role of salmonella typhimurium small rnas ryhb-1 and ryhb-2 in the oxidative stress response

+ MODEL

Research in Microbiology xx (2013) 1e11www.elsevier.com/locate/resmic

Role of Salmonella Typhimurium small RNAs RyhB-1 and RyhB-2in the oxidative stress response

Ivan L. Calderon a, Eduardo H. Morales b, Bernardo Collao a, Paulina F. Calderon a,Catalina A. Chahuan a, Lillian G. Acuna c, Fernando Gil a, Claudia P. Saavedra a,*

aLaboratorio de Microbiologıa Molecular, Facultad de Ciencias Biologicas, Universidad Andres Bello, Santiago, ChilebGreat Lakes Bioenergy Research Center and Department of Biomolecular Chemistry, University of WisconsineMadison, Madison, WI, USA

c Laboratorio de Ecofisiologıa Microbiana, Fundacion Ciencia & Vida, Santiago, Chile

Received 17 June 2013; accepted 4 October 2013

Abstract

As part of the response to specific stress conditions, bacteria express small molecules of non-coding RNA which maintain cellular ho-meostasis by regulating gene expression, commonly at the post-transcriptional level. Among these, in Salmonella enterica sv. Typhimurium, theparalog small non-coding RNAs RyhB-1 and RyhB-2 play an important role in iron homeostasis. In addition, in the present work, we show thatRyhB-1 and RyhB-2 also participate in the response to hydrogen peroxide (H2O2). Deletion of RyhB-1 and/or RyhB-2 resulted in increasedlevels of intracellular reactive oxygen species, protein carbonylation and an altered NADH/NADþ ratio. Analyses of the transcriptional profilesof ryhB-1 and ryhB-2 by northern blot and qRT-PCR showed that they are induced in response to H2O2 in an OxyR-dependent manner. By usinglacZ-fusions and electrophoretic mobility shift assays, we confirmed the requirement of OxyR for inducing expression of both ryhB-1 and ryhB-2. Taken together, our results support a model in which, in response to peroxide treatment, ryhB-1 and ryhB-2 are upregulated by OxyR throughdirect interaction with their promoter region.� 2013 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Keywords: sRNA; RyhB; Oxidative stress

1. Introduction

During the last decade, bacterial small non-coding RNAs(sRNAs) have emerged as important players in many cellularprocesses, allowing bacteria to adapt to diverse environmentalconditions. In fact, in order to maintain intracellular homeo-stasis, bacteria can sense and respond to specific stress con-ditions by using sRNAs, which act mainly at the post-

* Corresponding author. Laboratorio de Microbiologıa Molecular, Facultad

de Ciencias Biologicas, Universidad Andres Bello, Republica 217, Santiago,

Chile. Tel.: þ56 2 26618664; fax: þ56 2 26618390.

E-mail addresses: [email protected] (I.L. Calderon), [email protected]

(E.H. Morales), [email protected] (B. Collao), pau.calderon@

uandresbello.edu (P.F. Calderon), [email protected] (C.A.

Chahuan), [email protected] (L.G. Acuna), [email protected]

(F. Gil), [email protected] (C.P. Saavedra).

Please cite this article in press as: Calderon, I.L., et al., Role of Salmonella Typh

Research in Microbiology (2013), http://dx.doi.org/10.1016/j.resmic.2013.10.008

0923-2508/$ - see front matter � 2013 Institut Pasteur. Published by Elsevier Ma

http://dx.doi.org/10.1016/j.resmic.2013.10.008

transcriptional level by base pairing with target mRNA,modifying its translation and/or stability [27,40,46,52].

The expression of several sRNAs encoded within horizon-tally transferred genetic islands of Salmonella Typhimuriumhas been characterized under diverse stress conditions, i.e.high osmolarity, extreme pH, stationary phase, nutrient star-vation, oxygen limitation, oxidative stress and conditions ofiron and magnesium limitation [18,35,44]. Among these,RyhB-2 (also named IsrE and RfrB) is induced in stationaryphase iron-limiting conditions, and when bacteria are com-partmentalized in macrophages [35]. In S. Typhimurium,RyhB-2 is located at the STM1273/yeaQ intergenic region. Itis the paralog of the iron-responsive sRNA RyhB-1 and anortholog of RyhB from Escherichia coli [14,25,34,35,48].Both RyhB-1 and RyhB-2 are expressed under the same stressconditions, but with different patterns during growth phases,suggesting that they are regulated by different mechanisms

imurium small RNAs RyhB-1 and RyhB-2 in the oxidative stress response,

sson SAS. All rights reserved.

mailto:[email protected]












Table 1

Bacterial strains used in this study.

Strain Relevant characteristic(s) Source or

reference

S. Typhimurium

14028s Wild-type G. Mora,

UNAB

DryhB-1 ryhB-1::Cam This work

DryhB-2 ryhB-2::Kan This work

DryhB-1/DryhB-2 ryhB-1::Cam/ryhB-2::Kan This work

DoxyR oxyR::Cam This work

DrpoS rpoS::Cam L. Bossi,

CNRS,

France

pRyhB-1 DryhB-1 strain complemented

with pMCL-ryhB-1 vector

carrying the S. Typhimurium

ryhB-1 gene. AmpR

This work

pRyhB-2 DryhB-2 strain complemented

with pMCL-ryhB-2 vector


ryhB-2 gene. AmpR

This work

DoxyR/pOxyR DoxyR strain complemented

with pBAD vector carrying

the S. Typhimurium oxyR

gene. AmpR

This work

WT/pryhB-1-lacZ Wild-type strain with pLacZ

vector carrying ryhB-1 promoter

This work

WT/pryhB-2-lacZ Wild-type strain with pLacZ

vector carrying ryhB-2 promoter

This work

DoxyR/pryhB-1-lacZ DoxyR strain with pLacZ vector

carrying ryhB-1 promoter

This work

DoxyR/pryhB-2-lacZ DoxyR strain with pLacZ vector

carrying ryhB-2 promoter

This work

E. coli

BL21 pET-TOPOOxyR BL21(DE3) transformed with This work

2 I.L. Calderon et al. / Research in Microbiology xx (2013) 1e11

[35]. In this context, both sRNAs are controlled by Fur inresponse to iron starvation; however, RyhB-2 is expressed atlower levels than RyhB-1. The opposite is observed in sta-tionary phase [35]. In addition, RyhB-1 and RyhB-2 areinduced by oxidative stress [35], are required for hydrogenperoxide (H2O2) resistance [25] and share common mRNAtargets such as acnA, acnB, ftn, and sodB [14,25,48]. Uniquetargets for these sRNAs have also been described for someauthors [26,34].

