, dogs
and mice (Foutz et al., 1981, Mignot et al., 1993, Willie et al., 2003, Moller and Ostergaard,
2009, Ristanovic et al., 2009, Zaharna et al., 2010).
Systemically blocking α1 receptors in orexin KO mice increased the occurrence of
cataplexy. This finding suggests blockade or loss of noradrenergic drive promotes cataplexy.
Other studies support this concept, including the finding that rare cases of pontine lesions in
regions that include noradrenergic cells resulted in narcolepsy with cataplexy (D'Cruz et al.,
1994, Mathis et al., 2007). One particular noradrenergic area of interest is the LC because its
neurons cease firing during cataplexy in narcoleptic dogs (Wu et al., 1999). In addition, high-
frequency optogenetic stimulation of the LC, at frequencies thought to induce depolarization
block or depletion of noradrenaline, induces behavioral collapse similar to cataplexy (Carter et
al., 2010). Our data, along with these studies, indicate that loss of the noradrenergic system or
normal noradrenergic activity can lead to cataplexy or cataplexy-like states.
118
Recently, gene-replacement inducing orexin expression in the zona incerta was shown to
reduce narcolepsy symptoms in orexin-deficient mice (Liu et al., 2011a). The zona incerta
densely innervates the LC (Liu et al., 2011a). Orexinergic excitation of noradrenergic LC
neurons could be responsible for reducing the severity of cataplexy in these mice, suggesting that
increasing excitatory noradrenergic drive can reduce cataplexy. We show that restoring the drive
directly at the level of motor neurons can alleviate cataplexy in a single muscle group (i.e. restore
muscle tone during cataplexy); however this does not indicate that withdrawal of noradrenergic
drive from motor neurons is the primary cause of cataplexy-dependent muscle atonia.
5.5.2 Withdrawal of noradrenergic drive promotes cataplexy
The most direct evidence of a role for the noradrenergic system in cataplexy is the
finding that LC neurons cease firing during cataplexy in dogs (Wu et al., 1999). Parts of the
noradrenergic system project to both cranial and spinal motor pools (Grzanna et al., 1987,
Bruinstroop et al., 2011). Noradrenaline has been demonstrated to have an α1 receptor mediated
excitatory effect on motor neurons that ultimately increases muscle tone (Fung and Barnes, 1987,
Lai et al., 1989, Fung et al., 1991, Fenik et al., 2005b, Chan et al., 2006). The confluence of
these findings has led to the hypothesis that withdrawal of an excitatory noradrenergic drive to
motor neurons underlies the loss of muscle tone in cataplexy (Wu et al., 1999, Siegel and
Boehmer, 2006).
Our data confirm that a noradrenergic drive is not present during cataplexy and are the
first to demonstrate that the withdrawal of this drive accounts for some loss of muscle tone. We
observed an endogenous α1 receptor mediated noradrenergic drive during waking periods
preceding and following cataplexy. Blocking this drive on motor neurons during waking
resulted in a significant reduction in muscle tone, but did not induce full muscle atonia seen
during cataplexy. Therefore, the withdrawal of the endogenous noradrenergic drive from motor
neurons is only partially responsible for the loss of muscle tone during cataplexy.
It has been demonstrated that the LC and subcoeruleus noradrenergic neurons do not
project to motor neurons in great numbers. Recent data using genetically targeted tracing
demonstrated few projections from the LC directly to the spinal cord ventral horn in rats
(Bruinstroop et al., 2011). Importantly for our study, it was previously demonstrated that the LC
and subcoeruleus have few projections to the trigeminal motor nucleus in rats (Grzanna et al.,
119
1987). These data suggest that cessation of LC neuron activity would not trigger muscle atonia,
at least in rodents. In contrast, the A7 noradrenergic neurons send dense projections to both the
spinal cord ventral horn and trigeminal motor nucleus (Grzanna et al., 1987, Bruinstroop et al.,
2011). In addition, the A5 noradrenergic cells have been demonstrated to project to the
trigeminal motor nucleus (Grzanna et al., 1987). The activity of A5 and A7 neurons during
cataplexy is not known but cessation of these neurons may underlie the partial, noradrenergic
withdrawal-dependent muscle tone suppression we observed. Further investigation into the
activity of the different noradrenergic cell groups during sleep and cataplexy could help elucidate
the source of the waking noradrenergic drive to motor neurons.
5.5.3 Noradrenaline could act at REM sleep generating sites to
modulate cataplexy
The noradrenergic system could regulate cataplexy through direct projections to
brainstem areas that control REM sleep muscle atonia (Leger et al., 2009). Cataplexy and REM
sleep share many characteristic features, including the loss of muscle tone. This has led to the
hypothesis that cataplexy may be the intrusion of REM sleep atonia into wakefulness
(Rechtschaffen and Dement, 1967). Indeed, brainstem neurons that mediate the suppression of
muscle tone fire selectively during REM sleep and cataplexy in narcoleptic dogs (Siegel et al.,
1991).
The neural circuitry that controls muscle atonia during REM sleep in rodents has been
recently elucidated (Boissard et al., 2002, Boissard et al., 2003, Lu et al., 2006b). There are
REM sleep-suppressing regions in the pons that actively inhibit downstream REM sleep-
promoting systems that ultimately trigger muscle atonia (Boissard et al., 2002, Boissard et al.,
2003, Lu et al., 2006b). We propose that noradrenaline could act at excitatory α1 receptors on
REM sleep-suppressing regions and/or at inhibitory α2 receptors on REM sleep-promoting
systems to suppress muscle atonia during waking (Herbert and Saper, 1992, Crochet and Sakai,
1999a). In support of this, noradrenaline suppresses REM sleep when injected into REM sleep-
promoting regions in the cat (Crochet and Sakai, 1999a). Noradrenergic neurons in the
brainstem express Fos in a pattern consistent with the hypothesis that they act to inhibit REM
sleep-generating mechanisms; A1, A2, A5 and A7 neurons are Fos positive during REM sleep
120
deprivation, while only 2% of LC cells were active under the same conditions (Leger et al.,
2009).
It is clear that LC neurons are inhibited during both REM sleep and cataplexy (Wu et al.,
1999, Takahashi et al., 2010), but unclear if these neurons play any role in the loss of muscle
tone during these states. LC neurons are likely actively inhibited during REM sleep by
GABAergic projections from the dorsal paragigantocellular reticular nucleus (Nitz and Siegel,
1997, Verret et al., 2006), but could be inhibited by a different mechanism during cataplexy. A
recent study in humans demonstrated increased sympathetic nerve activity and blood pressure at
cataplexy-onset (Donadio et al., 2008). Increases in blood pressure reduce LC firing (Elam et al.,
1984, Murase et al., 1994), perhaps explaining the reduction of LC activity during cataplexy.
However, narcoleptic canines do not show elevated blood pressure during cataplexy (Siegel et
al., 1986) so further investigation of why LC neurons cease firing and whether this has a
functional role in cataplexy is required.
5.5.4 Other circuits involved in cataplexy
Numerous transmitter systems have been implicated in the regulation of cataplexy. Many
effective treatments for narcolepsy affect serotonin and dopamine systems in addition to
noradrenaline (Rothman et al., 2001, Leonard et al., 2004, Alexander et al., 2005, Wisor and
Eriksson, 2005, Moller and Ostergaard, 2009, Delucchi et al., 2010). Serotonin has been
demonstrated to have a negligible role, as systemic receptor modulators have little effect and unit
recording studies do not show remarkably different firing patterns during cataplexy (Nishino et
al., 1995a, Wu et al., 2004). Conversely, we have demonstrated that systemic modulation of the
dopaminergic system can affect cataplexy in orexin KO mice (Burgess et al., 2010); these results
are supported by previous findings in dogs, where both systemic and focal manipulation of
dopaminergic drive affects cataplexy most likely via a D2 auto-receptor mechanism (Nishino et
al., 1991, Reid et al., 1996, Honda et al., 1999b, Okura et al., 2000, Okura et al., 2004).
Acetylcholine, which has a well established role in the control of REM sleep, can modulate
cataplexy: work in narcoleptic dogs showed that increasing cholinergic drive systemically and
focally into pontine regions regulating REM sleep atonia can increase cataplexy (Reid et al.,
1994a, Reid et al., 1994b, Reid et al., 1994c); these findings have been recently reproduced and
built upon in narcoleptic mice (Kalogiannis et al., 2010, Kalogiannis et al., 2011). While our
121
data establish a role for noradrenergic drive in modulating cataplexy both systemically and at the
level of motor neurons, there are other transmitter systems that contribute to this phenomenon.
5.5.5 Conclusions
These data establish a functional role for the noradrenergic system in the regulation of
murine cataplexy. We demonstrated that withdrawal of noradrenergic excitation from motor
neurons contributes to, but is not solely responsible for the loss of muscle tone during cataplexy.
Evidence suggests that the loss of noradrenergic drive may also directly impact REM sleep
generating regions to induce muscle atonia. We propose that the suppression of monoaminergic
cell firing during cataplexy disfacilitates both motor neurons and REM sleep suppressing
regions, permitting muscle atonia during waking.
122
Chapter 6: Role for the Amygdala in Triggering
Cataplexy
Other researchers contributed to this work:
Takatoshi Mochizuki, PhD: Assisted with setting up counts for wheel running experiments.
Yo Oishi, PhD: Assisted with the anterograde tracing experiments.
Tom Scammell, MD: Assisted with experimental design.
123
Chapter 6: Role for the Amygdala in Triggering Cataplexy
6.1 Abstract
One of the most striking aspects of cataplexy is that it is usually triggered by strong,
positive emotions, but almost nothing is known about the neural pathways through which
positive emotions trigger muscle atonia. We hypothesized that the amygdala is necessary for
cataplexy because it contains neurons that are active during cataplexy and is thought to mediate
positive emotions. Using anterograde tracing in mice, we found that neurons in the amygdala
heavily innervate neurons in the LPT and vlPAG, brain areas that suppress muscle atonia. We
then found that bilateral, excitotoxic lesions of the amygdala (central and basolateral nuclei)
markedly reduced cataplexy in orexin KO mice, a mouse model of narcolepsy. These lesions did
not alter basic sleep-wake behavior, but substantially reduced cataplexy under baseline
conditions and when mice had access to running wheels and chocolate, conditions of high
arousal that should elicit positive emotions. These observations demonstrate that the amygdala is
a part of the underlying cataplexy circuitry and help generate a new model that explains how
positive emotions trigger cataplexy.
6.2 Introduction
Narcolepsy is caused by loss of the hypothalamic neurons that produce orexin
neuropeptides (Peyron et al., 2000, Thannickal et al., 2000). Loss of these cells or loss of just the
orexin peptides results in severe sleepiness and cataplexy, the sudden loss of postural muscle
tone during waking. In people with narcolepsy, cataplexy is most often triggered by positive
emotions such as those associated with laughter, joking, or delight (Overeem et al., 1999).
Similarly, in narcoleptic dogs, cataplexy is usually triggered by palatable food or play (Baker et
al., 1982, Siegel et al., 1989, Nishino et al., 1991), and in mouse models of narcolepsy, cataplexy
is increased by rewarding stimuli such as wheel running and palatable food (Espana et al., 2007,
Clark et al., 2009). This connection to positive emotions has been recognized as a key aspect of
cataplexy since its first description in 1880 (Gelineau, 1880), but the neural mechanisms through
which positive emotions trigger cataplexy remain unknown.
124
Several lines of evidence suggest that the amygdala could be a key site through which
emotions trigger cataplexy. There is clear evidence that the amygdala is important for responses
to positive stimuli in humans, non-human primates, and rodents. Activity increases in human
amygdala in response to positive affective stimuli, and amygdala neurons encode positive value
of conditioned images in non-human primates (Nishijo et al., 1988, Garavan et al., 2001). In rats,
amygdala neurons encode positive stimulus associations and amygdala lesioned rats failed to
approach stimuli of positive affective valence (Schoenbaum et al., 1998, Paton et al., 2006).
Anatomically, the amygdala is well-positioned to influence muscle tone and REM sleep
phenomena as the central nucleus of the amygdala in rats innervates regions in the pons that
regulate muscle atonia during REM sleep (Wallace et al., 1989, 1992). In addition, Gulyani and
colleagues recorded from the amygdala of freely behaving narcoleptic dogs and found a large
number of neurons with increased activity during cataplexy (Gulyani et al., 2002). These cells
often showed a sharp increase in firing at the onset of cataplexy and then a quick return to
baseline just as muscle tone recovered, suggesting they may be part of a cataplexy effector
mechanism.
Building on these observations, we hypothesized that the amygdala is necessary for
cataplexy. We first examined if the amygdala innervates regions of the pons that regulate muscle
atonia in mice. Then, to test whether the amygdala is functionally necessary for cataplexy, we
produced bilateral excitotoxic lesions of the amygdala in orexin KO mice and examined their
effect on cataplexy under conditions likely to elicit positive emotions.
6.3 Methods
These studies were approved by the Institutional Animal Care and Use Committees of
Beth Israel Deaconess Medical Center and Harvard Medical School and were carried out in
accordance with the National Institutes of Health Guide for the Care and Use of Laboratory
Animals.
6.3.1 Animals
We used 36 male, orexin KO mice, 12-22 weeks old and weighing 26-34g. Founder mice
were a kind gift from M. Yanagisawa (University of Texas Southwestern) and were then
backcrossed to C57BL/6J mice for over 10 generations. Mice were genotyped using PCR with
genomic primers 5’-GACGACGGCCTCAGACTTCTTGGG, 3’ –TCACCCCCTTGGGATAG
125
CCCTTCC, and 5’-CCGCTATCAGGACATAGCGTTGGC (with forward primers being
specific for either wildtype or KO mice and the reverse primer being common to both).
6.3.2 Surgery
We anesthetized mice with ketamine-xylazine (100 and 10 mg/kg i.p.) and placed them in
a stereotaxic alignment system (Model 1900, Kopf). Using an air pressure injection system and
glass micropipette (tip diameter ~10 um), we bilaterally injected ibotenic acid (5% in PBS; 25-50
nl injected over 3-5 min) into the area of the amygdala (1.35 mm posterior to bregma, ±2.75 mm
lateral, 4.5 mm ventral). To induce sham brain lesions, we microinjected the amygdalae of
control mice with an equal volume of sterile PBS.
We then implanted mice with electrodes for recording the EEG and EMG. In brief,
stainless steel screws were implanted for frontoparietal EEG recordings (1.5 mm lateral and 1
mm anterior to bregma; 1.5 mm lateral and 3 mm posterior to bregma). EMG electrodes were
made from fine, multi-stranded stainless steel wire (AS131, Cooner Wire, Chatsworth, CA),
which were sutured into the neck extensor muscles. All electrodes were attached to a micro-strip
connector affixed to the animal's head with dental cement. After surgery, mice were given 0.5
mL of 0.9% saline and meloxicam (5mg/kg; i.p.).
6.3.3 Experimental protocol
Two weeks after surgery, we transferred mice to recording cages in a sound-attenuated
chamber with a 12:12 light-dark cycle (30 lux daylight-type fluorescent tubes with lights on at
07:00), constant temperature (23 ±1°C), and with food and water available ad libitum. The
recording cable was attached to a low torque electrical swivel, fixed above the cages that allowed
free movement. Mice habituated to the cables for 4 days before the experiments began and
remained connected throughout the study.
We first examined baseline sleep-wake behavior across 24 hours with EEG, EMG and
infrared video recordings. We then studied mice under two conditions that should increase
cataplexy: access to a running wheel, and access to a running wheel and chocolate. We placed a
low-torque, polycarbonate running wheel (Fast-Trac, Bio-Serv, Frenchtown, NJ) in each cage
and recorded wheel rotations with a photodetector beneath each wheel. Running wheels increase
cataplexy in orexin KO mice (Espana et al., 2007), and this style of wheel was chosen because it
does not interfere with the EEG recording cable. After 7 days habituation to the wheel, we
126
recorded sleep-wake behavior and wheel rotations. The next night, we gave mice 3g of milk
chocolate (Hershey’s) at dark onset and recorded sleep-wake behavior and wheel running over
the next 12 hours (19:00-7:00). We chose to use chocolate because it is used as a reward in
rodent operant studies (Holahan et al., 2011, King et al., 2011), and cataplexy in mice and dogs
is increased by palatable foods (Siegel et al., 1986, Clark et al., 2009).
6.3.4 Data acquisition and analysis
EEG/EMG signals were acquired using Grass Model 12 amplifiers (West Warwick, RI)
and digitized at 256 Hz. Signals were digitally filtered (EEG: 0.3-30 Hz, EMG: 20-100 Hz) using
SleepSign (Kissei Comtec, Matsumoto, Japan). We manually scored behavior as wake, NREM
sleep, REM sleep, or cataplexy in 10s epochs. Behavior was scored as cataplexy based on the
consensus definition of murine cataplexy (Scammell et al., 2009). Specifically, if the mouse had
one or more epochs of muscle atonia accompanied by EEG theta that was preceded by at least
40s of active wakefulness and was also followed by wakefulness the period of atonia was scored
as cataplexy. Cataplexy was scored using both EEG/EMG as well as infrared video recordings.
