MOLECULAR AND CELLULAR BIOLOGY, Jan. 1985, P. 52-58 Vol. 5, No. 10270-7306/85/010052-07$02.00/0Copyright ©D 1985, American Society for Microbiology

Role of Specific Simian Virus 40 Sequences in theNuclease-Sensitive Structure in Viral Chromatin

ROBERT D. GERARD,t BETH A. MONTELONE, CHARLES F. WALTER, JEFFREY W. INNIS, ANDWALTER A. SCOTT*

Department of Biochemistry, University of Miami School of Medicine, Miami, Florida 33101

Received 17 July 1984/Accepted 18 September 1984

A nuclease-sensitive region forms in chromatin containing a 273-base-pair (bp) segment of simian virus 40DNA encompassing the viral origin of replication and early and late promoters. We have saturated this regionwith short deletion mutations and compared the nuclease sensitivity of each mutated segment to that of anunaltered segment elsewhere in the partially duplicated mutant. Although no single DNA segment is requiredfor the formation of a nuclease-sensitive region, a deletion mutation (d145) which disrupted both exact copiesof the 21-bp repeats substantially reduced nuclease sensitivity. Deletion mutations limited to only one copy ofthe 21-bp repeats had little, if any, effect. A mutant (d1135) lacking all copies of the 21- and 72-bp repeats, whileretaining the origin of replication and the TATA box, did not exhibit a nuclease-sensitive region. Mutantswhich showed reduced nuclease sensitivity had this effect throughout the nuclease-sensitive region, not just atthe site of the deletion, indicating that although multiple determinants must be responsible for thenuclease-sensitive chromatin structure they do not function with complete independence. Mutant d19, whichlacks the late portion of the 72-bp segment, showed reduced accessibility to BglI, even though the Bgll site is146 bp away from the site of the deletion.

Simian virus 40 (SV40)-infected cells contain SV40 DNAin a nucleoprotein structure with many similarities to cellularchromatin. The availability of an amplified, homogeneousDNA species in a chromatin-like structure has providedconvenient material for the study of specific features ofchromatin. Of particular interest is the short region adjacentto the viral origin of replication (ori site) which is hypersen-sitive to cleavage by endonucleases (23, 26, 27, 29) andwhich appears as a gap in the nucleosome pattern whenvisualized in the electron microscope (16, 22). This regioncontains the early and late gene promoters, the transcrip-tional enhancer sequences, and the viral origin of replica-tion. The distinctive chromatin structure may be relevant toany or all of these functions.To identify which sequences are responsible for the nucle-

ase-sensitive region, partially duplicated SV40 mutants havebeen studied. All essential information required for thehypersensitive site is contained within a 273-base-pair (bp)segment of DNA spanning the origin of replication (11, 30).Insertion of unrelated sequences between nucleotides 37 and38 (SV numbering system of Buchman et al. [4]) moves thepattern of nuclease cleavage sites in the late direction,indicating that sequences responsible for the positions ofthese sites lie on the side of nucleotide 37 which is distalfrom the origin of replication (15). Genetic elements can actindependently within the region of nuclease sensitivity togenerate specific hypersensitive sites. A DNA segmentcontaining the 72-bp tandem repeats (and the transcriptionalenhancer) creates a DNase I-sensitive site over itself whenplaced at various positions around the viral genome (10, 17).A segment containing the 21-bp tandem repeats forms aDNase I-sensitive site over adjacent sequences even whenseparated from the 72-bp repeats (10, 17).

* Corresponding author.t Present address: Cold Spring Harbor Laboratory, Cold Spring

Harbor, NY.

We have investigated the genetic elements responsible forthe chromatin structure in this region by analyzing a numberof additional mutants. No single segment is essential fornuclease sensitivity. However, overall accessibility to nucle-ase was dramatically decreased by a mutant affecting onlythe two exact copies of the 21-bp repeated sequences.Insertion of a foreign DNA segment into this region alsosubstantially diminished nuclease sensitivity. By contrast,deletion of only one of the two exact copies of the 21-bprepeats had little effect on the pattern of nuclease cleavage.These results imply that the region of the genome encom-

passing the two exact 21-bp repeated sequences and three ofthe six GGGCGG elements contains important determinantsfor the nuclease-sensitive chromatin structure. We suggestthat these sequences contribute to nuclease sensitivity overadjacent sequences on both sides.

MATERIALS AND METHODS

Cells and viruses. BSC-1 monkey cells were propagated aspreviously described (11). The nondefective mutant of SV40,in(Or)1411 (24), was grown from a stock provided by T.Shenk. Deletion mutants analyzed in this paper were isolatedfrom in(Or)1411 as previously described (11), and their se-quences were determined by the method of Maxam andGilbert (19). Mutant ddl308 is a double-deletion mutant iso-lated from d145 and d142 (a 28-bp deletion within the ori site[11]) as described by Konig and Lai (18). Mutant d1608 wasisolated by targeting S1 endonuclease activity to the 163-bpsegment of the in(Or)1411 genome between the BglI andBstNI sites by the D-loop procedure of Green and Tibbetts(12). Structures of the mutants described in this paper areshown in Fig. 1.

