role of lipid rafts in enterohemorrhagic escherichia coli o157:h7 … · 2013. 11. 7. ·...
TRANSCRIPT
Role of lipid rafts in enterohemorrhagic Escherichia coli O157:H7 mediated hijacking of host cell signalling
pathways to induce intestinal injury
by
Grace Shen-Tu, B.Sc. (Hon)
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Institute of Medical Science, University of Toronto
© Copyright by Grace Shen-Tu 2010
ii
Role of lipid rafts in enterohemorragic Escherichia coli O157:H7 mediated hijacking of host cell signalling pathways to induce
intestinal injury
Grace Shen-Tu
Degree of Doctor of Philosophy
Graduate Department of Institute of Medical Science
University of Toronto
2010
Abstract
Enterohemorrhagic Escherichia coli O157:H7 (EHEC) is a human intestinal pathogen, which can
cause severe disease. EHEC O157:H7 is responsible for outbreaks of diarrhea and hemorrhagic
colitis. EHEC produces a potent cytotoxin known as Vero (Shiga-like) cytotoxin, which causes
diarrhea-associated hemolytic uremic syndrome (HUS), the most common cause of acute renal
failure in children. Current treatment remains predominantly supportive in nature because
antibiotics and non-steroidal anti-inflammatory drugs exacerbate the condition. Therefore,
alternative therapeutic approaches that will prevent the EHEC colonization without the release of
toxins need to be delineated. Understanding the pathobiology of disease is likely to yield novel
approaches to interrupt the infectious process.
My hypothesis was that pathogen-derived effectors associate with lipid rafts and, thereby,
promote the recruitment of host signal transduction proteins to lipid rafts in response to EHEC
O157:H7 infection. In this thesis, specific host signalling pathways hijacked by EHEC
O157:H7, through lipid raft signalling platforms, to elicit pathogenic effects are studied using
complementary approaches, including epithelial model cell lines and an animal model of
infection (Citrobacter rodentium challenge of mice).
A lack of osteopontin resulted in decreased attaching effacing lesions and reduced colonic
epithelial cell hyperplasia in response to C. rodentium infection. These findings suggest that C.
rodentium, mimicking EHEC O157:H7 infection, is capable of utilizing host cell components to
elicit its pathogenic effects.
iii
In vitro data showed that EHEC O157:H7 effector proteins manipulate cell signalling through
lipid rafts employed as platforms to recruit and activate host second messengers. PKC and PI3K
activation led to attaching and effacing lesions, disruption of tight junctions, and the initiation of
both innate and adaptive host immune responses. The results pointed towards a role for atypical
PKC in EHEC-induced attaching and effacing lesion formation.
The role of lipid rafts in EHEC O157:H7 pathogenesis was also studied using Citrobacter
rodentium-infected Niemann-pick type C (NPC) mice. Infection of NPC mice, which lack lipid
rafts, with C. rodentium resulted in delayed colonization and delayed onset of attaching-effacing
lesion formation, compared with infected wild type mice. C. rodentium-infected NPC mice also
demonstrated reduced colonic epithelial hyperplasia and decreased secretion of the pro-
inflammatory cytokine, interferon-γ.
Taken together, the findings presented in this thesis highlight the importance of host cell signal
transduction cascades in EHEC O157:H7 disease pathogenesis, and demonstrate a role for lipid
rafts and OPN in mediating host cell signaling responses to non-invasive enteric microbial
pathogens.
iv
Dedicated to my parents, Mr. Kuang Shen-Tu and Mrs. Chiung-Lin
Chen, and to my darling sister Ms. Nancy Ming Hsin Shen-Tu
v
Acknowledgements
First and foremost, I would like to thank God for His guidance. I’m grateful to have my entire
family, mom, dad, and my sister, Nancy, supporting me through my many years of study. To my
long time friends, Jeff and Willa, I would like to express my gratitude for their friendship and
encouragement. To my fiancé, Peter, I would like you to know how much I cherish your love,
patience and understanding during the preparation of this thesis.
All the Sherman lab rats, past and present, at the Hospital for Sick Children have provided me
with support and encouragements throughout my graduate years. First of all, I would like to
thank Kathene for all her advice, in and outside the lab. Secondly, I would like to thank all my
friends in the lab who helped me during my journey: Jason and Narveen, for helping me get
started in the lab; Melanie, for being a great friend and giving me lots of technical help; Nathan,
for his helpful comments and being my skiing buddy; David and Juan, for their friendship and
support. Thirdly, I would like to thank Stella, Jamie, and Dana for their friendship.
The completion of this thesis would not have been possible without the help from both Eytan
Wine and Kevin Donato. Eytan has shared with me his vast scientific knowledge during our
research discussions, he worked tirelessly on our OPN project, and he is always willing to lend
an ear whenever I needed suggestions. To the other doctor, Kevin, who started and completed
this journey with me, I would like to thank you for your technical input over the years, for your
entertainment and friendship, and for your cool when I’m sweating over giving talks.
I owe my deepest gratitude to my supervisor, Dr. Philip Sherman. He has mentored me every
step of this journey: in my studies, student life, and now career life. I have matured immensely,
professionally and personally, under this nurturing and guiding environment provided by Phil.
His encouragement and support not only improved my skills in science, it also prepared me for
the career challenges ahead. I will continue to apply what I learned in my future endeavors, but I
have to admit, the baby egret doesn’t want to leave the comforts of this lab.
I would also like to thank my supervisory committee, Dr. Mingyao Liu and Dr. Christine Bear,
who provided critical analysis and guidance during these past five years. Lastly, I would like to
acknowledge the funding that I have received through master and doctoral awards provided by
the Canadian Institutes of Health Research (CIHR).
vi
Table of Contents
Title page….. ................................................................................................................................... i
Abstract….. ..................................................................................................................................... ii
Dedications .................................................................................................................................... iv
Acknowledgements ......................................................................................................................... v
Table of Contents ........................................................................................................................... vi
Dissemination of Work Arising from This Thesis ......................................................................... ix
List of Abbreviations ...................................................................................................................... x
List of Tables ............................................................................................................................... xvi
List of Figures ............................................................................................................................. xvii
Chapter 1. Introduction .................................................................................................................. 1
1.1 Bacterial infections of the gastrointestinal system, pathophysiology and disease .............. 2
1.1.1 Structure, Physiology, and Function of the GI Tract .............................................. 2
1.1.2 The Intestinal Barrier .............................................................................................. 4
1.1.3 Epithelial Cell Cytoskeleton ................................................................................... 6
1.1.4 Shiga-liketoxin (Verocytotoxin)-producing Escherichia coli O157:H7 ................. 7
1.1.5 Citrobacter rodentium as an AE enteropathogen in mice .................................... 16
1.2 Host Defense and Exploitation of Host Responses by Pathogens .................................... 21
1.2.1 Bacterial virulence factors .................................................................................... 21
1.2.2 Immune defense in microbial recognition ............................................................ 22
1.2.3 Inflammatory and Innate Responses to Bacteria .................................................. 25
1.2.4 Microbial Manipulation of the Host Epithelium ................................................... 27
1.3 Host cell mechanisms hijacked by bacteria during infection ............................................ 33
1.3.1 Osteopontin ........................................................................................................... 33
1.3.2 Detergent-resistant Microdomains ........................................................................ 35
vii
1.3.3 PI3K family: role in cell signalling and cytoskeletal rearrangements .................. 36
1.3.4 PKC: role in bacterial infection ............................................................................ 45
1.4 In vivo model of lipid raft during bacteria infection ......................................................... 50
1.4.1 Niemann-Pick Type C Disease ............................................................................. 50
1.5 Alternative preventative strategies .................................................................................... 53
1.5.1 Probiotics .............................................................................................................. 53
1.5.2 Probiotics in Disease Management ....................................................................... 53
1.5.3 Mechanism of Action ............................................................................................ 54
Chapter 2. Hypothesis and Objectives ......................................................................................... 56
Chapter 3. Osteopontin Mediates Citrobacter rodentium-Induced Colonic Epithelial Cell
Hyperplasia and Attaching-Effacing Lesions ............................................................ 59
3.1 Abstract .............................................................................................................................. 60
3.2 Introduction ....................................................................................................................... 61
3.3 Materials and Methods ...................................................................................................... 63
3.4 Results ............................................................................................................................... 71
3.5 Discussion ......................................................................................................................... 89
3.6 Acknowledgements ........................................................................................................... 94
Chapter 4. Detergent-Resistant Microdomains Mediate Activation of Host Cell Signalling in
Response to Attaching-Effacing Bacteria .................................................................. 95
4.1 Abstract ............................................................................................................................. 96
4.2 Introduction ....................................................................................................................... 97
4.3 Materials and Methods ...................................................................................................... 99
4.4 Results ............................................................................................................................. 106
4.5 Discussion ....................................................................................................................... 127
4.6 Acknowledgements ......................................................................................................... 133
Chapter 5. Recruitment of Protein Kinase C to Lipid Rafts in Response to
Enterohemorrhagic Escherichia coli O157:H7 is blocked by Lactobacillus
helveticus R0052 ...................................................................................................... 134
viii
5.1 Abstract ........................................................................................................................... 135
5.2 Introduction ..................................................................................................................... 136
5.3 Materials and Methods .................................................................................................... 138
5.4 Results ............................................................................................................................. 142
5.5 Discussion ....................................................................................................................... 165
Chapter 6. Discussion, Future Directions, and Significance ..................................................... 168
6.1 Discussion ....................................................................................................................... 169
6.2 Future Directions ............................................................................................................ 176
6.3 Significance ..................................................................................................................... 179
Chapter 7. References ................................................................................................................ 180
ix
Dissemination of Work Arising from This Thesis
Chapter 3 was published as:
*Eytan Wine, *Grace Shen-Tu, Mélanie G. Gareau, Harvey A. Goldberg, Christoph
Licht, Bo-Yee Ngan, Esben S. Sorensen, James Greenaway, Jaro Sodek, Ron Zohar,
Philip M. Sherman. Osteopontin mediates Citrobacter rodentium-induced colonic
epithelial cell hyperplasia and attaching-effacing lesions. American Journal of Pathology
September, 2010 (In Press).
Chapter 4 was published as:
Grace Shen-Tu, David B. Schauer, Nicola L. Jones, and Philip M. Sherman. Detergent-
resistant microdomains mediate activation of host cell signaling in response to attaching–
effacing bacteria. Laboratory Investigation 2010; 90: 266-281.
Chapter 5 is currently in progress:
Grace Shen-Tu, Ming-Yau Lu, and Philip M. Sherman. Recruitment of Protein Kinase C
to Lipid Rafts in Response to Enterohemorrhagic Esherichia coli O157:H7 infection is
blocked by Lactobacillus helveticus R0052.
Publication cited elsewhere in this thesis was taken from:
Kathene C. Johnson-Henry, Kevin A. Donato, Grace Shen-Tu, Mahsa Gordanpour, and
Philip M. Sherman. Lactobacillus rhamnosus Strain GG Prevents Enterohemorrhagic
Escherichia coli O157:H7-Induced Changes in Epithelial Barrier Function. Infection and
Immunity 2008; 76(4): 1340-1348.
x
List of Abbreviations
Abbreviations Full Term
AE Attaching-effacing
Ab Antibody
ADP Adenosine diphosphate
AJC Apical junction complex
Akt Protein kinase B
AMP Adenosine monophosphate
AMPs Antimicrobial peptides
ANOVA Analysis of variance
aPKC Atypical protein kinase C
AQP Aquaporins
Arp 2/3 Actin-related proteins 2/3
ATP Adenosine triphosphate
BH Breakpoint-cluster-region homology
CD Cluster of differentiation
Cdc42 Cell division control protein 42 homolog
CDX 2/3 Caudal-related cdx 2/3 homeobox gene encoded nuclear transcription factor
CFTR Cystic fibrosis transmembrane conductance regulator
CFU Colony-forming units
CLC Chloride channels
CLCA Calcium activated chloride channels
cPKC Classical protein kinase C
CTS Type VI secretion system cluster
DAG Diacylglycerol
xi
DAI Disease acitivity index
DAPI 4’,6-diamidino-2-phenylindole
DMEM Dulbecco’s Modified Eagle Medium
DNA Deoxyribonucleic acid
DRM Detergent-resistant microdomains
DSS Dextran sulfate sodium
E. coli Escherichia coli
eae E. coli attaching and effacing gene
EHEC Enterohemorrhagic Esherichia coli
ELISA Enzyme-linked immunosorbent assay
EPEC Enteropathogenic Escherichia coli
Esp E. coli secreted protein
Eta-1 T-lymphocyte activation protein
F-actin Filamentous actin
FH Formin homology
FITC Fluorescein isothiocyanate
GAP GTPase activating protein
Gb3 Glycosphingolipid globotriaosylceramide
GI Gastrointestinal
GM1/2/3 Gangliosides
GSK3 Glycogen synthase kinase-3
GTP Guanosine triphosphate
HRP Horseradish peroxidase
HUS Haemolytic uremic syndrome
IBD Inflammatory bowel disease
IBS Irritable bowel syndrome
xii
IFN- Interferon-gamma
IgM/A Immunoglobulin M or A
IL Interleukin
Io liquid-ordered
IRS-1/2 Insulin receptor substrate 1/2
IS Insertion sequence
KC Keratinocyte chemoattractant
LB Luria Bertani
LDL Low density lipoprotein
LEE Locus of enterocyte effacement
LGG Lactobacillus GG
LifA Lymphocyte inhibitor factor A
LPS Lipopolysaccharide
Map Mitochondrial activated protein
MAPK Mitogen-activated protein kinase
MEM Minimum Essential Medium
MHC Major histocompatibility complex
MLC Myosin light chain
MLCK Myosin light chain kinase
MMP Matrix Metalloproteinase
mTOR mammalian target of rapamycin
MCD Methyl--cyclodextrin
NAIP Baculoviral IAP repeat-containing protein
NALP NACHT, LRR and PYD domains-containing protein
Nck Non-catalytic region of tyrosine kinase adaptor protein
NEC Necrotizing enterocolitis
xiii
Neu5Gc N-glycolylneuraminic acid
NF-B Nuclear factor kappa-light-chain-enhancer of activated B cells
Nle Non-LEE encoded effector
NLR Nod-like receptor
NOD Nucleotide-binding oligomerization domain
NPC Niemann-pick type C
nPKC Novel protein kinase C
N-WASP Wiskott-Aldrich syndrome protein
OPN Osteopontin
Osp Outter surface protein
P70S6K
p70 ribosomal S6 kinase
PAMPs Pathogen-associated molecular patterns
PAR Proteinase-activated receptor
PBS Phosphate buffered saline
PCR Polymerase chain reaction
PH Pleckstrin homology
PI Post-infection
PI3K Phosphoinositide 3-kinase
PIP2 Phosphatidylinositol 4,5-bisphosphate
PIP3 Phosphatidylinositol 3,4,5-triphosphate
PKC Protein kinase C
PLC Phospholipase C
PRR Pattern-recognition receptor
PtdIns Phosphatidylinositol
PTK Protein tyrosine kinase
Rab Ras-related protein
xiv
Rac Ras-related C3 botulinum toxin substrate
RAG Recombination-activating gene
Rho Ras homology gene family
RNA Ribonucleic acid
RND Resistance-nodulation-division
SBS Short bowel syndrome
SDS-PAGE Sodium dodecyl sulphate polyacrylamide gel electrophoresis
SH2/3 Src homology 2 or 3
SPI-6 Salmonella pathogenicity island 6
Src Sarcoma (proto-oncogenic tyrosine kinases)
STEC Shiga toxin-producing E. coli
Stx Shiga toxin
T1SS Type I secretion system
T2SS Type II secretion system
T5SS Type V secretion system
T6SS Type VI secretion system
TEM Transmission electron microscopy
Th or TH T helper
Tir Translocating intimin receptor
Tj Tight junction
TLRs Toll-like receptors
TNF- Tumor necrosis factor-alpha
TTP Thrombotic Thrombocytopenic purpura
TTSS Type III secretion system
VTEC Verocytotoxin-producing E. coli
WT Wild type
xv
ZO Zonula occludens
xvi
List of Tables
Table 1.1 Classification of O157 and non-O157 STEC .......................................................... 11
Table 1.2 List of virulence factors secreted by EPEC, EHEC, and C. rodentium ................ 12
Table 3.1 Colonic Inflammation Histological Score ............................................................... 65
Table 3.2 Modified Disease Activity Index Score .................................................................... 69
Table 4.1 Baterial strains and treatments used in the in vitro studies ................................ 100
Table 6.1 PKC inhibitors used in vitro, in vivo, and in human studies ............................... 177
xvii
List of Figures
Figure 1.1 Schematic diagram of EHEC O157:H7 signalling regulation of AE lesion
formation and barrier disruption. .......................................................................... 31
Figure 1.2 Schematic diagram of the PI3K family enzymes. ................................................. 38
Figure 1.3 Schematic diagram of class IA PI3K p85 regulatory subunit. ............................ 42
Figure 1.4 A: Schematic diagram of the structures of PKC isoforms. ................................. 47
Figure 3.1 OPN expression is increased in response to C. rodentium infection. ................... 73
Figure 3.2 Colonic epithelial cell hyperplasia and inflammation in response to C.
rodentium are associated with OPN. ...................................................................... 75
Figure 3.3 OPN mediates C. rodentium colonization. ............................................................. 77
Figure 3.4 Rectal OPN restores responses to C. rodentium infection in OPN-/-
mice. .......... 81
Figure 3.5 Formation of actin-dense attachment pedestals in mouse fibroblasts infected
by C. rodentium and EHEC O157:H7 is mediated by OPN. ................................ 83
Figure 3.6 Exogenous OPN does not restore adhesion pedestals in vitro. ............................. 85
Figure 3.7 Actin-dense pedestals are formed in C. rodentium-infected WT mice and
reduced in OPN-/-
mice. ........................................................................................... 87
Figure 4.1 Phosphoinositide 3-kinase (PI3K) is recruited to lipid rafts in response to
enterohaemorrhagic Escherichia coli O157:H7 infection, and newly
synthesized bacterial proteins are required for PI3K recruitment to lipid
rafts. ........................................................................................................................ 107
Figure 4.2 Activated phosphoinositide 3-kinase (PI3K) is recruitment to lipid rafts in
response to infection independent of the type III secretion system and Shiga-
like toxins 1 and 2. ................................................................................................. 109
Figure 4.3 Intact lipid microdomains are required for EHEC induced translocation of
phosphoinositide 3-kinase (PI3K) to lipid rafts, while secreted bacterial
factors are insufficient to induce this recruitment. ............................................. 112
Figure 4.4 Citrobacter rodentium colonization is delayed in the colonic mucosa of NPC -
/- mice. ...................................................................................................................... 115
Figure 4.5 Attaching-effacing lesions induced by Citrobacter rodentium infection are
delayed in NPC -/-
mice. ......................................................................................... 117
xviii
Figure 4.6 Citrobacter rodentium-induced epithelial cell hyperplasia is reduced in NPC-/-
mice. ........................................................................................................................ 120
Figure 4.7 Colonocyte proliferation is reduced in NPC -/-
mice infected with Citrobacter
rodentium. ............................................................................................................... 122
Figure 4.8 Altered cytokine profiles in NPC -/-
mice infected with Citrobacter rodentium. 125
Figure 5.1 PKC is recruited to lipid rafts during EHEC O157:H7 infection. ................... 143
Figure 5.2 Newly synthesized bacterial proteins and intact lipid rafts are required for
PKC recruitment to lipid rafts in response to EHEC infection. ........................ 145
Figure 5.3 Western blots of protein kinase C from ultracentrifugation fractions of
whole cell extracts (Intestine 407 cells). ............................................................... 147
Figure 5.4 Recruitment of PKC is independent of the type III secretion system and the
production of Shiga toxins 1 and 2. ...................................................................... 149
Figure 5.5 Recruitment of PKC is dependent on intact lipid rafts on the plasma
membrane of host epithelial cells. ........................................................................ 153
Figure 5.6 EHEC-induced recruitment of PKC is not blocked by bisindolylmaleimide I. 155
Figure 5.7 PKC inhibitor Gö6983 prevents recruitment of atypical protein kinase C
(PKC) isoforms to lipid rafts in response to Escherichia coli O157:H7
infection. ................................................................................................................. 157
Figure 5.8 Atypical isoform of PKC is involved in the recruitment of PKC to lipid rafts
in response to EHEC O157:H7 infection. ............................................................ 159
Figure 5.9 An atypical isoform of PKC is involved in EHEC O157:H7-induced AE
lesion formation. .................................................................................................... 161
Figure 5.10 The recruitment of host signalling proteins is blocked by pretreating the
cells with probiotics. .............................................................................................. 163
Figure 6.1 Schematic diagram of suggested infectious process of EHEC O157:H7,
leading to AE lesion formation and barrier disruption. .................................... 174
1
Chapter 1.