6.3.5 Histology
After recordings, we anesthetized mice with ketamine-xylazine (100 and 10 mg/kg i.p.)
and transcardially perfused them with 0.1M PBS followed by 10% formalin. We postfixed
brains in formalin for 24 hours, and then cryoprotected them in 20% sucrose for ~48 hours. We
coronally sectioned brains at 40 microns in a 1:3 series using a microtome. We stained one
series with thionin and mapped the lesions on standard brain atlas maps (Paxinos and Franklin,
2001). Criteria for inclusion in the lesion group were symmetrical, bilateral lesions of the
amygdala that encompassed most of the central nucleus and basolateral nucleus of the amygdala
without much injury to adjacent structures. The largest lesions encompassed the entirety of the
amygdala while occasionally lesioning cells in the piriform cortex and ventral regions of the
caudate-putamen. There were no obvious observable behavioral differences between mice with
smaller vs. larger lesions.
We excluded mice that received off-target ibotenic acid injections resulting in
asymmetrical or unilateral lesions. In 6 of the excluded mice that had unilateral hit/unilateral
miss lesions, such that the total volume of lesioned area was similar to bilateral amygdala
lesioned mice, we still scored sleep-wake behavior and cataplexy. In these mice there was no
127
change in sleep-wake behavior or cataplexy when compared to control mice (p>0.05 for all
states).
6.3.6 Anterograde tracing
Under ketamine-xylazine anesthesia, we microinjected an adeno-associated viral vector
coding for green fluorescent protein (AAV-GFP; 20-50nl; serotype 8; 7x1012p/ml; Harvard Gene
Therapy Initiative) into the amygdala of wild type mice to anterogradely label projections. Two
to three weeks later, we perfused the mice and sliced brain sections as above. We immunostained
for GFP by washing sections in PBS with triton x (0.25%) and then incubating in primary
antiserum (Invitrogen at 1:20,000) for two days at room temperature. Sections were then washed
in PBS with triton x (0.25%) and incubated in biotinylated secondary antiserum (against rabbit
IgG, 1:1000, Vector) for two hours, washed and incubated in ABC reagents for two hours.
Sections were then washed again and incubated in solution of 0.06% 3,3-diaminobenzidine
tetrahydrochloride (DAB, Sigma).
6.3.7 Statistical analysis
Paired t-tests were used for comparisons within each group, and unpaired t-tests were
used for comparisons between groups. Comparisons of frequency, duration and total time spent
in each behavioral state between treatments were made using unpaired t-tests. All statistical
analyses were performed using SigmaStat (SPSS Inc.) and applied a critical 2-tailed α value of
p<0.05. Data are presented as mean ± standard error of the mean.
6.4 Results
6.4.1 The amygdala is anatomically well positioned to regulate cataplexy
The vlPAG and adjacent LPT are thought to be key sites for the suppression of muscle
atonia and REM sleep, as lesions of this region increase REM sleep and may permit muscle
atonia to occur outside of REM sleep (Lu et al., 2006b, Kaur et al., 2009). We found that
microinjection of the anterograde tracer AAV-GFP into the central nucleus of the amygdala
densely labeled projections to the vlPAG and LPT (n=3; Figure 6.1). In addition, we saw
innervations of the lateral hypothalamus, including putative orexin neurons (data not shown).
These tracing studies demonstrate that the CeA of mice has strong direct projections to
the vlPAG/LPT. In addition, the CeA neurons innervate the orexin neurons which send a
128
presumably excitatory projection to the vlPAG/LPT. These pathways are similar to those
previously described in rats and guinea pigs (Boissard et al., 2002, Fung et al., 2011), and
confirm that the amygdala is well positioned to integrate neuronal signals related to emotions and
relay them on to neurons regulating atonia.
6.4.2 Amygdala lesions reduced cataplexy under baseline conditions
Most bilateral lesions of the amygdala encompassed both the central and basolateral
nuclei, but lesions varied, with a few affecting only the CeA and several involving much of the
amygdala (Figure 6.2). Nine mice met criteria for acceptable bilateral lesions. Six other mice
had essentially unilateral lesions (unilateral hit/unilateral miss, such that the overall lesioned area
was approximately equal to bilateral lesion mice) and had normal amounts of cataplexy (data not
shown). Sham-lesioned control mice (n=8) showed no evidence of injury. Bilateral amygdala
lesions significantly reduced the amount of time spent in cataplexy during the dark period
(p=0.02, Figure 6.3A), with 28% fewer bouts of cataplexy (p<0.001) and a 30% decrease in the
average duration of cataplexy bouts (p<0.001). The lesions did not affect wake, NREM or REM
sleep parameters (Table 6.1).
6.4.3 Amygdala lesions decreased cataplexy triggered by a positive
stimulus
To determine whether the amygdala is necessary for cataplexy triggered by a positive
stimulus, we examined cataplexy and sleep-wake behavior in amygdala-lesioned orexin KO mice
with access to a running wheel (n=9). Lesioned mice spent 58% less time in cataplexy than
control mice (p=0.023; Figure 6.3B). The lesioned mice also had 52% fewer cataplexy bouts and
a 20% decrease in the average duration of cataplexy bouts, but these changes were not
statistically significant. Amygdala lesions had no effect on sleep-wake architecture in the
presence of a running wheel (Table 6.1). The lesioned mice had a slight decrease in total wheel
rotations (7375 ±2603 vs. 10877 ±2058 rotations, lesion vs. control, p=0.161).
129
Figure 6.1: The central nucleus of the amygdala projects to brainstem regions that regulate
REM sleep
Anterograde tracing from the central nucleus of the amygdala (CeA) showing observable
projections to the ventrolateral periaquaductal gray (vlPAG) and lateral pontine tegmentum
(LPT) in the mouse. These areas have been implicated in the regulation of muscle atonia during
REM sleep.
130
Figure 6.2: Excitotoxic lesions of the amygdala
Ibotenic acid injections successfully lesioned the CeA and often extended in the BLA. Drawings
are adapted from a mouse brain atlas (Paxinos and Franklin, 2001) and AP coordinates are
relative to bregma.
131
Figure 6.3: Amygdala lesions reduce cataplexy in orexin KO mice
A. Under baseline conditions, bilateral amygdala lesions decreased the total amount of cataplexy
compared to controls. This decrease was due to a reduction in the number of cataplexy bouts and
a shortening of bouts. B. Amygdala lesions also decreased the amount of cataplexy when mice
had access to running wheels (WR). C. Amygdala lesions reduced the amount of cataplexy and
the number of cataplexy bouts when mice had access to running wheels and chocolate (WR/Ch).
Data is from the 12 hour dark period. *, p<0.05; **, p<0.001 compared to sham-lesioned orexin
KO mice.
132
Table 6-1: Sleep-wake architecture in amygdala-lesioned mice
* denotes a significant difference from control (p<0.05)
Baseline Wheel Running
Wheel Running and Chocolate
Control Lesion Control Lesion Control Lesion
Wake
Percent (%)
65.2 ± 2.0 69.5 ± 2.4 78.4 ± 1.7 74.6 ± 3.0 90.1 ± 1.8 77.1 ± 3.1 *
Bout Number (#)
185 ± 16 173 ± 12 130 ± 11 140 ± 13 107 ± 15 156 ± 15 *
Mean Duration (s)
166 ± 21 183 ± 21 281 ± 28 264 ± 47 443 ± 69 259 ± 59
NREM
Percent (%)
28.8 ± 2.0 26.0 ± 2.3 16.8 ± 1.8 21.5 ± 2.8 4.4 ± 1.6 17.2 ± 2.8 *
Bout Number (#)
167 ± 17 162 ± 14 96 ± 13 123 ± 13 39 ± 12 114 ± 15 *
Mean Duration (s)
80 ± 8 68 ± 3 79 ± 7 72 ± 6 44 ± 6 60 ± 6
REM
Percent (%)
3.5 ± 0.4 3.8 ± 0.4 1.6 ± 0.3 2.5 ± 0.4 0.4 ± 0.2 2.8 ± 0.5 *
Bout Number (#)
25 ± 3 30 ± 6 13 ± 2 17 ± 3 4 ± 2 19 ± 4 *
Mean Duration (s)
61 ± 3 62 ± 7 55 ± 4 63 ± 5 38 ± 8 64 ± 5 *
Cata-plexy
Percent (%)
2.6 ± 0.4 1.3 ± 0.3 * 3.1 ± 0.5 1.3 ± 0.4 * 5.0 ± 0.6 2.9 ± 0.6 *
Bout Number (#)
18 ± 4 13 ± 2 * 33 ± 6 16 ± 3 67 ± 10 40 ± 8
Mean Duration (s)
66 ± 5 46 ± 5 * 40 ± 6 32 ± 4 34 ± 2 36 ± 2
133
6.4.4 Amygdala lesions decreased cataplexy triggered by a strong
positive stimulus
The combination of chocolate plus a running wheel dramatically increased cataplexy in
control orexin KO mice, in lesioned mice cataplexy was decreased by 42% compared to controls
under these conditions (n=9; p=0.021; Figure 6.3C). The lesioned mice had 40% fewer
cataplexy bouts (p=0.053), with no change in the duration of cataplexy bouts. The lesions did not
alter the amount of chocolate consumed (2.2 ±0.2g vs. 1.9 ±0.4g, lesion vs. control, p=0.368).
Though lesioned mice seemed to run less, this reduction was not statistically significant (9846
±3850 vs. 18627 ±2769 rotations, lesion vs. control, p=0.085). Control mice had a very strong
arousal response to chocolate plus running wheel, but this response was attenuated in the
lesioned mice. Control mice were awake 90% of the dark period, but lesioned mice only 77% of
the dark period, with proportionately greater amounts of NREM and REM sleep (p<0.05; Table
6.1).
Because our interventions affected wakefulness, and cataplexy can by definition only
occur during wake, we normalized percent and bouts of cataplexy to the percent of waking in
each animal. This would determine if the observed changes in cataplexy were due to the
interventions or were also a product of the changes in wakefulness. After normalizing for wake
time, amygdala lesions still significantly decreased the amount of cataplexy under baseline
(p=0.011; Figure 6.4) and wheel running (p=0.027) condition. Under wheel running with
chocolate conditions, there was a trend towards a decrease but it was no longer significant
(p=0.065).
134
Figure 6.4: Amygdala lesions reduced cataplexy in orexin KO mice even when accounting
for changes in wakefulness
A. Under baseline conditions, bilateral amygdala lesions decreased the total amount of cataplexy
compared to controls when normalized for the amount of waking. B. Amygdala lesions also
decreased the amount of cataplexy normalized to waking when mice had access to running
wheels (WR). C. Amygdala lesions reduced the amount of cataplexy normalized to waking when
mice had access to running wheels and chocolate, although this change was not significantly
different from control mice (WR/Ch). Data is from the 12 hour dark period. *, p<0.05 compared
to sham-lesioned orexin KO mice.
135
6.5 Discussion
This study establishes a functional role for the amygdala in the regulation of cataplexy.
We first confirmed that the amygdala is well situated to trigger muscle atonia in the mouse, as it
innervates brainstem regions known to regulate REM sleep muscle atonia. Ablating amygdala
neurons resulted in a significant decrease in the occurrence of cataplexy in orexin KO mice
compared to controls. Cataplexy-inducing stimuli, wheel running and chocolate were able to
increase cataplexy in lesioned mice, but the total amount of cataplexy was still reduced
compared to controls.
6.5.1 The amygdala is an important part of the cataplexy inducing
circuitry
Since Gelineau’s original description of narcolepsy in 1880, it has been clear that
cataplexy is often triggered by laughter, pleasant surprise, or other positive emotions (Gelineau,
1880). This has led to the hypothesis that the limbic system has a role in triggering cataplexy;
however few studies have investigated this link. Perhaps the most compelling evidence that
limbic areas are involved in cataplexy is the finding that amygdala activity is correlated with
cataplexy in narcoleptic dogs. There is a subpopulation of amygdala neurons that increase firing
at cataplexy onset and reduce firing when muscle tone is resumed (Gulyani et al., 2002). This
relationship between amygdala firing and muscle tone suggests that the amygdala is involved in
triggering cataplexy. Here we directly tested whether the amygdala is necessary for cataplexy to
occur, and demonstrated that an intact amygdala is necessary for the normal occurrence of
cataplexy in orexin KO mice.
It is possible that the amygdala elicits cataplexy through direct projections to REM sleep
atonia generating regions (Wallace et al., 1989, 1992, Fung et al., 2011). The brainstem circuitry
that regulates REM sleep atonia has been characterized in rodents, with REM sleep-off regions
in the pons (vlPAG/LPT) that inhibit a REM sleep-on region (SLD) (Boissard et al., 2002,
Boissard et al., 2003, Lu et al., 2006b). The SLD indirectly inhibits motor neurons, through
spinal interneurons and medullary pre-motor neurons causing muscle atonia (Boissard et al.,
2002, Lu et al., 2006b, Luppi et al., 2012). While these regions are thought to generate the
atonia associated with cataplexy as well, the mechanisms through which positive emotions could
trigger cataplexy have not been characterized (Luppi et al., 2011). The amygdala is implicated in
136
processing positive affective stimuli and we have demonstrated a direct link between the
amygdala and brainstem REM sleep-off regions (vlPAG/LPT) that could be responsible for
emotionally induced cataplexy, as well as the weakness that is associated with laughter even in
healthy patients (Overeem et al., 1999). Positive affect causes increased amygdala activity
(Paton et al., 2006, Straube et al., 2008, Ball et al., 2009, Bermudez and Schultz, 2010, Davey et
al., 2011). Therefore, in response to positive emotions, GABAergic neurons of the CeA could
inhibit vlPAG/LPT neurons in the pons, in turn disinhibiting the SLD and causing muscle atonia.
Alternatively, excitatory projections from the amygdala to the SLD have been demonstrated
(Boissard et al., 2003). Increased amygdala activity, in response to positive emotions, could also
excite SLD neurons and induce muscle atonia. These two mechanisms may act in concert to
trigger cataplexy through REM sleep atonia pathways (Figure 6.5).
Even large lesions of the amygdala did not abolish cataplexy in orexin KO mice, as
lesioned mice still demonstrated cataplexy and increased occurrence of cataplexy in response to
stimulating environments. This makes it unlikely that the amygdala is the sole source of
emotionally triggered cataplexy but is rather part of the cataplexy-generating circuitry, perhaps
as part of a relay from forebrain structures that process emotion (Brinley-Reed et al., 1995).
Recent findings demonstrate that transient inactivation of the prefrontal cortex, which innervates
the amygdala, in orexin KO mice reduced cataplexy (Y Oishi and TE Scammell, unpublished
data). We also cannot state for certain that reduced cataplexy was due to a disruption of positive
affect. Our data confirm past studies in showing that presumptive positive affective stimuli can
trigger cataplexy in mice (Espana et al., 2007, Clark et al., 2009), and this is certainly the case in
dogs and human patients (Gelineau, 1880, Siegel et al., 1989), but whether the amygdala is part
of this mechanism or part of a more general atonia-promoting system is unknown. Nevertheless,
we saw no change in REM sleep under baseline conditions suggesting we were not affecting a
REM sleep mechanism.
6.5.2 Interventions affected sleep-wake behavior
We found that both wheel running and wheel running with chocolate significantly
increased waking at the expense of NREM and REM sleep. Given the general sleepiness of
orexin KO mice and their inability to maintain long waking bouts (Chemelli et al., 1999,
Mochizuki et al., 2004) it is remarkable that control mice in the wheel running and chocolate
condition were awake for 90% of the dark period. It was previously reported that wheel running
137
can prolong waking in orexin KO mice (Espana et al., 2007), and the addition of chocolate seems
to further increase arousal. Chocolate contains several chemicals that could affect arousal,
though most have subtle effects or are quickly metabolized. Caffeine is present in chocolate and
has clear affects on arousal in mice (Okuro et al., 2010). A single bolus injection of caffeine in
orexin deficient mice significantly increased arousal, with a trend towards more cataplexy noted
in one study (Willie et al., 2003, Okuro et al., 2010). The average amount of caffeine the mice
would receive from the chocolate consumed in these experiments is equivalent to the 10mg/kg
bolus injection given previously, only under our paradigm it would be consumed over 12h
(Willie et al., 2003). Caffeine could have contributed to the increase in cataplexy we observed,
however it is unlikely that the stimulating effects accounted for the greater than 270% increase in
cataplexy over baseline and 100% increase over wheel running alone. We propose that wheel
running and chocolate, stimuli that rodents will work to obtain (Collier and Hirsch, 1971,
Porterfield and Stern, 1974, Holahan et al., 2011, King et al., 2011), are positive affective stimuli
that increase cataplexy.
138
Figure 6.5: Hypothesized model of the neural pathways through which positive emotions
trigger cataplexy
During normal wakefulness, neurons in the ventrolateral periaquaductal grey (vlPAG) and
adjacent lateral pontine tegmentum (LPT) inhibit neurons in the sublaterodorsal nucleus (SLD)
that generates atonia. Neurons in the central nucleus of the amygdala (CeA) could inhibit the
LPT/vlPAG whereas the orexin neurons have an excitatory influence. Positive emotions may
activate neurons in the CeA and the orexin neurons, but their inhibitory and excitatory influences
on the LPT/vlPAG are roughly balanced. Loss of orexin signaling in narcolepsy upsets this
balance, so that the amygdala can now produce lasting inhibition of the vlPAG/LPT, resulting in
cataplexy. (Green arrows represent excitatory projections; Red lines represent inhibitory
projections)
139
The amygdala plays a role in sleep-wake regulation, particularly changes in REM sleep
associated with emotional stimuli (Sanford et al., 2006, Liu et al., 2009, Liu et al., 2011b).