Analysis of endonuclease cleavage of viral nucleoprotein.Infection of BSC-1 cells with in(Or)1411 and variants, label-ing with 32p, and preparation of nuclear extracts by theTriton X-100-EDTA procedure were performed as de-scribed previously (11, 23). In some BglI digestion experi-

52

ROLE OF SEQUENCES IN SV40 CHROMATIN STRUCTURE 53

-50

ddl 308

dl 171

dl 6081

dl 116

d 139 dl6dlSS I

T dp72

2001

0dl I"

50

100

iSO

FIG. 1. Map of in(Or)1411 and locations of mutations. Stippled regions I and II of in(Or)1411 represent the SV40 origin in its normalposition and the inserted origin region, respectively. Wedge-shaped extensions from the circle indicate deleted sequences in in(Or)1411 bycomparison with SV40. Numbering on the expanded section of the map is in bp from the center of the 27-bp palindrome, with positive valuesin the late direction with respect to the inserted origin. Locations of the A-T-rich region, 21-bp repeats, and 72-bp segment are shown. Deletedsequences in mutants are as follows: d19 (146 to 197, plus C-G); dllO (92 to 169); d1l6 (83 to 103); d145 (71 to 98); d194 (104 to 130); d1116 (40to 131); d1135 (22 to 210); d1139 (83 to 169); d1155 (83 to 90); d1171 (-4 to +57); d1219 (101 to 141); ddl308 (-20 to +7 and +71 to +98); dl608(17 to 60). Mutant dp72 is a tandem duplication of the 72-bp segment (nucleotides 107 to 179). Mutant in76 is an insertion of 76 bp atposition 100-101. The sequence of the insertion in the sense of SV40 late RNA is CGGAGGGAAGTTTCGTTCTTCGGAGAAGCCAGAT-TCCTAACAA GATCTGGGTACCTGATCTTATTACCAGGTACCA.

ments, nuclear extracts were prepared by the isotonic pro-cedure of Fernandez-Munoz et al. (8).

Cleavage of viral chromatin by endogenous nuclease inthe presence of MnCl2 has been described previously (11, 23,30), as have the isolation of full-length linear DNA, redi-gestion with restriction enzymes, fractionation by elec-trophoresis in agarose gel slabs, and detection by autoradi-ography. This procedure yields four broad bands of radio-activity in the gel pattern for each mutant, corresponding toinitial cleavage in either region I or II, followed by a secondcleavage with a single-cut restriction enzyme, to producetwo bands of radioactivity for each nuclease-sensitive regionin the chromatin. The two largest bands for each mutantwere scanned with a densitometer, and the relative amountsof radioactivity produced by specific cleavage within regionsI and II were determined by integrating the densitometertracing after first graphically subtracting a background ofrandom cleavage. The frequencies of initial cleavage inregions I and II (Fl and FII, respectively) were calculatedassuming that the DNA was uniformly labeled with 32p (30).For resolution of individual cutting sites within the nucle-

ase-sensitive region, DNA fragments were fractionated byelectrophoresis on 2% agarose, transferred to nitrocelluloseby the method of Southern (25), and hybridized in thepresence of 50% formamide for 2 days at 37°C (28) with a32P-labeled probe prepared by nick translation (21).

In BglI cleavage experiments, viral chromatin was iso-lated from nuclear extracts by centrifugation into a 5 to 20%sucrose gradient in TENT buffer (10 mM Tris-hydrochloride

[pH 7.4], 50 mM NaCl, 0.5 mM Na2EDTA, 0.17% TritonX-100) for 150 min at 35,000 rpm in an SW41 Spinco rotor at4°C. After brief digestion with BglI to generate full-lengthlinear molecules, the linear DNA was isolated by prepara-tive gel electrophoresis (23) and redigested with EcoRI.Analysis of the frequencies of cleavage in regions I and IIwas carried out as described above.

RESULTS

Time course of cleavage of the two nuclease-sensitive sites inin(Or)1411. When Triton-EDTA extracts of in(Or)1411-infected BSC-1 cells were incubated in the presence ofMnCl2, single- and double-strand cuts were introduced in atime-dependent manner (Fig. 2). The amount of full-lengthlinear DNA increased to a maximum after 10 to 20 min ofincubation, depending on the concentration of nuclei duringthe extraction step. The remaining supercoiled moleculeswere most likely contained in virions or provirions and wereinaccessible to nuclease cleavage.