Introduction
2
1.1 Bacterial infections of the gastrointestinal system,
pathophysiology and disease
The gastrointestinal (GI) tract has multiple roles, but its primary function is to convey nutrients
and water from the external environment into the mammalian body. This complex interface
starts from the oral cavity and extends caudally to the anus. The intestinal epithelium has the
largest mucosal surface area of the body, because it is required for digestive, absorptive,
excretory, and immunological functions (Mirpuri, Brazil et al. 2010).
Since the GI tract is continuously exposed to the outside environment, it has several protection
systems, including: low pH in the stomach, lining of the complete GI tract with a surface mucus
layer, a single cell layer of polarized epithelia, an enormous population of innate and adaptive
immune cells that lie beneath the epithelial surface in the submucosa, and the presence of
commensal microbes that colonize, to variable numbers and complexity, the lumen of the GI
tract (Tlaskalova-Hogenova et al. 2004; Zoetendal et al. 2008).
One of the key features of the GI tract is to regulate molecular trafficking between the intestinal
lumen and the submucosa, distinguishing between self and non-self; mounting immune
responses against pathogens while being tolerant of dietary antigens and beneficial bacteria
(Garrett, Gordon et al. 2010). Intestinal permeability is what regulates macromolecule
trafficking and its regulation is dependent on the integrity of intercellular tight junctions (tj)
(Turner 2009). In the past, tj were thought to be a fixed and unregulated barrier in the
paracellular space and its contribution to GI tract molecule trafficking was negligible. However,
it is now evident that tj are important, dynamic structures involved in GI development,
physiology, and function both in health and in a variety of disease states, including enteric
infections (Marchiando, Graham et al. 2010).
1.1.1 Structure, Physiology, and Function of the GI Tract
1.1.1.1 Structural components of the intestine
3
Four different types of epithelial cells line the villi and crypts of the small intestine. The four
major epithelial cells include: absorptive enterocytes, goblet cells, enteroendocrine cells, and
Paneth cells. Enterocytes are polarized epithelial cells that are joined together via tj. They take
up and process luminal antigens through fluid-phase endocytosis. Enterocytes express class I
and II (in settings of inflammation) MHC molecules in order to present processed antigens to T-
cells (Snoeck, Goddeeris et al. 2005). Intestinal epithelial cells can be further divided according
to their proliferative activity, where cells in the crypt region have the highest activity while
surface epithelial cells are non-proliferative and more differentiated. Conventional thought is
that crypt cells are secretory in function, while enterocytes are absorptive. The intestinal villi are
lined by functional absorptive, goblet, and endocrine cells. The crypts contain stem cells, both
proliferative and poorly differentiated, as well as highly differentiated secretory Paneth cells.
The proliferative crypt cells differentiate into different cell types and either move upward toward
the villus (mainly cells with absorptive, mucus secretion, or hormone-producing functions) or
downward to the bottom of the crypt (Paneth cells) (Karam 1999). Recent studies point toward
the role of p38 mitogen-activated protein kinase (MAPKs) in interacting with CDX 2/3,
enhancing its transcription activity, and stimulating intestinal differentiation (Houde, Laprise et
al. 2001).
Goblet cells are found along the entire intestinal tract and their primary function is to secrete a
variety of mucins and trefoil peptides for lubrication and to protect the mucosa from irritation
(Artis and Grencis 2008).
The enteroendocrine cells are located deeper in gastric glands and in the lower portions of
intestinal crypts. These enteroendocrine cells are specialized to secrete a particular hormone that
influences either gastrointestinal secretion or motility (Mellitzer, Beucher et al. 2010).
Paneth cells are secretory epithelial cells located at the ends of intestinal crypts. The function of
these cells is secretion of antimicrobial cryptdins or defensins, and growth factors into the crypt
lumen (Vaishnava, Behrendt et al. 2008).
1.1.1.2 Water and electrolyte absorption
4
One of the critical roles of the intestinal system is water and electrolyte absorption. Water
absorption is passive and, therefore, depends on rates of solute transport. In the basolateral
plasma membrane, there are sodium-potassium pumps that provide the energy for driving
transcellular and paracellular flows of fluid across the gut epithelium. There is also
transepithelial resistance, regulated mainly by intercellular tight junctions (Groschwitz and
Hogan 2009). Transcellular flow of water, on the other hand, is dependent mainly on sodium-
linked solute co-transporters in the apical microvillus membrane of small intestinal enterocytes.
Aquaporins (AQP), membrane proteins with high water selectivity, are also important in
transcellular fluid movement (Hansen, Holt et al. 2009). These protein channels are located in
apical and basolateral sides of the epithelial cell in both the small intestine and colon.
Intestinal absorption relies on sodium transport, whereas intestinal secretion is associated with
chloride transport through the cystic fibrosis transmembrane conductance regulator (CFTR)
present in the apical plasma membrane of gut epithelial cells. Unwarranted CFTR activity leads
to secretory diarrhea in response to bacterial-derived toxins, including choleragen of Vibrio
cholerae (Venkatasubramanian, Ao et al. 2010) and heat-labile enterotoxin of enterotoxigenic
Escherichia coli, ETEC (Crane, Choudhari et al. 2006).
Other chloride channels present in the intestine include the CLC family and the calcium activated
chloride channel (CLCA). The precise functional role of these chloride channels remains
unclear; however, it has been suggested that they play a role in neural (cholinergic) mediated ion
and water secretion in the colon (Catalan, Niemeyer et al. 2004; Basavappa, Vulapalli et al.
2005).
1.1.2 The Intestinal Barrier
1.1.2.1 Selectively permeable barrier
Barriers created by epithelial cells are essential to life. This is particularly true along the
gastrointestinal tract, where the epithelial barrier is responsible for nutrient and water transport
and, at the same time, the prevention of microbial contamination of the interstitial and systemic
tissues. The intercellular tight junction (tj) is the primary cellular determinant of epithelial
5
barrier function (Groschwitz and Hogan 2009). The tj is responsible for both absorption and
secretory functions of the epithelia and is also a barrier between the apical and basolateral
compartments. Tj closely regulate the passive diffusion of ions and macromolecules through the
paracellular pathway and, thereby, control gradients created by the transcellular pathway
(Groschwitz and Hogan 2009). Other apical junction complex constituents, such as adherence
junctions and desmosomes, provide strong bonds essential for maintaining cellular proximity that
allows for tj formation (Marchiando, Graham et al. 2010).
Despite the presence of tj that seems to create an impermeable barrier, the electrical resistance of
the paracellular pathway varies by as much as one thousand-fold between different polarized
epithelia (Marchiando, Graham et al. 2010). The range of tight junction barrier function makes
water and nutrients absorption in the small intestine possible and the pore size through the
epithelium decreases in the distal intestine. Tj are complex and dynamic structures, which are
tightly regulated by a number of transmembrane, cytoskeletal, and regulatory proteins (Turner
2009).
Important transmembrane proteins in the tj include 24 members of the claudin family, which
regulate several aspects of tight junction permeability. Claudins are expressed in a tissue-
specific manner, and mutation or deletion of claudin family members can result in organ
dysfunction. The transmembrane tj protein, occludin, interacts directly with claudins and F-
actin, to regulate permeability (Groschwitz and Hogan 2009). Peripheral membrane proteins
zonula occludens 1, 2, and 3 (ZO-1, ZO-2, and ZO-3) contain three PDZ domains within their
amino-terminal portion. PDZ domains are involved in protein interactions and allow ZO-1, ZO-
2, and ZO-3, to bind to the carboxy terminal of claudins. This is critical because deletion or
mutation of the PDZ-binding motif prevents efficient claudins, occludin, and actin targeting to
the tight junction (Turner 2009).
1.1.2.2 Tight junction barrier regulation and effects on absorption
Even though the majority of claudin-1 is anchored at the tight junction in epithelial monolayers,
recent studies have shown a dynamic tight junction protein behavior (Groschwitz and Hogan
2009). Immunofluorescence imaging has shown that the majority of tight junction-associated
6
ZO-1 and occludin are present in endocytosed vacuoles, via caveolae, that allows them to rapidly
move in and out of specific regions within the tight junction in a calcium-dependent manner
(Ivanov, Nusrat et al. 2004). Thus, although ZO-1 and occludin interact at the tight junction, this
interaction is constantly disassembling and reassembling (Shen, Weber et al. 2008).
The Ca2+
–calmodulin-dependent serine–threonine protein kinase myosin light chain kinase
(MLCK) is important in sodium–nutrient co-transport-induced tight junction regulation (Turner
2009). MLCK inhibition prevents MLC phosphorylation and disrupts epithelial barrier
regulation induced by Na+-glucose cotransport and blocks barrier regulation in intact intestinal
mucosa (Turner, Rill et al. 1997). Enteropathogenic Escherichia coli infection induces MLCK-
dependent MLC phosphorylation with increased tight junction permeability, indicating that
MLCK-dependent MLC phosphorylation is both a physiological and a pathophysiological
regulator of barrier function (Yuhan, Koutsouris et al. 1997). Moreover, enzymatic MLCK
activation is sufficient to trigger downstream signaling events essential for barrier regulation
(Shen, Black et al. 2006).
1.1.2.3 Epithelial barrier regulated by immune stimuli and
cytoskeleton
Cytokines, such as IFN-γ and TNF-alpha, also have the ability to regulate barrier function
(Bruewer, Luegering et al. 2003). Increased tight junction protein expression, removal of
proteins from the tj, junction protein degradation, kinase activation, and cytoskeletal
rearrangements all have been implicated in mediating cytokine-induced disruption of intestinal
barrier function. MLCK has a crucial role in TNF-alpha-induced epithelial barrier dysregulation,
both in vitro (Zolotarevsky, Hecht et al. 2002) and in vivo (Shen, Su et al. 2009). MLC
phosphorylation within the perijunctional actomyosin ring leads to increased myosin ATPase
activity, which is involved in tj regulation (Capaldo and Nusrat 2009). Both Rho family kinases
and AMP-activated protein kinase can directly phosphorylate MLC and inhibit MLC
phosphatase and, in turn, contribute to tj regulation (Utech, Ivanov et al. 2005; Capaldo and
Nusrat 2009).
1.1.3 Epithelial Cell Cytoskeleton
7
Eukaryotic cells include three types of cytoskeletons: actin filaments, microtubules, and
intermediate filaments. These polymers are assembled from individual monomers in a reversible
fashion (Ku, Zhou et al. 1999). Knowledge of host cell actin filament architecture is needed in
order to learn the process of cell movement, host defenses, and bacterial and viral pathogenesis
(Burckhardt and Greber 2009; Guttman and Finlay 2009; Huang and Brumell 2009; Olson and
Nordheim 2010).
1.1.3.1 Actin regulation
Actin exists in two forms: monomeric and filamentous actin (F-actin), which is two helical
polymeric chains of actin monomers. Actin polymerization in vitro involves three steps: (1)
nucleation (formation of actin oligomers to form filaments later on); (2) elongation; and (3)
treadmilling (movement of monomers along the filament) (Le Clainche and Carlier 2008). Actin
nucleation is promoted by high actin-ATP concentration (Bean and Amann 2008), where the
nuclei persist longer for polymers to form. During elongation, ATP-dependent profilin and
thymosin activity promote polymerization, whereas depolymerization of ADP-actin at the
opposite end is promoted by cofilin (Le Clainche and Carlier 2008). These processes are strictly
regulated by other signalling cascades. For example, the Rho family of proteins, Rho, Rac, and
Cdc42, are activated, bind to, and induce conformational changes in the Wiskott-Aldrich
syndrome protein (N-WASP) family of proteins, exposing binding sites for the Arp2/3 complex
(Miki and Takenawa 2003). Binding of N-WASP protein to the Arp2/3 complex alters the
conformation of the complex and initiates actin filament elongation (Miki and Takenawa 2003).
Another example is formins, a group of multidomain proteins with formin homology (FH)
domains, which play a role in the regulation of cell shape and polarity (Schonichen and Geyer
2010). The formins, in the presence of profilin, nucleate the growth of actin assembly and
produce linear actin filaments. Formins at the peripheral membrane induce actin monomers to
add to growing filaments at the membrane-actin cytoskeleton interface resulting in directional
actin assembly for membrane protrusion (Chesarone, DuPage et al. 2010).
1.1.4 Shiga-liketoxin (Verocytotoxin)-producing Escherichia coli
O157:H7
8
Haemolytic uraemic syndrome (HUS), the leading cause of acute renal failure in children, and
haemorrhagic colitis are some of the major clinical symptoms associated with
enterohaemorrhagic Escherichia coli, serotype O157:H7 (EHEC) infection (Karch 2001). EHEC
constitutes a subset of serotypes called Shiga toxin-producing E. coli (STEC), where bacterial-
derived toxins function as virulence factors during disease pathogenesis (Karmali, Petric et al.
1985).
1.1.4.1 Clinical presentations of E. coli O157:H7 infection
E. coli O157:H7 infection is a major health issue in North America, Europe, and other areas of
the world. E. coli O157:H7 infection leads to high hospitalization and case-fatality rates, wells
above more common infections caused by non-typhoidal Salmonellae and Campylobacters
(Slutsker, Ries et al. 1997).
Human infection by enterohemorrhagic Escherichia coli (EHEC) O157:H7 leads to a broad
clinical spectrum, ranging from asymptomatic colonization to death. The majority of infected
individuals initially experience non-bloody diarrhea, which resolves without further
complications (Tarr 1995). However, some patients will experience bloody diarrhea in the first 3
days of infection. Up to 10% of hemorrhagic colitis patients progress to develop either HUS or
thrombotic thrombocytopenic purpura (TTP) (Manning, Motiwala et al. 2008).
Currently, there is no effective treatment for EHEC infection and the use antibiotics may cause
more harm than good (Wong, Jelacic et al. 2000). Therefore, treatment is mainly supportive in
nature (Bavaro 2009). Further understanding of disease pathogenesis is required to be able to
develop novel intervention strategies to reduce the current burden of illness.
1.1.4.2 Bacterial Virulence: Evolution and Acquisition
It is wrong to assume E. coli is a homogenous species. In fact, the composition of the E. coli
genome is highly dynamic. For example, the fully sequenced genome of E. coli, strain K-12
showed that more than 200 lateral gene transfer events have occurred since it diverged from
Salmonella and 18% of contemporary genes were obtained through horizontal transfer from
other species.
9
Virulence factors that separate various types of E. coli that cause enteric disease were acquired
through plasmids, bacteriophages, and genes from other bacteria (Lim, Yoon et al. 2010). The
evolution of EHEC O157:H7 likely began with an EPEC-like, serogroup O55 ancestor. From
this ancestor, EHEC O157:H7 has emerged through: (1) inheritance of the LEE pathogencity
island; (2) acquisition of a stx2-containing bacteriophage; and (3) acquisition of pO157 plasmid,
and (4) change of the rfb region somatic antigen from O55 to O157 (Donnenberg and Whittam
2001). Thereafter, evolution, diverged in 2 directions: the bacterial lineage lost motility, but
retained Stx2 to give rise to an O157:H- clone followed by acquisition of the stx1-containing
bacteriophage; and loss of the ability to ferment D-sorbitol and loss of beta-glucuronidase
(GUD) activity to give rise to the common O157:H7 clone that has now spread world-wide
(Donnenberg and Whittam 2001; Feng, Monday et al. 2007).
Seropathotype classification of various Shiga toxin (Stx)-producing E. coli
Although serotype O157:H7 has been implicated in most human disease outbreaks and in most
HUS cases, there are approximately 200 non-O157 STEC serotypes that are associated with
human illness (Karmali 2004). Canada had the first non-O157 serotype association with HUS,
and since then there have been increasing reports of non-O157 serogroups being implicated in
HUS in Latin America and Australia, and their frequency is also increasingly recognized in
European countries. Recent data indicate that as many as 20% of HUS cases in North America
are associated with non-O157 STEC (Karmali, Mascarenhas et al. 2003). STEC serotypes seem
to differ in pathogenic potential; therefore, the clinical and public health risks have been assessed
and the serotypes have been classified according to frequency of outbreaks and severity of
disease (Table 1.1) (Karmali, Mascarenhas et al. 2003).
1.1.4.3 LEE Pathogenicity Island: LEE-encoded and non-LEE
encoded bacterial virulence factors
Diarrheagenic enterohaemorrhagic Escherichia coli (EHEC), enteropathogenic E. coli (EPEC),
and Citrobacter rodentium are all non-invasive AE pathogens. They elicit their pathogenic
effects through secreted bacterial effector proteins/virulence factors and there is a diverse set of
virulence determinants that distinguish them according to phenotype and pathology (Tobe,
10
Beatson et al. 2006). The locus of enterocyte effacement (LEE) is conserved in both EHEC
O157:H7 and EPEC and associated strongly with human disease (Deng, Puente et al. 2004).
The EHEC LEE is 45kb in size and has a 7.5kb prophage sequence that is not present in EPEC
(Yang, Kim et al. 2009). The LEE contains at least 41 different genes responsible for the
following major regions: (1) a type III secretion system (TTSS) that translocates molecules either
to the outside of the bacterium or directly into the host cell; (2) an adhesin, intimin, and its
translocated receptor, Tir (EspE), which is shuttled into the host cell membrane by the TTSS;
and (3) secreted proteins (Esp’s) (Table 1.2) that are important in manipulating host cell signal
transduction and attaching-effacing (A/E) lesion formation by cytoskeleton rearrangements
(Spears, Roe et al. 2006).
LEE-ecoded TTSS structural bacterial factors are: EspA, pilus protein of TTSS; EspB,
component of the translocation pore on the host cell surface; and EspD, interact with EspB for
form the translocation pore. Some of these bacterial secreted proteins include: EspF, which is
involved in the disruption of intercellular tight junctions; Map, involved in the disruption of tight
junctions and the formation of filopodium; EspH, playing a role in the disruption of cytoskeleton;
and EspG/G2, involved in disruption and modulation of the cytoskeleton (Deng, Puente et al.