Studies investigating fear and stress in rodents, and using pharmacological silencing of the
amygdala, have observed that the amygdala functions to stimulate REM sleep (Sanford et al.,
2006, Liu et al., 2009). Here we showed that under baseline conditions lesions of the amygdala
had no affect on sleep. Under the wheel running and chocolate condition there was a significant
increase in both NREM and REM sleep compared to control non-lesioned mice. A previous
study in amygdala lesioned non-human primates also demonstrated increased sleep under
arousing conditions compared to controls (Benca et al., 2000). There are several factors that
could explain the differences observed with lesions vs. pharmacological silencing of the
amygdala including size of the affected area (i.e. whether the BLA was affected in addition to the
CeA), experimental paradigm (negative affective stimuli vs. positive/neutral environment) and
compensatory changes after lesions (many chronic manipulations of arousal related regions fail
to show changes in sleep-wake behavior after recovery (Blanco-Centurion et al., 2007)). It is
important to note that we observed significant change in cataplexy with minimal change in REM
sleep, suggesting the executive systems that regulate these behaviors may be different, with areas
that regulate emotional processing having a role in cataplexy but not REM sleep.
6.5.3 Conclusions
Positive emotions are the most reliable trigger of cataplexy. Here we identified a key part of
the cataplexy circuitry that could act to trigger cataplexy in response to positive emotions. The
amygdala could ultimately trigger the loss of muscle tone indirectly through brainstem areas that
regulate REM sleep muscle atonia. We hypothesize that an intact orexin system would act to
oppose the induction of muscle atonia by activating REM sleep-off regions in the pons. Further
investigation is required to elucidate the exact nature of how emotions trigger cataplexy,
particularly the role of other limbic structures and their projections to brainstem atonia-
generating regions.
140
Chapter 7: Discussion
141
Chapter 7: Discussion
7.1 Overview
In the time since the discovery of the orexin system, much has been elucidated about the
etiology, treatment and neurobiology of narcolepsy and cataplexy. However, important
questions remain, in particular what causes loss of orexin neurons, why emotion is a trigger of
cataplexy, and what transmitter systems mediate the loss of muscle tone during cataplexy. This
thesis addresses these latter two unanswered questions.
7.2 Cataplexy as a REM sleep phenomenon
Chapter 3 of this thesis further characterized the narcoleptic phenotype in orexin KO
mice and addressed whether REM sleep and cataplexy share a common neural mechanism.
Despite clear similarities (theta rich EEG, loss of muscle tone), recent evidence suggests that
cataplexy and REM sleep may be generated by different mechanisms (Chemelli et al., 1999,
Nishino et al., 2000, Thankachan et al., 2009, Burgess et al., 2010). Our data suggest that REM
sleep and cataplexy may share a common mechanism at the level of the motor neuron and
perhaps upstream at sites that generate REM sleep atonia but the executive mechanisms, those
that trigger each state, are different. This hypothesis is supported by our findings that muscles
are atonic during cataplexy, cataplexy is not induced by increasing REM sleep pressure, and that
potentially positive emotion-inducing stimuli can trigger cataplexy but supress REM sleep.
These data contribute to our general understanding of cataplexy and suggest that atonia can be
triggered by mechanisms separate from those regulating REM sleep.
7.3 Dopaminergic regulation of cataplexy
Chapter 4 of this thesis examined the role of the dopaminergic system in the regulation of
murine cataplexy. Dopaminergic drugs have a well-established role in regulating cataplexy in
canine narcolepsy, however this model results from a mutated receptor rather than absence of the
orexin ligand, therefore the role for dopamine was tested in narcoleptic mice (Nishino et al.,
1991, Reid et al., 1996, Honda et al., 1999a, Reilly, 1999, Okura et al., 2004). By manipulating
D1-like dopamine receptors, with systemic injections of a D1 agonist and antagonist, we
demonstrated that sleepiness and sleep attacks are mediated by a D1 receptor mechanism.
Conversely, a D2-like receptor agonist or antagonist given systemically could result in changes
142
in the expression of cataplexy with no change in sleep-wake architecture, suggesting that
cataplexy is mediated by a D2 receptor mechanism. This work establishes a role for different
dopamine receptor types in mediating different aspects of murine narcolepsy. These results
suggest that cataplexy-triggering circuits are not related to sleep-generating circuits and further
establishes the orexin KO mouse model as a useful tool for studying the underlying neural
circuitry regulating sleepiness and cataplexy.
It is not possible to state where these drugs are mediating their effects, however previous
studies provide evidence that D2 drugs may be acting at auto-receptors on DA neurons, affecting
endogenous dopaminergic tone (Westerink et al., 1990, Reid et al., 1996, Honda et al., 1999b,
Okura et al., 2004). This provides a number of possible mechanisms by which D2 drugs could
affect cataplexy. It was previously demonstrated that D2 receptor agonists applied to
diencephalic dopamine neurons (including the A11) can trigger cataplexy; these neurons, unlike
SN and VTA neurons, project directly to the spinal cord and could affect motor neuron
excitability directly (Skagerberg et al., 1982, Okura et al., 2004). Our lab has recently
demonstrated a key role for dopamine receptors on motor neurons in REM sleep atonia (N. Yee,
J. Fraigne, J. Peever, unpublished), suggesting that the dopaminergic effects seen here could be
at the level of the motor neuron (Figure 7.1). The A11 dopaminergic cells also project to the
atonia-generating cells in the SLD (Leger et al., 2010). Dopamine from these neurons could act
to oppose muscle atonia during waking (Leger et al., 2010). Loss of this dopaminergic drive
during waking could disinhibit SLD neurons, permitting the occurrence of cataplexy (Figure
7.1).
7.4 Noradrenergic regulation of cataplexy
Chapter 5 of this thesis examined the role for noradrenaline mediating cataplexy, both
systemically and focally at the level of the motor pool. Systemic application of drugs that affect
noradrenergic tone can modulate the occurrence of cataplexy in both human patients and canine
narcolepsy (Babcock et al., 1976, Schachter and Parkes, 1980, Foutz et al., 1981, Mignot et al.,
1988b, a, Mignot et al., 1989, Mignot et al., 1993, Zaharna et al., 2010). We used systemic
application of a noradrenergic receptor agonist and antagonist to determine whether the this
system had a role in mediating murine cataplexy. Application of an α1 receptor agonist
significantly reduced cataplexy in orexin KO mice, while antagonism resulted in a significant
increase in cataplexy. These results suggest that the noradrenergic system plays a role in
143
Figure 7.1: Dopaminergic control of cataplexy.
The A11 dopaminergic neurons have direct projections to motor neurons and the SLD that could
regulate cataplexy. An intact orexin system would rescue cataplexy-dependent muscle atonia.
(SLD, sublateral dorsal nucleus; VMM, ventral medial medulla; LPT, lateral pontine tegmentum;
vlPAG, ventrolateral periaquaductal gray)
144
regulating cataplexy in mice. Although it is difficult to determine what sites these drugs are
affecting, it is possible that they are exerting their effects on brainstem sites recently shown to
regulate REM sleep atonia, including the vlPAG/LPT (Figure 7.2).
Withdrawal of noradrenergic excitation from motor neurons is hypothesized to underlie
cataplexy-dependent atonia (Wu et al., 1999, Siegel and Boehmer, 2006); we investigated this
directly by applying noradrenergic receptor modulators onto motor neurons. Applying this
technique to orexin KO mice to investigate the neurochemical mechanisms that regulate atonia
during cataplexy demonstrated a role for the noradrenergic system at the level of the motor pool.
Antagonism of α1 receptors on trigeminal motor neurons decreased waking muscle tone,
suggesting that there is an endogenous noradrenergic excitatory drive to motor neurons during
wake. The same intervention during cataplexy had no effect on muscle tone, confirming that
there is no endogenous noradrenergic drive during episodes of cataplexy (Wu et al., 1999).
These data demonstrate that withdrawal of noradrenergic drive to motor neurons contributes to
the loss of muscle tone during cataplexy; however waking tone was not suppressed to cataplexy
levels. Therefore, withdrawal of noradrenaline is not sufficient to induce atonia during cataplexy
suggesting that other mechanisms are involved. These data confirm that withdrawal of
noradrenergic tone has a role in cataplexy, but refute the hypothesis that it is the primary cause of
cataplexy-dependent muscle atonia. As has recently been demonstrated with respect to REM
sleep atonia, it is likely that a combination of disfacilitation and inhibition of motor neurons
underlies the loss of muscle tone during cataplexy (Chase and Morales, 1990, Soja et al., 1991,
Kohlmeier et al., 1997, Morrison et al., 2003b, Fenik et al., 2005b, a, Chan et al., 2006, Brooks
and Peever, 2008, Burgess et al., 2008, Steenland et al., 2008, Brooks and Peever, 2011).
7.5 The role of the amygdala in triggering cataplexy
Chapter 6 of this thesis investigates the role of the amygdala in triggering cataplexy.
Positive emotions trigger cataplexy in humans, canines and mice, therefore the limbic system is
hypothesized to have a role in triggering cataplexy (Baker et al., 1982, Siegel et al., 1989, Siegel
and Boehmer, 2006, Espana et al., 2007, Clark et al., 2009). The amygdala has a role in
processing positive emotion and has been previously implicated in the regulation of cataplexy, as
145
Figure 7.2: Noradrenergic control of cataplexy.
The noradrenergic system (here expressed as a single nucleus for simplicity) modulates
cataplexy through projections to motor neurons and to pontine REM sleep-suppressing regions.
(SLD, sublateral dorsal nucleus; VMM, ventral medial medulla; LPT, lateral pontine tegmentum;
vlPAG, ventrolateral periaquaductal gray; NA, noradrenaline)
146
amygdala neuron firing is inversely related to muscle activity in narcoleptic canines (Gulyani et
al., 2002). In mice, injections of an anterograde tracer showed the amygdala projects to
brainstem regions regulating muscle atonia, where it could directly modulate muscle tone.
Bilateral ablation of the amygdala in orexin KO mice significantly reduced cataplexy, indicating
that the amygdala has a functional role in mediating this behavior. Amygdala lesions were
equally as successful at reducing cataplexy triggered by positive affective stimuli (wheel running
and chocolate) as during baseline conditions. However, even complete lesions of the amygdala
could not abolish cataplexy entirely, suggesting that either the amygdala mediates only specific
episodes of cataplexy or that there are multiple pathways/mechanisms that can trigger cataplexy.
In addition, it has recently been demonstrated that activation of the prefrontal cortex, an area
with projections to the amygdala, is important for the expression of cataplexy in orexin KO mice
(Y Oishi and TE Scammell, unpublished data). A possible mechanism by which amygdala
activation could trigger cataplexy is by relaying signals from the prefrontal cortex to brainstem
regions that regulate atonia, such as the vlPAG/LPT and SLD (Boissard et al., 2002, Lu et al.,
2006b, Fung et al., 2011) (Figure 7.3).
As mentioned previously, both the midbrain dopaminergic and brainstem noradrenergic
nuclei project to and have modulatory influences on the amygdala (Loughlin and Fallon, 1983,
Tanaka et al., 1991). Dopamine and noradrenaline release into different nuclei within the
amygdala can both modulate amygdala activity and the response of the amygdala to incoming
cortical and sensory inputs (Fendt et al., 1994, Rosenkranz and Grace, 2001, Schulz et al., 2002).
It is possible that the effects observed in Chapters 4 and 5 were in part mediated at the level of
the amygdala. In addition, the orexin neurons and the amygdala have reciprocal projections
(Peyron et al., 1998, Sakurai et al., 2005). The absence of the orexin system may cause an
imbalance in the monoaminergic-orexinergic-amygdala circuit that causes abnormal amygdala
responses after emotionally salient stimuli (as is observed in neuroimaging studies of human
patients) (Ponz et al., 2010a, Ponz et al., 2010b). This activation could then be transmitted
through the CeA to the brainstem, triggering the atonia-generating mechanisms discussed above.
147
Figure 7.3: Amygdaloid control of cataplexy
Positive emotions could trigger cataplexy via a PFC-amygdala-pontine mechanism. The
presence of the orexin system stabilizes this network preventing cataplexy. (SLD, sublateral
dorsal nucleus; VMM, ventral medial medulla; LPT, lateral pontine tegmentum; vlPAG,
ventrolateral periaquaductal gray; CeA, central nucleus of the amygdala; PFC, prefrontal cortex)
148
7.6 General model of the mechanisms underlying cataplexy
Data from the experiments detailed in this thesis, in addition to recent published studies
investigating narcolepsy, allow us update the model of the neural mechanisms regulating
cataplexy. Available evidence suggests the limbic system processes the incoming emotional
input and in turn may affect monoaminergic and cholinergic arousal related areas (Faull et al.,
1982, Mignot et al., 1988b, Reid et al., 1994a, Wu et al., 1999, Gulyani et al., 2002). These
brainstem arousal nuclei then modulate the activity of the REM sleep switch in the pons (Siegel
et al., 1991, Boissard et al., 2002, Boissard et al., 2003, Luppi et al., 2004, Lu et al., 2006b).
Ultimately these pontine areas inhibit motor neuron activity, causing the loss of muscle tone
(Boissard et al., 2002, Boissard et al., 2003, Lu et al., 2006a).
Adding to this simplified overview, we demonstrated that the amygdala has a functional
role in cataplexy and projects directly to brainstem regions that regulate atonia, where it could
act to trigger muscle atonia. We also demonstrate that the noradrenergic system, which projects
directly to motor neurons, has a role in the loss of muscle tone during cataplexy; other
monoaminergic systems could also contribute (Nygren and Olson, 1977, Skagerberg et al., 1982,
Westlund et al., 1983, Grzanna et al., 1987, Luppi et al., 1995, Sood et al., 2005, Chan et al.,
2006, Sood et al., 2006).
Regardless of the mechanisms involved, it is thought that in healthy individuals (those
with intact orexin systems) the excitatory drive from orexin neurons would oppose whatever
ultimately triggers cataplexy, and the orexin system is positioned to do this at multiple levels
(Peyron et al., 1998, Boissard et al., 2002, Boissard et al., 2003, Peever et al., 2003, Yamuy et
al., 2004, McGregor et al., 2005, Lu et al., 2006b, Siegel and Boehmer, 2006). This model of the
mechanisms underlying cataplexy incorporates existing findings and suggests important areas for
further research (Figure 7.4). This model differs from the previously proposed model discussed
in the introduction; the role of the dopamine system is no longer marginalized and the role of the
limbic system has been elaborated to include the demonstrated role of the amygdala.
Importantly, the work detailed in this thesis provides some of the few functionally defined
pathways through which cataplexy could be triggered.
The absence of orexin is an interesting and powerful perturbation of the systems
regulating sleep and motor control, one with widespread affects on multiple brain regions and
transmitter systems, and one that requires further investigation.
149
Figure 7.4: General schematic of cataplexy mechanisms
This represents an updated model of the mechanisms underlying the triggering of cataplexy.
This model incorporates findings from this thesis, including a functional role for the amygdala in
cataplexy, a more prominent role for the dopamine system, a role for catecholamines at the level
of the motor neuron, and the integration of the REM sleep flip-flop switch model. (NA,
noradrenaline; DA, dopamine; Ach, acetylcholine)
150
7.7 Limitations
This thesis elucidates several previously unexplored neural mechanisms that regulate
cataplexy. However, there are still several mechanisms that contribute to narcolepsy/cataplexy
that this thesis does not explore. Many brain regions and transmitter systems have been
implicated in narcolepsy/cataplexy: dopamine in the A9-13 (Reid et al., 1996, Honda et al.,
1999b, Okura et al., 2004), noradrenaline from the A6 (Wu et al., 1999), serotonin from the DR
(Nishino et al., 1995a), acetylcholine both in the LDT/PPT and BF (Reid et al., 1994a, Reid et
al., 1994b, Reid et al., 1994c, Nishino et al., 1995b, Kalogiannis et al., 2010, Kalogiannis et al.,
2011), histamine in the TMN (Mochizuki et al., 2011), orexin and MCH in the LH (Peyron et al.,
2000, Thannickal et al., 2000), and others. It was not possible to address the roles for each of
these transmitters in triggering cataplexy.
In addition, there are some methodological concerns that could be addressed. Systemic
injections are a useful tool for investigating drug effects on the whole brain and increase
translational potential, however it is impossible to determine exactly where the drug exerts its
effects. In these experiments we have partially addressed this by then focally manipulating
specific systems to determine where systemic drugs may be acting but there are many brain areas
where these drugs could exert effects. Of particular interest would be to apply drugs directly into
brainstem regions that regulate atonia, as has recently been done with drugs that affect
cholinergic tone (Kalogiannis et al., 2011).