Initial cleavage by endogenous nuclease within one of thetwo nuclease-sensitive regions, followed by isolation offull-length linear DNA and redigestion with EcoRI, gave riseto four clusters ofDNA fragments. From densitometer scansof the larger two fragment clusters (Fig. 3), the relativefrequency of cleavage by endogenous nuclease in regions Iand II was determined. The ratio between specific cuttingfrequencies in these two regions (F1/F11) increased onlyslightly during the period of digestion.

/

/

EcoRof

-7-A/T

Late

AKpn I

,Bg/ I 21

21

Sg/ 1

72

41-

7I

,pI

VOL. 5, 1985

'BC/

54 GERARD ET AL.

Mutations affecting the 21-bp repeated sequences. Precisemaps of the mutants affecting the 21-bp repeat region andadjacent sequences are shown in Fig. 4. Within this regionthe sequence GGGCGG is repeated six times (numbered Ithrough VI). Mutant d145 affects both exact copies of the21-bp repeated sequences (disrupting hexanucleotide ele-ments IV, V, and VI). Mutant d1155 disrupts only element V,d116 lacks elements V and VI, and both d1608 and d1171 lackelements I and II as well as sequences in the early direction.In d1171 a sequence similar to the hexanucleotide element(GGCCGG) was reconstructed at the site of the deletion.Chromatin preparations containing these mutant genomes

were examined by digestion with endogenous nuclease. Therelative frequency of cleavage in the two nuclease-sensitiveregions was determined as described in the previous section(Fig. 5, Table 1). In the parent, in(Or)1411, cleavage oc-curred in the two segments with approximately equal fre-quency, with region I being slightly favored in most experi-ments. The mutation in d145 caused a substantial reductionin nuclease sensitivity in region II by comparison with regionI. Mutants d1155 and d1171 had little, if any, effect, whereasmutant d1608 had an intermediate effect. Mutant dd1308,which contains d145 in combination with d142, did not differsignificantly from d145 alone.A similar analysis was carried out to determine the effect

of sequence alterations on the accessibility of the BgII site inregion II (BglI cleaves in(Or)1411 DNA twice, once in eachnuclease-sensitive region [Fig. 1]). Mutant chromatin waspurified by sucrose gradient centrifugation and incubatedwith BglI. Full-length linear DNA was isolated and redi-gested with EcoRI to determine the relative frequencies ofinitial cleavage at the BglI sites (Table 2; autoradiograms arenot shown). Mutant d145 had substantially reduced cleavageat the BglI site, d1608 had an intermediate reduction, andd116 showed no detectable change.

Specific sites for endogenous nuclease cleavage within thenuclease-sensitive region were examined by electrophoreticfractionation of the EcoRI digest mixture and by hybridiza-tion with a specific probe derived from sequences lying

I , I

20.6g

4.

z06

U.

0 0 20 30 40 50 60TIME (MINUTES)

FIG. 2. Time course of cleavage of in(Or)1411 chromatin byendogenous nuclease. Triton-EDTA extracts of in(Or)1411-infectedBSC-1 cells were incubated with MnC12, and samples were removedat various times. The samples were electrophoresed on a 1.4%oagarose gel; the gel was dried and exposed on X-ray film. Theautoradiogram was scanned by a densitometer, and the amounts ofviral DNA present at each time in closed circular (-), relaxedcircular (A), and full-length linear (-) forms were determined andexpressed as a fraction of the total viral DNA present at zero time.

21 9' 20' 3O'

Ii .

k b

-5 2-4 4-3 9

aI 2-272-25

FI /Fl =1i 2 1-4 1-5

FIG. 3. EcoRI digests of linear DNA produced by endogenousnuclease digestion of in(Or)1411 chromatin. Nuclear extracts wereincubated for various times as described in the legend to Fig. 2 andelectrophoresed on agarose. 32P-labeled linear DNA was isolatedfrom the gel and redigested with EcoRI before electrophoresis on a1.4% agarose gel. Size markers (unlabeled channel) were mixturesof the products of double digestion of circular in(Or)1411 DNA byEcoRI + BamHI, EcoRI + BgIl, and EcoRI + BclI. I and II refer tothe fragment sizes expected to result from endogenous nucleasecleavage in region I or region II. F, and Fl, are defined as the fractionof in(Or)1411 chromatin molecules specifically cleaved by endoge-nous nuclease in regions I and II, respectively (Fig. 1). Theautoradiogram was scanned, and the F1/F1l ratio was calculated aspreviously described (30). kb, Kilobases.

between the EcoRI site and nuclease-sensitive region II. Acharacteristic pattern was observed with in(Or)1411 (Fig.6A, B, and C; 15), in which major cleavage sites occurredover the 21-bp repeat region and over the portion of the72-bp segment which is distal to the ori site. Minor cleavagesites occurred near the late border of the insert, over theBgIl site, and between the 21-bp repeats and the A-T-richregion (the site near the A-T-rich region was not resolvedfrom the site over the 21-bp repeats in the autoradiogramshown in Fig. 6A). Maps of these cleavage sites in in(Or)1411and various mutants are shown in Fig. 6D, E, and F.