2004; Tobe, Beatson et al. 2006); and EspFU/TccP, activates N-WASP, in a similar fashion as
Nck in EPEC infection, in AE lesion formation (Crepin, Girard et al. 2010).
Recently, more and more non-LEE encoded effectors have been identified (Table 1.2), and
determination of their function will advance the understanding of EHEC O157:H7 disease
pathogenesis. Some of the non-LEE-encoded virulence factors include: adhesins, responsible for
initial epithelial cell interactions by both EHEC and EPEC; NleH, homologous to the Shigella
effector OspG, which is a protein kinase that prevents ubiquitination and subsequent degradation
of phosphor-IθBα and downstream activation of the transcriptional factor NF-θB (Hemrajani,
Berger et al. 2010); OspG, a protein kinase that interferes with the NF-θB signaling; and OspD
and OspE, with currently unknown functions (Spears, Roe et al. 2006).
11
Table 1.1 Classification of O157 and non-O157 STEC (Karmali, Mascarenhas et al. 2003)
12
Table 1.2 List of virulence factors secreted by EPEC, EHEC, and C. rodentium (Spears,
Roe et al. 2006)
Effector protein Location in the genome Function(s)
EspA LEE pilus protein of E. coli TTSS, flagellar fillament
EspB LEEcomponent of translocation pore and modulate
host cell cytoskeleton
EspD LEEinteract with EspB to form translocation pore,
biogenesis of the EspA filaments
Tir/EspE LEE
extracellular domain binds intimin and
intracellular N and C termini tyrosin
phosphorylated, recruit cytoskeletal proteins, lead
EspG LEEformation of actin stress fibers and disrupt of
microtubule networks
EspF LEE
disrupt intestinal barrier function, permeabilize
mitochondrion membrane, modulate IF network,
remodel microvilli, induce mitochondrial death,
play direct role in EPEC-induced cell death
(apoptosis)
EspH LEE modulate the host actin cytoskeleton structure
Map LEE
induce host cell actin dynamics, disrupt tight-
junction barrier function, mimick GTP-active form
of Rho-family GTPases (Alto et al., 2006),
stimulate Cdc42-dependent filopodia formation
and disruption of mitochondrial membrane
potential
EspZ/SepZ LEEmay play a role in causing severe colonic
hyperplasia in mice.
EspJ CP-933Unot required for A/E lesion formation, plays a role
in host survival and pathogen transmission.
NleA/EspI CP-933P not required for A/E lesion formation.
NleB ~ F non-LEE
associated directly or indirectly with the
colonization and pathogenesis of EHEC, EPEC, or
C. rodentium .
NleG non-LEE role not determined
NleH non-LEE role in early C. rodentium infection process
EPEC/EHEC/C. rodentium
13
Effector protein Location in the genome Function(s)
Type 1 fimbriae fim operon adherence to α-D-mannose-containing glycoproteins
Type IV pilus (Bfp) EAF plasmid initial adherence to epithelial cells
Orf3/EspG2 EspC PAI plays a similar role as EspG
Intimin LEE intimate attachment adhesion molecule
OmpA ompA mediates HeLa cell adherence
Escherichia coli
factor for adherence
(Eta)
efal (EHEC), toxB
(O157), lifA (EPEC)
adherence – intestinal colonization, posttranscription
regulation of TTSS
Flagellin fliC motility and adherence; H6 – EPEC, H7 – EHEC
Secreted serine
protease
espC (EPEC), espP
(EHEC)
epithelial/tight junction disruption, mucinase,
interference with complement cascade
Cif
(Cycle inhibiting
factor)
ι Prophage
induce recruitment of focal adhesion plaques,
assembly of stress fiers, inhibition of cell cycle G2/M
phase transition, and lead to accumulation of inactive
phophorylated Cdk1 (Marches et al., 2003)
Long polar fimbriae Ipf and IpA operonspossible involvement in follicle-associated
epithelium
Secreted protease
of C1 esterase
inhibitor (StcE)
non-LEE C1-INH protease
Shiga-like toxins
1/2non-LEE inhibits protein synthesis
Haemolysin non-LEEcytotoxic to red blood cells, leukocytes, and
fibroblasts
TccP/EspFU (Tir-
cytoskeleton
coupling protein)
CP-933U
associate indirectly with Tir, binds N-WASP, and
stimulates Nck-independent actin polymerization,
alter polarized epithelial barrier function (similar to
EspF function).
EPEC
EPEC/EHEC
EHEC
14
1.1.4.4 Shiga-like toxins
Shiga toxin is the prototype of the Shiga toxin family, a group of structurally and functionally
related exotoxins. This family includes Shiga toxin derived from Shigella dysenteriae serotype 1
and the Shiga-like toxins produced by STEC (Johannes and Romer 2010).
In 1897, the Japanese microbiologist Professor Kiyochi Shiga characterized the bacterial origin
of dysentery as being caused by S. dysenteriae. Konowalchuk, in 1977, identified a group of E.
coli isolates that are able to kill Vero cells in culture by secreting a factor into the tissue culture
medium. These bacteria were named Verotoxin-producing E. coli (VTEC). By the early 1980s,
Alison O’Brien and her research group discovered that some E. coli produced a toxin very
similar to Shiga toxin and, therefore, named these microorganisms Shiga-like toxin-producing E.
coli (STEC) (Johannes and Romer 2010). Later, it became clear that VTEC and STEC are two
names describing the same organisms and toxins.
Shiga-like toxin 1 (Stx1) produced by E. coli is nearly identical to the Shiga toxin prototype,
since they only differ by a single amino acid in the catalytic A subunit of the toxin (Johannes and
Romer 2010). STEC produce both Stx1 and Stx2 variants. The two toxins signal through a
common receptor (CD77, also referred to as Gb3) and have the same intracellular mechanism of
action, but they only share 56% homology at the amino acid sequence level. Stx2-producing
STEC have been linked epidemiologically to more severe disease in infected humans and to
more neurological symptoms in challenged gnotobiotic piglets than strains producing only Stx1
(Schuller, Frankel et al. 2004).
Shiga toxin family members consist of a single enzymatically active A-subunit (molecular mass
of 32 kDa) and five identical B-subunits (pentamer with each B fragment weighing at 7.7 kDa)
allowing the toxin to bind to the target cell surface receptors. Such AB5 toxins have a strong
affinity for glycans terminating in the sialic acid N-glycolylneuraminic acid (Neu5Gc), a
monosaccharide that creates high-affinity receptors on human gut epithelia and kidney
vasculature (Byres, Paton et al. 2008).
15
StxA possesses specific RNA N-glycosidase activity that cleaves a single adenine residue from
the 28S rRNA of the 60S ribosomal subunit, resulting in the inhibition of elongation factor-
dependent aminoacyl tRNA binding and chain elongation in host cell protein synthesis process
(Suh, Hovde et al. 1998).
StxB binds to the receptor glycosphingolipid globotriaosylceramide (Gb3; also known as CD77),
present on cell surface, leading to the internalization of the toxin (Lingwood 1996). Gb3 fatty
acid heterogeneity, hydroxylation, length of carbon chain, and degree of saturation each may
influence the lateral movement of the glycolipid receptor in the plasma membrane. The
conformation of the head group presented on the cell surface may also be affected. The
membrane environment, dissociation of the receptor from lipid rafts, and membrane cholesterol
content are all important in the recognition and intracellular trafficking of Stx’s (Ling, Boodhoo
et al. 1998; Soltyk, MacKenzie et al. 2002).
Shiga toxin is internalized into host cells via endocytosis. The toxin is associated with clathrin-
dependent endocytosis; however, Shiga toxin is still taken up efficiently when clathrin-dependent
endocytosis is inhibited (Johannes and Romer 2010). This finding shows that the clathrin
pathway is not essential for the initial steps of toxin entry. Toxin-induced plasma membrane
invagination is dependent on the host cellular machinery involving dynamin, actin, and plasma
membrane cholesterol. Shiga toxin promotes membrane reordering and establishes membrane
environments that form detergent-insoluble complexes (Nakajima, Kiyokawa et al. 2001).
Toxin-induced lipid partition drives nanocompartmentalization at the cytoplasmic level to induce
the recruitment of an intracellular sorting machinery and toxin translocation (Mahfoud, Manis et
al. 2009).
1.1.4.5 Transmission of STEC
Cattle are the major reservoir of EHEC O157:H7, but they are not affected by this
microorganism. Many other farm animals such as sheep, goats, pigs, and turkeys can also shed
EHEC O157:H7 in their feces (Williams, McGregor et al. 2008). The most common route of
transmission for EHEC to humans is via ingestion of contaminated foods and water (Lim, Yoon
et al. 2010). In addition, it can also spread from person to person and from animal to person
16
(Donnenberg and Whittam 2001). For example, STEC infections have been noted in people
visiting petting zoos, dairy farms, and camp sites where cattle used to reside. There have also
been reports suggesting potential airborne transmission in buildings with animal exhibits (Varma,
Greene et al. 2003).
Contaminated food sources
Contaminated ground beef is the most common vehicle for EHEC O157:H7 outbreaks. In the
process of grinding beef, pathogens contaminating the surface of the meat are transferred to the
interior; therefore, to ensure complete killing of the bacteria, ground beef should be cooked all
the way through (Welinder-Olsson and Kaijser 2005). Other contaminated food vehicles linked
to EHEC O157:H7 outbreaks including: unpasteurized milk, fresh produce, and drinking water.
Epidemiological studies suggest that these food sources were contaminated by bovine and feral
swine fecal materials (Donnenberg and Whittam 2001).
1.1.5 Citrobacter rodentium as an AE enteropathogen in mice
EPEC and EHEC do not readily colonize and cause disease in mice. Therefore, a related murine-
specific, non-invasive AE enteric pathogen is widely employed as a relevant animal model of
human disease (Mundy, MacDonald et al. 2005). Citrobacter rodentium belongs to the family of
bacterial pathogens, including EPEC and EHEC, that causes attaching-effacing (AE) lesions in
infected hosts. The histopathological features of these pathogens are intimate adherence to the
host intestinal epithelial cells and the effacement of brushborder microvilli. C. rodentium is
presently the only known murine AE pathogen (Bergstrom, Kissoon-Singh et al. 2010).
1.1.5.1 Ancestry and Phylogeny
Citrobacter rodentium, formerly Citrobacter freundii biotype 4280, is a highly infectious
pathogen that causes transmissible murine colonic hyperplasia (Deng, Li et al. 2001). In the
1960s and 1970s there were spontaneous infectious outbreaks in mouse colonies that occurred in
the United States and Japan. These infections were associated with the Gram-negative pathogen
Escherichia coli, Citrobacter freundii biotype 4280 now referred to as C. rodentium.
17
The genome of C. rodentium ICC168 contains a 5.3 Mb circular chromosome and four plasmids,
pCROD1, pCROD2, pCROD3, and pCRP3, that are 54 to 3kb in size. The genome sequence of
C. rodentium identified key phylogenetic information of C. rodentium and revealed 1, 585 C.
rodentium-specific coding sequences (no orthologues in EPEC or EHEC), 10 prophage-like
regions, and 17 genomic islands, including the LEE region, which encodes the TTSS and
effector proteins (Petty, Bulgin et al. 2010).
The genome of C. rodentium genome has similarity with E. coli K-12 and other
Enterobacteriaceae (Petty, Bulgin et al. 2010). In a phylogenetic study, C. rodentium clusters
within the phylogenetic tree between other members of the Enterobacteriaceae; however, C.
rodentium is more distantly reltated to E. coli than E. coli is to Salmonella. Furthermore,
genomic evidence shows that sequenced species within the genus Citrobacter do not cluster and
that the genus is polyphyletic. From comparisons of the gene sets of C. rodentium, EPEC, and
EHEC, it is apparent that there is a large percentage (~32%) of the C. rodentium genome that is
unique (Petty, Bulgin et al. 2010).
On the other hand, there are a number of homologous genes present in C. rodentium, EPEC, and
EHEC that are not found in the K-12 reference strain (Ren, Beatson et al. 2005; Petty, Bulgin et
al. 2010). The majority of such genes are located on mobile genetic elements and contain many
key virulence determinants, such as the Locus of enterocyte effacement (LEE) and TTSS effector
proteins (Hoffmann, Hill et al. 2009; Tauschek, Yang et al. 2010). The virulence acquisition
mechanism of C. rodentium effectors is similar to that used by both EPEC and EHEC, which is
specialized transduction by lambdoid phages (Deng, Li et al. 2001; Petty, Bulgin et al. 2010).
Yet, even though cargo genes are found at analogous sites in the bacterial genomes, phage gene
comparisons show that they probably came from distinct phages. The acquisition of the LEE and
its associated effector proteins probably had a dramatic effect on the pathogenesis of C.
rodentium in the mouse. Although C. rodentium is genetically distinct from EPEC and EHEC
and does not infect the same host, the three bacteria share similar infection mechanisms and
virulence genes that are found on mobile genetic elements (Petty, Bulgin et al. 2010).
1.1.5.2 LEE and TTSS
18
The locus of enterocyte effacement (LEE) pathogenicity island, including the associated type III
secretion system (TTSS), is conserved amongst EPEC, EHEC, and C. rodentium genomes.
However, there are some notable differences: while the LEE of EPEC and EHEC are in the SelC
tRNA locus, the C. rodentium LEE is inserted into a non-synonymous location flanked by
insertion sequence (IS) elements (Petty, Bulgin et al. 2010). In contrast to EPEC and EHEC, the
rorf1 and espG genes of C. rodentium are located at the opposite end of the LEE (Deng, Li et al.
2001).
There are 35 genes in C. rodentium that encode proteins with great sequence homology to known
TTSS effector proteins that are translocated by C. rodentium TTSS (Petty, Bulgin et al. 2010).
These effector proteins are encoded on the LEE, prophage remnants (CPRr13, CPRr17, and
CPRr33), and genomic islands. The prophage-like elements share similarity with the lambdoid
prophages identified in the genomes of EPEC and EHEC (Iguchi, Thomson et al. 2009). CRPr13
encodes effectors homologues to effectors encoded on EHEC prophage Sp6. CRPr17 encodes
effectors homologues to NleC, NleB, and NleG encoded on lambdoid prophages in EPEC and
EHEC (Petty, Bulgin et al. 2010).
In addition to effectors homologues to EPEC and EHEC, C. rodentium also encodes new TTSS
translocated proteins, including EspS, which has some similarity to OspB of Shigella dysenteria.
EspS is translocated in an EspA (molecular syringe filament)-dependent manner. C. rodentium
also encodes EspT, which enables the ability to subvert eukaryotic cytoskeleton by activating
small Rho GTPases (Bulgin, Arbeloa et al. 2009).
C. rodentium also encodes a type II secretion system (T2SS), type I secretion system (T1SS), and
type VI secretion system (T6SS). There are two T6SS gene clusters in the genome of C.
rodentium that are named type VI secretion system cluster 1 (CTS1) and 2 (CTS2). CTS1 is
nearly identical to the T6SS gene clusters contained in Enterobacter cancerogenus and has
similarity to SPI-6 components encoded in Salmonella enterica (Folkesson, Lofdahl et al. 2002).
CTS2, very similar to a putative T6SS in C. freundii, encodes all the components required for the
assembly of a functional T6SS; however, there is a bona fide frameshift in this cluster, which
means that it is unlikely that CTS2 can produce a functional T6SS (Schauer, Zabel et al. 1995;
Mougous, Cuff et al. 2006).
19
There are 20 potential type V secretion systems (T5SS) encoded in the C. rodentium genome. 14
of them are identified as putative autotransporter adhesins that are related to those encoded in
EPEC (Benz and Schmidt 1989) and ETEC (Brennan, Li et al. 1988), which are involved in
virulence.
C. rodentium carries 19 fimbrial biogenesis operons, including the Kfc chaperone-usher fimbrial
operon and CFC type IV fimbriae, which produce factors involved in gastrointestinal
colonization (Mundy, Pickard et al. 2003). C. rodentium also encodes nonfimbrial adhesins,
such as LifA (Klapproth, Sasaki et al. 2005) and intimin (Schauer and Falkow 1993) that are
essential for gut colonization.
C. rodentium secretes several effector proteins (Esps) into tissue sulture medium in a similar
fashion as EPEC and EHEC (Deng, Puente et al. 2004). Some of these proteins translocate into
host cells. These translocated proteins include EspA, EspB, and EspD (Deng, Puente et al.
2004).
The C. rodentium LEE is slightly larger than EPEC and EHEC LEEs, 36kb vs. 34kb. CR LEE
shares all 41 open reading frames (ORFs) with EPEC and EHEC LEE (Deng, Li et al. 2001)
(Table 1.2). In spite of the differences, the intimin gene from EPEC can complement a C.
rodentium eae mutant and EHEC tir gene can complement a C. rodentium tir deletion mutant.
Therefore, there is still a striking similarity between C. rodentium LEE and that of the AE E. coli
pathogens, implying that the role of these genes in pathogenesis and disease is conserved (Deng,
Li et al. 2001; Deng, de Hoog et al. 2010).
1.1.5.3 C. rodentium pathogenesis and murine model of EHEC
infection
C. rodentium causes transmissible murine colonic hyperplasia and a reproducible distal colitis in
infected mice of a variety of genetic backgrounds (Mundy, MacDonald et al. 2005). The AE
lesions induced by C. rodentium infection at the epithelial cell surface are indistinguishable from
EPEC and EHEC infections. C. rodentium infection is characterized by crypt hyperplasia,
epithelial cell proliferation, mucosal thickening, and an uneven apical enterocyte surface
20
(Higgins, Frankel et al. 1999). In infected mice, large numbers of bacteria colonize the distal
colon and adhere to epithelial surface (Johnson-Henry, Nadjafi et al. 2005). The onset of
hyperplasic response is first seen on day 4 post oral administration of C. rodentium, and the
mucosal thickening reach a maximum between on day 10 post infection (Gareau, Wine et al.
2010). An inflammatory response is also activated, but the precise mechanism and underlying
molecular events still need to be delineated. Research results showing the functional
conservation of virulence proteins encoded by LEE from various AE pathogens indicate the
relevance of using C. rodentium-mouse intestine interaction as a model for studying human
EPEC and EHEC infections. This murine infection model also allows for the study of immune
responses to EPEC and EHEC LEE-encoded proteins (Deng, Li et al. 2001).
1.1.5.4 C. rodentium provides murine infectious model of IBD
Oral introduction of C. rodentium to mice is associated with an inflammatory cell infiltrate in the
distal colon. C. rodentium infection elicits a mucosal T-cell infiltrate that is associated with
colonic epithelial cell hyperplasia. The mucosal inflammatory infiltrate consists predominately
CD4+ T-cells, with a Th1 phenotype (Kang, Otsuka et al. 2010) that is said to provide a murine
model of Crohn disease (Higgins, Frankel et al. 1999).
In mice infected with C. rodentium, bacteria transverse the epithelial barrier and are detected in
the colonic mucosa where interactions with host immune cells occur.C. rodentium have been
detected in mesenteric lymph nodes of orally infected mice (Skinn, Vergnolle et al. 2006) similar
to what occurs in inflammatory bowel disease (IBD) patients - enteric bacteria have been
isolated from the mesenteric lymph nodes of patients with Crohn disease (Caradonna, Amati et al.