Some of the techniques utilized lack specificity. Reverse microdialysis is a useful
technique for focally applying pharmacological agents into the brain; however, diffusion of
drugs makes spatial specificity an issue. The trigeminal motor nucleus is surrounded by a
network of pontine reticular formation interneurons that can modulate motor neuron excitability
(Bourque and Kolta, 2001); we cannot state for certain that the effects observed in our study
were not due to manipulation of these surrounding neurons rather than motor neurons
themselves. We took several measures to limit and control for spread of drugs into brain regions
that we did not intend to affect, including using small membrane probes (1mm tip, 220 micron
diameter) and demonstrating that behavior did not change (which would be expected if drugs
were diffusing into neighboring areas that affect behaviors such as sleep/wake). However,
techniques with greater spatial specificity would be advantageous.
151
The trigeminal-masseter motor system has several advantages for this type of study,
including size and accessibility of the motor pool. However, the trigeminal motor nucleus is a
cranial motor pool and it has been demonstrated that different mechanisms may regulate muscle
tone during sleep in cranial vs. spinal motor pools (Lu et al., 2006b, Vetrivelan et al., 2009,
Anaclet et al., 2010). Therefore, it is difficult to extrapolate our findings to all motor
neurons/muscles; fortunately many studies focused on elucidating the mechanisms responsible
for REM sleep atonia have focused on the trigeminal motor nucleus or other cranial motor nuclei
allowing us to make meaningful comparisons (Kohlmeier et al., 1997, Morrison et al., 2003a,
Peever et al., 2003, Fenik et al., 2005b, Chan et al., 2006, Brooks and Peever, 2008, Burgess et
al., 2008).
Excitotoxic lesions are specific to cell bodies within the area of injection and the glass
micropipette system used in these experiments is capable of injecting very small quantities,
making specific lesions possible, however ibotenic acid lesions are not specific to a single cell
type. Therefore, we cannot state with certainty that it is a specific type of neuron within the
amygdala that are responsible for the changes in behavior. Future experiments will be required
to parse out the details of this mechanism. The absence of orexin signaling in the brain affects
many systems, making elucidating the circuitry involved in triggering cataplexy difficult.
However, the progress made since mouse models have been available has been rapid and the
availability of techniques with greater temporal, spatial, and genetic specificity will further
improve our knowledge of this system.
7.8 Future directions
The noradrenergic and dopaminergic systems were chosen as the focus of this thesis
because there is ample evidence that they are involved in cataplexy. There are, however, other
brain regions that have been implicated in the regulation of cataplexy that were not investigated
in this thesis. The cholinergic and possibly serotonergic nuclei in the brainstem play a role in
murine cataplexy and could warrant investigation. Indeed, extensive investigation of the
cholinergic system and its role in murine cataplexy has been recently published (Kalogiannis et
al., 2010, Kalogiannis et al., 2011). It would also be useful to investigate some of the brain
regions that regulate REM sleep-dependent muscle atonia directly. While there is some debate
about how atonia is generated and the location of the atonia-generating neuron pools, one could
selectively manipulate these areas in narcoleptic animals and observe changes in cataplexy and
152
muscle tone (Boissard et al., 2002, Boissard et al., 2003, Lu et al., 2006b, Saper et al., 2010,
Luppi et al., 2011). Similarly the amygdala is not the only brain region implicated in emotion.
Many other areas have been implicated in reward, motivation, and emotion including the nucleus
accumbens, PFC, and VTA (Burgdorf and Panksepp, 2006, Boissy et al., 2007). As mentioned
previously, investigation of the role for the PFC has already yielded interesting results. In order
to better characterize the circuitry responsible for emotionally triggered cataplexy it would be
advantageous to lesion, stimulate or otherwise manipulate each of these systems.
Some of the techniques utilized in these studies lack both spatial and cellular specificity.
There are now techniques in neuroscience that are more selective and could be used in future
experiments to map out the circuitry responsible for cataplexy in a more detailed manner. One
could use viral-vectors to selectively express genes in specific neuron types, either to lesion cells
or to deliver genes such as channel-rhodopsin or Cre-recombinase (Adamantidis et al., 2010,
Gross, 2011, Jerome and Heck, 2011, Zeng and Madisen, 2012). Optogenetics, which utilizes
light to activate or inhibit specific cell types through a light gated ion channel, could be used to
manipulate a single neurotransmitter system, rather than stimulating a specific area, regardless of
the heterogeneity of the cell types there (Deisseroth, 2011). The Cre/lox system is another
technique that allows one to more selectively manipulate neurons; this technique has recently
been applied to address the question of how the histaminergic system regulates sleepiness in
narcoleptic mice (Mochizuki et al., 2011). Through selective manipulation of specific neuron
types, one could investigate the mechanisms involved in cataplexy without the concern of
affecting other brain areas or transmitter systems.
One could imagine a number of possible experiments using these techniques to investigate
some of the neurotransmitter systems that were not addressed in this thesis. For example, one
could cross floxed-ChAT mice with orexin KO mice, then microinject AAV-Cre into the
LDT/PPT region, thereby removing the ability of these neurons to generate and release
acetylcholine. Investigating the occurrence of cataplexy in these selective acetylcholine-depleted
mice would help elucidate the role that LDT/PPT cholinergic signaling has on cataplexy.
7.9 Summary
The findings presented in this thesis increase our understanding of the neurobiology of
cataplexy. Specifically this data sheds light on the underlying mechanisms that regulate
cataplexy, particularly the role of the noradrenergic system, dopaminergic system and the
153
amygdala. Using behavioral studies, systemic pharmacology, focal manipulation of motor
neurons, neuronal tracing techniques and lesions these results help elucidate the brain regions
and transmitter systems that trigger cataplexy in mice. The resulting model of how cataplexy is
triggered and atonia is generated, while incomplete, provides testable hypotheses for future
experiments.
154
References
Adamantidis A, Carter MC, de Lecea L (Optogenetic deconstruction of sleep-wake circuitry in the brain. Front Mol Neurosci 2:31.2010).
Adamantidis AR, Zhang F, Aravanis AM, Deisseroth K, de Lecea L (Neural substrates of awakening probed with optogenetic control of hypocretin neurons. Nature 450:420-424.2007).
Ahmed I, Thorpy M (Clinical features, diagnosis and treatment of narcolepsy. Clin Chest Med 31:371-381.2010).
Alexander M, Rothman RB, Baumann MH, Endres CJ, Brasic JR, Wong DF (Noradrenergic and dopaminergic effects of (+)-amphetamine-like stimulants in the baboon Papio anubis. Synapse 56:94-99.2005).
Amici R, Zamboni G, Perez E, Jones CA, Parmeggiani PL (The influence of a heavy thermal load on REM sleep in the rat. Brain Res 781:252-258.1998).
Anaclet C, Pedersen NP, Fuller PM, Lu J (Brainstem circuitry regulating phasic activation of trigeminal motoneurons during REM sleep. PLoS One 5:e8788.2010).
Arias-Carrion O, Murillo-Rodriguez E (Cell transplantation: a future therapy for narcolepsy? CNS Neurol Disord Drug Targets 8:309-314.2009).
Aston-Jones G, Smith RJ, Sartor GC, Moorman DE, Massi L, Tahsili-Fahadan P, Richardson KA (Lateral hypothalamic orexin/hypocretin neurons: A role in reward-seeking and addiction. Brain Res 1314:74-90.2010).
Babcock DA, Narver EL, Dement WC, Mitler MM (Effects of imipramine, chlorimipramine, and fluoxetine on cataplexy in dogs. Pharmacol Biochem Behav 5:599-602.1976).
Bagetta G, De Sarro G, Priolo E, Nistico G (Ventral tegmental area: site through which dopamine D2-receptor agonists evoke behavioural and electrocortical sleep in rats. Br J Pharmacol 95:860-866.1988).
Baier PC, Hallschmid M, Seeck-Hirschner M, Weinhold SL, Burkert S, Diessner N, Goder R, Aldenhoff JB, Hinze-Selch D (Effects of intranasal hypocretin-1 (orexin A) on sleep in narcolepsy with cataplexy. Sleep Med 12:941-946.2011).
Baker FC, Angara C, Szymusiak R, McGinty D (Persistence of sleep-temperature coupling after suprachiasmatic nuclei lesions in rats. Am J Physiol Regul Integr Comp Physiol 289:R827-838.2005).
Baker TL, Foutz AS, McNerney V, Mitler MM, Dement WC (Canine model of narcolepsy: genetic and developmental determinants. Exp Neurol 75:729-742.1982).
155
Ball T, Derix J, Wentlandt J, Wieckhorst B, Speck O, Schulze-Bonhage A, Mutschler I (Anatomical specificity of functional amygdala imaging of responses to stimuli with positive and negative emotional valence. J Neurosci Methods 180:57-70.2009).
Bardage C, Persson I, Ortqvist A, Bergman U, Ludvigsson JF, Granath F (Neurological and autoimmune disorders after vaccination against pandemic influenza A (H1N1) with a monovalent adjuvanted vaccine: population based cohort study in Stockholm, Sweden. BMJ 343:d5956.2011).
Baron-Cohen S, Ring HA, Bullmore ET, Wheelwright S, Ashwin C, Williams SC (The amygdala theory of autism. Neurosci Biobehav Rev 24:355-364.2000).
Bassetti CL, Baumann CR, Dauvilliers Y, Croyal M, Robert P, Schwartz JC (Cerebrospinal fluid histamine levels are decreased in patients with narcolepsy and excessive daytime sleepiness of other origin. J Sleep Res 19:620-623.2010).
Baxter MG, Murray EA (The amygdala and reward. Nat Rev Neurosci 3:563-573.2002).
Baxter MG, Parker A, Lindner CC, Izquierdo AD, Murray EA (Control of response selection by reinforcer value requires interaction of amygdala and orbital prefrontal cortex. J Neurosci 20:4311-4319.2000).
Benca RM, Obermeyer WH, Shelton SE, Droster J, Kalin NH (Effects of amygdala lesions on sleep in rhesus monkeys. Brain Res 879:130-138.2000).
Bermudez MA, Schultz W (Responses of amygdala neurons to positive reward-predicting stimuli depend on background reward (contingency) rather than stimulus-reward pairing (contiguity). J Neurophysiol 103:1158-1170.2010).
Berridge CW, Espana RA, Vittoz NM (Hypocretin/orexin in arousal and stress. Brain Res 1314:91-102.2010).
Berridge CW, Waterhouse BD (The locus coeruleus-noradrenergic system: modulation of behavioral state and state-dependent cognitive processes. Brain Res Brain Res Rev 42:33-84.2003).
Bjorklund A, Dunnett SB (Dopamine neuron systems in the brain: an update. Trends Neurosci 30:194-202.2007a).
Bjorklund A, Dunnett SB (Fifty years of dopamine research. Trends Neurosci 30:185-187.2007b).
Bjorklund A, Skagerberg G (Evidence for a major spinal cord projection from the diencephalic A11 dopamine cell group in the rat using transmitter-specific fluorescent retrograde tracing. Brain Res 177:170-175.1979).
Black J, Guilleminault C (Medications for the treatment of narcolepsy. Expert Opin Emerg Drugs 6:239-247.2001).
156
Black JL, 3rd, Krahn LE, Pankratz VS, Silber M (Search for neuron-specific and nonneuron-specific antibodies in narcoleptic patients with and without HLA DQB1*0602. Sleep 25:719-723.2002).
Blanco-Centurion C, Gerashchenko D, Shiromani PJ (Effects of saporin-induced lesions of three arousal populations on daily levels of sleep and wake. J Neurosci 27:14041-14048.2007).
Blouin AM, Thannickal TC, Worley PF, Baraban JM, Reti IM, Siegel JM (Narp immunostaining of human hypocretin (orexin) neurons: loss in narcolepsy. Neurology 65:1189-1192.2005).
Boissard R, Fort P, Gervasoni D, Barbagli B, Luppi PH (Localization of the GABAergic and non-GABAergic neurons projecting to the sublaterodorsal nucleus and potentially gating paradoxical sleep onset. Eur J Neurosci 18:1627-1639.2003).
Boissard R, Gervasoni D, Schmidt MH, Barbagli B, Fort P, Luppi PH (The rat ponto-medullary network responsible for paradoxical sleep onset and maintenance: a combined microinjection and functional neuroanatomical study. Eur J Neurosci 16:1959-1973.2002).
Boissy A, Manteuffel G, Jensen MB, Moe RO, Spruijt B, Keeling LJ, Winckler C, Forkman B, Dimitrov I, Langbein J, Bakken M, Veissier I, Aubert A (Assessment of positive emotions in animals to improve their welfare. Physiol Behav 92:375-397.2007).
Borbely AA (A two process model of sleep regulation. Hum Neurobiol 1:195-204.1982).
Bourque MJ, Kolta A (Properties and interconnections of trigeminal interneurons of the lateral pontine reticular formation in the rat. J Neurophysiol 86:2583-2596.2001).
Bowersox SS, Kilduff TS, Faull KF, Zeller-DeAmicis L, Dement WC, Ciaranello RD (Brain dopamine receptor levels elevated in canine narcolepsy. Brain Res 402:44-48.1987).
Brabec J, Rulseh A, Horinek D, Pala A, Guerreiro H, Buskova J, Petrovicky P, Nemcova V, Krasensky J, Seidl Z, Nimsky C, Sonka K (Volume of the amygdala is reduced in patients with narcolepsy - a structural MRI study. Neuro Endocrinol Lett 32:652-656.2011).
Braun CM, Pivik RT (Effects of brainstem lesions on tonic immobility in the rabbit (Oryctolagus cuniculus). Brain Res Bull 10:127-135.1983).
Brinley-Reed M, Mascagni F, McDonald AJ (Synaptology of prefrontal cortical projections to the basolateral amygdala: an electron microscopic study in the rat. Neurosci Lett 202:45-48.1995).
Brooks PL, Peever JH (Glycinergic and GABA(A)-mediated inhibition of somatic motoneurons does not mediate rapid eye movement sleep motor atonia. J Neurosci 28:3535-3545.2008).
157
Brooks PL, Peever JH (Impaired GABA and glycine transmission triggers cardinal features of rapid eye movement sleep behavior disorder in mice. J Neurosci 31:7111-7121.2011).
Bruinstroop E, Cano G, Vanderhorst VG, Cavalcante JC, Wirth J, Sena-Esteves M, Saper CB (Spinal projections of the A5, A6 (locus coeruleus), and A7 noradrenergic cell groups in rats. J Comp Neurol.2011).
Burgdorf J, Panksepp J (The neurobiology of positive emotions. Neurosci Biobehav Rev 30:173-187.2006).
Burgdorf J, Wood PL, Kroes RA, Moskal JR, Panksepp J (Neurobiology of 50-kHz ultrasonic vocalizations in rats: electrode mapping, lesion, and pharmacology studies. Behav Brain Res 182:274-283.2007).
Burgess C, Lai D, Siegel J, Peever J (An endogenous glutamatergic drive onto somatic motoneurons contributes to the stereotypical pattern of muscle tone across the sleep-wake cycle. J Neurosci 28:4649-4660.2008).
Burgess CR, Tse G, Gillis L, Peever JH (Dopaminergic regulation of sleep and cataplexy in a murine model of narcolepsy. Sleep 33:1295-1304.2010).
Buscher R, Herrmann V, Insel PA (Human adrenoceptor polymorphisms: evolving recognition of clinical importance. Trends Pharmacol Sci 20:94-99.1999).
Card JP, Riley JN, Moore RY (The motor trigeminal nucleus of the rat: analysis of neuronal structure and the synaptic organization of noradrenergic afferents. J Comp Neurol 250:469-484.1986).
Carlander B, Eliaou JF, Billiard M (Autoimmune hypothesis in narcolepsy. Neurophysiol Clin 23:15-22.1993).
Carter ME, Yizhar O, Chikahisa S, Nguyen H, Adamantidis A, Nishino S, Deisseroth K, de Lecea L (Tuning arousal with optogenetic modulation of locus coeruleus neurons. Nat Neurosci 13:1526-1533.2010).
Cason AM, Smith RJ, Tahsili-Fahadan P, Moorman DE, Sartor GC, Aston-Jones G (Role of orexin/hypocretin in reward-seeking and addiction: implications for obesity. Physiol Behav 100:419-428.2010).
Chan E, Steenland HW, Liu H, Horner RL (Endogenous excitatory drive modulating respiratory muscle activity across sleep-wake states. Am J Respir Crit Care Med 174:1264-1273.2006).
Chase MH, Morales FR (The atonia and myoclonia of active (REM) sleep. Annu Rev Psychol 41:557-584.1990).
Chemelli RM, Willie JT, Sinton CM, Elmquist JK, Scammell T, Lee C, Richardson JA, Williams SC, Xiong Y, Kisanuki Y, Fitch TE, Nakazato M, Hammer RE, Saper CB, Yanagisawa
158
M (Narcolepsy in orexin knockout mice: molecular genetics of sleep regulation. Cell 98:437-451.1999).
Chen L, McKenna JT, Bolortuya Y, Winston S, Thakkar MM, Basheer R, Brown RE, McCarley RW (Knockdown of orexin type 1 receptor in rat locus coeruleus increases REM sleep during the dark period. Eur J Neurosci 32:1528-1536.2010).
Chiou LC, Lee HJ, Ho YC, Chen SP, Liao YY, Ma CH, Fan PC, Fuh JL, Wang SJ (Orexins/hypocretins: pain regulation and cellular actions. Curr Pharm Des 16:3089-3100.2010).