After correcting for the size effects of deletion mutationson the lengths of the DNA fragments observed after rediges-tion with EcoRI, it is apparent that cleavage occurred overthe same sequences in most of the mutants and in in(Or)1411.The mutations in d1155 and d116 caused no significant changein the cleavage pattern. The deletion in d145 removed amajor cleavage site seen in in(Or)1411; however, cleavageoccurred at a reduced frequency over the sequences remain-ing in this mutant at approximately the same positions as inin(Or)1411. The distribution of cleavage sites in d1608 wasaltered by comparison with in(Or)1411 and the other mu-tants. Cleavage in a DNA segment extending from the 21-bprepeats across the deletion to the BglI site was stronglypreferred over cleavage in the 72-bp region.

Mutations affecting the 72-bp segment. The mutation ind194, which affects sequences only in the proximal portion ofthe 72-bp segment (relative to the ori site), reduced accessi-bility at the BglI site (Table 2), as well as endogenousnuclease sensitivity of the region (Fig. 5, Table 1). Mutantd19, which lacks sequences from the distal portion of the72-bp segment, showed a similar reduction in BglI sensitvity(Table 2). It has previously been shown that this mutationalso substantially reduces endogenous nuclease sensitivityof the region (11).A second copy of the 72-bp segment was introduced to

form mutant dp72. This genetic alteration had no detectable

MOL. CELL. BIOL.

ROLE OF SEQUENCES IN SV40 CHROMATIN STRUCTURE 55

effect on the frequency of cleavage by endogenous nuclease(Fig. 5, Table 1) or by BglI (Table 2). A new cleavage siteappeared over the distal portion of the second 72-bp segment(Fig. 6C and F).

Mutations affecting both the 21-bp repeated sequences andthe 72-bp segment. Mutant d1135 lacks all copies of the 72-and 21-bp repeated sequences but retains the minimal originof replication, the TATA box, and T-antigen binding sites Iand II. This mutant lacked a detectable nuclease-sensitiveregion when cleaved with endogenous nuclease (Fig. 5,Table 1), and accessibility of the Bgll site was reducedapproximately sevenfold by comparison with in(Or)1411(Table 2). The two BglI sites were cleaved with approxi-mately equal frequency in DNA isolated from this mutant.The mutations in dlO, dl139, and d1219 extend in the late

direction from positions within the last copy of the 21-bprepeats, leaving the distal 38 bp of the 72-bp segment in thecase of d1219 and only the last 10 bp in the case of dulO andd1139. Mutant d1219 showed little, if any, reduction insensitivity to endogenous nuclease in region II; however,sensitivity in dl139 and dlO (11) was substantially reduced(Fig. 5, Table 1). This agrees with the observations in theprevious section that removal of sequences from the proxi-mal portion of the 72-bp segment had less effect on endoge-nous nuclease sensitivity than did removal of sequencesfrom the distal portion. BglI cleavage was reduced to similarextents in all three mutants.The importance of the 21-bp repeat region is underscored

by a comparison of d1116, which lacks all copies of the 21-bprepeats and is cleaved very poorly by endogenous nuclease,with d1139, which lacks only hexanucleotide elements V andVI and is cleaved at a moderately reduced frequency (Fig. 5,Table 1). A strong cleavage site was retained across thedeletion in dl139 (Fig. 6B and E), which corresponds to afusion between the two major cleavage sites in in(Or)1411. It

has previously been reported (11) that the intact 72-bpsegment in d112 shows little, if any, sensitivity to endoge-nous nuclease. This mutant lacks all copies of the 21-bprepeats as well as the origin of replication and the TATAbox. The implication of these results is that sequences on theearly side of the 72-bp segment make an important contri-bution to the nuclease sensitivity over the 72-bp sequences.Mutant in76, in which 76 bp of unrelated DNA sequencehave been inserted between nucleotides 100 and 101, alsoshowed reduced sensitivity to endogenous nuclease (Fig. 5,Table 1) and to BglI (Table 2). This could be due to theincreased distance between the 21-bp repeats and the 72-bpsegment; however, a possible sequence-specific influence ofthe inserted DNA cannot be eliminated.

DISCUSSION

Determinants found in a restricted region of the SV40genome are sufficient to generate an endonuclease-sensitiveregion in SV40 chromatin (10, 11, 17, 30). Starting with aviable double-origin mutant, in(Or)1411 (constructed by T.Shenk [24]), we have isolated a collection of deletion muta-tions which remove segments of DNA at various locationsthroughout the nuclease-sensitive region. Although most ofthese mutations reduce the degree of nuclease sensitivitywithin this region by comparison with the unaltered nucle-ase-sensitive region in in(Or)1411, no single short DNAsegment has been identified which is essential for the nucle-ase-sensitive chromatin structure. From this we concludethat more than one sequence must be capable of providinginformation sufficient for this feature.