To understand how RyhB-1 and RyhB-2 are able tomodulate bacterial adaptation to oxidative stress, we evaluatedtheir regulation in response to H2O2 and their requirement forH2O2 resistance in S. Typhimurium 14028s. Deletion mutantsof these sRNAs (DryhB-1, DryhB-2 and DryhB-1/DryhB-2)grew defectively when challenged with H2O2, showedincreased levels of intracellular reactive oxygen species (ROS)and protein carbonylation, and an altered NADH/NADþ ratio.This indicates that RyhB-1 and RyhB-2 are required for H2O2

resistance and suggests that a metabolic imbalance is gener-ated in the DryhB-1 and DryhB-2 strains. Peroxide exposureincreased the expression of RyhB-1 and RyhB-2 and, in bothcases, this regulation depended on OxyR, but not RpoS, whichcontrols their expression in stationary phase. Using tran-scriptional fusions and electrophoretic mobility shift assays,we confirmed the requirement of OxyR for inducing expres-sion of both ryhB-1 and ryhB-2. Taken together, our resultssupport a model where, in response to peroxide treatment,ryhB-1 and ryhB-2 are upregulated by OxyR through a directinteraction with their promoter region.

2. Materials and methods
the pET-TOPOOxyR vector

oxyR gene
2.1. Bacterial strains and growth conditions
The Salmonella strains used in this study are listed in Table1. Bacteria were grown routinely at 37 �C in LuriaeBertanimedium (LB) and aerated by shaking. As LB is considered asa rich source of iron (w17 mM) [1], for growth in iron-limitingconditions LB was supplemented with the iron chelator 2,20-dipyridyl (0.2 mM). When required, LB was supplementedwith ampicillin (100 mg l�1), chloramphenicol (25 mg l�) orkanamycin (50 mg l�1). Media were solidified by the additionof agar (15 g l�1). The complemented strains were grown inmedia supplemented with 1 mM arabinose.

2.2. Mutant strain construction and complementation

The genes ryhB-1, ryhB-2 and oxyR from S. Typhimurium14028s (wild type) were interrupted by gene disruption asdescribed by Datsenko [9]. Transformants carrying plasmidpKD46 were grown in LB medium with 1 mM arabinose to anOD600 w 0.6, made electrocompetent, and transformed with aPCR fragment generated using plasmids pKD3 or pKD4 as atemplate and the respective primers (50e30): TTTGCAAAAAGAAGTAGACAACTGCGAATGAGAATGATTGTAGGCTGGAGCTGCTTCG and AGTTTGTTCACGGCAAGCGCGCAGGGCCCGGAGCGTACTACATATGAATATCCTCCTTAG for ryh

Please cite this article in press as: Calderon, I.L., et al., Role of Salmonella Typ


B-1; GTTGCAATCATTAATGATAACGATTATCTTTATCAATGTAGGCTGGAGCTGCTTCG and CCATGAATTCGACATGGGATAGATAGCGGTTAGCAACATATGAATATCCTCCTTAG for ryhB-2; ACCTATCGCCATGAACTATCGTGGCGACGGAGGATGAATATGTAGGCTGGAGCTGCTTCG andGTCGAAATGGCCATCCATTGCGCCACGGATGGCCTCTGCCCATATGAATATCCTCCTTAG for oxyR. Correct trans-formants were selected by plating cells in LB medium with theappropriate antibiotics and verification was done by PCR usingthe following primers (50e30): CTCGCTGAGAAAGAAAATTCC and CCTACAAAAGCAGATGCCTC for DryhB-1; CATCGTCAGGAAAGTGAAGT and ACGTAAGGAGATTGTTCGTC for DryhB-2; CCGCTCCGTTCTGTGATGTA and GTTGAACGGCTTAAACCGCC for DoxyR.

The double mutant strain DryhB-1/DryhB-2 was con-structed by generalized transduction using P22 HT105/1 int-201 bacteriophage [12].

Plasmids pMCL-ryhB1 and pMCL-ryhB2, used in the ryhB-1and ryhB-2 complementation assays, respectively, were con-structed by cloning the promoter (600 nt upstream from de þ1)plus the coding region of each sRNA in the pMCL210 cloningvector, using primers containing appropriated restriction sites as

himurium small RNAs RyhB-1 and RyhB-2 in the oxidative stress response,

3I.L. Calderon et al. / Research in Microbiology xx (2013) 1e11

follows (50e30): (EcoRI) CCGGGAATTCAACAACTATTGCTCGGGCGG and (BamHI) GGCCGGATCCCCCAAAAAAAAAGCCAGCAAAAGC for ryhB-1; (BamHI) CGGGATCCTGCGTTTAGCTTTTGATTTTTC and (EcoRI) CGGAATTCAAAAAAAGCCCGCACTCGGT for ryhB-2.

Plasmid pOxyR used in oxyR complementation assays wasconstructed by cloning the coding region of the oxyR gene inplasmid pBAD according to the manufacturer’s instructions(Invitrogen). Primers (50e30) ATGAATATTCGTGATCTTGAA and TTAAACCGCCTGTTTTAACG were used in therespective amplification reactions. Correct insertion wasverified by PCR and DNA sequencing.

2.3. Bacterial survival after exposure to oxidative stress

Bacteria were grown in 5 ml of LB medium at 37 �C over-night with shaking. 1:1000 dilutions of the overnight cultureswere grown in 25ml of LB, andwhen required, the culturesweresupplemented with 0.2 mM 2,20-dipyridyl at early exponentialphase (OD600 of 0.2). The cells were treated at OD600 of 0.4 with0.38 mM H2O2. In all the assays, the cultures were grownaerobically at 250 rpm. Aliquots of cultures were withdrawn atdifferent time points after peroxide treatment and theOD600 wasrecorded for the growth curves, or diluted and plated in triplicatefor the determination of bacterial concentration. Cultures wereenumerated by counting the number of colony-forming units(CFU)/ml after overnight incubation.

2.4. Determination of intracellular ROS, proteincarbonylation and NADH content

Measurement of intracellular ROS was performed using theprobe 20,70-dichlorodihydrofluorescein diacetate (H2DCFDA)as previously described with minor modifications [13].H2DCFDA is a chemically reduced form of fluorescein used asan indicator of ROS in cells. Upon cleavage of the acetategroups by intracellular esterases and oxidation, the non-fluo-rescent H2DCFDA is converted to the highly fluorescent 20,70-dichlorofluorescein. Briefly, cells grown aerobically to OD600

of 0.4 in iron-rich or iron-depleted media were incubated with10 mM H2DCFDA for 20 min and treated with 0.38 mM H2O2.At 10 min intervals, aliquots were withdrawn and washed with10 mM potassium phosphate buffer pH 7.0. After washing, thecells were suspended in the same buffer and disrupted bysonication. Cell extracts (100 ml) were mixed with 1 mlphosphate buffer and fluorescence was measured using aTECAN Infinite 200 PRO Nanoquant microplate reader(excitation, 480 nm; emission, 520 nm). Emission values werenormalized by protein concentration.