2000).
The T-cell infiltration, cytokine production, and epithelial cell proliferation observed in C.
rodentium-infected mice are similar to changes seen in other mouse models of IBD: including
mice with IL-2, IL-10, T-cell receptor alpha (TcRα), or TcRβ gene deletions. In these models,
disease occurs as a result of immune dysregulation and it is mediated by CD4+ T-cells of a Th1
phenotype (Spahn, Ross et al. 2008).
21
1.2 Host Defense and Exploitation of Host Responses by
Pathogens
Infectious diseases are a major cause of morbidity and mortality around the world and are an
immense challenge in the biomedical research field. Improving sanitary conditions and
developing vaccines or therapies are all important in combating infectious diseases. However,
improving intervention strategies requires further understanding of the host immune system and
more importantly, microbial pathogenesis and host-microbe interactions (Mirpuri, Brazil et al.
2010).
The intestinal tract has upwards of 100 trillion microbes, composed by an estimated 500 species
at any given point in time (Turnbaugh, Ley et al. 2007; Canny and McCormick 2008). The
effect of microbial colonization on host health depends on microbial adaptation (Casadevall and
Pirofski 2000). Some microbes exert beneficial, positive effects in host intestine. In other
scenarios, pathogenic bacteria colonization has detrimental effects on the host, leading to
diarrheal disease and infectious colitis. The severity of the outcome depends on the condition of
the host immune system; for example, some pathogens only affect immune compromised
individuals (Pamer 2007).
1.2.1 Bacterial virulence factors
Depending on the micro-environment where bacteria colonize, enteric pathogens express various
virulence factors that allow them to penetrate epithelial surface, attach to cell surfaces, invade
intracellular compartments, evade host defense mechanisms, and effectively infect neighboring
cells. One example of this is how Streptococcus pneumoniae relies on its capsule to prevent
antibody and complement deposition on its surface, thereby avoiding phagocyte clearance
(Finlay and McFadden 2006). In mammals, there are two types of defense: innate and adaptive
or acquired (Shames, Auweter et al. 2009) that respond to virulence factors of enteric pathogens;
these are each considered in more detail below.
1.2.1.1 Bacterial lipopolysaccharide
22
Lipopolysaccharide (LPS) is an abundant outer membrane component, an active entity of
endotoxin, of Gram-negative bacteria. Its biological activity is associated with its ability to
trigger host innate immune system to initiate inflammatory response. LPS was first described as
a highly toxic component bound tightly to cells of Vibrio cholerae. LPS induces high fever,
septic shock and even death of experimental animals. Similar effects have also been observed in
humans (Bilbo, Wieseler et al. 2010). Chemically, LPS contains 3 covalently bound parts – an
O-antigenic polysaccharide, a core oligosaccharide, and glycolipids. The glycolipid structural
component, known as lipid A, contains full endotoxic activity (Raetz and Whitfield 2002).
The repetitive glycan polymer found in LPS is known as the O-antigen. Following synthesis of
O-antigens, they are ligated to the core oligosaccharide as the outermost domain of LPS. The
composition of the O-antigen varies from strain to strain of E. coli and other Gram negative
organisms. The presence or absence of O chains classifies the LPS as either smooth or rough,
respectively. The core oligosaccharide attaches directly to lipid A and commonly contains 3-
deoxy-D-mannooctulosonic Acid (KDO) (Raetz and Whitfield 2002).
Lipid A is an amphiphilic molecule with covalently-bound hydrophilic part and lipophilic long
chain fatty acyl groups. The biosynthesis of lipid A-core starts with the acylation of the sugar
nucleotide UDP-GlcNAc (N-Acetylglucosamine). The acetyl group is then removed to obtain an
acylated glcN residue. Two of these residues together form the lipid A subunit (Raetz and
Whitfield 2002). The number and length of acyl chains vary depending on the bacterium. For
instance, hex-acylated lipid A molecules are commonly found in the Enterobacteriaceae family
of Gram negative bacteria (van Mourik, Steeghs et al. 2010).
1.2.2 Immune defense in microbial recognition
1.2.2.1 Innate immune response to microbes
Innate immune recognition of gut pathogens is mediated by pattern-recognition receptors
(PRRs), which have recognition capabilities for conserved and invariant features of the
microorganisms (Tlaskalova-Hogenova, Stepankova et al. 2004; Diacovich and Gorvel 2010).
PRRs bind to a large number of molecules unique to microorganisms that have common
23
structural regions. Targets of PRRs are known as pathogen-associated molecular patterns
(PAMPs) (Tlaskalova-Hogenova, Stepankova et al. 2004).
A well characterized class of PRRs is the family of Toll-like receptors (TLRs) (Tlaskalova-
Hogenova, Stepankova et al. 2004; Mirpuri, Brazil et al. 2010). TLRs are transmembrane
receptors that recognize viral nucleic acids and several bacterial products, such as
lipopolysaccharide (TLR4), flagellin (TLR5), and lipotechoic acid (TLR2) (Roy and Mocarski
2007). TLRs elicit both inflammatory and antimicrobial responses after activation by microbial
ligands. TLRs activate macrophages to produce pro-inflammatory cytokines such as TNF-alpha,
IL-1β, and IL-6, which initiate local and systemic inflammatory responses (Roy and Mocarski
2007). TLRs also directly induce macrophages to produce antimicrobial peptides (AMPs),
including cathelicidins and defensins (Guani-Guerra, Santos-Mendoza et al. 2010). Cathelicidin
exerts a direct chemoattractive action on monocytes, neutrophils, and CD4+
T lymphocytes and it
is also able to bind LPS to block the release of TNF-α. Defensins have chemoattractant
properties on different cell types such as monocytes, T lymphocytes, and dendritic cells plus
they also are able to induce the production of diverse chemokines and cytokines (Guani-Guerra,
Santos-Mendoza et al. 2010).
The expression of these inflammatory cytokines is associated with the presence of Shiga toxin
and LPS. However, the development of HUS requires not only the presence of Shiga toxin, but
also pro-inflammatory stimuli such as LPS and TNF-α (Psotka, Obata et al. 2009). This finding
is pointing towards the possibility of using LPS as potential antigens in the development of
vaccines, there is increasing evidence that serum antibodies to the surface LPS may confer
protective immunity to these Gram-negative enteric pathogens (Horne, Vallance et al. 2002).
Gram negative bacteria induce inflammatory responses in host via the interaction between LPS
and receptors on both epithelial cells and innate immune cells such as macrophages and dendritic
cells (Horne, Vallance et al. 2002). LPS-binding protein (LBP) binds monomers of LPS that is
in circulation and a complex with CD14 is formed. CD14, a glycosylphosphatidylinositol-
anchored cell surface molecule, then forms a complex with Toll-like receptor 4 (TLR4), which
activates intracellular signaling (Stahl, Svensson et al. 2006).
24
Although TLR4 is both a surface receptor and a Golgi-localized protein, the recycling of TLR4
from cell surface back and forth to the Golgi is not necessary for the initiation of cellular
activation (Latz, Visintin et al. 2003). Following activation with LPS, both TLR4 and CD14 are
clustered into lipid rafts where the rafts provide a platform for signal transduction responses
ultimately leading to actin cytoskeletal rearrangements. This finding point to TLR4 function as a
bacterial antigen receptor, which partition into lipid microdomains upon ligand stimulation leads
to intracellular signal transduction events (Szabo, Dolganiuc et al. 2007).
In addition to transmembrane receptors on the cell surface, there are intracellular receptors,
including Nod-like receptors (NLRs), that are involved in bacterial recognition (Roy and
Mocarski 2007). NLRs contain a nucleotide-binding oligomerization domain (NOD) and a
leucine-rich-repeat domain (Kumar, Kawai et al. 2009). The three types of domains present at
the amino terminus of NLRs categorize them into 3 subfamilies: NOD, NALP, and the NAIP
subfamily. The NOD subfamily is involved in sensing bacterial peptidoglycans to induce the
production of pro-inflammatory cytokines and chemokines, which results in the recruitment of
neutrophils to the site of infection (Kumar, Kawai et al. 2009). The NALP subfamily is involved
in the activation of the inflammatory response and inflammasome activation mediated by the IL-
1 cytokine family. There are several types of inflammasomes activated by NAIPs (Arend,
Palmer et al. 2008). NALPs can also contribute to antimicrobial defense by inducing apoptosis
(programmed cell death) of infected host cells (Petrilli, Papin et al. 2007).
1.2.2.2 Adaptive immune system
Adaptive immune recognition is mediated by both T-cells and B-cells. These cells express on
their surface a diverse group of receptors assembled from variable and constant fragments
through recombination-activating gene (RAG)-protein-mediated somatic recombination
(Maynard and Weaver 2009). Microbial antigens are taken up by antigen-presenting cells and
delivered to either mesenteric lymph nodes or the spleen where they are recognized by
lymphocytes (Medzhitov 2007).
In intestinal epithelia, dendritic cells residing underneath the epithelial monolayer take up
pathogens by phagocytosis (Moll 2003). Bacterial proteins are then processed into antigenic
25
peptides and presented at the cell surface by MHC class I and/or class II molecules. This results
in TH (helper)-cell activation, which leads to differential cytokine and chemokine production
(Moser and Murphy 2000). The produced cytokines and chemokines control the recruitment,
from the systemic circulation into the lamina propria, of neutrophils, eosinophils, and basophils
to mount a mucosal defense against pathogens (Stadnyk, Dollard et al. 2000).
For B-cells, which can be directly activated by bacterial LPS or flagellin, antibodies of the IgM
and IgA classes generated by plasma cells are released into the mucus layer to combat enteric
pathogens (Tlaskalova-Hogenova, Stepankova et al. 2004).
1.2.3 Inflammatory and Innate Responses to Bacteria
The interaction between bacteria, the gut epithelium, and host defense responses are very
important in determining the fate of bacterial infections and disease outcomes. It is clear from
the previous section that epithelial cells produce various inflammatory mediators in response to
pathogens in order to manage or eliminate the infection. Many times this translates to an
increase in fluid section and intestinal motility, which aids in clearance of the pathogen by
―flushing‖, or recruitment of innate and adaptive inflammatory mediators and cells, which also
contribute to pathogen clearance. The hosts often pay a price by developing disease symptoms,
and the pathogen can benefit from these responses by spreading to other hosts (Klapproth, Sasaki
et al. 2005). Normally, the intestinal epithelial layer induces a controlled and balanced
inflammatory response to eliminate pathogens and limit the destructive consequences of mucosal
inflammation to minimal. A number of defects in this homeostasic balance can lead to a wide
range of disorders. Many gastrointestinal bacterial pathogens have developed many strategies to
promote inflammation leading to extensive epithelial injury and necrosis of the mucosa, affecting
large areas of the colon (Santos, Zhang et al. 2002). Invasive enteric pathogens, such as Shigella
spp. or S. Typhimurium, is found to associate with exacerbated epithelial injury and this is
attenuated when infecting CD18-deficient calves, whose neutrophils are unable to extravasate,
with the pathogen (Nunes, Lawhon et al. 2010). This suggests that neutrophils are mainly
responsible for the collateral tissue damage accompanying the severe inflammation and lead to
intestinal fluid accumulation and diarrhea. Diarrhea and dehydration that follows can be life
threatening; therefore, this draws a clear picture of how the protection against bacterial
26
translocation and dissemination provided by exudative inflammation can become a burden and
need to be tightly monitored in order to limit the damage inflicted on the host (Winter, Keestra et
al. 2010).
Another problem associated with bacteria-induced severe inflammation is how they use this
aggressive inflammatory response to breach cell-cell junction followed with significant changes
in the gut microbiota (Guttman, Li et al. 2006). EPEC, EHEC, and C. rodentium have evolved
various mechanisms to target and disrupt tight junctions by manipulating Pho GTPases and
MCLK-mediated signalling in infected host cells. By hijacking these pathways, the pathogens
can manipulate the host actin cytoskeleton and, ultimately, the junction structure as well as the
innate immune response (Guttman and Finlay 2009). This inflammatory response is associated
with changes in the intestinal microbiota, which includes an increase in abundance of bacteria in
the phylum Proteobacteria, specifically members of the Enterobacteriaceae family (Lupp,
Robertson et al. 2007). Severe inflammation enteric pathogens such as Campylobacter jejuni
and S. Typhimurium, is followed by an increase in the population of Enterobacteriaceae
(Stecher, Robbiani et al. 2007). Furthermore, the intestinal inflammation caused by C.
rodentium-infection results in the overgrowth of the pathogen in the intestinal lumen of mice
(Stecher, Robbiani et al. 2007).
The onset of intestinal inflammation induced by pathogens allow them to take advantage of
environmental changes that accompany this host response. First, the removal of luminal contents
by the flushing action of diarrhea provide pathogens the opportunity to colonize the mucus layer
and outgrow the microbiota. An example would be S. Typhimurium benefiting from
inflammation by outgrowing the intestinal microbiota in mice and the S. Typhimurium mutants
are unable to use motility and chemotaxis to outcompete other microbes (Stecher, Barthel et al.
2008). Secondly, recent studies suggest that pathogens capable of inducing severe inflammatory
response possess virulence mechanisms that make them resistant against antimicrobials, and this
process enhances their competitiveness in the lumen of an inflamed gut. For instance, S.
Typhimurium synthesizes and releases a glycosylated derivative of enterobactin, salmochelin,
which is no longer bound by lipocalin-2, an antimicrobial, in an inflamed intestine and allows the
pathogen to resist against this antimicrobial protein. This advantage for pathogen is not observed
27
in the absence of intestinal inflammation or in lipocalin-2-deficient mice (Raffatellu, George et al.
2009).
Both the innate and adaptive immune systems play a role in IBD. Gut microbiota changes have
been seen in IBD patients and the chronic intestinal inflammation is accompanied by a
significant increase in Enterobacteriaceae and a reduced biodiversity of bacteria in the phylum
Firmicutes (Marteau 2009). In mice, the induction of inflammation by bacteria during infection,
by a chemical inducer such as dextran sulphate sodium (DSS), or a genetic deficiency such as the
interleukin-10-deficient mouse model, can alter the compositions of the intestinal microbiota and
cause a reduction in bacterial diversity. In Citrobacter rodentium-infected mice, acute intestinal
inflammation occurs followed by the weakening of intestinal barrier functions and thereby
triggering chronic disease. S. Typhimurium possesses bacterial factors that allow them to
maintain active in macrophages and promotes intracellular S. Typhimurium proliferation, leading
to an increase in immune response. Intestinal inflammation by S. Typhimurium is characterized
by the disruption of crypt organization in the ileum, caecum, and colon by epithelial erosion and
ulceration, by reduction of goblet cells, by infiltration with acute pro-inflammatory cells (Barthel,
Hapfelmeier et al. 2003). Both of these bacterial infections are specific examples illustrating that
in the context of a bacterium, immunocompetent hosts can become susceptible to increased
inflammation and exacerbated disease symptoms caused by bacterial factors (Nell, Suerbaum et
al. 2010).
1.2.4 Microbial Manipulation of the Host Epithelium
EHEC O157:H7 elicits its pathogenic effects by attacking intracellular signal transduction
pathways in host cells. These bacteria manipulate more than one intracellular pathway and
interfere at a number of points along each pathway to ensure their own survival. Further
characterization of how EHEC subverts host cell signaling pathways is key to better
understanding this infectious disease (Bhavsar, Guttman et al. 2007).
1.2.4.1 Attaching-effacing Lesions
28
One of the most commonly described cellular targets of pathogenic bacteria is the host
cytoskeleton. Many microorganisms manipulate the host cytoskeleton to gain entry into the cells
and to move around in the infected cell. Bacterial pathogens usually manipulate and control the
polymerization of actin filaments by interfering with cellular regulators of the process, such as
small GTPases (Stender, Friebel et al. 2000).
Manipulation of host cell cytoskeleton by an extracellular pathogen—EHEC
EHEC has elaborate actin-recruiting processes. E. coli secreted proteins (EspE, EspB, EspD,
Map, EspF, EspFU, and EspT) are injected into the cytosol of infected host cells through a type
III secretion system encoded molecular syringe (Welinder-Olsson and Kaijser 2005). Among the
various translocated proteins encoded on the 35-kb pathogenicity island, called the locus of
enterocyte effacement (LEE), is the EspE protein, also known as translocating intimin receptor
(Tir). Tir, with the help of other secreted proteins (EspFU), acts as a receptor for the bacterial
outer membrane protein intimin (Garmendia, Phillips et al. 2004; Cheng, Skehan et al. 2008).
There are also other receptors besides Tir, although controversial, that have been suggested to
play a role in bacterial adhesion such as nucleolin and β1 integrin (Sinclair and O'Brien 2004).
The Tir-intimin interaction gives rise to intimate attachment of EPEC and EHEC to host cells
and leads to cytoskeletal rearrangements via different mechanisms.
In EPEC infection, Tir inserts itself into the host cell membrane and is tyrosine phosporylated in
the C-terminus by host kinases such as Ab1- and Tec-family kinases, which leads to the
recruitment of kinases through interactions with their SH2 and SH3 domains (Bommarius,
Maxwell et al. 2007). Phospho-Tir then mediates the recruitment of the host adaptor protein Nck
(non-catalytic region of tyrosine kinase), which activates downstream neural Wiskott-Aldrich
syndrome protein (N-WASP) leading to actin polymerization through Arp2/3 at the bacteria
attachment site (Frankel and Phillips 2008). α-actinin is also recruited during this process and
contributes to pedestal formation by cross-linking actin filaments (Caron, Crepin et al. 2006).
On the other hand, Tir from EHEC (EspE) does not get phosphorylated by host kinases, but
instead interacts with another bacterial effector, EspFU. The function of EspFU is very similar to
Nck leading to the recruitment of the host actin cytoskeleton elements such as N-WASP and
Arp2/3 complex to form dense pedestals, and the effacement of intestinal brush-border
29
microvilli, collectively known as the attaching-effacing lesion (Donato, Zareie et al. 2008)
(Figure 1.1). Activity of EspE of C. rodentium also does not require tyrosine phosphorylation
by host kinases (Deng, Vallance et al. 2003). Our laboratory has shown previously that depletion
of cellular cholesterol, a major component in lipid rafts, inhibits EHEC O157:H7-induced A/E
lesions (Riff, Callahan et al. 2005).
1.2.4.2 Apical Junction Complexes
Tight junction disruption by enteric pathogens
As shown by a number of infection models affecting the integrity of the intestinal epithelial
barrier, Apical junction complexes (AJCs) are clearly one of main targets of bacterial virulence
(Laukoetter, Bruewer et al. 2006). AJCs can be compromised by either bacterial toxins or
bacterial effectors, by direct contact of the pathogen or indirect manipulation of the signalling
pathways in host junction regulation, such as the phosphorylation or dephosphorylation of
junction-associated proteins. Pathogens causes dysregulation of the AJCs to breakdown the
intestinal barrier thereby increase fluid secretion, diarrhoea, and enhance transmission.
The EPEC TTSS and effector protein EspF decreases transepithelial electrical resistance (TER)
and alters intestinal epithelial AJC structure (Dean and Kenny 2004; Viswanathan, Lukic et al.
2004). EPEC disrupt tight junction architecture by interfering with tight junction protein-protein
interactions and redistributing tight junction proteins (Muza-Moons, Schneeberger et al. 2004).