This is in agreement with recent reports (10, 17) whichidentify two segments of DNA, each independently capableof creating a nuclease-sensitive site. A segment containing

LATE C>

0(0 0. 0

0I 8 1 ~~21 21 72

r---l ~I II LIILC CTCTGCATAAATAAAAAAAATTAGTCAGCATGGGGCGGAGAAT AT GAG T T_T GCT

I 11 III V VI

Xdi 2IQ

I dl 10

sdl 15SJX I dl 94

I dl 45

A In 76

dl 116

di I3

FIG. 4. Detailed map of the region around the 21-bp repeats. The DNA sequence of the strand in the sense of the SV40 late RNA is shown.The 21-bp repeats, the six GGGCGG elements (I to VI), the TATA box (bracket), and eight bases of the 72-bp segment are indicated. Thenumbering is as described in the legend to Fig. 1.

0cM

0

dl m 1

L

VOL. 5, 1985

I

56 GERARD ET AL.

a b

k b - 6 'D _

52

4.4

3.9 - _

2 -7 -2 5 -

~a

nw "In0 x

'M._ ;.l.

aN: ...... O" so*..a

FIG. 5. EcoRI digests of linear DNA producenuclease digestion of chromatin of in(Or)1411 andextracts were prepared, incubated for times deoptimal yields of linear DNA, and electrophorlinear DNA was isolated and redigested with Ecodthe legend to Fig. 3. Size markers (unlabeledprepared as in Fig. 3 with circular DNA from dlin(Or)1411 (c and d), or dp72 (e).

structural feature which helps generate the nuclease-sensi-to ¢ ,,, tive region and that their loss influences chromatin struc-

, ,, tures at locations distant from the site of the deletion. The21-bp repeated sequences are known to play important rolesin early and late transcription (1, 3, 5-7, 9, 13, 14, 20) and anauxiliary role in DNA replication (2); however, the bases for

~ these roles are not understood. Transcriptional factor SP-1,

_ recently described by Dynan and Tjian (6), binds specificallyto the 21-bp repeat region; This factor or some other factorwhich binds to this region may disrupt the regular nucleo-some organization and create a nuclease-sensitive chromatinstructure. An analogous role has been proposed by Wu (31)for a protein which binds to promoter sequences in the heatshock 70- and 83-kilodalton protein genes of Drosophilamelanogaster.An additional contribution of sequences on the origin-prox-

imal side of nucleotide 61 may be proposed to account forkXb the effect of d1608 on nuclease sensitivity. Innis and Scott

.-5 3 (15) have shown that determinants for most of the endoge-*;~-4 5 nous nuclease cutting sites are located on the origin-distal

g 3' 9 side of nucleotide 37. From this we suppose that the influ-ence of d1608 may be due to DNA between nucleotides 37

- 2-6 and 61. This region includes the imperfect copy of the 21-bprepeated sequences (hexanucleotide elements I and II) and isknown to influence early-early transcription (1).

-1-7 It is evident from our results (d145 and in76 [this report]and d112 [11]), as well as from the results of others (17), that

sequences in the 21-bp repeat region contribute to nucleasesensitivity over the 72-bp sequences. Innis and Scott (15)

d by endogenous and others (17) also have reported that sequences in themutants. Nuclear 21-bp repeat region direct the formation of a nuclease-sen-termined to give sitive site over adjacent sequences on the early side. Theseesed. Full-length{I as described inchannels) were TABLE 1. Comparison of specific cleavage frequencies by

1155 (a), d145 (b), endogenous nuclease within regions I and II for in(Or)1411 and

mutant chromatina

the 72-bp repeated sequences can organize a nuclease-sen-sitive site over itself when transposed to various locations onthe SV40 genome. Furthermore, a segment containing the21-bp repeated sequences created a DNase I-sensitive siteover adjacent sequences on the early side. Large deletions(e.g., d1135 [this report]) which abolish the nuclease-sensi-tive chromatin structure presumably do so because both ofthese determinants are disrupted.