The carbonyl content in cellular proteins was determined asdescribed by Perez [36]. Crude extracts were prepared from S.Typhimurium cells grown in iron-rich and iron-depleted mediatreated at OD600 of 0.4 with 0.38 mMH2O2 for 20 min. Extractswere then treated with streptomycin sulfate (2%) and incubatedon ice for 15 min. Precipitated nucleic acids were discarded bycentrifugation at 14,000� g for 5min.After adding four volumesof 10mMdinitrophenyl hydrazine (DNPH, prepared in 2MHCl)



to 100 ml of the nucleic acid-free supernatant, the mixture wasincubated for 1 h at room temperature with vortexing every10e15 min. Proteins were precipitated by adding 500 ml of 20%trichloro-acetic acid and then sedimented by centrifugation at14,000� g for 5 min. The pellet was washed at least three timeswith an ethanol:ethylacetate mixture (1:1) to remove anyunreacted DNPH and redissolved at 37 �Cwith 450 ml guanidineHCl/dithiothreitol. Carbonyl content was determined spectro-photometrically at 370 nm using a molar absorption coefficientof 22,000 M�1 cm�1.

For NADH/NAD+ measurement, cells were grown to OD600

of 0.4 in iron-rich or iron-depleted media and then treated with0.38 mM H2O2 for 20 min. NADH was measured spectro-photometrically at 450 nm using a commercially available kitby Abcam� following the manufacturer’s instructions.

2.5. RNA extraction and northern analyses

Total RNA extraction and northern analyses were per-formed as described by Bossi [5]. Briefly, RNA was obtainedwith the acidephenol method from cells grown in iron-rich oriron-depleted media, treated in exponential phase (OD600 of0.4) with 0.38 mM H2O2 for 20 min. The primers used asprobes were (50e30): ACACTACCATCGGCGCTACG for 5SRNA, CTTTCAGGTTCTCCGTAG for RyhB-1 and CCGAACAGGTGGGTT for RyhB-2.

2.6. Reverse transcription and real-time PCR (qRT-PCR)

Total RNAwas treated with 2 U of DNase I to remove traceamounts of DNA. The cDNA was prepared from 2 mg totalRNA using specific primers and Superscript II reverse tran-scriptase (Invitrogen) according to the manufacturer’s in-structions. The real-time PCR reactions were performed in theRotorGene Q PCR System (Qiagen) using the KAPA SYBRFAST qPCR Kit (Kapa Biosystems). The reaction mixture wascarried out in a final volume of 20 ml containing 1 ml oftemplate cDNA, 0.24 ml of each primer (120 nM) and 10 ml of2� Kapa Master Mix. 16S rRNA levels were used fornormalization. The cycling protocol was performed under thefollowing conditions: initial denaturation for 10 min at 95 �Cfollowed by 40 cycles of 30 s at 95 �C, 15 s at 58 �C; 1 s at72 �C. Fluorescence was measured after the extension phase at72 �C. A previous standard curve with DNA 10-fold dilutions(ranging from 10 ng to 1 pg) was constructed for each gene tocalculate the amplification efficiency. Amplicon quantitieswere calculated from the standard curve by the softwareRotorGene Q Series Software 2.0.2 (Qiagen) set with defaultparameters. These values were used to obtain the ratio be-tween the gene of interest and the expression of the 16S rRNAgene as described by Pfaffl [37]. All experiments were per-formed in three biological and technical replicates. Specificprimers used were (50e30): GCATTCAGGGGAACCCCTA(forward) and GCCAGCAAAAGCTGGCCAAA (reverse) forryhB-1; CCGAGTGGTTGAGTTTATAACC (forward) andATTTGCCCGCCTCACCGAGT (reverse) for ryhB-2; GTAG



AATTCCAGGTGTAGC (forward) and TTATCACTGGCAGTCTCCTT (reverse) for 16S RNA.

2.7. Construction of transcriptional fusions

The native ryhB-1 and ryhB-2promoter regions frompositions+1 to�400 (ryhB-1) and +1 to�300 (ryhB-2) were amplified byPCR with primers ryhB-1-pLacZ Fw (50CGGGGTACC ATTGTGCCACCGGGCATCCA30), ryhB-1-pLacZ Rv (50CCCAAGCTT GGCAATAATAATCATTCTCATTCGC30), ryhB-2-lacZFw (50CGGCTCGAG CATCCTCCGACTACCGCAC30) andryhB-2-pLacZ Rv (50CCCAAGCTT CCACTCGGTATTGATAAAGATAATCG30) using genomic DNA from S. Typhimu-rium (strain 14028s). The restriction sites (KpnI and HindIII forryhB-1, and XhoI andHindIII for ryhB-2) at the ends of the DNAfragment were introduced by the PCR primers (underlined se-quences) and digested with the corresponding enzymes. Thedigested PCR product was cloned into the multiple cloning site(MCS) of the b-galactosidase reporter vector pLacZ-Basic(Clontech�, GenBank accessionnumberU13184), generating thevectors pryhB-1-lacZ and pryhB-2-lacZ. Constructions wereconfirmed byDNA sequencing. The constructs were transformedinto wild type strain 14028s. To evaluate activity, cells grown iniron-rich or iron-depleted media at OD600 of 0.4 were treated for20 min with 0.38 mM H2O2. b-galactosidase activity was deter-mined as previously described [17].

2.8. Electrophoretic mobility shift assay (EMSA)

To study the interaction between OxyR and the promoter re-gions of ryhB-1 and ryhB-2, non-radioactive EMSAs were per-formed according to the protocol described by De la Cruz [10].The probes were obtained by PCR using specific primers (50e30):ryhb1Fw (GGCTCGTTATCAACAAACAC) and ryhb1Rv(GGCAATAATAATCATTCTCATTCGC), to amplify the pro-moter region of ryhB-1 (w500 bp); ryhb2Fw (CAACGATCCCCAGAATGATC) and ryhb2Rv (CAAATAATACTGGAAGCAATGTGAGCAATGT) for the ryhB-2 promoter region (w300 bp).As a negative control, a DNA fragment spanning the coding re-gion of katG (w230 bp) was used; the primers were (50e30):katGFw (TGGGAACCGGATCTGGATGTGAACTGGGGCG)and katGRv (CCGCCAGCGATCAACGCCACGGTCT). PCRwas performed under the following conditions: 10 min at 95 �C,followed by 30 cycles of 30 s at 95 �C, 30 s at 55 �C and 1 min at72 �C, and a final extension of 10 min at 72 �C. The DNA frag-ments (w2 ng ml�1) were mixed with increasing amounts ofOxyR in the presence of binding buffer (0.1 mM TriseHCl, pH7.5, 0.1mMEDTA, 5mMDTT, 10mMNaCl, 1mMMgCl2, 5%,v/v glycerol). The mixture was incubated for 30 min at roomtemperature and loaded on a native 6% polyacrylamide gel in0.5� TriseborateeEDTA buffer. The DNA bands were visual-ized by ethidium bromide staining on a UV transilluminator.