Recent results show that enteropathogenic E. coli causes diarrhea by disruption of tight junctions
and by redistributing occludin (Shifflett, Clayburgh et al. 2005) (Figure 1.1). Similarly, EHEC
infection leads to decrease in TER, however, this appears to occur through different mechanisms
that can be rescued by TGF-β.
Other bacteria such as S. Typhimurium, can also cause structural and functional alterations in tj
through its SPI-1-dependent type 3 secretion of effectors (SopB, SopE, SopE2, and SipA). C.
jejuni-mediates barrier disruption through phosphorylation of junction-related proteins such as
ERK, JNK, and p38 MAPK, moreover, it causes redistribution of lipid raft-associated
hyperphosphorylated occludin (Grassl and Finlay 2008). The mouse pathogen C. rodentium, can
30
alter apical junctional protein distribution during its attachment to the epithelial cells (Guttman,
Li et al. 2006).
31
Figure 1.1 Schematic diagram of EHEC O157:H7 signalling regulation of AE lesion
formation and barrier disruption. EHEC adheres to epithelial cells and secrete its effector
proteins (Esps) into the host cell through type III secretion system (TTSS). Among the secreted
proteins is Tir which binds to EHEC intimin thereby activating the asparagine-proline-tyrosine
(NPY) motif on Tir to initiate downstream signalling molecules including: TccP2/EspFU, N-
WASP, Arp2/3. This signalling cascade is involved in EHEC-induced AE lesion formation.
EHEC also secrets EspF and NleH which interferes with tight junction proteins/cytoskeleton
regulation leading to tight junction disruption.
32
33
1.3 Host cell mechanisms hijacked by bacteria during infection
Microbial infections result in characteristic stereotypic pattern of host inflammatory responses
(Serhan, Brain et al. 2007). The intestinal tract, coming in contact with numerous microbial
pathogens can develop enterocolitis in an infected individual. Interestingly, non-invasive bacteria
are emerging as enteric pathogens also capable of eliciting host damage and inducing
inflammatory responses by hijacking signal transduction pathways in host epithelial cells
(Croxen and Finlay 2010).
In the field of EHEC O157:H7 infection research, many results now point to bacteria pirating
signalling pathways such as the cytochrome c (cyt c)-caspase 3 pathway, the MAP kinases-
nuclear transcription factor pathway, and the PI3K-PKC pathway to induce host programmed
cell death, the production and secretion of chemokine CXCL8 (IL-8), the induction of attaching-
effacing (AE) lesions, as well as barrier disruption by manipulating the host cell cytoskeleton
(Ceponis, Riff et al. 2005).
1.3.1 Osteopontin
Osteopontin is a phosphorylated glycoprotein that is expressed by a wide range of cell types
(Sodek, Batista Da Silva et al. 2006). Originally, OPN was characterized as a bone matrix
protein (Prince and Butler 1987), T-lymphocyte activation protein (Eta-1) (Patarca, Saavedra et
al. 1993), and cell transformation-associated protein (Craig, Nemir et al. 1988). However, further
research pointed to OPN also being a matricellular protein with diverse biological activities
signalling through multiple cell-surface receptors (Sodek, Batista Da Silva et al. 2006). Another
major role of OPN is its function as an inflammatory cytokine. Recent studies have reported that
OPN is up-regulated in a number of inflammatory diseases and is needed for developing both
cellular immunity and wound healing (Morimoto, Kon et al. 2010). The development of many
inflammatory diseases is attenuated in the absence of OPN and OPN expression is up-regulated
in most wound injured organs (Yumoto, Ishijima et al. 2002).
Structure
34
OPN is part of SIBLING family proteins that is synthesized as a ~34kDa nascent protein (Cho
and Kim 2009). OPN then goes through extensive post-translational modifications, such as
phosphorylation, glycosylation, and sulphation prior to being secreted as a 44-75 kDa protein.
These post-translational modifications relate to the different functional activities of OPN
(Giachelli and Steitz 2000). Most of the known functional activities of OPN are associated with
its highly conserved structural motifs that bind mineral, CD44, and integrin receptors (Lee,
Wang et al. 2008).
CD44 has been identified as an OPN receptor in cytokine responses of macrophages (Ashkar,
Weber et al. 2000). Ligation of CD44 receptors and β3-integrin by OPN domains leads to
macrophage recruitment and the production of cytokines and activation of metalloproteinases
(Weber 2002). Recent literature also shows that OPN can bind to and recruit complement factor
H to the cell surface via its interaction with αλβ3 and CD44 receptors (Fedarko, Fohr et al.
2000). The interaction of OPN with factor H likely plays a role in controlling OPN pro-
inflammatory effects. An intracellular form of OPN (iOPN) that co-localizes with CD44 in
fibroblasts, macrophages, and osteoclasts appears to modulate cytoskeleton-related functions
(Zohar, Zhu et al. 2004).
Osteopontin and mucosal immunity
Multiple studies link OPN expression with epithelial barrier changes. OPN is an important
luminal regulator where epithelial cells secrete OPN, which is then involved in controlling
epithelial barrier permeability and secretary functions (Gassler, Autschbach et al. 2002; Acheson
and Luccioli 2004). OPN has a critical function in regulating barrier defense processes,
including the expression of MHC-II and TLRs (Acheson and Luccioli 2004; Iwasaki and
Medzhitov 2004). The presence of OPN may also be important for supporting cell apoptosis and
preventing cell necrosis, which can lead to massive inflammation and loss of epithelial barrier
integrity (Kruidenier, Kuiper et al. 2003).
OPN expression increases at sites of inflammation by epithelial, stromal, and immune cells;
therefore, it is involved in both innate and adaptive immune signalling pathways. OPN is
secreted by activated T-cells to recruit macrophages and stimulate Th1 cytokine release through
OPN interaction with αλβ3 receptor (Cantor and Shinohara 2009). Conversely, secretion of the
35
anti-inflammatory cytokine IL-10 is suppressed by OPN signalling through the CD44 receptor
(Shinohara, Jansson et al. 2005). In the absence of OPN expression, the Th2 cytokine response
is critical, and OPN-null mice display an increased susceptibility to infectious challenge with
intracellular pathogens, compared to their wild type littermates (Ashkar, Weber et al. 2000).
1.3.2 Detergent-resistant Microdomains
Detergent-resistant microdomains (DRMs), also known as lipid rafts, are liquid-ordered (Io)
phase microdomains that exist in cell membranes. The liquid-ordered (Io) phase is a sterol-
dependent composition in which lipid acyl chains are tightly packed. In plasma membrane, Io-
phase domains form in sterol-rich cell membranes where they are dispersed in disordered
membrane domains. DRMs are enriched in cholesterol and sphingolipids. The main function of
cholesterol is to ensure the integrity of lipid rafts (Kline, O'Connor Butler et al. 2010).
Detergent insolubility of lipid rafts
The existence of rafts was first described from the observation that eukaryotic cell plasma
membranes are not fully solubilized by non-ionic detergents, such as Triton X-100, at low
temperature. Using this extraction method, Io phase can be isolated using sucrose gradient
ultacentrifugation (Brown and Rose 1992). The principle behind this extraction method is that
the close packing of lipids in Io phase prevents detergent incorporation into the lipid bilayer (Xu,
Bittman et al. 2001).
Raft structure and function
Much of the evidence of raft functioning in eukaryotic cells comes from looking at DRM-
association of key proteins and the effect of cholesterol modulators in disrupting function
(Dykstra, Cherukuri et al. 2003; Pike 2003). Lipid rafts have important roles in both signal
transduction (Pike 2009) and membrane trafficking (Kirkham and Parton 2005).
Recent studies have further confirmed the existence and function of lipid rafts through
microscopic observations of cell surface signaling molecules assembling into large complexes
(Pike 2009). For example, DRM-association of T and B-cell receptors increases during
signaling, and signaling in T-cells is sensitive to cholesterol depletion (Kabouridis 2006).
36
Lipid rafts and bacterial pathogens
Another strong evidence for raft function comes from observing the behavior of pathogens
(Grassme, Gulbins et al. 1997). Some pathogens bind order-preferring proteins and lipids on
host cell surfaces, thereby hijacking a host signaling platform to elicit pathogenic effects of
infection (Riethmuller, Riehle et al. 2006; Shen-Tu, Schauer et al. 2010). Invading bacteria also
have raft-targeting bacterial factors, which use rafts for internalization into the host cell
(Kalischuk, Inglis et al. 2009). More studies point to a highly regulated raft formation
mechanism that occur only in response to stimulation, such as receptor clustering (Hashimoto-
Tane, Yokosuka et al. 2010).
One example of receptor clustering, also a method used to visualize rafts, is cholera toxin-
induced clustering of the DRM-enriched ganglioside, GM1 (Ingelmo-Torres, Gaus et al. 2009).
Recruitment of raftophilic proteins to rafts promotes their interaction and creates signaling
platforms to reduce interference by non-raft proteins (Brown 2006). Multiple factors involved in
actin regulation - such as PLCγ1, diacylglycerol, PIP2, and PIP3 are common raft constituents
that can be targeted by pathogens for host cell attachment and subsequent entry by invasive
organisms (Zaas, Duncan et al. 2005; Chichlowski and Hale 2008).
1.3.3 PI3K family: role in cell signalling and cytoskeletal
rearrangements
Phospholipids are known as precursors for second messengers in cell surface receptor coupled
signal transduction pathways. Phosphoinositide 3-kinases (PI3Ks) are a family of enzymes
(Figure 1.2) involved in numerous cellular functions such as cell growth, proliferation,
differentiation, motility, survival, and intracellular trafficking (Ulici, Hoenselaar et al. 2008).
PI3Ks are related to intracellular signal transducer enzymes capable of phosphorylating the 3rd
position hydroxyl group of the inositol ring of phosphatidylinositol (PtdIns) (Jones, Paneda et al.
2005). PI3Ks generate three different lipids by converting PtdIns, PtdIns(4)P, and PtdIns(4,5)P2
to PtdIns(3)P, PtdIns(3,4)P2, and PtdIns(3,4,5)P3 (Cantrell 2001; Kooijman, King et al. 2009).
PtdIns(3)P is constitutively present in cells; whereas PtdIns(3,4)P2 and PtdIns(3,4,5)P3 are nearly
absent in resting cells, but following stimulation the intracellular concentration rises dramatically
37
indicating an important function as second messengers (Vanhaesebroeck, Leevers et al. 1997;
Kok, Geering et al. 2009).
38
Figure 1.2 Schematic diagram of the PI3K family enzymes. These class-specific structural
regions include: the p85-binding domain (p85); Ras-binding domain (Ras); a proline-rich region
(P, only present in p110 and PI3K-II); a leucine-zipper-like domain (bZIP, found only in
p110, , and ); a G-protein subunit binding domain (); a putative PH domain (only in
PI3K); and a C2 domain found only in class II PI3Ks. Conserved regions throughout the PI3K
family members include: the PI-kinase region; the Wortmannin-binding site (Wm), and the ATP-
binding site (ATP).
39
40
Class IA PI3Ks
The class IA PI3Ks refers to a group of proteins with heterodimers ~200 kDa in size, which
contain a 110-120 kDa catalytic subunit and a 50-85 kDa regulatory subunit (Inukai, Funaki et al.
2001; Hawkins, Anderson et al. 2006). The class IA PI3K catalytic subunits include p110α, -β, -
δ, and homologous molecules from several other species (Walker, Perisic et al. 1999). They
have several conserved regions, including the adaptor- and the Ras-binding sites, the PI-kinase
region, and the C-terminal kinase domain (Vanhaesebroeck, Guillermet-Guibert et al. 2010).
The regulatory subunit of class IA PI3K is composed of a Src homology 3 (SH3) domain, a
breakpoint-cluster-region homology (BH) flanked by two proline-rich regions, and two C-
terminal SH2 domains spaced by an iSH2 region (Wymann and Pirola 1998) (Figure 1.3). The
iSH2 region mediates tight biding of p85 to catalytic subunit. The p85 subunit self-associates via
a SH3 domain (Kapeller, Prasad et al. 1994) and proline-rich sequences to regulate PI3K
activity. Proline-rich regions 1 and 2 flank the BH domains and act as ligands for SH3 domains
of non-receptor protein tyrosine kinases (PTK) like v-Src, Lyn, and Fyn (Pleiman, Hertz et al.
1994). The N- and C-terminal SH2 domains of p85α recognize the canonical phosphotyrosine
motif PYXXM. The BH domain of p85 is highly homologous to the GAP (GTPase activating
protein) domain of the breakpoint-cluster-region (Bcr) gene product (Diekmann, Brill et al.
1991). It specifically interacts with the Rho family proteins Cdc42 and Rac1.
Class IB PI3Ks
The class IB PI3Ks is stimulated by G-protein βγ subunits. They do not interact with the SH2-
domain-containing adaptors. The catalytic subunit, p110γ, contains an amino terminal Ras-
binding site, a PIK domain, and a catalytic domain (Vanhaesebroeck, Guillermet-Guibert et al.
2010).
Class II PI3Ks
The class II PI3Ks has an in vitro specificity towards PtdIns and PtdIns 4-P. This class of PI3Ks
are 170-210 kDa in size with a C-terminal C2 homology domain. No adaptor molecules have
been identified to date, and the mode of activation is still unclear. Studies suggest, however, that
41
this class of PI3Ks binds to lipids in a calcium-independent manner (Vanhaesebroeck,
Guillermet-Guibert et al. 2010).
42
Figure 1.3 Schematic diagram of class IA PI3K p85 regulatory subunit. The modular
domains are: Src homology 3 domain (SH3); P1 and P2 proline-rich regions; the breakpoint-
cluster-region (Bcr) homology domain (BH); the N- and C-terminal SH2 domains (NSH2 and
CSH2); and the inter-SH2 region (iSH2).
43
44
Class III PI3Ks
This class of enzymes is homologues of S. cerevisiae Vps34p (vacuolar protein sorting mutant).
They only phosphorylate PtdIns and activity depends on functional Vps15p protein, a 170 kDa
Ser/Thr kinase, which activates and recruits Vps34p to membranes. This class of PI3Ks is
responsible for recruiting phosphatidylinositol kinase to the late Golgi compartment
(Vanhaesebroeck, Guillermet-Guibert et al. 2010).
Upstream of class I PI3Ks
Class I PI3Ks are involved in signalling through receptors with intrinsic or associated Tyr kinase
activity and by receptors linked to heterotrimeric G proteins (Kok, Geering et al. 2009). The
mechanism of G-protein induced PI3K signalling is still unclear, but studies have shown that
signalling may take place in specialized platforms in the membrane variously referred to as either
cholesterol-enriched microdomains or lipid rafts. The association of Src kinases with lipid rafts
plays a crucial role in the activation of PI3K-Akt signalling (Arcaro, Aubert et al. 2007). An
adaptor-mediated translocation of PI3Ks to receptor Tyr kinases, similar to signalling via IRS-
1/2, likely aids positioning of the catalytic subunits close to membranes with their lipid
substrates (Rodriguez-Viciana, Warne et al. 1994).
Furthermore, class I PI3Ks interact with Ras proteins in a GTP-dependent manner. Co-
expression studies looking at interaction between p110α-p85α and various Ras mutant point to
Ras actively involved in the regulation of p110α-p85α in vivo. Data indicate that the interaction
of Ras with PI3K results in allosteric activation and induces PI3K recruitment to plasma
membrane (Hu, Klippel et al. 1995).
Downstream of PI3K
PI3K lipid products interact with proteins and modulate their localization and activity. One
major function for PI3Ks is in cytoskeleton reorganization through exchange factors that regulate
the small GTP-binding protein Rac, which modulates the affinity of integrins for the extracellular
matrix (Hawkins, Eguinoa et al. 1995). In addition, a number of protein Ser/Thr kinases have
been identified as downstream targets of PI3Ks (Andjelkovic, Jakubowicz et al. 1996;
Andjelkovic, Alessi et al. 1997). These include: Akt, p70 ribosomal S6 kinase (p70S6k
) (Chung,
45
Grammer et al. 1994), and protein kinase C (PKC) (Le Good, Ziegler et al. 1998). Akt Ser/Thr
protein kinases are activated upon receptor-Tyr kinase stimulation. This activation process
involves phosphorylation and a PH-domain mediated lipid binding. PI3K induced Akt activation
plays a critical role in protection against cell apoptosis. Signalling proteins downstream of Akt
are glycogen synthase kinase-3 (GSK3) and mitogen-activated protein kinase (MAPK). P70S6k
is activated in response to mitogenic stimuli and plays an important role in the progression of
cells from the G1 to S phase of the cell cycle. Activation of p70S6k
is regulated by PI3K, mTOR,
and PKC-mediated Ser/Thr-directed phosphorylation (Chung, Grammer et al. 1994). Lipid
products of PI3K activate a broad panel of PKC family members and PKC-related kinases
(Toker and Cantley 1997). However, there is no consensus as to which member of the PKC
family is the selected target of these lipids.
1.3.4 PKC: role in bacterial infection
There are at least 15 PKC isoforms encoded by 9 genes, depending on classification criteria
(Ohno and Nishizuka 2002). Each PKC isoform is ubiquitously expressed in a single cell. The
isoforms are subdivided into three categories based on primary structure and biochemical
properties: classical or conventional PKC (cPKC) isoforms (PKCα, βI, βII, and γ); novel PKC
(nPKC) isoforms (PKCδ, ε, ε, and ζ); and atypical PKC (aPKC) isoforms (PKCη/ι, and δ)
(Larsson 2006) (Figure 1.4).
Classical PKC isoforms
The cPKCs share structural motifs C1 and C2. The C1 domains in cPKCs contain a cysteine-
rich repeat and constitute a binding site for diacylglycerol (DAG) and phorbol esters, such as
PMA. The C2 domains in cPKCs are calcium-dependent phospholipid binding domains. cPKC
isoforms can be activated by DAG and phorbol esters in the presence of Ca2+
(Shirai and Saito
2002).
Novel PKC isoforms
The nPKCs also contain C1 and C2 motifs. The nPKC-C1 domain works in a similar fashion as
cPKC-C1 domain binding to DAG and phorbol esters. However, the sequence C2 domain of
46
nPKC isoforms is divergent from the cPKC-C2 domain. nPKC isoforms can be activated by
DAG or phorbol esters, but this activation is not dependent on Ca2+
(Schechtman and Mochly-
Rosen 2001).
47
Figure 1.4 A: Schematic diagram of the structures of PKC isoforms. All isoforms consist
of a regulatory domain and a catalytic domain. The conserved region of the regulatory domain
in all three isotypes is the pseudosubstrate (PS). In both the classical and novel isoforms
regulatory domain contains the phorbol ester-binding region (C1a and C1b). Only the classical
isoforms regulatory domain has a calcium-binding region. All three isotypes contain a conserved
catalytic domain, which includes an ATP-binding site and a kinase domain. B: Summary of
activators of the various PKC isoforms.
48
49
Atypical PKC isoforms
The aPKC isoforms share structural motifs C1 and octicosapeptide (OPR). The C1 sequence in
aPKC isoforms are not repeated like the C1 sequences in cPKC and nPKC isoforms. They also
lack the regions required for the interaction with DAG and phorbol esters; therefore, aPKC
isoforms cannot bind to nor are they activated by DAG and phorbol esters (Ohno and Nishizuka
2002).