Chou TC, Lee CE, Lu J, Elmquist JK, Hara J, Willie JT, Beuckmann CT, Chemelli RM, Sakurai T, Yanagisawa M, Saper CB, Scammell TE (Orexin (hypocretin) neurons contain dynorphin. J Neurosci 21:RC168.2001).
Clarenbach P (Parkinson's disease and sleep. J Neurol 247 Suppl 4:IV/20-23.2000).
Clark EL, Baumann CR, Cano G, Scammell TE, Mochizuki T (Feeding-elicited cataplexy in orexin knockout mice. Neuroscience 161:970-977.2009).
Collier G, Hirsch E (Reinforcing properties of spontaneous activity in the rat. J Comp Physiol Psychol 77:155-160.1971).
Commissiong JW, Hellstrom SO, Neff NH (A new projection from locus coeruleus to the spinal ventral columns: histochemical and biochemical evidence. Brain Res 148:207-213.1978).
Crochet S, Sakai K (Alpha-2 adrenoceptor mediated paradoxical (REM) sleep inhibition in the cat. Neuroreport 10:2199-2204.1999a).
Crochet S, Sakai K (Effects of microdialysis application of monoamines on the EEG and behavioural states in the cat mesopontine tegmentum. Eur J Neurosci 11:3738-3752.1999b).
Crocker A, Espana RA, Papadopoulou M, Saper CB, Faraco J, Sakurai T, Honda M, Mignot E, Scammell TE (Concomitant loss of dynorphin, NARP, and orexin in narcolepsy. Neurology 65:1184-1188.2005).
D'Cruz OF, Vaughn BV, Gold SH, Greenwood RS (Symptomatic cataplexy in pontomedullary lesions. Neurology 44:2189-2191.1994).
Dahlstroem A, Fuxe K (Evidence for the Existence of Monoamine-Containing Neurons in the Central Nervous System. I. Demonstration of Monoamines in the Cell Bodies of Brain Stem Neurons. Acta Physiol Scand Suppl SUPPL 232:231-255.1964).
Dahlstroem A, Fuxe K, Olson L, Ungerstedt U (Ascending Systems of Catecholamine Neurons from the Lower Brain Stem. Acta Physiol Scand 62:485-486.1964).
Dahlstrom A, Fuxe K (Localization of monoamines in the lower brain stem. Experientia 20:398-399.1964).
159
Darke PG, Jessen V (Narcolepsy in a dog. Vet Rec 101:117-118.1977).
Dauvilliers Y, Montplaisir J, Cochen V, Desautels A, Einen M, Lin L, Kawashima M, Bayard S, Monaca C, Tiberge M, Filipini D, Tripathy A, Nguyen BH, Kotagal S, Mignot E (Post-H1N1 narcolepsy-cataplexy. Sleep 33:1428-1430.2010).
Davey CG, Allen NB, Harrison BJ, Yucel M (Increased amygdala response to positive social feedback in young people with major depressive disorder. Biol Psychiatry 69:734-741.2011).
de Lecea L, Kilduff TS, Peyron C, Gao X, Foye PE, Danielson PE, Fukuhara C, Battenberg EL, Gautvik VT, Bartlett FS, 2nd, Frankel WN, van den Pol AN, Bloom FE, Gautvik KM, Sutcliffe JG (The hypocretins: hypothalamus-specific peptides with neuroexcitatory activity. Proc Natl Acad Sci U S A 95:322-327.1998).
Deadwyler SA, Porrino L, Siegel JM, Hampson RE (Systemic and nasal delivery of orexin-A (Hypocretin-1) reduces the effects of sleep deprivation on cognitive performance in nonhuman primates. J Neurosci 27:14239-14247.2007).
Deisseroth K (Optogenetics. Nat Methods 8:26-29.2011).
Delucchi L, Martino P, Baldovino A, Pessina P, Rodrigues A (Use of venlafaxine in the treatment of a canine narcolepsy-cataplexy case. J Small Anim Pract 51:132.2010).
Di Chiara G, Imperato A (Drugs abused by humans preferentially increase synaptic dopamine concentrations in the mesolimbic system of freely moving rats. Proc Natl Acad Sci U S A 85:5274-5278.1988).
Dolenc-Grosel L, Vodusek DB (The importance of HLA DQB1*0602 typing in Slovene patients with narcolepsy. Cell Mol Biol Lett 7:359-360.2002).
Donadio V, Plazzi G, Vandi S, Franceschini C, Karlsson T, Montagna P, Vetrugno R, Bugiardini E, Mignot E, Liguori R (Sympathetic and cardiovascular activity during cataplexy in narcolepsy. J Sleep Res 17:458-463.2008).
Eaton MJ, Wagner CK, Moore KE, Lookingland KJ (Neurochemical identification of A13 dopaminergic neuronal projections from the medial zona incerta to the horizontal limb of the diagonal band of Broca and the central nucleus of the amygdala. Brain Res 659:201-207.1994).
Eisensehr I, Linke R, Tatsch K, von Lindeiner H, Kharraz B, Gildehaus FJ, Eberle R, Pollmacher T, Schuld A, Noachtar S (Alteration of the striatal dopaminergic system in human narcolepsy. Neurology 60:1817-1819.2003).
Elam M, Yao T, Svensson TH, Thoren P (Regulation of locus coeruleus neurons and splanchnic, sympathetic nerves by cardiovascular afferents. Brain Res 290:281-287.1984).
Erickson JD, Eiden LE, Hoffman BJ (Expression cloning of a reserpine-sensitive vesicular monoamine transporter. Proc Natl Acad Sci U S A 89:10993-10997.1992).
160
Espana RA, McCormack SL, Mochizuki T, Scammell TE (Running promotes wakefulness and increases cataplexy in orexin knockout mice. Sleep 30:1417-1425.2007).
Espana RA, Reis KM, Valentino RJ, Berridge CW (Organization of hypocretin/orexin efferents to locus coeruleus and basal forebrain arousal-related structures. J Comp Neurol 481:160-178.2005).
Faull KF, Barchas JD, Foutz AS, Dement WC, Holman RB (Monoamine metabolite concentrations in the cerebrospinal fluid of normal and narcoleptic dogs. Brain Res 242:137-143.1982).
Fendt M, Koch M, Schnitzler HU (Amygdaloid noradrenaline is involved in the sensitization of the acoustic startle response in rats. Pharmacol Biochem Behav 48:307-314.1994).
Fenik V, Davies RO, Kubin L (Combined antagonism of aminergic excitatory and amino acid inhibitory receptors in the XII nucleus abolishes REM sleep-like depression of hypoglossal motoneuronal activity. Arch Ital Biol 142:237-249.2004).
Fenik VB, Davies RO, Kubin L (Noradrenergic, serotonergic and GABAergic antagonists injected together into the XII nucleus abolish the REM sleep-like depression of hypoglossal motoneuronal activity. J Sleep Res 14:419-429.2005a).
Fenik VB, Davies RO, Kubin L (REM sleep-like atonia of hypoglossal (XII) motoneurons is caused by loss of noradrenergic and serotonergic inputs. Am J Respir Crit Care Med 172:1322-1330.2005b).
Ferry B, Roozendaal B, McGaugh JL (Role of norepinephrine in mediating stress hormone regulation of long-term memory storage: a critical involvement of the amygdala. Biol Psychiatry 46:1140-1152.1999).
Foutz AS, Delashaw JB, Jr., Guilleminault C, Dement WC (Monoaminergic mechanisms and experimental cataplexy. Ann Neurol 10:369-376.1981).
Fraigne JJ, Orem JM (Phasic motor activity of respiratory and non-respiratory muscles in REM sleep. Sleep 34:425-434.2011).
Franceschini C, Ferri R, Pizza F, Ricotta L, Vandi S, Detto S, Poli F, Pruneti C, Mazzetti M, Cipolli C, Lugaresi E, Plazzi G (Motor events during REM sleep in patients with narcolepsy-cataplexy: a video-polysomnographic pilot study. Sleep Med 12 Suppl 2:S59-63.2011).
Fujiki N, Yoshida Y, Ripley B, Mignot E, Nishino S (Effects of IV and ICV hypocretin-1 (orexin A) in hypocretin receptor-2 gene mutated narcoleptic dogs and IV hypocretin-1 replacement therapy in a hypocretin-ligand-deficient narcoleptic dog. Sleep 26:953-959.2003).
Fumagalli F, Jones S, Bosse R, Jaber M, Giros B, Missale C, Wightman RM, Caron MG (Inactivation of the dopamine transporter reveals essential roles of dopamine in the
161
control of locomotion, psychostimulant response, and pituitary function. Adv Pharmacol 42:179-182.1998).
Fung SI, Chan JY, Manzoni D, White SR, Lai YY, Strahlendorf HK, Zhuo H, Liu RH, Reddy VK, Barnes CD (Cotransmitter-mediated locus coeruleus action on motoneurons. Brain Res Bull 35:423-432.1994).
Fung SJ, Barnes CD (Evidence of facilitatory coerulospinal action in lumbar motoneurons of cats. Brain Res 216:299-311.1981).
Fung SJ, Barnes CD (Membrane excitability changes in hindlimb motoneurons induced by stimulation of the locus coeruleus in cats. Brain Res 402:230-242.1987).
Fung SJ, Manzoni D, Chan JY, Pompeiano O, Barnes CD (Locus coeruleus control of spinal motor output. Prog Brain Res 88:395-409.1991).
Fung SJ, Xi M, Zhang J, Torterolo P, Sampogna S, Morales FR, Chase MH (Projection neurons from the central nucleus of the amygdala to the nucleus pontis oralis. J Neurosci Res 89:429-436.2011).
Gainetdinov RR, Caron MG (Monoamine transporters: from genes to behavior. Annu Rev Pharmacol Toxicol 43:261-284.2003).
Garavan H, Pendergrass JC, Ross TJ, Stein EA, Risinger RC (Amygdala response to both positively and negatively valenced stimuli. Neuroreport 12:2779-2783.2001).
Garcia-Sainz JA, Vazquez-Prado J, Villalobos-Molina R (Alpha 1-adrenoceptors: subtypes, signaling, and roles in health and disease. Arch Med Res 30:449-458.1999).
Geffen LB, Jessell TM, Cuello AC, Iversen LL (Release of dopamine from dendrites in rat substantia nigra. Nature 260:258-260.1976).
Gelineau J (De la narcolepsie. Gazette des hôpitaux 53:626-628.1880).
Gervasoni D, Panconi E, Henninot V, Boissard R, Barbagli B, Fort P, Luppi PH (Effect of chronic treatment with milnacipran on sleep architecture in rats compared with paroxetine and imipramine. Pharmacol Biochem Behav 73:557-563.2002).
Gessa GL, Porceddu ML, Collu M, Mereu G, Serra M, Ongini E, Biggio G (Sedation and sleep induced by high doses of apomorphine after blockade of D-1 receptors by SCH 23390. Eur J Pharmacol 109:269-274.1985).
Golicki D, Bala MM, Niewada M, Wierzbicka A (Modafinil for narcolepsy: systematic review and meta-analysis. Med Sci Monit 16:RA177-186.2010).
Gompf HS, Mathai C, Fuller PM, Wood DA, Pedersen NP, Saper CB, Lu J (Locus ceruleus and anterior cingulate cortex sustain wakefulness in a novel environment. J Neurosci 30:14543-14551.2010).
Gross M (Shining new light on the brain. Curr Biol 21:R831-833.2011).
162
Grzanna R, Chee WK, Akeyson EW (Noradrenergic projections to brainstem nuclei: evidence for differential projections from noradrenergic subgroups. J Comp Neurol 263:76-91.1987).
Grzanna R, Fritschy JM (Efferent projections of different subpopulations of central noradrenaline neurons. Prog Brain Res 88:89-101.1991).
Guilleminault C, Heinzer R, Mignot E, Black J (Investigations into the neurologic basis of narcolepsy. Neurology 50:S8-15.1998).
Guilleminault C, Salva MA, Mancuso J, Hayes B (Narcolepsy, cataplexy, heart rate, and blood pressure. Sleep 9:222-226.1986).
Guilleminault C, Wilson RA, Dement WC (A study on cataplexy. Arch Neurol 31:255-261.1974).
Gulyani S, Wu MF, Nienhuis R, John J, Siegel JM (Cataplexy-related neurons in the amygdala of the narcoleptic dog. Neuroscience 112:355-365.2002).
Guo RX, Anaclet C, Roberts JC, Parmentier R, Zhang M, Guidon G, Buda C, Sastre JP, Feng JQ, Franco P, Brown SH, Upton N, Medhurst AD, Lin JS (Differential effects of acute and repeat dosing with the H3 antagonist GSK189254 on the sleep-wake cycle and narcoleptic episodes in Ox-/- mice. Br J Pharmacol 157:104-117.2009).
Guyenet PG (The coeruleospinal noradrenergic neurons: anatomical and electrophysiological studies in the rat. Brain Res 189:121-133.1980).
Hallmayer J, Faraco J, Lin L, Hesselson S, Winkelmann J, Kawashima M, Mayer G, Plazzi G, Nevsimalova S, Bourgin P, Hong SC, Honda Y, Honda M, Hogl B, Longstreth WT, Jr., Montplaisir J, Kemlink D, Einen M, Chen J, Musone SL, Akana M, Miyagawa T, Duan J, Desautels A, Erhardt C, Hesla PE, Poli F, Frauscher B, Jeong JH, Lee SP, Ton TG, Kvale M, Kolesar L, Dobrovolna M, Nepom GT, Salomon D, Wichmann HE, Rouleau GA, Gieger C, Levinson DF, Gejman PV, Meitinger T, Young T, Peppard P, Tokunaga K, Kwok PY, Risch N, Mignot E (Narcolepsy is strongly associated with the T-cell receptor alpha locus. Nat Genet 41:708-711.2009).
Han F, Lin L, Warby SC, Faraco J, Li J, Dong SX, An P, Zhao L, Wang LH, Li QY, Yan H, Gao ZC, Yuan Y, Strohl KP, Mignot E (Narcolepsy onset is seasonal and increased following the 2009 H1N1 pandemic in China. Ann Neurol 70:410-417.2011).
Hara J, Beuckmann CT, Nambu T, Willie JT, Chemelli RM, Sinton CM, Sugiyama F, Yagami K, Goto K, Yanagisawa M, Sakurai T (Genetic ablation of orexin neurons in mice results in narcolepsy, hypophagia, and obesity. Neuron 30:345-354.2001).
Hengstmann JH, Goronzy J (Pharmacokinetics of 3H-phenylephrine in man. Eur J Clin Pharmacol 21:335-341.1982).
Herbert H, Saper CB (Organization of medullary adrenergic and noradrenergic projections to the periaqueductal gray matter in the rat. J Comp Neurol 315:34-52.1992).
163
Holahan MR, Madularu D, McConnell EM, Walsh R, DeRosa MC (Intra-accumbens injection of a dopamine aptamer abates MK-801-induced cognitive dysfunction in a model of schizophrenia. PLoS One 6:e22239.2011).
Honda K, Riehl J, Mignot E, Nishino S (Dopamine D3 agonists into the substantia nigra aggravate cataplexy but do not modify sleep. Neuroreport 10:3717-3724.1999a).
Honda K, Riehl J, Mignot E, Nishino S (Dopamine D3 agonists into the substantia nigra aggravate cataplexy but do not modify sleep [corrected]. Neuroreport 10:3111-3118.1999b).
Hopkins DA, Holstege G (Amygdaloid projections to the mesencephalon, pons and medulla oblongata in the cat. Exp Brain Res 32:529-547.1978).
Horel JA, Keating EG, Misantone LJ (Partial Kluver-Bucy syndrome produced by destroying temporal neocortex or amygdala. Brain Res 94:347-359.1975).
Howard SG, Feigenbaum JJ (Effect of gamma-hydroxybutyrate on central dopamine release in vivo. A microdialysis study in awake and anesthetized animals. Biochem Pharmacol 53:103-110.1997).
Huang YS, Guilleminault C (Narcolepsy: action of two gamma-aminobutyric acid type B agonists, baclofen and sodium oxybate. Pediatr Neurol 41:9-16.2009).
Huang ZL, Qu WM, Li WD, Mochizuki T, Eguchi N, Watanabe T, Urade Y, Hayaishi O (Arousal effect of orexin A depends on activation of the histaminergic system. Proc Natl Acad Sci U S A 98:9965-9970.2001).
Hungs M, Fan J, Lin L, Lin X, Maki RA, Mignot E (Identification and functional analysis of mutations in the hypocretin (orexin) genes of narcoleptic canines. Genome Res 11:531-539.2001).
Hunsley MS, Curtis WR, Palmiter RD (Behavioral and sleep/wake characteristics of mice lacking norepinephrine and hypocretin. Genes Brain Behav 5:451-457.2006).
Hunsley MS, Palmiter RD (Norepinephrine-deficient mice exhibit normal sleep-wake states but have shorter sleep latency after mild stress and low doses of amphetamine. Sleep 26:521-526.2003).
Inocente CD, Arnulf I, Bastuji H, Thibault-Stoll A, Raoux AM, Reimao R, Lin JS, Franco P (Pitolisant, an Inverse Agonist of the Histamine H3 Receptor: An Alternative Stimulant for Narcolepsy-Cataplexy in Teenagers With Refractory Sleepiness. Clin Neuropharmacol.2012).