2.9. Cloning, overexpression and purification of OxyR

The oxyR gene was amplified using primers (50e30) CAC-CATGCAGACCCCGCACATTCT (pET-OxyRFw) and



TTAATCCTGCAGGTCGCCGCAGA (pET-OxyRRv) andinserted into plasmid pET100/D-TOPO (Invitrogen). Plasmidscontaining oxyR (pET-TOPOOxyR) were checked by PCR andDNA sequencing. Overexpression of oxyR was carried out byadding 1 mM of IPTG to 500 ml of BL21 pET-TOPOOxyRcells at OD600 w 0.5 for 3 h. OxyR purification was carriedout by affinity chromatography using fast flow ChelatingSepharose (GE Healthcare) as previously described [7]. Afterchromatography, the purified OxyR was dialyzed for 12 hagainst the storage buffer (20 mM TriseHCl, pH 7.5, 30 mMNaCl, 1 mM DTT and 50% (v/v) glycerol).

3. Results

3.1. ryhB-1 and ryhB-2 are required for resistance tosubmillimolar concentrations of H2O2 in S.Typhimurium

To evaluate if RyhB-1 and/or RyhB-2 are required for theresistance to submillimolar concentrations of H2O2, strainscontaining single and double deletions were generated(DryhB-1, DryhB-2 and DryhB-1/DryhB-2), and growth curvesand the number of CFU/mL were determined after treatmentwith the toxic compound. Sensitivity was analyzed by expo-sure to 0.38 mM H2O2, a concentration equivalent to a fractionof what cells are thought to experience during phagocytosis[41].

Growth in LB (iron-rich) media was almost identical be-tween all strains tested (Fig. 1A). However, addition of H2O2

inhibited the growth of strains DryhB-1, DryhB-2 and DryhB-1/DryhB-2, as compared to strain 14028s (wild type), with amore pronounced effect for the DryhB-2 mutant. Interestinglythe DryhB-1/DryhB-2 mutant showed a less pronouncedgrowth defect than the individual mutant strains (Fig. 1A andC). In the case of strain 14028s exposed to H2O2, there was noincrease in the number of CFU/mL for the first 30 min, afterwhich growth resumed until it reached w5 � 109 CFU/mL atthe later time points (Fig. 1C). In contrast, the number of CFU/mL of strains DryhB-1 and DryhB-2 remained unaltered ordecreased until after 60 min of adding H2O2. After this point,the number of CFU/mL increased, although to lower levelsthan those of strain 14028s (Fig. 1C). For the double DryhB-1/DryhB-2 mutant, the effect of H2O2 in the number of CFU/mLwas less dramatic than for the single mutants.

In iron-depleted media, the overall growth pattern wassimilar to that observed in LB, with no significant differencesbetween the strains (Fig. 1B). When cells were grown in iron-depleted media and exposed to H2O2, strains DryhB-1, DryhB-2 and DryhB-1/DryhB-2 were more sensitive than strain14028s. Again, strain DryhB-2 showed the greatest growthinhibition and the DryhB-1/DryhB-2 mutant was less affectedby addition of the toxic compound (Fig. 1B and D). Growth ofstrains DryhB-1, DryhB-2 and DryhB-1/DryhB-2 decreasedmore markedly in iron-depleted media (Fig. 1D) than in iron-rich media, with no growth until after 120 min of addingH2O2. The number of CFU/mL of the mutant strains exposedto H2O2 was restored to wild type levels after complementing


Fig. 1. Growth curves and bacterial concentration of S. Typhimurium ryhBs mutants exposed to hydrogen peroxide. For growth curves, wild type (WT), DryhB-1,

DryhB-2 and DryhB-1/DryhB-2 strains were grown in iron-rich (A) or iron-depleted media (B) until OD600 w 0.4 and treated with 0.38 mM H2O2. CFU/mL was

determined under the H2O2-stressed condition described above in iron-rich (C) and iron-depleted media (D), including the corresponding complemented strains

pRyhB-1 and pRyhB-2. Control cells received no treatment. Error bars indicate SD (n ¼ 3).


the mutations with the respective genes (Fig. 1C and D),supporting a role for both RyhBs in the response to H2O2.

3.2. Deletion of ryhB-1 and/or ryhB-2 results inincreased oxidative stress markers and alterations in theNADH/NAD+ ratio

To gain further insight into the role of RyhB-1 and RyhB-2in H2O2 resistance, and their role in the oxidative stressresponse, we measured characteristic oxidative stress markersin the different genetic backgrounds.

The presence of carbonyl groups in proteins derived fromthe reaction of ROS with the side chains of some amino acidsis a suitable marker to assess the redox balance inside the cell[47]. Spectrophotometric determination of derivatizedcarbonyl groups with 2,4 dinitrophenyl hydrazine (DNPH)showed that strains DryhB-1 and DryhB-2 grown in LB mediaand exposed to H2O2 had higher levels of oxidized cyto-plasmic proteins than strain 14028s (Fig. 2A, w2 and 2.5 fold,respectively). Interestingly, even in the absence of the toxiccompound, the levels of oxidized cytoplasmic proteins werehigher in both the DryhB-1 and DryhB-2 mutant strains(Fig. 2A). In the double DryhB-1/DryhB-2 mutant grown in



iron-rich media, the levels of carbonylated proteins werealmost identical to those of strain 14028s. Addition of H2O2

slightly increased the levels of carbonylated proteins in strainDryhB-1/DryhB-2, although the increase was not statisticallysignificant (Fig. 2A). Under iron-depleted conditions, theoverall pattern of carbonylated proteins showed the sametendency as in iron-rich media (Fig. 2B), with the DryhB-1 andDryhB-2 strains having the highest levels of carbonylatedproteins. However, the levels of carbonylated proteins for eachstrain were lower in iron-depleted media than in LB. Thiscould be explained by the reduced availability of iron substratefor the Fenton reaction, hence lower levels of hydroxyl radicalto induce protein carbonylation.