Deletion mutants described in this report provide moreinformation about the sequences involved in these twodeterminants and about interactions between these determi-nants in forming the nuclease-sensitive chromatin structure.Comparison between d145 (a deletion of 28 bp) and otherdeletions of approximately the same size (e.g., dl42, 28 bp[11]; d194, 27 bp [this report]) lead to the conclusion that themutation in d145 must affect sequences of special importanceto this chromatin structure. In this mutation, both exactcopies of the 21-bp repeated sequences are affected (threecopies of the GGGCGG motif are disrupted). Mutants whichaffect only one of the 21-bp repeats (e.g., d1155 and d116) hadlittle effect on the chromatin structure.One of the major cleavage sites in in(Or)1411 is deleted in

d145; however, the influence of this mutation is not limited tothe sequences removed. All sites within the nuclease-sensi-tive region were cleaved less frequently (Fig. 5 and 6), andaccessibility of the BglI site was also reduced. It seemslikely that the sequences deleted in d145 contribute to some

Specific cleavageVirus frequencies FI/Flratio

F, Fl,

1411 0.22 0.16 1.4d145 0.34 0.11 3.1

1411 0.10 0.13 0.8d145 0.26 0.08 3.3dl94 0.12 0.06 2.0d1139 0.30 0.11 2.7

1411 0.19 0.16 1.2d1116 0.30 0.05 6.0d135 0.33 0.01 33dl155 0.25 0.17 1.5d1171 0.18 0.11 1.6

1411 0.23 0.20 1.1d1219 0.11 0.07 1.6in76 0.16 0.05 3.2

1411 0.15 0.12 1.2ddl308 0.18 0.06 3.0d1608 0.15 0.08 1.9

1411 0.21 0.18 1.2dp72 0.16 0.16 1.0

a The fraction of the total chromatin population specifically cleaved insegment I (F1) or in segment 11 (F,,) was determined by scanning autoradio-grams with a densitometer (see the text). Each set of mutants groupedtogether was analyzed in the same experiment.

MOL. CELL. BIOL.

d

ROLE OF SEQUENCES IN SV40 CHROMATIN STRUCTURE 57

TABLE 2. Relative frequency of Bgll cleavage at the two BgIlsites in chromatin from in(Or)1411 and various mutants

Frequency ofVirus BgIl cleavage FI/Fl1ratio

F, F,,

1411 0.52 0.48 1.1d19 0.65 0.35 1.9d1116 0.75 0.25 3.0d1135 0.88 0.12 7.3d1139 0.73 0.27 2.7d1135-DNAa 0.47 0.53 0.9

1411 0.53 0.47 1.1dl16 0.52 0.48 1.1d1608 0.64 0.36 1.8

1411 0.57 0.43 1.3dllO 0.68 0.32 2.2d194 0.68 0.32 2.2dl219 0.72 0.28 2.5in76 0.76 0.24 3.1

1411 0.51 0.49 1.0d145 0.66 0.34 1.9d145 0.59 0.41 1.5

1411 0.56 0.44 1.3dp72 0.53 0.47 1.1

a Initial BglI cleavage was carried out on isolated supercoiled circular d1135DNA.

mutants. Their result could help explain the finding (11) thatmutant d1l2, which contains a single intact copy of the 72-bpsegment but lacks the 21-bp repeats, TATA box, and ori site,showed little or no nuclease sensitivity. Mutant d1171, whichis similar to d112 but contains the 21-bp repeated sequences,

A - ,D 0= X @ = It ° =

A _ :a ; sr Ml

ISI a I

Bourt);a

M2 kb

kb

- 126

0-98-094

-075

C

= t'.- CM3 kb

-1 26

. -0794

v0 -0-75

-l133

-a94

-0 75

observations mav be related to the role of the 21-bp repeatsin initiating transcription in both directions (1, 3, 5-7, 9, 13,14, 20).Sequences within the 72-bp segment influence accessibil-

ity in other parts of the nuclease-sensitive region. Mutantdl9, which lacks sequences in the distal portion of the 72-bpsegment, showed reduced cleavage by BglI. This representsan influence on chromatin structure over a distance of atleast 146 bp. We have reported a similar long-distance effecton Bg(I cleavage in ev-1114 (30). A similar effect was seenwith dl94 which is limited to the proximal portion of the72-bp segment and which does not overlap with dl9. Weconclude that the two elements which are capable of creatingnuclease-sensitive sites do not act independently when theylie next to each other on the viral genome.We found that endogenous nuclease cleaved in region II of

dp72, which contains two copies of the 72-bp segment, atabout the same frequency that it cleaved in region II ofin(Or)1411, which contains only one copy. This is in contrastto the results of Jongstra et al. (17), who found that DNase Isensitivity of a mutant containing two copies of the 72-bpsegment was two to three times greater than that of a mutantcontaining only one copy. Those investigators inserted 72-bpsequences in the same position and orientation as ourmutants; however, their comparison was made betweenmutants which lacked adjacent 21-bp repeats. In our exper-iments, the 21-bp repeats were present. It is possible that asingle copy of the 72-bp segment may be deficient in theability to generate a nuclease-sensitive site only when it actsby itself. It may be nearly as good as two copies whenpositioned next to the 21-bp repeats.Fromm and Berg (10) found that the ability of the 72-bp

repeated sequences to create a nuclease-sensitive region wassuppressed by an unknown mechanism when they wereinserted in the same position and orientation as in our