Role of PKC in actin cytoskeleton regulation
The cell cytoskeleton is regulated by a number of components including phorbol esters, which
has for a long time been known to stimulate cellular migration and motility (Rigot, Lehmann et
al. 1998). This is associated with effects on the actin cytoskeleton. Since phorbol esters are
well-known activators of cPKC and nPKC isoforms, it is reasonable to consider that PKCs are
regulators of cellular cytoskeletal rearrangement processes (Larsson 2006).
PKCα has emerged as a general promoter of cell spreading and migration (Lin, Shen et al. 2010).
Both PKCα and PKCε associate with β1 integrin, which is important in mediating the binding of
the cell with the extracellular matrix (Thodeti, Albrechtsen et al. 2003). The PKCδ isoform is
involved in the RhoA pathway in the induction of stress fibers (Li, O'Connor et al. 2005). PKC
isoforms also phosphorylate N-WASP, which may be one mechanism of control of the F-actin
cytoskeleton (Leibfried, Fricke et al. 2008). PKCδ plays a role in protein phosphatase 2A
associated regulation of the epithelial tight junction complex, via Ca2+
-mediated tight junction
protein redistribution (Nunbhakdi-Craig, Machleidt et al. 2002).
Role of PKC in diarrheagenic E. coli pathogenesis
PKC is involved in pathogenic E. coli infection (Crane and Vezina 2005). EPEC infection of
T84 and HeLa cells increases membrane-bound PKC activity accompanied by a decrease in
cytosolic PKC activity. .PKCα increases its plasma membrane-association in response to EPEC
infection in vitro (Crane and Oh 1997). The atypical PKCδ isoform plays an important role in
the regulation of epithelial tight junctions (Tomson, Koutsouris et al. 2004). EPEC-activated
PKCδ also participates in the disruption of barrier function (Tomson, Koutsouris et al. 2004).
50
EPEC activation of proximal signalling pathways, PKCδ and ERK, converges downstream to
stimulate pro-inflammatory responses, including NF-θB activation. The mechanism by which
EPEC activate PKC isoforms is still largely unknown; however, PKCδ is recruited to ceramide-
enriched microdomains where it is activated (Savkovic, Koutsouris et al. 2003). Since enteric
pathogens signal through lipid-ordered membrane signalling platforms (Bi and Altman 2001),
my hypothesis is that EHEC O157:H7 could activate host PKC pathways through lipid raft
microdomains.
Protein kinase C also plays an important role in vascular complications and tumorigenesis, which
involves the participation of osteopontin (OPN), a glycosylated phosphoprotein (Denhardt,
Giachelli et al. 2001). Specifically, OPN inhibits IL-1-stimulated increases in translocation of
PKC- from cytosol to membrane fraction, and increases in MMP-2 and MMP-9 activities (Xie,
Singh et al. 2003). Even the regulation of actin cytoskeleton requires both PKC and OPN (Kang,
Zhou et al. 2008; Falkenburger, Jensen et al. 2010). Thus, it is important to delineate the role of
OPN in EHEC pathogenesis.
1.4 In vivo model of lipid raft during bacteria infection
1.4.1 Niemann-Pick Type C Disease
Niemann-Pick type C disease is characterized by accumulation of unesterified cholesterol in
perinuclear vesicles (Vanier 2010). Cholesterol is a major factor in maintaining cell structure
and function (Lusa, Blom et al. 2001). It is an essential component of the cell membrane,
especially important in lipid organization. The various concentrations of cholesterol often times
regulate membrane fluidity; therefore, it is involved in cell structural integrity and functions in
various locations in the cell (Jaureguiberry, Tricerri et al. 2010). Cytoplasmic cholesterol is also
a source of bioactive molecule that forms steroid hormones, vitamin D, and bile acids (Schmidt,
Holmstrom et al. 2010) Therefore, cholesterol regulates diverse cellular metabolisms, cellular
homeostasis, and extracellular and intracellular molecular communication.
1.4.1.1 Clinical Presentation and Symptoms
51
Niemann-Pick disease, type C (NPC) is a lysosomal lipid storage disease with autosomal
recessive inheritance. NPC is a subacute progressive neurodegenerative disorder where
cholesterol and sphingolipid accumulate in endosomes and lysosomes because of incorrect
cholesterol trafficking (Ikonen and Holtta-Vuori 2004). This defect is particularly pronounced in
the liver and spleen cells, but more detrimental in the brain (Sayre, Rimkunas et al. 2010).
Symptoms include progressive ataxia, dystonia, and dementia (Strauss, Goebel et al. 2010). This
lipid accumulation causes progressive neurodegeneration and hepatosplenomegaly, leading to
death during early childhood (Patterson, Vecchio et al. 2010). An animal model of Niemann-
Pick disease type C occurs in mice that harbour the NPC1 knockout (Davidson, Ali et al. 2009).
1.4.1.2 Pathophysiology
The majority (95%) of NPC disease stems from mutations of the NPC1 protein, and the
remainder due to NPC2 mutations (Ikonen and Holtta-Vuori 2004). NPC1 and NPC2 proteins
share no sequence similarity, but they both are involved in cholesterol homeostasis and likely
play a role in the same signalling pathway (Sleat, Wiseman et al. 2004). A defect of NPC1
protein has a striking impact on sterol homeostasis in all cells. Low density lipoprotein (LDL)-
derived and endogenously synthesized sterols are mislocalized (Abi-Mosleh, Infante et al. 2009).
The failure of cells to esterify exogenously added cholesterol as well as this accumulation of
unesterified cholesterol in endo/lysosomal compartment and the Golgi apparatus are all
manifestations of NPC (Walkley and Suzuki 2004).
Not only is free cholesterol accumulation a phenotype in NPC mutants, but several classes of
sphingolipids are also accumulated. In addition, it has been shown that gangliosides such as
GM1, GM2, and GM3 are transported by a NPC1-defined pathway in cellular models (Vanier
1999; Sugimoto, Ninomiya et al. 2001). NPC disease causes biochemical and physiological
disturbances including changes in cholesterol and sphingolipid/ganglioside accumulation,
membrane microdomains (lipid rafts) (Kosicek, Malnar et al. 2010), sphingomyelinase activity
(Devlin, Pipalia et al. 2010), caveolin and annexin II expression (Garver, Krishnan et al. 2002),
peroxisomal function, copper metabolism, apoptosis, and neurotrophin response (Sturley,
Patterson et al. 2004). However, which are primary defects that arise from loss of this gene and
which are secondary consequences? This question remains to be answered.
52
Evolutionary Findings
Evolution provides important clues to understand the functional mechanism and pathophysiology
of NPC1. Different from NPC2, NPC1 shows high percentage conservation in yeast, worms,
insects, plants, and mammals (Higaki, Almanzar-Paramio et al. 2004). NPC1 is a eukaryotic
member of the resistance-nodulation-division (RND) family of prokaryotic permeases (Davies,
Chen et al. 2000). These proteins have been studied in numerous bacteria and use proton-motive
force to remove hydrophobic molecules from the cell. NPC1 expression in Escherichia coli
facilitates the transport of metabolites, such as acriflavine and oleic acid, across the bacterial
membrane (Passeggio and Liscum 2005). These data point to additional basic functions of the
protein that predates sterol transport; however, these functions remain to be elucidated in
humans.
Pathway that affects NPC1 phenotype
There has been a new insight identifying a link between NPC1 dysfunction and cholesterol
trafficking by manipulating small GTPases in the Rab gene family. Overexpression of a subset
of Rab proteins can affect NPC1 phenotype (Kaptzan, West et al. 2009). Overexpressing Rab7
and 9, which regulate vesicle trafficking between the cell surface and endosomal compartments
in the cell, results in complete reversal of cholesterol/sphingolipid accumulation (Narita,
Choudhury et al. 2005). Therefore, the NPC1 defect leading to accumulation of
cholesterol/sphingolipid in late endosomal compartments can be normalized by altering these
Rab regulated pathways.
Role of NPC1 in the intestine
Compared to wild type cells, in NPC1-/- cells cholesterol is more readily incorporated into
detergent-resistant membranes (DRMs) after hydrolysis from LDL-cholesterol ester (Ikonen and
Holtta-Vuori 2004). This indicates that cholesterol/sphingolipid accumulation results in excess
formation of rafts in late endosomal compartments, whereas they are depleted under normal
circumstances. There is also a recent identification of the mammalian NPC1 relative, NPC1-L1,
as an intestinal transporter of cholesterol (Altmann, Davis et al. 2004). This may hint towards a
function in microbial-host interactions in the gut.
53
1.4.1.3 Model to study Detergent-Resistant Microdomains
(DRMs)
In normal mammalian cells, cholesterol associate with sphingolipids to form lateral domains –
lipid rafts. Rafts are present in cholesterol-sphingolipid-enriched membranes, such as the
membrane of early and recycling endosomes (van der Meer-Janssen, van Galen et al. 2010).
Since in NPC disorders, cholesterol and sphingolipids accumulate in lysosomes, this lysosomal
storage defect is a result of accumulation of rafts in late endosomes and lysosomes.
In addition, the transport of hydrolyzed LDL-derived cholesterol to the plasma membrane is
defective in cells that do not have a functional NPC1 protein (Lusa, Blom et al. 2001). This
reflects impaired membrane dynamics of the late endocytic organelles suggesting that in NPC1
deficient cells cholesterol-sphingolipid-containing rafts accumulate and form multilamellar
bodies, which leads to aberrant raft formation in lysosomes, preventing the formation of these
rafts in cell plasma membranes (Garver, Krishnan et al. 2002). NPC1-deficient mice are,
therefore, a suitable model for studying plasma membrane lipid raft disruption and its effects on
microbial-host interactions (Riff, Callahan et al. 2005).
1.5 Alternative preventative strategies
1.5.1 Probiotics
Probiotics are selective nonpathogenic live microorganisms that have beneficial effects on host
health, disease prevention, or disease treatment (Gareau, Sherman et al. 2010). Some of these
microorganisms include ones that are presently part of the gut microflora.
1.5.2 Probiotics in Disease Management
Results from the rising numbers of studies and clinical trials indicate potential applications of
probiotics for the prevention and/or treatment of many gastrointestinal disorders including: IBD,
antibiotic-associated diarrhea, IBS, neonatal necrotizing enterocolitis (NEC), enteropathy in HIV
54
infection, gluten intolerance, gastroenteritis, H. pylori infection, and colon cancer (Michail
2009).
Management of IBD
The pathogenesis of IBD involves a primary or secondary alteration of the intestinal microbiota.
Therefore, much research has been pursuing clinical studies to manipulate the intestinal
microbiota via the use of probiotics. Many probiotics show potential for therapeutic usage in
ulcerative colitis patients via induction of remission, reduction of clinical DAI scores, and
preventing the onset of pouchitis. Selected probiotics (eg. VSL#3) mediate their beneficial
effects via increasing the number of mucosal regulatory T cells indicating a beneficial
immunoregulatory mechanism of action in patients with a surgically fashioned ileal pouch
(Pronio, Montesani et al. 2008).
However, the potential use of probiotics in Crohn’s disease as a prevention or treatment strategy
remains controversial. For example, in a meta-analysis of eight randomized placebo-controlled
clinical trials, the use of Lactobacillus johnsonii, LGG, E. coli Nissle 1917, or Saccbaromyces
boulardii did not show efficacy in maintaining remission. This may be due to the lack of
understanding of probiotics mechanism and the insufficient knowledge of the underlying
pathogenesis of Crohn’s disease.
1.5.3 Mechanism of Action
The recent biomedical literature now corroborates that probiotics can be used as a supportive
treatment for a wide spectrum of intestinal diseases (Sherman, Ossa et al. 2009). In IBD animal
models, a strain of Lactobacillus plantarum was able to stabilize the mucosal barrier in an
interleukin-10 gene knockout mouse model of colitis (Kennedy, Kirk et al. 2001; Schultz,
Veltkamp et al. 2002). Other bifidobacteria and lactobacilli decrease intestinal permeability,
enhance mucosal IgA responses (Chen, Louie et al. 2005), and increase the production of anti-
inflammatory cytokines (Lamine, Eutamene et al. 2004). The probiotic Escherichia coli, strain
Nissle 1917 (EcN) induces an overriding signalling effect leading to restoration of a disrupted
epithelial barrier via PKCδ signalling pathway and the redistribution of ZO-2 (Zyrek, Cichon et
al. 2007).
55
Probiotics are also capable of increasing host innate and adaptive immune functions. For
instance, cell-free extracts from probiotics have also been reported to enhance the phagocytosis
of viable Salmonella (Higgins, Erf et al. 2007).
56
Chapter 2.
Hypothesis and Objectives
57
Enterohemorrhagic Escherichia coli O157:H7 maintain a type III secretion system (TTSS) that
functions in secreting virulence factors directly into the cytosolic space of host cells (Larzabal,
Mercado et al. 2010). Many of these virulence factors, either directly or indirectly, influence the
structure of actin filaments that maintain host cell morphology and promote binding of bacteria
to host cells. Specifically, EspA, B, D, and Tir regulate host actin morphology, allowing the
formation of actin-based pedestals that underlie bacterial attachment sites on the host plasma
membrane surface (Batchelor, Prasannan et al. 2000; Hamada, Hamaguchi et al. 2010).
Multiple host signalling pathways are hijacked by EHEC O157:H7 to induce these host
cytoskeleton changes. Some of the host proteins exploited by EHEC O157:H7 include: N-
WASP, Arp 2/3, Nck (Vingadassalom, Kazlauskas et al. 2009), PLC, PI3K (Johnson-Henry,
Wallace et al. 2001), and small GTPases (Bulgin, Raymond et al. 2010). Osteopontin (OPN) has
also been shown to mediate actin cytoskeleton rearrangement (Kang, Zhou et al. 2008), which
can also be manipulated by bacterial pathogens during the infection process. However, the
precise mechanisms how these signalling molecules are activated by the bacteria to induce its
pathogenic effects are still largely undefined .
Lipid rafts are prominent targets of bacterial pathogens. Several pathogens with functional TTSS
secrete effector proteins that are targeted to lipid rafts, and these pathogens adhere at GM1-
enriched lipid raft microdomains (French, Panina et al. 2009). Lipid rafts are important for
attachment of bacterial pathogens (Hayward, Hume et al. 2009), bacterial invasion (Lafont and
van der Goot 2005), activating bacterial TTSS (van der Goot, Tran van Nhieu et al. 2004), and
cell-surface binding by A-B toxins (ie. Shiga toxins) (Lencer and Saslowsky 2005). Disruption
of these host lipid rafts, with the use of agents like methyl-β-cyclodextrin (MCD), protects cells
from TTSS-induced cytotoxicity (French, Panina et al. 2009). Lipid raft disruption using MCD
also causes a decrease in adherence of bundle-forming pili (BFP)-deficient EPEC. Translocation
of the effector proteins is also blocked when lipid rafts are disrupted (Allen-Vercoe, Waddell et
al. 2006). Taken together, these findings indicate that lipid rafts play a role in the adherence and
virulence of pathogens.
58
The goal of this thesis project was to identify host signaling proteins involved in the microbial-
host interaction. The overall hypothesis of this thesis project was that EHEC O157:H7 effectors
associate with lipid rafts and promote the translocation of host signal transduction proteins to
lipid rafts, which then leads to the formation of A/E lesions. . The overall objective of this PhD
thesis was to determine how E. coli O157:H7 utilize host signalling platforms during the
infectious process.
The specific aims of this thesis were to:
1. Investigate how osteopontin (OPN) is involved in EHEC-induced A/E lesion formation, and
determine its role in C. rodentium pathogenesis in a murine model of AE infection.
2. Determine the role of lipid rafts in the recruitment of host signal transduction proteins during
EHEC O157:H7 infection.
3. Identify the specific PKC isoform(s) recruited to lipid rafts in response to EHEC O157:H7
infection, and assess whether this recruitment process can be interrupted.
59
Chapter 3.
Osteopontin Mediates Citrobacter rodentium-Induced Colonic Epithelial Cell Hyperplasia and Attaching-Effacing Lesions
*Eytan Wine, *Grace Shen-Tu, Melanie G. Gareau, Harvey A. Goldberg, Christoph Licht,
Bo-Yee Ngan, Esben S. Sorensen, James Greenaway, Jaro Sodek, Ron Zohar, and Philip M.
Sherman. Osteopontin Mediates Citrobacter rodentium-Induced Colonic Epithelial Cell
Hyperplasia and Attaching-Effacing Lesions. American Journal of Pathology (2010) 177(3), in
press (September).
* G.S-T. and E.W. contributed equally to this work.
60
3.1 Abstract
Background: Although osteopontin (OPN) is upregulated in inflammatory bowel diseases
(IBD), its role in disease pathogenesis remains controversial. The objective of this study,
therefore, was to determine the role of OPN in host responses to a non-invasive bacterial
pathogen, Citrobacter rodentium, which serves as a murine infectious model of colitis.
Methods: OPN gene knockout and wild-type (WT) mice were infected orogastrically with either
C. rodentium or LB broth. Mouse-derived OPN+/+
and OPN-/-
fibroblasts were incubated with C.
rodentium and attaching-effacing lesions demonstrated using transmission electron microscopy
and immunofluorescence.
Results: Colonic expression of OPN was increased by C. rodentium infection of WT mice.
Furthermore, colonic epithelial cell hyperplasia, the hallmark of C. rodentium infection, was
reduced in OPN-/-
mice and spleen enlargement by infection was absent in OPN-/-
mice. Rectal
administration of OPN to OPN-/-
mice restored these effects. There was a 8-17-fold reduction in
bacterial colonization in OPN-/-
mice, compared to WT mice, which was accompanied by
reduced attaching-effacing lesions, both in infected OPN-/-
mice and OPN-/-
mouse fibroblasts.
Adhesion pedestals were restored in OPN-/-
cells complemented with human OPN.
Conclusions: Lack of OPN results in decreased pedestal formation, colonization, and colonic
epithelial cell hyperplasia responses to C. rodentium infection, indicating that OPN impacts on
disease pathogenesis through bacterial attachment and altered host immune responses.