Irie F, Badie-Mahdavi H, Yamaguchi Y (Autism-like socio-communicative deficits and stereotypies in mice lacking heparan sulfate. Proc Natl Acad Sci U S A 109:5052-5056.2012).
164
Isaac SO, Berridge CW (Wake-promoting actions of dopamine D1 and D2 receptor stimulation. J Pharmacol Exp Ther 307:386-394.2003).
Jacobs BL, Heym J, Trulson ME (Behavioral and physiological correlates of brain serotoninergic unit activity. J Physiol (Paris) 77:431-436.1981).
Jerome J, Heck DH (The age of enlightenment: evolving opportunities in brain research through optical manipulation of neuronal activity. Front Syst Neurosci 5:95.2011).
John J, Wu MF, Boehmer LN, Siegel JM (Cataplexy-active neurons in the hypothalamus: implications for the role of histamine in sleep and waking behavior. Neuron 42:619-634.2004).
Kalogiannis M, Grupke SL, Potter PE, Edwards JG, Chemelli RM, Kisanuki YY, Yanagisawa M, Leonard CS (Narcoleptic orexin receptor knockout mice express enhanced cholinergic properties in laterodorsal tegmental neurons. Eur J Neurosci 32:130-142.2010).
Kalogiannis M, Hsu E, Willie JT, Chemelli RM, Kisanuki YY, Yanagisawa M, Leonard CS (Cholinergic modulation of narcoleptic attacks in double orexin receptor knockout mice. PLoS ONE 6:e18697.2011).
Kanbayashi T, Honda K, Kodama T, Mignot E, Nishino S (Implication of dopaminergic mechanisms in the wake-promoting effects of amphetamine: a study of D- and L-derivatives in canine narcolepsy. Neuroscience 99:651-659.2000).
Kanbayashi T, Kodama T, Kondo H, Satoh S, Inoue Y, Chiba S, Shimizu T, Nishino S (CSF histamine contents in narcolepsy, idiopathic hypersomnia and obstructive sleep apnea syndrome. Sleep 32:181-187.2009).
Kantor S, Mochizuki T, Janisiewicz AM, Clark E, Nishino S, Scammell TE (Orexin neurons are necessary for the circadian control of REM sleep. Sleep 32:1127-1134.2009).
Kaur S, Thankachan S, Begum S, Liu M, Blanco-Centurion C, Shiromani PJ (Hypocretin-2 saporin lesions of the ventrolateral periaquaductal gray (vlPAG) increase REM sleep in hypocretin knockout mice. PLoS One 4:e6346.2009).
King SJ, Isaacs AM, O'Farrell E, Abizaid A (Motivation to obtain preferred foods is enhanced by ghrelin in the ventral tegmental area. Horm Behav 60:572-580.2011).
Kiyashchenko LI, Mileykovskiy BY, Maidment N, Lam HA, Wu MF, John J, Peever J, Siegel JM (Release of hypocretin (orexin) during waking and sleep states. J Neurosci 22:5282-5286.2002).
Klemm WR (Evoked responses in brain motor areas during the immobility reflex ("animal hypnosis"). Physiol Behav 6:137-144.1971a).
Klemm WR (Neurophysiologic studies of the immobility reflex ("animal hypnosis"). Neurosci Res (N Y) 4:165-212.1971b).
165
Klemm WR (Identity of sensory and motor systems that are critical to the immobility reflex ("animal hypnosis"). J Neurosci Res 2:57-69.1976).
Knutson B, Burgdorf J, Panksepp J (Ultrasonic vocalizations as indices of affective states in rats. Psychol Bull 128:961-977.2002).
Kohlmeier KA, Lopez-Rodriguez F, Chase MH (Strychnine blocks inhibitory postsynaptic potentials elicited in masseter motoneurons by sensory stimuli during carbachol-induced motor atonia. Neuroscience 78:1195-1202.1997).
Kuczenski R, Segal DS (Effects of methylphenidate on extracellular dopamine, serotonin, and norepinephrine: comparison with amphetamine. J Neurochem 68:2032-2037.1997).
Kushida CA, Baker TL, Dement WC (Electroencephalographic correlates of cataplectic attacks in narcoleptic canines. Electroencephalogr Clin Neurophysiol 61:61-70.1985).
Kuwaki T, Zhang W (Orexin neurons as arousal-associated modulators of central cardiorespiratory regulation. Respir Physiol Neurobiol 174:43-54.2010).
Kvetnansky R, Sabban EL, Palkovits M (Catecholaminergic systems in stress: structural and molecular genetic approaches. Physiol Rev 89:535-606.2009).
Kwiat GC, Basbaum AI (The origin of brainstem noradrenergic and serotonergic projections to the spinal cord dorsal horn in the rat. Somatosens Mot Res 9:157-173.1992).
Lai YY, Strahlendorf HK, Fung SJ, Barnes CD (The actions of two monoamines on spinal motoneurons from stimulation of the locus coeruleus in the cat. Brain Res 484:268-272.1989).
Larkman PM, Kelly JS (Ionic mechanisms mediating 5-hydroxytryptamine- and noradrenaline-evoked depolarization of adult rat facial motoneurones. J Physiol 456:473-490.1992).
Laviolette SR (Dopamine modulation of emotional processing in cortical and subcortical neural circuits: evidence for a final common pathway in schizophrenia? Schizophr Bull 33:971-981.2007).
LeDoux JE (Emotion circuits in the brain. Annu Rev Neurosci 23:155-184.2000).
Lee MG, Hassani OK, Jones BE (Discharge of identified orexin/hypocretin neurons across the sleep-waking cycle. J Neurosci 25:6716-6720.2005).
Leemburg S, Vyazovskiy VV, Olcese U, Bassetti CL, Tononi G, Cirelli C (Sleep homeostasis in the rat is preserved during chronic sleep restriction. Proc Natl Acad Sci U S A 107:15939-15944.2010).
Leger L, Goutagny R, Sapin E, Salvert D, Fort P, Luppi PH (Noradrenergic neurons expressing Fos during waking and paradoxical sleep deprivation in the rat. J Chem Neuroanat 37:149-157.2009).
166
Leger L, Sapin E, Goutagny R, Peyron C, Salvert D, Fort P, Luppi PH (Dopaminergic neurons expressing Fos during waking and paradoxical sleep in the rat. J Chem Neuroanat 39:262-271.2010).
Leite-Panissi CR, Coimbra NC, Menescal-de-Oliveira L (The cholinergic stimulation of the central amygdala modifying the tonic immobility response and antinociception in guinea pigs depends on the ventrolateral periaqueductal gray. Brain Res Bull 60:167-178.2003).
Leonard BE, McCartan D, White J, King DJ (Methylphenidate: a review of its neuropharmacological, neuropsychological and adverse clinical effects. Hum Psychopharmacol 19:151-180.2004).
Li A, Nattie E (Catecholamine neurones in rats modulate sleep, breathing, central chemoreception and breathing variability. J Physiol 570:385-396.2006).
Li Y, van den Pol AN (Direct and indirect inhibition by catecholamines of hypocretin/orexin neurons. J Neurosci 25:173-183.2005).
Lin JS, Sakai K, Jouvet M (Evidence for histaminergic arousal mechanisms in the hypothalamus of cat. Neuropharmacology 27:111-122.1988).
Lin JS, Sergeeva OA, Haas HL (Histamine H3 receptors and sleep-wake regulation. J Pharmacol Exp Ther 336:17-23.2011).
Lin L, Faraco J, Li R, Kadotani H, Rogers W, Lin X, Qiu X, de Jong PJ, Nishino S, Mignot E (The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2 gene. Cell 98:365-376.1999).
Lindvall O, Bjorklund A, Skagerberg G (Dopamine-containing neurons in the spinal cord: anatomy and some functional aspects. Ann Neurol 14:255-260.1983).
Liu M, Blanco-Centurion C, Konadhode R, Begum S, Pelluru D, Gerashchenko D, Sakurai T, Yanagisawa M, van den Pol AN, Shiromani PJ (Orexin gene transfer into zona incerta neurons suppresses muscle paralysis in narcoleptic mice. J Neurosci 31:6028-6040.2011a).
Liu M, Thankachan S, Kaur S, Begum S, Blanco-Centurion C, Sakurai T, Yanagisawa M, Neve R, Shiromani PJ (Orexin (hypocretin) gene transfer diminishes narcoleptic sleep behavior in mice. Eur J Neurosci 28:1382-1393.2008).
Liu X, Wellman LL, Yang L, Ambrozewicz MA, Tang X, Sanford LD (Antagonizing corticotropin-releasing factor in the central nucleus of the amygdala attenuates fear-induced reductions in sleep but not freezing. Sleep 34:1539-1549.2011b).
Liu X, Yang L, Wellman LL, Tang X, Sanford LD (GABAergic antagonism of the central nucleus of the amygdala attenuates reductions in rapid eye movement sleep after inescapable footshock stress. Sleep 32:888-896.2009).
167
Loughlin SE, Fallon JH (Dopaminergic and non-dopaminergic projections to amygdala from substantia nigra and ventral tegmental area. Brain Res 262:334-338.1983).
Lu J, Jhou TC, Saper CB (Identification of wake-active dopaminergic neurons in the ventral periaqueductal gray matter. J Neurosci 26:193-202.2006a).
Lu J, Sherman D, Devor M, Saper CB (A putative flip-flop switch for control of REM sleep. Nature 441:589-594.2006b).
Lu JW, Fenik VB, Branconi JL, Mann GL, Rukhadze I, Kubin L (Disinhibition of perifornical hypothalamic neurones activates noradrenergic neurones and blocks pontine carbachol-induced REM sleep-like episodes in rats. J Physiol 582:553-567.2007).
Luppi PH, Aston-Jones G, Akaoka H, Chouvet G, Jouvet M (Afferent projections to the rat locus coeruleus demonstrated by retrograde and anterograde tracing with cholera-toxin B subunit and Phaseolus vulgaris leucoagglutinin. Neuroscience 65:119-160.1995).
Luppi PH, Clement O, Sapin E, Gervasoni D, Peyron C, Leger L, Salvert D, Fort P (The neuronal network responsible for paradoxical sleep and its dysfunctions causing narcolepsy and rapid eye movement (REM) behavior disorder. Sleep Med Rev 15:153-163.2011).
Luppi PH, Clement O, Sapin E, Peyron C, Gervasoni D, Leger L, Fort P (Brainstem mechanisms of paradoxical (REM) sleep generation. Pflugers Arch 463:43-52.2012).
Luppi PH, Gervasoni D, Boissard R, Verret L, Goutagny R, Peyron C, Salvert D, Leger L, Barbagli B, Fort P (Brainstem structures responsible for paradoxical sleep onset and maintenance. Arch Ital Biol 142:397-411.2004).
Mansour A, Meador-Woodruff JH, Bunzow JR, Civelli O, Akil H, Watson SJ (Localization of dopamine D2 receptor mRNA and D1 and D2 receptor binding in the rat brain and pituitary: an in situ hybridization-receptor autoradiographic analysis. J Neurosci 10:2587-2600.1990).
Marcus CL (Association between narcolepsy and H1N1 exposure. Sleep 34:687; author reply 689-690.2011).
Marcus JN, Aschkenasi CJ, Lee CE, Chemelli RM, Saper CB, Yanagisawa M, Elmquist JK (Differential expression of orexin receptors 1 and 2 in the rat brain. J Comp Neurol 435:6-25.2001).
Mathis J, Hess CW, Bassetti C (Isolated mediotegmental lesion causing narcolepsy and rapid eye movement sleep behaviour disorder: a case evidencing a common pathway in narcolepsy and rapid eye movement sleep behaviour disorder. J Neurol Neurosurg Psychiatry 78:427-429.2007).
McCarley RW (Mechanisms and models of REM sleep control. Arch Ital Biol 142:429-467.2004).
168
McCune SK, Voigt MM, Hill JM (Expression of multiple alpha adrenergic receptor subtype messenger RNAs in the adult rat brain. Neuroscience 57:143-151.1993).
McGregor R, Damian A, Fabbiani G, Torterolo P, Pose I, Chase M, Morales FR (Direct hypothalamic innervation of the trigeminal motor nucleus: a retrograde tracer study. Neuroscience 136:1073-1081.2005).
McGregor R, Siegel JM (Illuminating the locus coeruleus: control of posture and arousal. Nat Neurosci 13:1448-1449.2010).
Meador-Woodruff JH, Mansour A, Bunzow JR, Van Tol HH, Watson SJ, Jr., Civelli O (Distribution of D2 dopamine receptor mRNA in rat brain. Proc Natl Acad Sci U S A 86:7625-7628.1989).
Meador-Woodruff JH, Mansour A, Healy DJ, Kuehn R, Zhou QY, Bunzow JR, Akil H, Civelli O, Watson SJ, Jr. (Comparison of the distributions of D1 and D2 dopamine receptor mRNAs in rat brain. Neuropsychopharmacology 5:231-242.1991).
Mieda M, Willie JT, Hara J, Sinton CM, Sakurai T, Yanagisawa M (Orexin peptides prevent cataplexy and improve wakefulness in an orexin neuron-ablated model of narcolepsy in mice. Proc Natl Acad Sci U S A 101:4649-4654.2004).
Mignot E (Genetic and familial aspects of narcolepsy. Neurology 50:S16-22.1998).
Mignot E (A hundred years of narcolepsy research. Arch Ital Biol 139:207-220.2001).
Mignot E, Guilleminault C, Bowersox S, Frusthofer B, Nishino S, Maddaluno J, Ciaranello R, Dement WC (Central alpha 1 adrenoceptor subtypes in narcolepsy-cataplexy: a disorder of REM sleep. Brain Res 490:186-191.1989).
Mignot E, Guilleminault C, Bowersox S, Rappaport A, Dement WC (Effect of alpha 1-adrenoceptors blockade with prazosin in canine narcolepsy. Brain Res 444:184-188.1988a).
Mignot E, Guilleminault C, Bowersox S, Rappaport A, Dement WC (Role of central alpha-1 adrenoceptors in canine narcolepsy. J Clin Invest 82:885-894.1988b).
Mignot E, Lin X, Arrigoni J, Macaubas C, Olive F, Hallmayer J, Underhill P, Guilleminault C, Dement WC, Grumet FC (DQB1*0602 and DQA1*0102 (DQ1) are better markers than DR2 for narcolepsy in Caucasian and black Americans. Sleep 17:S60-67.1994).
Mignot E, Renaud A, Nishino S, Arrigoni J, Guilleminault C, Dement WC (Canine cataplexy is preferentially controlled by adrenergic mechanisms: evidence using monoamine selective uptake inhibitors and release enhancers. Psychopharmacology (Berl) 113:76-82.1993).
Mileykovskiy BY, Kiyashchenko LI, Siegel JM (Behavioral correlates of activity in identified hypocretin/orexin neurons. Neuron 46:787-798.2005).
169
Miller JD, Farber J, Gatz P, Roffwarg H, German DC (Activity of mesencephalic dopamine and non-dopamine neurons across stages of sleep and walking in the rat. Brain Res 273:133-141.1983).
Missale C, Nash SR, Robinson SW, Jaber M, Caron MG (Dopamine receptors: from structure to function. Physiol Rev 78:189-225.1998).
Mitler MM (Letter: Animal model of narcolepsy-cataplexy. J Am Vet Med Assoc 166:643.1975).
Mitler MM, Dement WC (Sleep studies on canine narcolepsy: pattern and cycle comparisons between affected and normal dogs. Electroencephalogr Clin Neurophysiol 43:691-699.1977).
Mitler MM, Soave O, Dement WC (Narcolepsy in seven dogs. J Am Vet Med Assoc 168:1036-1038.1976).
Mochizuki T, Arrigoni E, Marcus JN, Clark EL, Yamamoto M, Honer M, Borroni E, Lowell BB, Elmquist JK, Scammell TE (Orexin receptor 2 expression in the posterior hypothalamus rescues sleepiness in narcoleptic mice. Proc Natl Acad Sci U S A 108:4471-4476.2011).
Mochizuki T, Crocker A, McCormack S, Yanagisawa M, Sakurai T, Scammell TE (Behavioral state instability in orexin knock-out mice. J Neurosci 24:6291-6300.2004).
Molinoff PB, Axelrod J (Biochemistry of catecholamines. Annu Rev Biochem 40:465-500.1971).
Moller LR, Ostergaard JR (Treatment with venlafaxine in six cases of children with narcolepsy and with cataplexy and hypnagogic hallucinations. J Child Adolesc Psychopharmacol 19:197-201.2009).
Monnier M, Fallert M, Battacharya IC (The waking action of histamine. Experientia 23:21-22.1967).
Monti JM (Involvement of histamine in the control of the waking state. Life Sci 53:1331-1338.1993).
Monti JM, Fernandez M, Jantos H (Sleep during acute dopamine D1 agonist SKF 38393 or D1 antagonist SCH 23390 administration in rats. Neuropsychopharmacology 3:153-162.1990).
Monti JM, Hawkins M, Jantos H, D'Angelo L, Fernandez M (Biphasic effects of dopamine D-2 receptor agonists on sleep and wakefulness in the rat. Psychopharmacology (Berl) 95:395-400.1988).