Bum HI S1 Bel

uEEVfiA ,

-: 0

0c4.e:

LI

C w_ - , D

I

L.z~

E 14 r__-_-L__

s~~~~~~-i-: l z

E V ____________,ffi

FIG. 6. Details of endogenous nuclease cleavage in region II. (Ato C) Linear DNA, isolated after endogenous nuclease digestion ofchromatin, was cleaved with EcoRI, electrophoresed on 2% agarose,transferred to nitrocellulose, and hybridized with a probe consistingof the smallest BamHI-PstI fragment of SV40 (this probe hybridizesto the smaller fragments resulting from cleavage of in(Or)1411 ormutants in region II, followed by EcoRI digestion). Size markers:M2, mixture of digests of circular in(Or)1411 DNA by BamHI +EcoRl, BgIl + EcoRI, and Bcll + EcoRI; Ml, the same, plus a Ncol+ EcoRI digest; M3, the same as for M2 except that dp72 DNA wasused. (D to F) Map positions of endogenous nuclease cleavage sitesobtained from the data in A to C, respectively. The thickness ofboxes corresponds to the intensity of the band resulting fromcleavage at that site. Endpoints of deletions are indicated by heavybrackets. The extent of the inserted origin region is denoted by opentriangles. The A-T-rich region, 21-bp repeats, and 72-bp segment arealso indicated. kb, Kilobases.

VOL. 5, 1985

r-----i

58 GERARD ET AL.

showed substantial nuclease sensitivity in this region. Bycontrast, Jongstra et al. (17) observed a DNase I-sensitivesite over the 72-bp segment in a mutant with a similarconstruction to d12 which lacked the 21-bp repeats. Furtherexperiments will be necessary before these complicationsare resolved.The role of these sequence elements in chromatin struc-

ture will eventually be resolved in terms of their ability tobind specific proteins or to assume unique configurations.Their roles in transcription and replication may be related tothe same features.

ACKNOWLEDGMENTSWe thank Thomas Shenk for providing mutant in(Or)1411, Mary

Woodworth-Gutai for helpful advice, and Michele Gaston for pre-paring the manuscript.

This work was supported by Public Health Service grant Al-12852from the National Institute of Allergy and Infectious Diseases.R.D.G. was supported by Public Health Service training grantGM-07332 from the National Institute of General Medical Sciences.W.A.S. was the recipient of Research Career Development awardAM-00549 from the National Institute of Arthritis, Diabetes, Diges-tive and Kidney Diseases.

LITERATURE CITED

1. Baty, D., H. A. Barrera-Saldana, R. D. Everett, M. Vigneron,and P. Chambon. 1984. Mutational dissection of the 21 bp repeatregion of the SV40 early promoter reveals that it containsoverlapping elements of the early-early and late-early promot-ers. Nucleic Acids Res. 12:915-932.

2. Bergsma, D. J., D. M. Olive, S. W. Hartzell, and K. N.Subramanian. 1982. Territorial limits and functional anatomy ofthe simian virus 40 replication origin. Proc. Natl. Acad. Sci.U.S.A. 79:381-385.

3. Brady; J., M. Radonovich, M. Thoren, G. Das, and N. P.Salzman. 1984. Simian virus 40 major late promoter: an up-stream DNA sequence required for efficient in vitro transcrip-tion. Mol. Cell. Biol. 4:133-141.

4. Buchman, A. R., L. Burnett, and P. Berg. 1980. The SV40nucleotide sequence, p. 799-829. In J. Tooze (ed.), DNA tumorviruses, part II, 2nd ed. Cold Spring Harbor Laboratory, ColdSpring Harbor, NY.

5. Byrne, B. J., M. S. Davis, J. Yamaguchi, D. J. Bergsma, and K.Subramanian. 1983. Definition of the simian virus 40 earlypromoter region and demonstration of a host range bias in theenhancement effect of the simian virus 40 72-base-pair repeat.Proc. Natl. Acad. Sci. U.S.A. 80:721-725.

6. Dynan, W. S., and R. Tjian. 1983. The promoter-specifictranscription factor SP1 binds to upstream sequences in theSV40 early promoter. Cell 35:79-87.

7. Everett, R. D., D. Baty, and P. Chambon. 1983. The repeatedGC-rich motifs upstream from the TATA box are importantelements of the SV40 early promoter. Nucleic Acids Res.11:2447-2464.

8. Fernandez-Munoz, R., M. Coca-Prados, and M.-T. Hsu. 1979.Intracellular forms of simian virus 40 nucleoprotein complexes.I. Methods of isolation and cnaracterization in CV1 cells. J.Virol. 29:612-623.

9. Fromm, M., and P. Berg. 1982. Deletion mapping of DNAregions required for SV40 early region promoter function invivo. J. Mol. Appl. Genet. 1:457-481.