In the absence of H2O2, the levels of carbonylated proteinswere slightly higher in strains DryhB-1 and DryhB-2, ascompared to strain 14028s (Fig. 2A). This suggests that thelevels of intracellular ROS might increase in the absence ofboth sRNAs. The ROS-sensitive probe H2DCFDAwas used tomonitor by fluorescence the production of intracellular ROS atdifferent time intervals after the treatment of exponentiallygrowing cells with H2O2. In agreement with the levels ofcarbonylated proteins, the DryhB-1 and DryhB-2 strains grownin LB showed higher levels of total ROS than strain 14028s


Fig. 2. Redox status of the S. Typhimurium ryhBs mutants exposed to hydrogen peroxide. Wild type (WT), DryhB-1, DryhB-2 and DryhB-1/DryhB-2 strains and the

corresponding complemented strains, pRyhB-1 and pRyhB-2, were grown to OD600 w 0.4 in iron-rich (A, C and E) or iron-depleted media (B, D and F) and then

treated with 0.38 mM H2O2 for 20 min or the indicated times. Control cells received no treatment. The content of protein carbonyl groups (A and B), total ROS (C

and D) and the NADH/NADþ ratio (E and F) was measured. Asterisks represent statistical differences with respect to the wild type strain ( p < 0.005). Error bars

indicate SD (n ¼ 3) and values were normalized by protein concentration. Panels C and D are representative of at least three independent assays, respectively. AU:

arbitrary units.


(Fig. 2C). When the different strains were treated with H2O2,the increase in the levels of ROS was more pronounced forstrains DryhB-1 and DryhB-2, but not for strain DryhB-1/DryhB-2 (Fig. 2C). The increase in fluorescence was partiallyquenched when bacteria were cultured in iron-depleted media(Fig. 2D), however, the overall result was the same; theDryhB-1 and DryhB-2 strains showed the highest levels oftotal ROS, followed by the DryhB-1/DryhB-2 strain. Thegenetically complemented strains showed ROS levels com-parable to strain 14028s (Fig. S1A and S1B, Supplementarymaterial). Taken together, the results suggest that both



sRNAs are directly or indirectly related in the maintenance ofintracellular ROS levels.

Given that several genes downregulated by RyhB-1 andRyhB-2 code proteins of the tricarboxylic acid cycle (TCAcycle) or related metabolic pathways, we speculated that theNADH/NAD+ ratio could be altered in the DryhBs back-grounds. As predicted, in cells grown in iron-rich media, theNADH/NAD+ ratio was higher in strains DryhB-1 and DryhB-2 than in strain 14028s. The increase in the NADH/NAD+ ratiowas observed in both the absence and presence of H2O2, with amore marked effect in the later condition (Fig. 2E). In


Fig. 3. Effect of H2O2 on the expression of ryhB-1 and ryhB-2 in S. Typhimurium. Wild type (WT), DoxyR and DrpoS mutant strains were grown in LB to

OD600 w 0.4 and then treated with 0.38 mM H2O2 for 20 min to analyze the expression of ryhBs by northern blot (A and B). Control cells received no treatment.

Late stationary phase cultures of WT and DrpoS in LB media were analyzed for ryhB-1 and ryhB-2 levels by northern blot (C). qRT-PCR analyses of ryhB-1 (D and

E) and ryhB-2 (F and G) were performed from cells grown in iron-rich (D and F) and iron-depleted media (E and G) and treated as described above. Asterisks

represent statistical differences between control and treated cells ( p < 0.005). Error bars indicate SD (n ¼ 3).


addition, the levels of total NAD (NAD+ and NADH) werediminished in the mutant strains, even in untreated cells (TableS1, Supplementary material). The change in the NADH/NAD+

ratio was just partially retained when strains DryhB-1 andDryhB-2 were treated with H2O2 in iron-depleted media(Fig. 2F). This could be explained by the effect of irondepletion, which may reduce the levels of NADH by TCAcycle inhibition. Taken together, these results indicate that the



absence of RyhB-1 and RyhB-2 generates a metabolicimbalance which alters the redox status of the cell.

3.3. ryhB-1 and ryhB-2 are upregulated by OxyR inresponse to H2O2

The response to H2O2 has been commonly related to thetranscription factor OxyR [8]. To investigate whether OxyR


Fig. 4. Expression of ryhBelacZ fusions in the DoxyR and wild type back-

grounds of S. Typhimurium. Wild-type and DoxyR strains were transformed

with the reporter plasmids pryhB-1-lacZ (A) and pryhB-2-lacZ (B). Cells were

grown to OD w 0.4 and treated with 0.38 mM H2O2 for 20 min and b-

galactosidase activity was measured. Control cells received no treatment.

Asterisks represent statistical differences between control and treated cells

( p < 0.005). Error bars indicate SD (n ¼ 3).


might play a role in the upregulation of ryhB-1 and ryhB-2 inresponse to H2O2, we evaluated the expression of ryhB-1 andryhB-2 in a DoxyR strain. Northern blot analyses showed thatin the wild type strain, both sRNAs were strongly upregulatedin response to H2O2 (Fig. 3), with the highest induction forryhB-1 (Fig. 3A). This was confirmed by qRT-PCR, showingthat the expression of ryhB-1 was increased more than 20times after peroxide exposure, while the expression of ryhB-2increased w6 times (Fig. 3D and F). Furthermore, the upre-gulation of ryhB-1 and ryhB-2 in response to H2O2 was in-dependent of RpoS (Fig. 3A and B), that regulates expressionof both ryhBs in stationary phase (Fig. 3C) [35]. The inductionobserved in the wild-type strain was not totally retained in theoxyR mutant, and although there was still an increase inexpression of ryhB-1 and ryhB-2, this was significantly lower(Fig. 3A and B). The differences were quantified by qRT-PCR,revealing that in the DoxyR strain, the induction of ryhB-1 andryhB-2 decreased by 70% and 60%, respectively, as comparedto the induction in strain 14028s (Fig. 3D and F).

The sole growth in iron-depleted media drastically inducedthe expression of both sRNAs (Fig. 3E and G), not allowing usto observe any additive effects by the addition of H2O2 to themedia.