Monti JM, Jantos H, Boussard M, Altier H, Orellana C, Olivera S (Effects of selective activation or blockade of the histamine H3 receptor on sleep and wakefulness. Eur J Pharmacol 205:283-287.1991).
170
Monti JM, Jantos H, Fernandez M (Effects of the selective dopamine D-2 receptor agonist, quinpirole on sleep and wakefulness in the rat. Eur J Pharmacol 169:61-66.1989).
Monti JM, Monti D (The involvement of dopamine in the modulation of sleep and waking. Sleep Med Rev 11:113-133.2007).
Moorman DE, Aston-Jones G (Orexin/hypocretin modulates response of ventral tegmental dopamine neurons to prefrontal activation: diurnal influences. J Neurosci 30:15585-15599.2010).
Morrison JL, Sood S, Liu H, Park E, Liu X, Nolan P, Horner RL (Role of inhibitory amino acids in control of hypoglossal motor outflow to genioglossus muscle in naturally sleeping rats. J Physiol 552:975-991.2003a).
Morrison JL, Sood S, Liu H, Park E, Nolan P, Horner RL (GABAA receptor antagonism at the hypoglossal motor nucleus increases genioglossus muscle activity in NREM but not REM sleep. J Physiol 548:569-583.2003b).
Murase S, Inui K, Nosaka S (Baroreceptor inhibition of the locus coeruleus noradrenergic neurons. Neuroscience 61:635-643.1994).
Murray EA (The amygdala, reward and emotion. Trends Cogn Sci 11:489-497.2007).
Nakamura T, Uramura K, Nambu T, Yada T, Goto K, Yanagisawa M, Sakurai T (Orexin-induced hyperlocomotion and stereotypy are mediated by the dopaminergic system. Brain Res 873:181-187.2000).
Narita M, Nagumo Y, Hashimoto S, Khotib J, Miyatake M, Sakurai T, Yanagisawa M, Nakamachi T, Shioda S, Suzuki T (Direct involvement of orexinergic systems in the activation of the mesolimbic dopamine pathway and related behaviors induced by morphine. J Neurosci 26:398-405.2006).
Neubauer DN (Almorexant, a dual orexin receptor antagonist for the treatment of insomnia. Curr Opin Investig Drugs 11:101-110.2010).
Nishijo H, Ono T, Nishino H (Single neuron responses in amygdala of alert monkey during complex sensory stimulation with affective significance. J Neurosci 8:3570-3583.1988).
Nishino S, Arrigoni J, Valtier D, Miller JD, Guilleminault C, Dement WC, Mignot E (Dopamine D2 mechanisms in canine narcolepsy. J Neurosci 11:2666-2671.1991).
Nishino S, Fruhstorfer B, Arrigoni J, Guilleminault C, Dement WC, Mignot E (Further characterization of the alpha-1 receptor subtype involved in the control of cataplexy in canine narcolepsy. J Pharmacol Exp Ther 264:1079-1084.1993).
Nishino S, Haak L, Shepherd H, Guilleminault C, Sakai T, Dement WC, Mignot E (Effects of central alpha-2 adrenergic compounds on canine narcolepsy, a disorder of rapid eye movement sleep. J Pharmacol Exp Ther 253:1145-1152.1990).
171
Nishino S, Honda K, Riehl J, Okura M, Mignot E (Neuronal activity in the cholinoceptive basal forebrain of freely moving narcoleptic dobermans. Neuroreport 9:3653-3661.1998a).
Nishino S, Kanbayashi T (Symptomatic narcolepsy, cataplexy and hypersomnia, and their implications in the hypothalamic hypocretin/orexin system. Sleep Med Rev 9:269-310.2005).
Nishino S, Mao J, Sampathkumaran R, Shelton J (Increased dopaminergic transmission mediates the wake-promoting effects of CNS stimulants. Sleep Res Online 1:49-61.1998b).
Nishino S, Reid MS, Dement WC, Mignot E (Neuropharmacology and neurochemistry of canine narcolepsy. Sleep 17:S84-92.1994).
Nishino S, Riehl J, Hong J, Kwan M, Reid M, Mignot E (Is narcolepsy a REM sleep disorder? Analysis of sleep abnormalities in narcoleptic Dobermans. Neurosci Res 38:437-446.2000).
Nishino S, Ripley B, Overeem S, Nevsimalova S, Lammers GJ, Vankova J, Okun M, Rogers W, Brooks S, Mignot E (Low cerebrospinal fluid hypocretin (Orexin) and altered energy homeostasis in human narcolepsy. Ann Neurol 50:381-388.2001).
Nishino S, Sakurai E, Nevsimalova S, Yoshida Y, Watanabe T, Yanai K, Mignot E (Decreased CSF histamine in narcolepsy with and without low CSF hypocretin-1 in comparison to healthy controls. Sleep 32:175-180.2009).
Nishino S, Shelton J, Renaud A, Dement WC, Mignot E (Effect of 5-HT1A receptor agonists and antagonists on canine cataplexy. J Pharmacol Exp Ther 272:1170-1175.1995a).
Nishino S, Tafti M, Reid MS, Shelton J, Siegel JM, Dement WC, Mignot E (Muscle atonia is triggered by cholinergic stimulation of the basal forebrain: implication for the pathophysiology of canine narcolepsy. J Neurosci 15:4806-4814.1995b).
Nitz D, Andersen A, Fahringer H, Nienhuis R, Mignot E, Siegel J (Altered distribution of cholinergic cells in the narcoleptic dog. Neuroreport 6:1521-1524.1995).
Nitz D, Siegel JM (GABA release in the locus coeruleus as a function of sleep/wake state. Neuroscience 78:795-801.1997).
Nixon JP, Kotz CM, Novak CM, Billington CJ, Teske JA (Neuropeptides controlling energy balance: orexins and neuromedins. Handb Exp Pharmacol 209:77-109.2012).
Nygren LG, Olson L (A new major projection from locus coeruleus: the main source of noradrenergic nerve terminals in the ventral and dorsal columns of the spinal cord. Brain Res 132:85-93.1977).
Okura M, Fujiki N, Kita I, Honda K, Yoshida Y, Mignot E, Nishino S (The roles of midbrain and diencephalic dopamine cell groups in the regulation of cataplexy in narcoleptic Dobermans. Neurobiol Dis 16:274-282.2004).
172
Okura M, Riehl J, Mignot E, Nishino S (Sulpiride, a D2/D3 blocker, reduces cataplexy but not REM sleep in canine narcolepsy. Neuropsychopharmacology 23:528-538.2000).
Okuro M, Fujiki N, Kotorii N, Ishimaru Y, Sokoloff P, Nishino S (Effects of paraxanthine and caffeine on sleep, locomotor activity, and body temperature in orexin/ataxin-3 transgenic narcoleptic mice. Sleep 33:930-942.2010).
Olive MF, Seidel WF, Edgar DM (Compensatory sleep responses to wakefulness induced by the dopamine autoreceptor antagonist (-)DS121. J Pharmacol Exp Ther 285:1073-1083.1998).
Oliveira LC, Nobre MJ, Brandao ML, Landeira-Fernandez J (Role of amygdala in conditioned and unconditioned fear generated in the periaqueductal gray. Neuroreport 15:2281-2285.2004).
Ongini E, Bonizzoni E, Ferri N, Milani S, Trampus M (Differential effects of dopamine D-1 and D-2 receptor antagonist antipsychotics on sleep-wake patterns in the rat. J Pharmacol Exp Ther 266:726-731.1993).
Overeem S, Lammers GJ, van Dijk JG (Weak with laughter. Lancet 354:838.1999).
Overeem S, Lammers GJ, van Dijk JG (Cataplexy: 'tonic immobility' rather than 'REM-sleep atonia'? Sleep Med 3:471-477.2002).
Overeem S, Mignot E, van Dijk JG, Lammers GJ (Narcolepsy: clinical features, new pathophysiologic insights, and future perspectives. J Clin Neurophysiol 18:78-105.2001).
Overeem S, Reijntjes R, Huyser W, Lammers GJ, van Dijk JG (Corticospinal excitability during laughter: implications for cataplexy and the comparison with REM sleep atonia. J Sleep Res 13:257-264.2004).
Overeem S, van Nues SJ, van der Zande WL, Donjacour CE, van Mierlo P, Lammers GJ (The clinical features of cataplexy: a questionnaire study in narcolepsy patients with and without hypocretin-1 deficiency. Sleep Med 12:12-18.2011).
Owen RT (Sodium oxybate: efficacy, safety and tolerability in the treatment of narcolepsy with or without cataplexy. Drugs Today (Barc) 44:197-204.2008).
Parmentier R, Anaclet C, Guhennec C, Brousseau E, Bricout D, Giboulot T, Bozyczko-Coyne D, Spiegel K, Ohtsu H, Williams M, Lin JS (The brain H3-receptor as a novel therapeutic target for vigilance and sleep-wake disorders. Biochem Pharmacol 73:1157-1171.2007).
Partinen M, Saarenpaa-Heikkila O, Ilveskoski I, Hublin C, Linna M, Olsen P, Nokelainen P, Alen R, Wallden T, Espo M, Rusanen H, Olme J, Satila H, Arikka H, Kaipainen P, Julkunen I, Kirjavainen T (Increased Incidence and Clinical Picture of Childhood Narcolepsy following the 2009 H1N1 Pandemic Vaccination Campaign in Finland. PLoS One 7:e33723.2012).
173
Paton JJ, Belova MA, Morrison SE, Salzman CD (The primate amygdala represents the positive and negative value of visual stimuli during learning. Nature 439:865-870.2006).
Paxinos G, Franklin K (2001) The mouse brain in stereotaxic coordinates. New York: Academic Press.
Peever JH, Lai YY, Siegel JM (Excitatory effects of hypocretin-1 (orexin-A) in the trigeminal motor nucleus are reversed by NMDA antagonism. J Neurophysiol 89:2591-2600.2003).
Peyron C, Faraco J, Rogers W, Ripley B, Overeem S, Charnay Y, Nevsimalova S, Aldrich M, Reynolds D, Albin R, Li R, Hungs M, Pedrazzoli M, Padigaru M, Kucherlapati M, Fan J, Maki R, Lammers GJ, Bouras C, Kucherlapati R, Nishino S, Mignot E (A mutation in a case of early onset narcolepsy and a generalized absence of hypocretin peptides in human narcoleptic brains. Nat Med 6:991-997.2000).
Peyron C, Tighe DK, van den Pol AN, de Lecea L, Heller HC, Sutcliffe JG, Kilduff TS (Neurons containing hypocretin (orexin) project to multiple neuronal systems. J Neurosci 18:9996-10015.1998).
Phelps EA, LeDoux JE (Contributions of the amygdala to emotion processing: from animal models to human behavior. Neuron 48:175-187.2005).
Piascik MT, Perez DM (Alpha1-adrenergic receptors: new insights and directions. J Pharmacol Exp Ther 298:403-410.2001).
Pitkanen A, Savander M, Nurminen N, Ylinen A (Intrinsic synaptic circuitry of the amygdala. Ann N Y Acad Sci 985:34-49.2003).
Pitkanen A, Savander V, LeDoux JE (Organization of intra-amygdaloid circuitries in the rat: an emerging framework for understanding functions of the amygdala. Trends Neurosci 20:517-523.1997).
Ponz A, Khatami R, Poryazova R, Werth E, Boesiger P, Bassetti CL, Schwartz S (Abnormal activity in reward brain circuits in human narcolepsy with cataplexy. Ann Neurol 67:190-200.2010a).
Ponz A, Khatami R, Poryazova R, Werth E, Boesiger P, Schwartz S, Bassetti CL (Reduced amygdala activity during aversive conditioning in human narcolepsy. Ann Neurol 67:394-398.2010b).
Porterfield AL, Stern JJ (A simple method for studying operant wheel running in rats. Physiol Behav 12:1083-1085.1974).
Poryazova R, Tartarotti S, Khatami R, Baumann CR, Valko P, Kallweit U, Werth E, Bassetti CL (Sodium oxybate in narcolepsy with cataplexy: Zurich sleep center experience. Eur Neurol 65:175-182.2011).
174
Prather MD, Lavenex P, Mauldin-Jourdain ML, Mason WA, Capitanio JP, Mendoza SP, Amaral DG (Increased social fear and decreased fear of objects in monkeys with neonatal amygdala lesions. Neuroscience 106:653-658.2001).
Quarta D, Valerio E, Hutcheson DM, Hedou G, Heidbreder C (The orexin-1 receptor antagonist SB-334867 reduces amphetamine-evoked dopamine outflow in the shell of the nucleus accumbens and decreases the expression of amphetamine sensitization. Neurochem Int 56:11-15.2010).
Ralph RJ, Caine SB (Dopamine D1 and D2 agonist effects on prepulse inhibition and locomotion: comparison of Sprague-Dawley rats to Swiss-Webster, 129X1/SvJ, C57BL/6J, and DBA/2J mice. J Pharmacol Exp Ther 312:733-741.2005).
Rechtschaffen A, Dement W (Studies on the relation of narcolepsy, cataplexy, and sleep with low voltage random EEG activity. Res Publ Assoc Res Nerv Ment Dis 45:488-505.1967).
Reese WG, Angel C, Newton JE (Immobility reactions: a modified classification. Pavlov J Biol Sci 19:137-143.1984).
Reid MS, Nishino S, Tafti M, Siegel JM, Dement WC, Mignot E (Neuropharmacological characterization of basal forebrain cholinergic stimulated cataplexy in narcoleptic canines. Exp Neurol 151:89-104.1998).
Reid MS, Siegel JM, Dement WC, Mignot E (Cholinergic mechanisms in canine narcolepsy--II. Acetylcholine release in the pontine reticular formation is enhanced during cataplexy. Neuroscience 59:523-530.1994a).
Reid MS, Tafti M, Geary JN, Nishino S, Siegel JM, Dement WC, Mignot E (Cholinergic mechanisms in canine narcolepsy--I. Modulation of cataplexy via local drug administration into the pontine reticular formation. Neuroscience 59:511-522.1994b).
Reid MS, Tafti M, Nishino S, Sampathkumaran R, Siegel JM, Mignot E (Local administration of dopaminergic drugs into the ventral tegmental area modulates cataplexy in the narcoleptic canine. Brain Res 733:83-100.1996).
Reid MS, Tafti M, Nishino S, Siegel JM, Dement WC, Mignot E (Cholinergic regulation of cataplexy in canine narcolepsy in the pontine reticular formation is mediated by M2 muscarinic receptors. Sleep 17:424-435.1994c).
Reilly CE (I. Mutation in the hypocretin (orexin) receptor 2 gene causes canine narcolepsy. J Neurol 246:985-986.1999).
Renaud A, Nishino S, Dement WC, Guilleminault C, Mignot E (Effects of SDZ NVI-085, a putative subtype-selective alpha 1-agonist, on canine cataplexy, a disorder of rapid eye movement sleep. Eur J Pharmacol 205:11-16.1991).
Ripley B, Overeem S, Fujiki N, Nevsimalova S, Uchino M, Yesavage J, Di Monte D, Dohi K, Melberg A, Lammers GJ, Nishida Y, Roelandse FW, Hungs M, Mignot E, Nishino S
175
(CSF hypocretin/orexin levels in narcolepsy and other neurological conditions. Neurology 57:2253-2258.2001).
Ristanovic RK, Liang H, Hornfeldt CS, Lai C (Exacerbation of cataplexy following gradual withdrawal of antidepressants: manifestation of probable protracted rebound cataplexy. Sleep Med 10:416-421.2009).
Romanski LM, LeDoux JE (Information cascade from primary auditory cortex to the amygdala: corticocortical and corticoamygdaloid projections of temporal cortex in the rat. Cereb Cortex 3:515-532.1993).
Rosenkranz JA, Grace AA (Dopamine attenuates prefrontal cortical suppression of sensory inputs to the basolateral amygdala of rats. J Neurosci 21:4090-4103.2001).
Rothman RB, Baumann MH (Balance between dopamine and serotonin release modulates behavioral effects of amphetamine-type drugs. Ann N Y Acad Sci 1074:245-260.2006).
Rothman RB, Baumann MH, Dersch CM, Romero DV, Rice KC, Carroll FI, Partilla JS (Amphetamine-type central nervous system stimulants release norepinephrine more potently than they release dopamine and serotonin. Synapse 39:32-41.2001).
Rubboli G, d'Orsi G, Zaniboni A, Gardella E, Zamagni M, Rizzi R, Meletti S, Valzania F, Tropeani A, Tassinari CA (A video-polygraphic analysis of the cataplectic attack. Clin Neurophysiol 111 Suppl 2:S120-128.2000).
Sah P, Faber ES, Lopez De Armentia M, Power J (The amygdaloid complex: anatomy and physiology. Physiol Rev 83:803-834.2003).
Sakurai T, Amemiya A, Ishii M, Matsuzaki I, Chemelli RM, Tanaka H, Williams SC, Richardson JA, Kozlowski GP, Wilson S, Arch JR, Buckingham RE, Haynes AC, Carr SA, Annan RS, McNulty DE, Liu WS, Terrett JA, Elshourbagy NA, Bergsma DJ, Yanagisawa M (Orexins and orexin receptors: a family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior. Cell 92:573-585.1998).