10. Fromm, M., and P. Berg. 1983. Simian virus 40 early- andlate-region promoter functions are enhanced by the 72-base-pairrepeat inserted at distant locations and inverted orientations.Mol. Cell. Biol. 3:991-999.

11. Gerard, R. D., M. Woodworth-Gutai, and W. A. Scott. 1982.

Deletion mutants which affect the nuclease-sensitive site insimian virus 40 chromatin. Mol. Cell. Biol. 2:782-788.

12. Green, C., and C. Tibbetts. 1980. Targeted deletions of se-quences from closed circular DNA. Proc. Natl. Acad. Sci.U.S.A. 77:2455-2459.

13. Hartzell, S. W., B. J. Byrne, and K. N. Subramanian. 1984.Mapping of the late promoter of simian virus 40. Proc. Natl.Acad. Sci. U.S.A. 81:23-27.

14. Hartzell, S. W., J. Yamaguchi, and K. N. Subramanian. 1983.SV40 deletion mutants lacking the 21-bp repeated sequences areviable, but have noncomplementable deficiencies. Nucleic Ac-ids Res. 11:1601-1616.

15. Innis, J. W., and W. A. Scott. 1984. DNA replication andchromatin structure of simian virus 40 insertion mutants. Mol.Cell. Biol. 4:1499-1507.

16. Jakobovits, E. B., S. Bratosin, and Y. Aloni. 1980. A nucleo-some-free region in SV40 minichromosomes. Nature (London)285:263-265.

17. Jongstra, J., T. L. Reudelhuber, P. Oudet, C. Benoist, C.-B.Chae, J.-M. Jeltsch, D. J. Mathis, and P. Chambon. 1984.Induction of altered chromatin structures by simian virus 40enhancer and promoter elements. Nature (London) 307:708-714.

18. Konig, M., and C.-J. Lai. 1979. A general approach to constructdouble deletion mutants of SV40. Virology 96:277-280.

19. Maxam, A. M., and W. Gilbert. 1977. A new method forsequencing DNA. Proc. Natl. Acad. Sci. U.S.A. 74:560-564.

20. Moreau, P., R. Hen, B. Wasylyk, R. Everett, M. P. Gaub, and P.Chambon. 1981. The SV40 72 bp repeat has a striking effect ongene expression both in SV40 and other chimeric recombinants.Nucleic Acids Res. 9:6047-6068.

21. Rigby, P. W. J., M. Dieckmann, C. Rhodes, and P. Berg. 1977.Labeling deoxyribonucleic acid to high specific activity in vitroby nick translation with DNA polymerase I. J. Mol. Biol.113:237-251.

22. Saragosti, S., G. Moyne, and M. Yaniv. 1980. Absence ofnucleosomes in a fraction of SV40 chromatin between the originof replication and the region coding for the late leader RNA.Cell 20:65-73.

23. Scott, W. A., and D. J. Wigmore. 1978. Sites in simian virus 40chromatin which are preferentially cleaved by endonucleases.Cell 15:1511-1518.

24. Shenk, T. 1978. Construction of a viable SV40 variant contain-ing two functional origins of DNA replication. Cell 13:791-798.

25. Southern, E. M. 1975. Detection of specific sequences amongDNA fragments separated by gel electrophoresis. J. Mol. Biol.98:503-517.

26. Varshavsky, A. J., 0. Sundin, and M. Bohn. 1979. A stretch of"late" SV40 viral DNA about 400 bp long which includes theorigin of replication is specifically exposed in SV40 mini-chromosomes. Cell 16:453-466.

27. Varshavsky, A. J., 0. H. Sundin, and M. J. Bohn. 1978. SV40viral minichromosome: preferential exposure of the origin ofreplication as probed by restriction endonucleases. NucleicAcids Res. 5:3469-3477.

28. Wahl, G. M., M. Stern, and G. R. Stark. 1979. Efficient transferof large DNA fragments from agarose gels to diazobenzyloxy-methyl-paper and rapid hybridization by using dextran sulfate.Proc. Natl. Acad. Sci. U.S.A. 76:3683-3687.

29. Waldeck, W., B. Fohring, K. Chowdhury, P. Gruss, and G.Sauer. 1978. Origin of DNA replication in papovavirus chroma-tin is recognized by endogenous endonuclease. Proc. Natl.Acad. Sci. U.S.A. 75:5964-5968.

30. Wigmore, D. J., R. W. Eaton, and W. A. Scott. 1980. Endonu-clease-sensitive regions in SV40 chromatin from cells infectedwith duplicated mutants. Virology 104:462-473.

31. Wu, C. 1984. Two protein-binding sites in chromatin implicatedin the activation of heat-shock genes. Nature (London)309:229-234.

MOL. CELL. BIOL.