Our previous experiments showed that both sRNAs areupregulated in response to H2O2, and that OxyR is partiallyrequired for this induction. A search for putative OxyR-bind-ing sites at the promoter regions of ryhB-1 and ryhB-2 usingPRODORIC [33] predicted the presence of at least one bind-ing site (data not shown). To evaluate this possibility, weconstructed transcriptional fusions of the ryhBs promoter re-gions from positions +1 to �400 for ryhB-1 (pryhB-1-lacZ ),and +1 to �300 for ryhB-2 (pryhB-2-lacZ ), with respect to thetranscription start sites. The constructions pryhB-1-lacZ andpryhB-2-lacZ were transformed into the wild type and DoxyRmutant strains and b-galactosidase activity was measured inresponse to treatment with H2O2. Wild type cells containingthe ryhB-1 and ryhB-2 promoter fusions showedw27-fold andw10-fold increases, respectively, in b-galactosidase activityafter exposure to the toxic compound (Fig. 4A and B). Theincrease in activity was not retained in the DoxyR strains(Fig. 4A and B), confirming that OxyR is required to upre-gulate ryhB-1 and ryhB-2 in response to H2O2.

To demonstrate a direct interaction of OxyR with the ryhBspromoter regions, we performed EMSAs using increasingamounts of purified OxyR and DNA fragments spanning thepromoter regions of both ryhB-1 and ryhB-2, respectively. Asshown in Fig. 5, OxyR was able to bind to both promoterregions, and not to a DNA fragment corresponding to thecoding region of the katG gene (negative control). A similarband-shift pattern of the ryhBs promoters was observed whena DNA fragment corresponding to the katG promoter regionwas used as a positive control (data not shown).

4. Discussion

In order to have a successful infective cycle and proliferate,S. Typhimurium must be able to survive within the membrane-



bound compartment called the Salmonella-containing vacuole(SCV). In this compartment, the bacterium is exposed to aseries of adverse conditions including the oxidative burst andiron starvation, among others [3,16,20]. The poor solubility ofiron in the presence of oxygen and neutral pH limits itsavailability to levels below those required for microbialgrowth [32]. Moreover, the presence of host transferrin andlactoferrin further reduce the levels of iron [4,6,38,42].Therefore, an sRNA with the ability to modulate iron usageand promote an adaptive response to oxidative stress repre-sents an extremely useful tool for the bacteria, since bothfactors combine in an environment like the SCV. In thiscontext, expression of the sRNAs RyhB-1 and RyhB-2 of S.Typhimurium is significantly induced inside macrophages,


Fig. 5. Binding of OxyR to the ryhB-1 and ryhB-2 promoters. DNAeprotein interactions were evaluated by EMSA, incubating increasing amounts of purified

OxyR with a 500 bp DNA fragment (R1) of the ryhB-1 promoter region (A) or a 300 bp DNA fragment (R2) of the ryhB-2 promoter region (B). A 230 bp DNA

fragment of the middle coding region of katG gene was used as a negative control (NC). Asterisks indicate DNAeprotein interaction.


coincidentally at the time of ROS generation by phagocyticcells [35]. In addition, their orthologs from S. Typhi, RfrA andRfrB, are important for optimal intracellular replication inmacrophages [28].

It was previously established that RyhB-1 and RyhB-2 areinduced by oxidative stress [35]. Herein, we demonstrate byquantitative analyses that the expression of RyhB-1 and RyhB-2 is triggered by H2O2, and that it is significant, although to alesser extent than upregulation in response to iron starvation(see Fig. 3E and G, wild type control). In agreement withprevious studies [35], our results indicate that the upregulationof RyhB-1 in response to H2O2 is greater than that of RyhB-2.A combination of oxidative stress and iron depletion did notshow a synergistic effect in RyhBs expression, since irondepletion alone resulted in depression of RyhB-1 and RyhB-2,caused by Fur inactivation [25]. previously showed that RyhB-1 and RyhB-2 are implicated in ROS resistance, by exposingryhBs mutants generated in a Dfur background to 7.5 mMH2O2 for 1 h and determining the survival by CFU/mL. Thenumber of CFU/mL decreased in strains lacking one or bothsRNAs as compared to the wild type strain. However, the Dfurbackground seems to be the main one responsible for sensi-tivity in these strains, since the number of CFU/mL in the Dfurstrain was partially increased by introduction of the additionaldeletion in ryhB-1, ryhB-2 or both [25]. To analyze thesensitivity of single and double ryhBs mutants in a fur+background, we determined growth curves and CFU/mL afterexposure to 0.38 mM H2O2 in iron-rich and iron-depletedmedia. The growth inhibition and a decrease in the number of



CFU/mL observed in the mutant strains were more dramatic iniron-depleted media, with a more pronounced defect whenoxidative stress and iron starvation were combined. Theseresults argue for a role of both ryhB-1 and ryhB-2 in anintegrative response to oxidative stress and iron starvation.

The expression of RyhB-1 and RyhB-2 is induced todownregulate target mRNAs implicated in iron homeostasis,including its cognate repressor Fur and dispensable iron-con-taining proteins. As a result, iron availability increases forproteins that are essential for survival under iron starvation[11,14,21,25,30,51]. In this context, upregulation of RyhB-1and RyhB-2 in response to H2O2 could play a key role inoxidative stress resistance, since this toxic compound canreadily oxidize the iron-sulfur clusters [4Fee4S] of ROS-sensitive dehydratases [45]. These enzymes utilize exposediron-sulfur clusters to bind and dehydrate substrates, but theoxidation by H2O2 disintegrates their clusters, inactivatingthem and releasing Fe2+. In turn, the free Fe2+ reacts withH2O2 (Fenton reaction) generating hydroxyl radical, which isextremely reactive with most biological molecules, causingDNA modification and strand breaks, enzyme inactivation andlipid peroxidation [24,39]. Downregulation of non-essentialiron-containing proteins by the peroxide-induced RyhBs couldbe crucial to limit this kind of damage. In agreement with thishypothesis, some of the identified targets of these sRNAs aredamaged by H2O2, i.e. aconitases and fumarases[22,25,31,49]. This protective role could partially explain thegrowth and survival defects of strains lacking RyhB-1 andRyhB-2 when challenged with H2O2 (Fig. 1), where higher



levels of iron-containing enzymes subject to oxidation couldincrease the levels of free iron and ROS-induced damage. Inagreement, the levels of carbonylated proteins, indicators ofproteins interacting with hydroperoxides and Fe2+ [39], werehigher in strains DryhB-1 and DryhB-2 grown in iron-richmedia and exposed to H2O2 (Fig. 2AeD).