61
3.2 Introduction
Osteopontin (OPN) is a multifunctional glycophosphoprotein involved in a variety of cellular
functions, including stimulation of T helper(H)1 cytokines and adhesion through binding to
integrins and CD44 receptors on cell surfaces. This cytokine is highly expressed in chronic
inflammatory and autoimmune diseases,(Hashimoto, Sun et al. 2007) and is localized in and
around inflammatory cells.(Scatena, Liaw et al. 2007) OPN is believed to exacerbate
inflammation in a variety of settings, including infectious diseases.(Hashimoto, Sun et al. 2007)
It is involved in recruiting inflammatory cells to sites of injury, as indicated by a decrease in
macrophage infiltration in ischemic kidneys in OPN-deficient (OPN-/-
) mice.(Hashimoto, Sun et
al. 2007) OPN is also involved in controlling expression of inflammatory mediators, such as
down-regulation of the anti-inflammatory cytokine interleukin (IL)-10 and an increase in levels
of the TH1 cytokine interferon (IFN)γ.(Morimoto, Inobe et al. 2004)
Accumulating evidence indicates that defects in the dynamic balance between organisms in the
commensal intestinal microbiota and host innate defensive responses at the intestinal mucosal
surface results in the induction of inflammatory bowel diseases (IBD).(Neish 2009) An
association between luminal bacteria and IBD is further supported by animal models,(Xavier and
Podolsky 2007) including the use of Citrobacter rodentium infection. C. rodentium is the
causative agent of transmissible murine colonic epithelial cell hyperplasia that harbors a locus of
enterocyte effacement (LEE) pathogenicity island, similar to enterohemorrhagic Escherichia coli
(EHEC) O157:H7, and is capable of forming dense F-actin bacterial attachment pedestals,
known as attaching-effacing (A/E) lesions, in mouse colon.(Deng, Vallance et al. 2003) The
resulting TH1 response and accompanying pathological changes represent findings observed in
patients with IBD.(Eckmann 2006) As a result, C. rodentium serves as a relevant animal model
to study potential infectious mechanisms of IBD.(Borenshtein, McBee et al. 2008)
An association between OPN and IBD was recently assessed using dextran sodium sulphate
(DSS) to induce colitis in wild-type (WT) and OPN-/-
mice. However, the results arising were
contradictory. One study suggested that lack of OPN has a protective effect,(Zhong, Eckhardt et
al. 2006) whereas others reported a detrimental outcome during the acute phase(da Silva, Pollett
62
et al. 2006; Heilmann, Hoffmann et al. 2008; da Silva, Ellen et al. 2009) and protection from
chronic exposure to DSS.(Heilmann, Hoffmann et al. 2008) This controversy prompted us to
study an association between OPN and gut inflammation, using C. rodentium as a model of
infectious colitis, to provide insight regarding the role of OPN in the pathogenesis of IBD.
Herein, we describe the attenuation of C. rodentium-induced colonic epithelial cell hyperplasia
and a reduction in bacterial colonization in OPN-/-
mice. In addition, we demonstrate dependence
of adhesion pedestal formation in response to C. rodentium on the presence of OPN. Taken
together, these findings contribute to an improved understanding of the role of OPN in response
to intestinal infection.
63
3.3 Materials and Methods
Mice. OPN-/-
mice, kindly provided by Drs. Susan Rittling (Forsyth Institute, MA) and David
Denhardt (Rutgers University, NJ), back-crossed into a C57BL/6 background, were generated
and maintained, as described previously.(Rittling, Matsumoto et al. 1998) All OPN-/-
mice and
C57BL/6 control mice (6-8 weeks old) were maintained in a specific pathogen-free environment.
The mice were transferred to a containment facility at least 3 days prior to pathogen inoculation.
Animal care and interventions were approved by the Hospital for Sick Children Laboratory
Animal Services.
Bacterial infection of mice. C. rodentium, strain DBS100 (ATCC 51459, generously provided
by the late Dr. David Schauer, Massachusetts Institute of Technology, Cambridge, MA) was
stored in LB broth with 10% glycerol at -80C. Bacteria were grown from frozen stocks on LB
agar plates at 37C and then re-grown in LB broth overnight at 37C. The inoculum was
prepared to reach a final infection suspension containing 109 colony-forming units (CFU)/mL.
Mice were inoculated by orogastric gavage with 0.1 mL of the bacterial suspension. Sham
controls were challenged with an equal volume of sterile LB broth. In most cases, mice were
maintained until post-infection (PI) day 10. In some experiments animals were euthanized on PI
days 3, 6, and 15 for tissue analyses and to establish the time-course of OPN responses and
bacterial colonization to infection.
In a subset of experiments, OPN purified from bovine milk, was either added to the drinking
water, to reach a concentration of 20 κg/mL,(Schack, Lange et al. 2009) or inserted into the
rectum of WT and OPN-/-
mice without anesthesia once a day [2 κg in 100 κL phosphate
buffered saline (PBS)] through a flexible plastic cannula. In all cases, OPN supplementation was
started 24 h prior to infection and maintained throughout the 10 days of infection, until sacrifice.
PBS was rectally inserted to control mice (to control for potential confounding effects of daily
rectal insertion).
Large bowel histology and immunohistochemistry. Large bowel sections were fixed in 10%
buffered formalin and stained with hematoxylin and eosin. Intestinal inflammation was graded
on coded sections by a single pathologist (B-YN; Table 3.1). Mucosal thickness and epithelial
64
cell hyperplasia were assessed using a Zeiss Axioplan microscope and digital photographs
(SenSys; Photometrics, Tucson, AZ). The average depth of 20 well-oriented colonic crypts
measured for each mouse (V for Windows; Digital Optics, Auckland, New Zealand).
For immunohistochemistry, formalin-fixed, paraffin-embedded tissues were mounted onto
positive-charged microscope slides and baked overnight at 60C. Rabbit anti-mouse polyclonal
cleaved caspase 3 antibody (Ab) (Cell Signaling Technology, Danvers, MA) and rabbit-
monoclonal Ab against Ki67 (Lab Vision, Fremont, CA) were used on an automated immune
stainer (Benchmark, Ventana Medical Systems, Tucson, AZ) at dilutions of 1:40 and 1:100,
respectively. Immunodetection was carried out using an LSAB system employing a 1:100
dilution of biotinylated anti-rabbit immunoglobulin (Ig)G (Vector Laboratories, Burlingame,
CA) with a commercial secondary detection system (Ventana iVIEW DAB). Tissue sections
were dewaxed, heat-induced epitope retrieved, peroxidase blocked, endogenous biotin blocked,
and counterstained with hematoxylin.
For OPN immunohistochemistry, colonic sections were de-paraffinized and heat-induced epitope
retrieval was performed with Tris-EDTA pH 9. Rabbit polyclonal anti-OPN Ab (reacts with
human and mouse OPN; dilution 1:750; Abcam Inc., Cambridge, MA) was incubated for 1 h,
followed by incubation with secondary Ab and treatment with HRP-conjugated streptavidin as
the labeling reagent. Color was developed with NovaRed solution and counterstained with
hematoxylin.
ELISA. Immediately after euthanization, blood samples were obtained by cardiac puncture.
Serum was collected upon centrifugation at 18,000g for 10 min. Distal colonic sections were
collected in 1 mL Complete protease inhibitor cocktail (Roche Diagnostics, Mannheim,
Germany) and then homogenized. Samples were stored at -80C until use. Osteopontin levels in
serum samples and colonic homogenates were assessed using a mouse osteopontin immunoassay
kit as per the manufacturer’s instructions (R&D Systems Inc., Minneapolis, MN).
Immunoblotting. Aliquots of colonic homogenates were analyzed for OPN and β-actin. Proteins
were separated by pre-casted 10% Tris-HCl (Bio-Rad, Hercules, CA) sodium dodecyl sulphate
65
Table 3.1 Colonic Inflammation Histological Score*
Score
Criterion 0 1 2 3 4
Goblet cells — ↓ ↓↓ ↓↓↓ ↓↓↓
Mucosal thickening — ↑ ↑↑ ↑↑↑ ↑↑↑
Inflammatory cells — ↑ ↑↑ ↑↑↑ ↑↑↑
Submucosa cell infiltration — — ↑ ↑↑ ↑↑↑
Destruction of architecture — — — ↑ ↑↑
Ulcers (epithelial cell surface) 0% 0–25% 25%–50% 50%–75% 75%–100%
Crypt abscesses 0 1–3 4–6 7–9 >10
Eosinophil infiltration — ↑ ↑↑ ↑↑↑ ↑↑↑
*Scoring criteria modified from Van der Sluis, et al. 2006
66
polyacrylamide gel electrophoresis (SDS-PAGE) with a protein ladder standard (Bio-Rad, broad
molecular range ladder). After electrophoresis, proteins were transferred onto nitrocellulose
membranes (Pall Corporation, Pensacola, FL) and incubated in Odyssey blocking buffer (LI-
COR Biosciences, Lincoln, NE) before probing with rabbit polyclonal anti-human OPN Ab (also
reacts with mouse OPN; Abcam; 1:1000) and primary mouse monoclonal IgG Ab against β-actin
(Sigma, Saint Louis, Missouri; 1:5000) overnight. After washing the membrane (PBS plus 0.1%
Tween), blots were incubated with Ab [IRDye 800 goat anti-rabbit IgG (Rockland
Immunochemicals, Gilbertsville, PA; 1:20,000) and Alexa Fluor 680 goat anti-mouse IgG
(Invitrogen, Carlsbad, CA)] and incubated for 1 h at room temperature on a shaker. The blots
were then washed and the membrane was scanned; bands were detected using the Odyssey
system (LI-COR Biosciences). The integrative intensities of the detected bands were obtained by
software (Odyssey Infrared Imaging
System, LI-COR Biosciences). Quantification of
osteopontin expression was obtained by normalizing the integrated intensity of the OPN band
with β-actin expression.
mRNA expression of OPN using qRT-PCR. Quantitative real-time PCR was used to quantify
expression of OPN in colons of WT animals infected with C. rodentium and sham controls.
Briefly, colonic tissues were snap-frozen in liquid nitrogen and stored at -80C until further use.
Total RNA was isolated by homogenization in TRIzol reagent (Invitrogen), phase separation
using chloroform extraction, and precipitation from the aqueous phase using isopropyl alcohol.
Washed RNA was re-dissolved in RNase-free water and stored at -80C. RNA was treated with
DNase1 (Invitrogen) according to the manufacturer’s instructions. cDNA was synthesized using
the iScript synthesis kit (Bio-Rad) and stored at -20C. PCR was performed using SYBR green
reagents (Bio-Rad) and validated primers for β-actin (Forward: 5’-
GGCTGTATTCCCCTCCATCG; Reverse: 5’-CCAGTTGGTAACAATGCCATGT) and for
OPN (Forward: 5’-AGCAAGAAACTCTTCCAAGCAA; Reverse: 5’-
GTGAGATTCGTCAGATTCATCCG; Invitrogen). Expression levels were normalized using β-
actin as the reference gene and expressed as ΔΔCT values.
Cytokine assay. Distal colons homogenates were used for mouse TH1/TH2/IL-17 cytokine
detection using MESO Scale Discovery cytokine assay kits (Gaithersburg, Maryland, USA).
67
Samples were prepared according to manufacturer’s protocol and levels of IFNγ, IL-1β, IL-2, IL-
4, IL-5, IL-10, IL-12, IL-17, KC, and tumor necrosis factor (TNF)α were quantified using
electrochemiluminescence detection.
Weight, stool changes, and bacterial colonization. All mice were checked daily for the
development of signs of morbidity. A disease activity index (DAI) score (Table 3.2, modified
from(Van der Sluis, De Koning et al. 2006)) was obtained by documenting body weight, stool
color and consistency and general appearance every 3 days until euthanization by cervical
dislocation on PI day 10. Rectal swabs were collected on the same days and plated onto
MacConkey agar plates, and incubated aerobically overnight at 37C. C. rodentium colonies
were distinguished by their typical size and morphology.(LeBlanc, Yeretssian et al. 2008) C.
rodentium colonization was quantified on day 10 by homogenization of either fecal pellets or
distal colonic tissue in 1 mL PBS and plating of 10-fold serial dilutions onto MacConkey agar.
C. rodentium colonies were enumerated after overnight growth at 37C, and results expressed as
CFU/g feces or colonic tissue.
Detection of bacterial translocation. Blood samples were obtained by cardiac puncture, and the
spleen, liver, and mesentery (including lymph nodes) removed, weighed, and homogenized
(Pro200 homogenizer, PRO Scientific Inc., Oxford, CT). Under sterile conditions, aliquots (10
κL) of blood or organ homogenate were plated in 10-fold serial dilutions onto blood agar plates
and incubated aerobically for 24 h at 37C, after which the number of bacterial CFU was
calculated per mL of blood or per g of tissue.
Cells and bacterial infection. WT, OPN-/-
, and OPN-/-
mouse fibroblasts complemented with
human OPN(Zohar, Zhu et al. 2004) were employed as in vitro model systems and cultured in
DMEM with 10% fetal bovine serum, 100 κg/mL penicillin G, 50 κg/mL gentamicin, and 0.3
κg/mL fungizone (37C; 5% CO2). OPN-rescued cells were supplemented with Geneticin (all
reagents from Gibco Laboratories, Grand Island, NY). Cells were infected with either EHEC
O157:H7 (Hospital for Sick Children, Toronto, ON, Canada) or C. rodentium [multiplicity of
infection (MOI) 100:1; 37C; 5% CO2]. In some experiments bovine milk OPN (5
κg/mL)(Sorensen and Petersen 1993) or recombinant OPN(Hunter, Grohe et al. 2009) were
added to the medium 1 h prior to bacterial infection.
68
Transmission electron microscopy (TEM). Mouse fibroblasts were grown on six-well plates
and infected with C. rodentium (MOI 100:1) for 4 h at 37°C. Cells or colonic tissue samples
were then washed and fixed in 4% paraformaldehyde + 1% glutaraldehyde in PBS, post-fixed in
1% osmium tetroxide, dehydrated in a graded series of acetone, and subsequently infiltrated and
embedded in Epon-Araldite epoxy resin. The processing steps from post fixation to
polymerization of resin blocks were carried out in a microwave oven (Pelco BioWave 34770,
Pelco International, Redding, CA), as recommended by the manufacturer. Ultrathin sections
were cut with a diamond knife (Reichert Ultracut E, Leica Inc, Wetzlar, Germany). Sections
were stained with uranyl acetate and lead citrate before being examined by TEM (JEM-1011,
JEOL USA Corp., Peabody, MA). Digital electron micrographs were acquired directly with a
1024 X 1024 pixels CCD camera system (AMT Corp., Denver, MA).
Immunofluorescence. Mouse fibroblasts were grown on glass 22X22 mm No.1.5 coverslips
(VWR LabShop, Vatabia, IL) in 6 well plates covered with 2 mL of antibiotic-free media. Cells
were infected with EHEC or C. rodentium at MOI of 100:1 for 4.5–6 hours. Slides were washed,
fixed (paraformaldehyde), permeabilized (Triton-X 100), blocked for 30 min with 0.1% BSA,
and incubated in FITC-conjugated polyclonal goat-anti-EHEC O175:H7 Ab (1:100; Fitzgerald,
Concord, MA) or rabbit-anti-C. rodentium Ab with Alexa Fluor 594 Phalloidin for 1 h. Goat
anti-rabbit Cy2 secondary Ab (1:100; 1 h; 20°C; Jackson Immunoresearch Inc., West Grove, PA)
was used to visualize C. rodentium. Slides were stained with DAPI for 5 min prior to 3 washes
with PBS and then mounted using SlowFade Antifade Kits (Molecular Probes, Eugene, OR) and
analyzed under alternating phase-contrast and fluorescence microscopy (Leitz Dialux 22; Leica
Canada, Inc., Toronto, ON, Canada).
Adhesion assay. Mouse fibroblasts were grown in antibiotic-free culture medium in 6 well
plates overnight. Cells were then infected with 108 bacteria (MOI 100:1) for 4.5 h in 5% CO2 at
37°C. After infection, non-adherent bacteria were removed by washing the monolayers three
times with PBS (pH 7.0). Triton X-100 (0.1%, diluted in PBS) was added to each well and left
on an orbital spinner for 15 min at room temperature. To quantify the number of bacteria
adherent to cells, Serial dilutions were performed on each sample by taking 10 κl from a series of
10-fold diluted samples plating onto blood agar plates and cultured overnight in 37°C. The
69
Table 3.2 Modified Disease Activity Index Score*
Score Weight loss % Stool consistency Blood loss Appearance
0 None Normal Negative Normal
1 1-5% Loose Hunched
2 5-10% Diarrhea Gross Starey coat
3 10-15% Lethargic
4 >15%
*Scoring criteria modified from Van der Sluis, et al. 2006
70
number of bacteria on each plate was then counted to calculate the original number of adherent
bacteria.
Statistics. Results are expressed as means±SEM. ANOVA and unpaired Student’s t test were
employed, as appropriate, with Tukey’s post-hoc test for normal distribution was ascertained,
and nonparametric Kruskal-Wallis test for non-normal distribution. Fisher’s exact test was used
for analysis of categorical data. Analyses were conducted using InStat3 (GraphPad, San Diego,
CA). P<0.05 was considered significant.
71
3.4 Results
C. rodentium infection increases OPN expression in mouse colons.
WT C57BL/6 and OPN-/-
mice (N=31 & 28, respectively) were challenged orogastrically with C.
rodentium (108
CFU/0.1 mL), and 16-20 additional mice in each group were used as sham-
infected controls. Experiments were conducted on at least 4 separate occasions. To determine
whether OPN mediates epithelial responses to C. rodentium, the effect of bacterial infection on
OPN expression in the colon was assessed during the 10 day course of infection by
immunohistochemistry, protein ELISA and western blotting, and qPCR. As expected, colons
from OPN-/-
mice did not stain positive for OPN, whereas uninfected WT mice (sham) had low
basal levels of OPN, located mainly at the luminal surface (Figure 3.1A). Infection with C.
rodentium led to a time-dependent increase in OPN expression throughout the entire length of
the crypts that peaked at PI day 10, when inflammation is most prominent, and then decreased at
PI day 15 (Figure 3.1A). OPN protein levels in colons increased by ~3 fold during infection
(Figure 3.1, B and C) and a 10-fold increase in OPN mRNA expression in colonic homogenates
of infected WT mice after 10 days of infection (Figure 3.1D), as well as parallel increases in
OPN serum (Figure 3.1E) were also observed. These findings support the involvement of OPN
in epithelial cell responses to infection, as shown in inflamed colons of human subjects with
IBD.(Qu-Hong and Dvorak 1997; Sato, Nakai et al. 2005)
OPN is associated with inflammation and colonic epithelial cell hyperplasia in response to C.
rodentium infection.
Colonic epithelial cell hyperplasia, the hallmark of the host response to C. rodentium
infection,(Mundy, MacDonald et al. 2005) was demonstrated by a doubling in crypt length in 10
day-infected WT mice (290±6 vs. 144±4 µm in WT sham; Figure 3.2, A and B; p<0.001).
However, C. rodentium infection increased crypt length in OPN-/-
mice by only 21% (205±8 vs.
169±4 µm in sham-OPN-/-
mice; p<0.05), which was considerably shorter than in infected WT
mice (Figure 3.2, A and B; p<0.001). Similarly, there were significant differences in histology
scores, employed as a reproducible measure of mucosal injury, between WT and OPN-/-
infected
mouse colons (7.1±1.1 vs. 3.9±0.8, respectively; Figure 3.2, C and D; p<0.05). Cytokine levels,
72
measured in mouse colon homogenates, showed increases in IFNγ, IL-1β, and TNFα levels with
infection of WT mice (p<0.05) but no increase in infected KO mice (p>0.05). IFNγ was higher in
infected WT mice than in infected OPN-/-
mice (Figure 3.2 E; p<0.05). There were no changes
in levels of IL-2, IL-4, IL-5, IL-10, IL-17, or CK in both groups (data not shown). The reduced
crypt epithelial cell hyperplasia in OPN-/-
mice in response to C. rodentium infection was due to
a reduction in cell proliferative responses and not an increase in apoptosis (Figure 3.2, F and
G).