Sakurai T, Mieda M (Connectomics of orexin-producing neurons: interface of systems of emotion, energy homeostasis and arousal. Trends Pharmacol Sci 32:451-462.2011).
Sakurai T, Nagata R, Yamanaka A, Kawamura H, Tsujino N, Muraki Y, Kageyama H, Kunita S, Takahashi S, Goto K, Koyama Y, Shioda S, Yanagisawa M (Input of orexin/hypocretin neurons revealed by a genetically encoded tracer in mice. Neuron 46:297-308.2005).
Samson WK, Bagley SL, Ferguson AV, White MM (Orexin receptor subtype activation and locomotor behaviour in the rat. Acta Physiol (Oxf) 198:313-324.2010).
Sanford LD, Yang L, Liu X, Tang X (Effects of tetrodotoxin (TTX) inactivation of the central nucleus of the amygdala (CNA) on dark period sleep and activity. Brain Res 1084:80-88.2006).
176
Saper CB, Fuller PM, Pedersen NP, Lu J, Scammell TE (Sleep state switching. Neuron 68:1023-1042.2010).
Sasai T, Inoue Y, Komada Y, Sugiura T, Matsushima E (Comparison of clinical characteristics among narcolepsy with and without cataplexy and idiopathic hypersomnia without long sleep time, focusing on HLA-DRB1( *)1501/DQB1( *)0602 finding. Sleep Med 10:961-966.2009).
Sasaki K, Suzuki M, Mieda M, Tsujino N, Roth B, Sakurai T (Pharmacogenetic modulation of orexin neurons alters sleep/wakefulness states in mice. PLoS ONE 6:e20360.2011).
Scammell TE (The frustrating and mostly fruitless search for an autoimmune cause of narcolepsy. Sleep 29:601-602.2006).
Scammell TE, Matheson J (Modafinil: a novel stimulant for the treatment of narcolepsy. Expert Opin Investig Drugs 7:99-112.1998).
Scammell TE, Mochizuki T (Is low histamine a fundamental cause of sleepiness in narcolepsy and idiopathic hypersomnia? Sleep 32:133-134.2009).
Scammell TE, Willie JT, Guilleminault C, Siegel JM (A consensus definition of cataplexy in mouse models of narcolepsy. Sleep 32:111-116.2009).
Schachter M, Parkes JD (Fluvoxamine and clomipramine in the treatment of cataplexy. J Neurol Neurosurg Psychiatry 43:171-174.1980).
Schenck CH, Bassetti CL, Arnulf I, Mignot E (English translations of the first clinical reports on narcolepsy and cataplexy by Westphal and Gelineau in the late 19th century, with commentary. J Clin Sleep Med 3:301-311.2007).
Schmidt-Mutter C, Muller C, Zwiller J, Gobaille S, Maitre M (Gamma-hydroxybutyrate and cocaine administration increases mRNA expression of dopamine D1 and D2 receptors in rat brain. Neuropsychopharmacology 21:662-669.1999).
Schoenbaum G, Chiba AA, Gallagher M (Orbitofrontal cortex and basolateral amygdala encode expected outcomes during learning. Nat Neurosci 1:155-159.1998).
Schulz B, Fendt M, Schnitzler HU (Clonidine injections into the lateral nucleus of the amygdala block acquisition and expression of fear-potentiated startle. Eur J Neurosci 15:151-157.2002).
Schwartz S, Ponz A, Poryazova R, Werth E, Boesiger P, Khatami R, Bassetti CL (Abnormal activity in hypothalamus and amygdala during humour processing in human narcolepsy with cataplexy. Brain 131:514-522.2008).
Shao YP, Sutin J (Noradrenergic facilitation of motor neurons: localization of adrenergic receptors in neurons and nonneuronal cells in the trigeminal motor nucleus. Exp Neurol 114:216-227.1991).
177
Sharp T, Zetterstrom T, Ljungberg T, Ungerstedt U (A direct comparison of amphetamine-induced behaviours and regional brain dopamine release in the rat using intracerebral dialysis. Brain Res 401:322-330.1987).
Shea JL, Mochizuki T, Sagvaag V, Aspevik T, Bjorkum AA, Datta S (Rapid eye movement (REM) sleep homeostatic regulatory processes in the rat: changes in the sleep-wake stages and electroencephalographic power spectra. Brain Res 1213:48-56.2008).
Shelton J, Nishino S, Vaught J, Dement WC, Mignot E (Comparative effects of modafinil and amphetamine on daytime sleepiness and cataplexy of narcoleptic dogs. Sleep 18:817-826.1995).
Shigemoto Y, Fujii Y, Shinomiya K, Kamei C (Participation of histaminergic H1 and noradrenergic alpha 1 receptors in orexin A-induced wakefulness in rats. Brain Res 1023:121-125.2004).
Siegel JM, Boehmer LN (Narcolepsy and the hypocretin system--where motion meets emotion. Nat Clin Pract Neurol 2:548-556.2006).
Siegel JM, Fahringer H, Tomaszewski KS, Kaitin K, Kilduff T, Dement WC (Heart rate and blood pressure changes associated with cataplexy in canine narcolepsy. Sleep 9:216-221.1986).
Siegel JM, Nienhuis R, Fahringer HM, Chiu C, Dement WC, Mignot E, Lufkin R (Activity of medial mesopontine units during cataplexy and sleep-waking states in the narcoleptic dog. J Neurosci 12:1640-1646.1992).
Siegel JM, Nienhuis R, Fahringer HM, Paul R, Shiromani P, Dement WC, Mignot E, Chiu C (Neuronal activity in narcolepsy: identification of cataplexy-related cells in the medial medulla. Science 252:1315-1318.1991).
Siegel JM, Tomaszewski KS, Fahringer H, Cave G, Kilduff T, Dement WC (Heart rate and blood pressure changes during sleep-waking cycles and cataplexy in narcoleptic dogs. Am J Physiol 256:H111-119.1989).
Skagerberg G, Bjorklund A, Lindvall O, Schmidt RH (Origin and termination of the diencephalo-spinal dopamine system in the rat. Brain Res Bull 9:237-244.1982).
Skagerberg G, Lindvall O (Organization of diencephalic dopamine neurones projecting to the spinal cord in the rat. Brain Res 342:340-351.1985).
Skagerberg G, Meister B, Hokfelt T, Lindvall O, Goldstein M, Joh T, Cuello AC (Studies on dopamine-, tyrosine hydroxylase- and aromatic L-amino acid decarboxylase-containing cells in the rat diencephalon: comparison between formaldehyde-induced histofluorescence and immunofluorescence. Neuroscience 24:605-620.1988).
Soja PJ, Lopez-Rodriguez F, Morales FR, Chase MH (The postsynaptic inhibitory control of lumbar motoneurons during the atonia of active sleep: effect of strychnine on motoneuron properties. J Neurosci 11:2804-2811.1991).
178
Sonders RC (Pharmacokinetics of terazosin. Am J Med 80:20-24.1986).
Sood S, Morrison JL, Liu H, Horner RL (Role of endogenous serotonin in modulating genioglossus muscle activity in awake and sleeping rats. Am J Respir Crit Care Med 172:1338-1347.2005).
Sood S, Raddatz E, Liu X, Liu H, Horner RL (Inhibition of serotonergic medullary raphe obscurus neurons suppresses genioglossus and diaphragm activities in anesthetized but not conscious rats. J Appl Physiol 100:1807-1821.2006).
Stahl SM, Layzer RB, Aminoff MJ, Townsend JJ, Feldon S (Continuous cataplexy in a patient with a midbrain tumor: the limp man syndrome. Neurology 30:1115-1118.1980).
Steenland HW, Liu H, Horner RL (Endogenous glutamatergic control of rhythmically active mammalian respiratory motoneurons in vivo. J Neurosci 28:6826-6835.2008).
Steinfels GF, Heym J, Strecker RE, Jacobs BL (Behavioral correlates of dopaminergic unit activity in freely moving cats. Brain Res 258:217-228.1983a).
Steinfels GF, Heym J, Strecker RE, Jacobs BL (Response of dopaminergic neurons in cat to auditory stimuli presented across the sleep-waking cycle. Brain Res 277:150-154.1983b).
Straube T, Pohlack S, Mentzel HJ, Miltner WH (Differential amygdala activation to negative and positive emotional pictures during an indirect task. Behav Brain Res 191:285-288.2008).
Strecker RE, Steinfels GF, Jacobs BL (Dopaminergic unit activity in freely moving cats: lack of relationship to feeding, satiety, and glucose injections. Brain Res 260:317-321.1983).
Svensson K, Alfoldi P, Hajos M, Rubicsek G, Johansson AM, Carlsson A, Obal F, Jr. (Dopamine autoreceptor antagonists: effects on sleep-wake activity in the rat. Pharmacol Biochem Behav 26:123-129.1987).
Swanson LW, Hartman BK (The central adrenergic system. An immunofluorescence study of the location of cell bodies and their efferent connections in the rat utilizing dopamine-beta-hydroxylase as a marker. J Comp Neurol 163:467-505.1975).
Szymusiak R, Satinoff E, Schallert T, Whishaw IQ (Brief skin temperature changes towards thermoneutrality trigger REM sleep in rats. Physiol Behav 25:305-311.1980).
Takahashi K, Kayama Y, Lin JS, Sakai K (Locus coeruleus neuronal activity during the sleep-waking cycle in mice. Neuroscience 169:1115-1126.2010).
Tanaka T, Yokoo H, Mizoguchi K, Yoshida M, Tsuda A, Tanaka M (Noradrenaline release in the rat amygdala is increased by stress: studies with intracerebral microdialysis. Brain Res 544:174-176.1991).
Tang X, Yang L, Liu X, Sanford LD (Influence of tetrodotoxin inactivation of the central nucleus of the amygdala on sleep and arousal. Sleep 28:923-930.2005).
179
Teske JA, Billington CJ, Kotz CM (Hypocretin/orexin and energy expenditure. Acta Physiol (Oxf) 198:303-312.2010).
Thankachan S, Kaur S, Shiromani PJ (Activity of pontine neurons during sleep and cataplexy in hypocretin knock-out mice. J Neurosci 29:1580-1585.2009).
Thannickal TC, Moore RY, Nienhuis R, Ramanathan L, Gulyani S, Aldrich M, Cornford M, Siegel JM (Reduced number of hypocretin neurons in human narcolepsy. Neuron 27:469-474.2000).
Thannickal TC, Siegel JM, Nienhuis R, Moore RY (Pattern of hypocretin (orexin) soma and axon loss, and gliosis, in human narcolepsy. Brain Pathol 13:340-351.2003).
Thorpe AJ, Kotz CM (Orexin A in the nucleus accumbens stimulates feeding and locomotor activity. Brain Res 1050:156-162.2005).
Thorpy MJ (Sodium oxybate for the treatment of narcolepsy. Expert Opin Pharmacother 6:329-335.2005).
Tirelli E, Witkin JM (Differential effects of direct and indirect dopamine agonists on the induction of gnawing in C57Bl/6J mice. J Pharmacol Exp Ther 273:7-15.1995).
Trulson ME, Jacobs BL (Raphe unit activity in freely moving cats: correlation with level of behavioral arousal. Brain Res 163:135-150.1979).
Trulson ME, Trulson VM (Activity of nucleus raphe pallidus neurons across the sleep-waking cycle in freely moving cats. Brain Res 237:232-237.1982).
Tsunematsu T, Kilduff TS, Boyden ES, Takahashi S, Tominaga M, Yamanaka A (Acute optogenetic silencing of orexin/hypocretin neurons induces slow-wave sleep in mice. J Neurosci 31:10529-10539.2011).
Updyke BV (Organization of visual corticostriatal projections in the cat, with observations on visual projections to claustrum and amygdala. J Comp Neurol 327:159-193.1993).
Van Bockstaele EJ, Colago EE, Valentino RJ (Amygdaloid corticotropin-releasing factor targets locus coeruleus dendrites: substrate for the co-ordination of emotional and cognitive limbs of the stress response. J Neuroendocrinol 10:743-757.1998).
van den Pol AN, Ghosh PK, Liu RJ, Li Y, Aghajanian GK, Gao XB (Hypocretin (orexin) enhances neuron activity and cell synchrony in developing mouse GFP-expressing locus coeruleus. J Physiol 541:169-185.2002).
van Dijk G, Evers SS, Guidotti S, Thornton SN, Scheurink AJ, Nyakas C (The lateral hypothalamus: a site for integration of nutrient and fluid balance. Behav Brain Res 221:481-487.2011).
Verret L, Fort P, Gervasoni D, Leger L, Luppi PH (Localization of the neurons active during paradoxical (REM) sleep and projecting to the locus coeruleus noradrenergic neurons in the rat. J Comp Neurol 495:573-586.2006).
180
Vetrivelan R, Fuller PM, Tong Q, Lu J (Medullary circuitry regulating rapid eye movement sleep and motor atonia. J Neurosci 29:9361-9369.2009).
Vu MH, Hurni C, Mathis J, Roth C, Bassetti CL (Selective REM sleep deprivation in narcolepsy. J Sleep Res 20:50-56.2011).
Wallace DM, Magnuson DJ, Gray TS (The amygdalo-brainstem pathway: selective innervation of dopaminergic, noradrenergic and adrenergic cells in the rat. Neurosci Lett 97:252-258.1989).
Wallace DM, Magnuson DJ, Gray TS (Organization of amygdaloid projections to brainstem dopaminergic, noradrenergic, and adrenergic cell groups in the rat. Brain Res Bull 28:447-454.1992).
Wang H, Liang S, Burgdorf J, Wess J, Yeomans J (Ultrasonic vocalizations induced by sex and amphetamine in M2, M4, M5 muscarinic and D2 dopamine receptor knockout mice. PLoS ONE 3:e1893.2008).
Westerink BH, De Boer P, Timmerman W, De Vries JB (In vivo evidence for the existence of autoreceptors on dopaminergic, serotonergic, and cholinergic neurons in the brain. Ann N Y Acad Sci 604:492-504.1990).
Westlund KN, Bowker RM, Ziegler MG, Coulter JD (Noradrenergic projections to the spinal cord of the rat. Brain Res 263:15-31.1983).
Wierzbicka A, Wichniak A, Waliniowska E, Czasak K, Musinska I, Szatkowska E, Ryglewicz D, Jernajczyk W (REM sleep behaviour disorder in narcolepsy. Neurol Neurochir Pol 43:421-427.2009).
Willie JT, Chemelli RM, Sinton CM, Tokita S, Williams SC, Kisanuki YY, Marcus JN, Lee C, Elmquist JK, Kohlmeier KA, Leonard CS, Richardson JA, Hammer RE, Yanagisawa M (Distinct narcolepsy syndromes in Orexin receptor-2 and Orexin null mice: molecular genetic dissection of Non-REM and REM sleep regulatory processes. Neuron 38:715-730.2003).
Willie JT, Renthal W, Chemelli RM, Miller MS, Scammell TE, Yanagisawa M, Sinton CM (Modafinil more effectively induces wakefulness in orexin-null mice than in wild-type littermates. Neuroscience 130:983-995.2005).
Wisor JP, Eriksson KS (Dopaminergic-adrenergic interactions in the wake promoting mechanism of modafinil. Neuroscience 132:1027-1034.2005).
Wisor JP, Nishino S, Sora I, Uhl GH, Mignot E, Edgar DM (Dopaminergic role in stimulant-induced wakefulness. J Neurosci 21:1787-1794.2001).
Wu MF, Gulyani SA, Yau E, Mignot E, Phan B, Siegel JM (Locus coeruleus neurons: cessation of activity during cataplexy. Neuroscience 91:1389-1399.1999).
181
Wu MF, John J, Boehmer LN, Yau D, Nguyen GB, Siegel JM (Activity of dorsal raphe cells across the sleep-waking cycle and during cataplexy in narcoleptic dogs. J Physiol 554:202-215.2004).
Xi M, Fung SJ, Sampogna S, Chase MH (Excitatory projections from the amygdala to neurons in the nucleus pontis oralis in the rat: an intracellular study. Neuroscience 197:181-190.2011).
Xu F, Gainetdinov RR, Wetsel WC, Jones SR, Bohn LM, Miller GW, Wang YM, Caron MG (Mice lacking the norepinephrine transporter are supersensitive to psychostimulants. Nat Neurosci 3:465-471.2000).
Yamanaka A, Muraki Y, Ichiki K, Tsujino N, Kilduff TS, Goto K, Sakurai T (Orexin neurons are directly and indirectly regulated by catecholamines in a complex manner. J Neurophysiol 96:284-298.2006).
Yamuy J, Fung SJ, Xi M, Chase MH (Hypocretinergic control of spinal cord motoneurons. J Neurosci 24:5336-5345.2004).
Zaharna M, Dimitriu A, Guilleminault C (Expert opinion on pharmacotherapy of narcolepsy. Expert Opin Pharmacother 11:1633-1645.2010).
Zarrindast MR, Tabatabai SA (Involvement of dopamine receptor subtypes in mouse thermoregulation. Psychopharmacology (Berl) 107:341-346.1992).
Zeng H, Madisen L (Mouse transgenic approaches in optogenetics. Prog Brain Res 196:193-213.2012).