The levels of total ROS were increased in the DryhB-1 andDryhB-2 strains, even in untreated cells (Fig. 2C and D),suggesting that the rate of endogenous ROS production and/ordetoxification was altered in the individual mutants. It hasbeen well established that, in aerobic organisms, one of themost important sources of intracellular ROS is NADH and itsdownstream metabolism mediated by complexes I, III and IVof the respiratory chain [23,43]. Interestingly, the DryhB-1 andDryhB-2 strains showed an increased NADH/NAD+ ratio(Fig. 2E and F), and high concentrations of NADH coupledwith low concentrations of NADPH are known to promoteoxidative stress [29]. Based on these observations, it is plau-sible to speculate that since several of the targets of RyhB-1and RyhB-2 code proteins of the TCA cycle, the absence ofthese sRNAs could result in higher levels of NADH. Inaddition, because under the experimental conditions oxygen isreadily available, the increased levels of NADH could lead to ahigher electron flux through the respiratory chain, generatingan increase in intracellular ROS production, as observed in theindividual mutant strains (Fig. 2E and F). It should be notedthat the DryhB-1/DryhB-2 strain exposed to H2O2 did notexhibit the same phenotypes of the single mutant strains or asynergistic defect. Consistent with this, in the DryhB-1/DryhB-2 strain, the levels of oxidative stress markers and the NADH/NAD+ ratio closely resembled the levels observed in the wildtype strain. Despite their similarities, these results suggest thatthe roles of RyhB-1 and RyhB-2 are not absolutely redundant.

Under specific physiological and environmental conditions,the levels of H2O2 are tightly controlled by the transcriptionfactor OxyR, which regulates the expression of genes requiredfor H2O2 scavenging, limiting its generation [15,19]. In thepresent work, we show that in S.Typhimurium, OxyR positivelyregulates the expression of ryhB-1 and ryhB-2 (Figs. 3 and 4),and we suggest that this could link a response to oxidative stressand iron homeostasis. Supporting this model, the concentrationsof H2O2 used herein are sufficient to activate OxyR [2] and todisrupt the ability of the repressor Fur to control the levels offree iron [50], thus relieving the repression of both RyhBs. Thiscould explain why the expression of RyhB-1 and RyhB-2 is notcompletely abolished in a DoxyR strain treated with H2O2.While OxyR is not present to induce the expression of bothsRNAs, Fur is being disabled by sub-millimolar levels ofperoxide, releasing the repression of ryhB-1 and ryhB-2.

In summary, we propose a model where, in response toperoxide stress, the expression of RyhB-1 and RyhB-2 is notonly determined by OxyR activation, but also by an exquisiteredox balance that depends on the levels of H2O2 (generation/degradation) and the concentration of the active form of Fur.Future studies oriented in this direction might shed light on theprecise mechanism by which OxyR and Fur coordinate thisresponse.



Acknowledgments

This work received financial support from FONDECYT11110216, FONDECYT 1120384, UNAB DI-42-11/R andUNAB DI-340-13/R. We would also like to thank to LionelloBossi and Nara Figueroa-Bossi for critical reading of themanuscript, helpful suggestions and for providing some bac-terial strains.

Appendix A. Supplementary data

Supplementary data related to this article can be found athttp://dx.doi.org/10.1016/j.resmic.2013.10.008.

References

[1] Abdul-Tehrani H, Hudson AJ, Chang YS, Timms AR, Hawkins C,

Williams JM, et al. Ferritin mutants of Escherichia coli are iron deficient

and growth impaired, and fur mutants are iron deficient. J Bacteriol

1999;181:1415e28.

[2] Aslund F, Zheng M, Beckwith J, Storz G. Regulation of the OxyR

transcription factor by hydrogen peroxide and the cellular thiol-disulfide

status. Proc Natl Acad Sci U S A 1999;96:6161e5.

[3] Aussel L, Zhao W, Hebrard M, Guilhon AA, Viala JP, Henri S, et al.

Salmonella detoxifying enzymes are sufficient to cope with the host

oxidative burst. Mol Microbiol 2011;80:628e40.

[4] Barasch J, Mori K. Cell biology: iron thievery. Nature 2004;432:811e3.

[5] Bossi L, Figueroa-Bossi N. A small RNA downregulates LamB malto-

porin in Salmonella. Mol Microbiol 2007;65:799e810.

[6] Braun V. Bacterial iron transport related to virulence. Contrib Microbiol

2005;12:210e33.

[7] Calderon IL, Morales E, Caro NJ, Chahuan CA, Collao B, Gil F, et al.

Response regulator ArcA of Salmonella enterica serovar Typhimurium

downregulates expression of OmpD, a porin facilitating uptake of

hydrogen peroxide. Res Microbiol 2011;162:214e22.

[8] Christman MF, Morgan RW, Jacobson FS, Ames BN. Positive control of

a regulon for defenses against oxidative stress and some heat-shock

proteins in Salmonella typhimurium. Cell 1985;41:753e62.

[9] Datsenko KA, Wanner BL. One-step inactivation of chromosomal genes

in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A

2000;97:6640e5.

[10] De la Cruz MA, Fernandez-Mora M, Guadarrama C, Flores-Valdez MA,

Bustamante VH, Vazquez A, et al. LeuO antagonizes H-NS and StpA-

dependent repression in Salmonella enterica ompS1. Mol Microbiol

2007;66:727e43.

[11] Desnoyers G, Morissette A, Prevost K, Masse E. Small RNA-induced

differential degradation of the polycistronic mRNA iscRSUA. EMBO J

2009;28:1551e61.

[12] Ebel-Tsipis J, Fox MS, Botstein D. Generalized transduction by bacte-

riophage P22 in Salmonella typhimurium. II. Mechanism of integration of

transducing DNA. J Mol Biol 1972;71:449e69.[13] Echave P, Tamarit J, Cabiscol E, Ros J. Novel antioxidant role of alcohol

dehydrogenase E from Escherichia coli. J Biol Chem 2003;278:30193e8.

[14] Ellermeier JR, Slauch JM. Fur regulates expression of the Salmonella

pathogenicity island 1 type III secretion system through HilD. J Bacteriol

2008;190:476e86.

[15] Farr SB, Kogoma T. Oxidative stress responses in Escherichia coli and

Salmonella typhimurium. Microbiol Rev 1991;55:561e85.

[16] Garcıa-del Portillo F. Salmonella intracellular proliferation: where, when

and how? Microbes Infect 2001;3:1305e11.

[17] Gil F, Ipinza F, Fuentes J, Fumeron R, Villarreal JM, Aspee A, et al. The

ompW (porin) gene mediates methyl viologen (paraquat) efflux in Sal-

monella enterica serovar typhimurium. Res Microbiol 2007;158:529e36.




[18] Gong H, Vu GP, Bai Y, Chan E, Wu R, Yang E, et al. A Salmonella small

non-coding RNA facilitates bacterial invasion and intracellular replica-

tion by modulating the expression of virulence factors. PLoS Pathog

2011;7:e1002120.

[19] Gonzalez-Flecha B, Demple B. Genetic responses to free radicals. Ho-

meostasis and gene control. Ann N Y Acad Sci 2000;899:69e87.

[20] Haraga A, Ohlson MB, Miller SI. Salmonellae interplay with host cells.

Nat Rev Microbiol 2008;6:53e66.[21] Jacques JF, Jang S, Prevost K, Desnoyers G, Desmarais M, Imlay J, et al.

RyhB small RNA modulates the free intracellular iron pool and is

essential for normal growth during iron limitation in Escherichia coli.

Mol Microbiol 2006;62:1181e90.[22] Jang S, Imlay JA. Micromolar intracellular hydrogen peroxide disrupts

metabolism by damaging iron-sulfur enzymes. J Biol Chem

2007;282:929e37.

[23] Jezek P, Hlavata L. Mitochondria in homeostasis of reactive oxygen

species in cell, tissues, and organism. Int J Biochem Cell Biol

2005;37:2478e503.

[24] Keyer K, Imlay JA. Superoxide accelerates DNA damage by elevating

free-iron levels. Proc Natl Acad Sci U S A 1996;9:13635e40.

[25] Kim JN, Kwon YM. Genetic and phenotypic characterization of the

RyhB regulon in Salmonella Typhimurium. Microbiol Res

2013;168:41e9.[26] Kim JN, Kwon YM. Identification of target transcripts regulated by small

RNA RyhB homologs in Salmonella: RyhB-2 regulates motility pheno-

type. Microbiol Res 2013;168:621e9.

[27] Lalaouna D, Simoneau-Roy M, Lafontaine D, Masse E. Regulatory

RNAs and target mRNA decay in prokaryotes. Biochim Biophys Acta

2013;1829:742e7.

[28] Leclerc JM, Dozois CM, Daigle F. Role of the Salmonella enterica

serovar Typhi Fur regulator and small RNAs RfrA and RfrB in iron

homeostasis and interaction with host cells. Microbiology

2013;159:591e602.

[29] Mailloux RJ, Lemire J, Appanna VD. Metabolic networks to combat

oxidative stress in Pseudomonas fluorescens. Antonie Van Leeuwenhoek

2011;99:433e42.

[30] Masse E, Gottesman S. A small RNA regulates the expression of genes

involved in iron metabolism in Escherichia coli. Proc Natl Acad Sci U S

A 2002;99:4620e5.

[31] Masse E, Vanderpool CK, Gottesman S. Effect of RyhB small RNA on

global iron use in Escherichia coli. J Bacteriol 2005;187:6962e71.

[32] Miethke M, Marahiel MA. Siderophore-based iron acquisition and

pathogen control. Microbiol Mol Biol Rev 2007;71:413e51.

[33] Munch R, Hiller K, Grote A, Scheer M, Klein J, Schobert M, et al.

Virtual footprint and PRODORIC: an integrative framework for regulon

prediction in prokaryotes. Bioinformatics 2005;21:4187e9.

[34] Ortega AD, Gonzalo-Asensio J, Garcıa-del Portillo F. Dynamics of

Salmonella small RNA expression in non-growing bacteria located inside

eukaryotic cells. RNA Biol 2012;9:469e88.



[35] Padalon-Brauch G, Hershberg R, Elgrably-Weiss M, Baruch K,

Rosenshine I, Margalit H, et al. Small RNAs encoded within genetic

islands of Salmonella typhimurium show host-induced expression and

role in virulence. Nucleic Acids Res 2008;36:1913e27.

[36] Perez JM, Calderon IL, Arenas FA, Fuentes DE, Pradenas GA,

Fuentes EL, et al. Bacterial toxicity of potassium tellurite: unveiling an

ancient enigma. PLoS One 2007;2:e211.

[37] Pfaffl MW. A new mathematical model for relative quantification in real-

time RT-PCR. Nucleic Acids Res 2001;29:e45.

[38] Raymond KN, Dertz EA, Kim SS. Enterobactin: an archetype for mi-

crobial iron transport. Proc Natl Acad Sci U S A 2003;100:3584e8.

[39] Refsgaard HH, Tsai L, Stadtman ER. Modifications of proteins by

polyunsaturated fatty acid peroxidation products. Proc Natl Acad Sci U S

A 2000;97:611e6.

[40] Richards GR, Vanderpool CK. Molecular call and response: the physi-

ology of bacterial small RNAs. Biochim Biophys Acta

2011;1809:525e31.

[41] Root RK, Cohen MS. The microbicidal mechanisms of human neutro-

phils and eosinophils. Rev Infect Dis 1981;3:565e98.[42] Schaible UE, Kaufmann SH. Iron and microbial infection. Nat Rev

Microbiol 2004;2:946e53.

[43] Singh R, Mailloux RJ, Puiseux-Dao S, Appanna VD. Oxidative stress

evokes a metabolic adaptation that favors increased NADPH synthesis

and decreased NADH production in Pseudomonas fluorescens. J Bac-

teriol 2007;189:6665e75.

[44] Sittka A, Lucchini S, Papenfort K, Sharma CM, Rolle K, Binnewies TT,

et al. Deep sequencing analysis of small noncoding RNA and mRNA

targets of the global post-transcriptional regulator, Hfq. PLoS Genet

2008;4:e1000163.

[45] Storz G, Imlay JA. Oxidative stress. Curr Opin Microbiol

1999;2:188e94.

[46] Storz G, Opdyke JA, Zhang A. Controlling mRNA stability and trans-

lation with small, noncoding RNAs. Curr Opin Microbiol 2004;7:140e4.

[47] Suzuki Y, Carini M, Butterfield A. Protein carbonylation. Antioxid

Redox Signal 2010;12:323e5.

[48] Troxell B, Fink RC, Porwollik S, McClelland M, Hassan HM. The Fur

regulon in anaerobically grown Salmonella enterica sv. Typhimurium:

identification of new Fur targets. BMC Microbiol 2011;11:236.

[49] Varghese S, Tang Y, Imlay JA. Contrasting sensitivities of Escherichia

coli aconitases A and B to oxidation and iron depletion. J Bacteriol

2003;185:221e30.

[50] Varghese S, Wu A, Park S, Imlay KR, Imlay JA. Submicromolar

hydrogen peroxide disrupts the ability of Fur protein to control free-iron

levels in Escherichia coli. Mol Microbiol 2007;64:822e30.

[51] Vecerek B, Moll I, Blasi U. Control of Fur synthesis by the non-coding

RNA RyhB and iron-responsive decoding. EMBO J 2007;26:965e75.

[52] Wassarman KM. Small RNAs in bacteria: diverse regulators of gene

expression in response to environmental changes. Cell 2002;109:141e4.


role of salmonella typhimurium small rnas ryhb-1 and ryhb-2 in the oxidative stress response

Documents