C. rodentium colonization of mice is reduced in the absence of OPN.
OPN-/-
mice had significantly less C. rodentium CFU/g feces than infected WT mice
(1.2×106±3.4×10
5 vs. 2.1×10
7±5.6×10
6, respectively; Figure 3.3A; p<0.005) after 10 days of
infection, suggesting that OPN contributes to maintenance of C. rodentium colonization in the
colon. There was also a reduction in bacteria in colonic tissue homogenates of infected OPN-/-
mice (5.4×105±1.4×10
5), relative to infected WT mice (4.3×10
6±1×10
6 CFU/g colon; Figure
3.3B; p<0.005). A reduction in colonization of OPN-/-
mice, relative to WT mice, was also
observed on PI day 6 and bacterial clearance was apparent on PI day 15; findings which indicate
that reduced pathogen colonization was not due to changes in the time-course of infection in
OPN-/-
mice (Figure 3.3, C and D; p<0.01). These results suggest that OPN-/-
mice were
partially protected from C. rodentium infection due to a reduction in bacterial colonization in the
absence of OPN. Consistent with previous reports,(Mundy, MacDonald et al. 2005) bacterial
colonization of WT mice peaked at PI day 6 (Figure 3.3C).
Weight loss and disease activity in response to C. rodentium infection are not affected by OPN.
DAI (Table 3.2) scores for WT- and OPN-/-
-infected mice on days 4 and 10 were higher than in
sham mice (p<0.05; data not shown). Ten days after challenge, both sham groups gained
approximately 10% body weight, while weights of C. rodentium-infected WT and OPN-/-
mice
remained unchanged. However, there was no difference in DAI between WT and OPN-/-
mice
infected with C. rodentium. The lack of profound effect for OPN on systemic responses to
infection is likely due to relatively mild systemic disease in C57BL/6 mice infected with C.
rodentium, compared to other mouse strains.(Vallance, Deng et al. 2003; Borenshtein, Nambiar
et al. 2007)
73
Figure 3.1 OPN expression is increased in response to C. rodentium infection. A: Colonic
immunohistochemistry showed that OPN was present at low levels in uninfected WT mice (top
left panel), mainly located in the cytoplasm of surface epithelial cells. A time-dependent increase
in OPN expression was observed throughout the crypts of C. rodentium-infected WT mice as the
infection progressed to 10 days, followed by a reduction in OPN by PI day 15. Scale bar: 100
m. B: ELISA of WT mouse colons demonstrated a 3-fold increase in OPN levels with infection
(N=4-8; t test: *p<0.005). C: Western blotting of colonic homogenates of WT mice showed a
similar increase in OPN protein level, normalized to β-actin, on PI day 6 (N=4-5; ANOVA:
*p<0.01) and on PI day 10 (t test: +p<0.05). D: Colonic mRNA levels of OPN, relative to β-
actin, showed increased OPN expression in infected colons on PI day 10 by qPCR (N=5-9;
ANOVA: *p<0.01). E: Serum OPN levels, as measured by ELISA, were increased on PI day 10
and normalized by PI day 15 (N=5-9; ANOVA: *p<0.05).
74
75
Figure 3.2 Colonic epithelial cell hyperplasia and inflammation in response to C. rodentium
are associated with OPN. A: A decrease in the hyperplastic response after 10 days of C.
rodentium infection was observed in OPN-/-
infected mice (bottom right panel), relative to
infected WT mice (bottom left panel). Scale bar: 100 m. B: Quantification was performed by
measuring colonic crypt length in 20 well-oriented crypts per mouse (N=15-24; ANOVA:
*p<0.05; ** p<0.001). C: Overall histologic grading of colitis (PI day 10) indicated higher
scores in WT-infected relative to OPN-/-
-infected colons (t test: *p<0.05). D: Breakdown of the
histology score revealed increased severity in WT-infected mice (blue bars) relative to OPN-/-
-
infected mice (green bars) with respect to mucosal thickening and abscess formation (t test:
*p<0.05) but no significant change in goblet cell displacement and inflammatory cell infiltration,
which was mainly neutrophilic in nature (p=0.06 and 0.05, respectively). E: TNFα and IFNγ
were increased in colonic homogenates of infected WT mice (t test: *p<0.05) but not OPN-/-
mice. IFNγ was higher in infected WT mice than in OPN-/-
mice (t test: *p<0.05). F: Cleaved
caspase-3 staining demonstrates a small number of apoptotic epithelial cells in uninfected WT
and OPN-/-
mice (arrowheads in top left and right panels, respectively). Infection with C.
rodentium resulted in an increase in apoptosis in WT mice (arrowheads in bottom left panel), but
not in OPN-/-
mice (bottom right panel). G: In both uninfected WT and OPN-/-
mice (top panels)
Ki67 staining indicated that the proliferative zone was limited to the bottom third of colonic
crypts. Infection with C. rodentium caused an increase in proliferation, which extended to the
whole length of the crypt only in WT colons (bottom left panel), but not in OPN-/-
mice (bottom
right panel). Scale bar: 100 m.
76
77
Figure 3.3 OPN mediates C. rodentium colonization. A and B: Colonization with C.
rodentium on PI day 10 was measured by homogenizing fecal pellets and colonic tissues and
then quantifying bacterial growth in serial dilutions. OPN-/-
mice infected with C. rodentium had
significantly less CFU/g feces (A) and colonic homogenates (B), compared with infected WT
mice (t test: *p<0.005). C and D: A time-course of infection, quantifying CFU in feces (C) and
colonic homogenates (D) of infected OPN-/-
mice relative to infected WT mice showed a similar
pattern of peak colonization on days 6&10 and a reduction in bacterial load on day 15 (*p<0.01).
In WT mice, fecal colonization was maximum at 6 days PI (ANOVA: p<0.001 PI day 6 relative
to all other time points; KO mice: p>0.05).
78
79
Rectal OPN supplementation partially restores colonic epithelial cell hyperplasia in response
to C. rodentium infection in OPN-/-
mice.
To support our hypothesis that OPN is involved in colonic epithelial cell hyperplasia, bovine
milk OPN was administered daily by rectal insertion to OPN-/-
mice. OPN alone had no effect on
crypt length in sham-infected OPN-/-
mice (183±3 vs. 168±7 µm with rectal PBS). By contrast,
rectal OPN given daily to OPN-/-
mice 24h prior to, and throughout the 10 day C. rodentium
infection increased the colonic crypt length (256±12 versus 196±20 µm in infected OPN-/-
mice
that received PBS alone rectally; Figure 3.4A; p=0.01). Although rectal delivery of exogenous
OPN did not completely restore crypt length to levels observed in infected WT mice (Figure
3.2B), these results confirm a role for OPN in mediating epithelial cell responses to C. rodentium
infection. In contrast, oral administration of OPN to infected OPN-/-
mice(da Silva, Ellen et al.
2009) did not increase crypt length (data not shown), possibly due to intraluminal degradation of
exogenous protein.
Bacterial translocation in infected mice is dependent on OPN.
At PI day 10, there was a non-significant reduction in bacterial translocation to mesenteric
lymph nodes of infected OPN-/-
mice (18%), relative to WT-infected mice (44%; Fisher’s exact
test: p=0.09), while 50% of OPN-treated OPN-/-
mice had viable bacterial translocation to lymph
nodes (Figure 3.4B). Bacterial translocation to the liver was higher in WT-infected mice and
OPN-treated OPN-/-
mice than in OPN-/-
mice (p<0.0001 and p<0.01, respectively). Positive
spleen cultures were uncommon and bacteremia was found in 50% of OPN-treated mice, but
only 2 mice in each of the other infected groups (Figure 3.4B; p=0.05). It is possible that the
reduced bacterial translocation observed is a consequence of lower colonization seen in OPN-/-
mice. However, eventhough rectal OPN restored crypt hyperplasia responses to C. rodentium
infection, pathogen colonization was not increased in OPN-treated versus PBS-treated mice
(Figure 3.4, C and D; p>0.05).
Increases in spleen weight and splenocyte numbers in response to C. rodentium infection are
mediated by OPN.
80
There was a 46% increase in the weight of spleens of infected WT mice on PI day 10 (133±11
versus 91±7 mg in uninfected-WT; p<0.005), likely due to accumulation of immune cells within
the spleen after infection.(Berntman, Rolf et al. 2005) This effect was absent in OPN-/-
mice
(93±7 vs. 82±6 mg in infected and uninfected mice, respectively; Figure 3.4E; N=11-28). Daily
rectal delivery of OPN to infected OPN-/-
mice restored spleen weights to levels similar to
infected WT mice (120±17 mg).
There was a parallel increase in the number of splenocytes in WT mice from 88±15×106 to
159±19×106
cells/spleen following C. rodentium infection (p<0.01). Such an increase was absent
in OPN-/-
mice (78±5×106 vs. 85±7×10
6 with infection; Figure 3.4F), whereas rectal treatment of
OPN to OPN-/-
mice increased the number of splenocytes to 122±19×106 (p<0.05). There was no
difference between uninfected WT and OPN-/-
mice in spleen weights or numbers of splenocytes.
These findings suggest that OPN mediates effects that lead to the accumulation of immune cells
in the spleen and subsequent splenic enlargement.
C. rodentium infection of mouse fibroblasts results in pedestal formation.
Intimate adherence of C. rodentium to WT mouse fibroblasts, but not cells from OPN-/-
mice,
was demonstrated by TEM, with the formation of dense F-actin attachment pedestals after 4 h of
infection (Figure 3.5A), which is a pathognomonic feature of bacterial-induced A/E
lesions.(Mundy, MacDonald et al. 2005) This is the first demonstration of C. rodentium-induced
adherence pedestals, compatible with A/E lesions, in mouse-derived cells.(Tobe and Sasakawa
2002)
OPN promotes C. rodentium and EHEC-induced pedestals.
C. rodentium-infected WT mouse fibroblasts exhibited adhesion pedestals, as demonstrated by
accumulation of dense F-actin-binding phalloidin at sites of bacterial attachment after 6 h of
infection. In contrast, pedestals were not observed in infected OPN-/-
cells, indicating that OPN
plays a role in bacterial-induced rearrangements of the host cell cytoskeleton. Furthermore, when
human-OPN knock-in mouse fibroblasts were infected with C. rodentium, F-actin pedestals were
observed (Figure 3.5B). Similar findings were also found after 4.5 h infection of the 3 cell types
with EHEC (Figure 3.5C). This observation indicates that OPN is involved in formation of
81
Figure 3.4 Rectal OPN restores responses to C. rodentium infection in OPN-/-
mice. A:
Quantification of colonic crypt length of OPN-/-
mice receiving bovine milk OPN by daily rectal
administration indicated a partial recovery in the phenotype with longer colonic crypts (N=8-15;
ANOVA; *p=0.01; representative micrographs below chart). B: Eighteen percent of infected
OPN-/-
mice (white bars) had bacterial translocation to the MLN, relative to 44% of infected WT
mice (black bars; p=0.09); translocation was restored in OPN-/-
mice pre-treated with rectal OPN
(gray bars). Bacterial translocation to the liver was higher in WT and rectal OPN-treated mice
than in infected OPN-/-
mice (Fisher’s exact test: ***p<0.0001; **p<0.01), and bacteremia was
more common in mice treated with rectal OPN (*p<0.05). C and D: Fecal (C) and colonic (D)
evidence of C. rodentium colonization was not increased in OPN-/-
mice pretreated with rectal
OPN (p=0.09 and 0.5, respectively). E: An increase was observed in the weight of spleens from
C. rodentium-infected WT mice (white bars in panels E&F), relative to uninfected WT mice
(black bars; N=12&8; ANOVA: **p<0.001). While infection of OPN-/-
mice did not change the
size of the spleen, topical rectal OPN given to OPN-/-
mice infected with C. rodentium led to an
increase in spleen weights (gray bars; N=6; *p<0.05). F: The number of splenocytes in WT mice
doubled following C. rodentium infection (ANOVA: **p<0.01). There was no change in the
splenocyte counts in OPN-/-
mice in response to enteric infection, but the addition of daily rectal
OPN to OPN-/-
mice produced a response similar to levels seen in infected WT mice (*p<0.05).
82
83
Figure 3.5 Formation of actin-dense attachment pedestals in mouse fibroblasts infected by
C. rodentium and EHEC O157:H7 is mediated by OPN. A: Transmission electron
photomicrographs of mouse fibroblasts infected for 4 h at 37ºC with C. rodentium demonstrate
adhesion pedestals. Scale bar: 500 nm. B: C. rodentium-infected (bacteria stained green) WT
mouse fibroblasts exhibited dense F-actin foci (stained with phalloidin, red), indicating
formation of adhesion pedestals (arrowheads in top panels and magnified inserts corresponding
with the outlined area). Pedestals were not present, however, in infected OPN-/-
cells (middle
panel and insert show adherent bacteria that are not accompanied by A/E lesions in the absence
of OPN). Furthermore, when human OPN knock-in mouse fibroblasts were infected with C.
rodentium, A/E-like lesions were again observed (bottom panel and inserts). C: EHEC-infected
cells were stained with FITC-conjugated anti-EHEC (green), phalloidin (red), and DAPI (blue).
Similar to C. rodentium, EHEC infection of WT fibroblasts induced adhesion pedestals
(arrowheads in top panels), which were absent in infected OPN-/-
cells (middle panels) and
restored in human-OPN complemented OPN-/-
fibroblasts (arrowheads in bottom panels).
84
85
adhesion pedestals and that the role of OPN in response to C. rodentium infection can be
extended to another intestinal pathogen containing the LEE pathogenicity island, EHEC
O157:H7. There was also a 37% reduction in overall adhesion of C. rodentium to OPN-/-
cells in
vitro relative to WT fibroblasts (p<0.05).
OPN status had no discernible effect on overall cell structure in uninfected fibroblasts. When
OPN-/-
cells were pretreated with either bovine milk-derived OPN or recombinant OPN, added to
the medium, no pedestals were seen in response to EHEC infection (Figure 3.6). These findings
suggest that an intracellular form of OPN mediates formation of pedestals, since addition of
exogenous OPN to OPN-/-
cells did not recover the WT phenotype in vitro. However, rectal OPN
was able to recover the effect in OPN-/-
mice.
To determine whether OPN is also involved in the formation of adhesion pedestals in vivo,
colonic sections were examined 6 days after infection, at the time of maximum bacterial
colonization (Figure 3.3C and (Borenshtein, Nambiar et al. 2007)). While colons of WT mice
were carpeted by multiple intimately adherent bacteria (Figure 3.7A), bacteria were absent from
most colonic sections of OPN-/-
mice and present only in small numbers in other areas (Figure
3.7B). Rarely, larger numbers of bacteria were found, located mainly in areas of mucosal damage
and cell shedding (Figure 3.7B, right panel). Rectal administration of OPN restored A/E
lesions, as shown by TEM (Figure 3.7C). Taken together, these results show that the formation
of A/E lesions in response to bacterial infections is dependent on the presence of OPN.
Figure 3.6 Exogenous OPN does not restore adhesion pedestals in vitro. Presence or absence
of OPN had no effect on F-actin phalloidin staining (red) of uninfected fibroblasts (left panels).
Pretreatment of OPN-/-
cells with extracellular, bovine milk-derived (top panels) or recombinant
(bottom panels) OPN did not induce pedestals with infection, as demonstrated by multiple
adherent bacteria (blue- C. rodentium; green- EHEC) without phalloidin-positive adhesion
pedestals.
86
87
Figure 3.7 Actin-dense pedestals are formed in C. rodentium-infected WT mice and
reduced in OPN-/-
mice. A: Multiple bacteria carpeted the surface of colons of WT mice with
A/E lesions after 6 days of infection with C. rodentium. B: In infected OPN-/-
mice, there were
no bacteria seen in most areas of the colon (left panel). In other areas, some adherent organisms
were seen (middle panel) while only in rare cases were multiple adherent bacteria observed in
infected OPN-/-
mice, especially on shedding epithelial cells (arrows in right panel). C: OPN-/-
mice treated with rectal OPN and infected with C. rodentium showed multiple A/E lesions.
88
89
3.5 Discussion
Due to recent controversies regarding the role of OPN in murine models of IBD,(da Silva, Pollett
et al. 2006; Zhong, Eckhardt et al. 2006; Heilmann, Hoffmann et al. 2008; da Silva, Ellen et al.
2009) we evaluated the involvement of OPN in the development of intestinal changes in mice
challenged with the murine enteric pathogen, C. rodentium. In the absence of OPN, mice were
protected from bacterial colonization and the colonic epithelial hyperplastic cell response
induced by C. rodentium. This protection correlated with a reduction in F-actin condensation
directly below adherent C. rodentium in vitro and in vivo, indicating that the contribution of OPN
to mucosal responses to infection could be, either directly or indirectly, mediated through
bacterial attachment.
IBD, including Crohn disease and ulcerative colitis, are chronic debilitating intestinal disorders
characterized by mucosal inflammation.(Xavier and Podolsky 2007) Increased levels of OPN are
described in both the serum and intestinal mucosa of patients with IBD and correlate with
disease severity.(Masuda, Takahashi et al. 2003; Heilmann, Hoffmann et al. 2008) In these
patients, OPN is produced by gut epithelia, IgG-producing plasma cells, and
macrophages.(Gordon and MacDonald 2005; Agnholt, Kelsen et al. 2007) Increased OPN
expression in areas of active inflammation suggests that OPN is involved in stimulating cytokine
production that contributes to a TH1-predominant adaptive immune response, as is observed in
Crohn disease.(Sato, Nakai et al. 2005) Since OPN is also associated with a decrease in the
production of the anti-inflammatory cytokine IL-10 by T cells from patients with Crohn
disease,(Agnholt, Kelsen et al. 2007) OPN-mediated defects in immune-regulation may further
contribute to the development of inflammation.
Most models studying the involvement of OPN in inflammation support a pro-inflammatory role
for this key regulator, because disease is usually attenuated when OPN is absent. For example,
OPN is elevated in the synovium of patients with rheumatoid arthritis and over-expression of
OPN in synovial T cells amplifies inflammation.(Xu, Nie et al. 2005) OPN-/-
mice with
experimental autoimmune encephalomyelitis, as a TH1 model of multiple sclerosis, are protected
from disease,(Chabas, Baranzini et al. 2001) while administration of exogenous OPN causes
90
relapse and paralysis.(Hur, Youssef et al. 2007) OPN is also involved in integrin adhesion,(Kon,
Ikesue et al. 2008) inflammatory cell chemotaxis(Zhu, Suzuki et al. 2004), and in enhanced
neutrophil function.(Koh, da Silva et al. 2007) Our findings support a role for OPN in mediating
immune responses to C. rodentium infection as demonstrated by a reduction in the increase of
IFNγ in OPN-/-
mice.
Recent attempts to define a role for OPN in intestinal inflammation, using a chemically-induced
model of colitis (DSS), have yielded conflicting results. While our group has shown that OPN-/-
mice are more susceptible to DSS colitis, through a reduction in TNFα and neutrophil
recruitment,(da Silva, Pollett et al. 2006; da Silva, Ellen et al. 2009) other investigators found an
opposite effect.(Zhong, Eckhardt et al. 2006) More recently, Heilmann et al.(Heilmann,
Hoffmann et al. 2008) found that OPN-/-
mice are more susceptible to acute challenge with DSS,
associated with reduced IL-22 and macrophage activity but increased serum TNFα, while
chronic DSS-induced colitis was reduced in these mice. This variability can be explained, at least
in part, by the use of different mouse strains, OPN gene modification strategies, varying DSS
doses, animal facility conditions, and treatment protocols. The reported discrepancies also
highlight the limitations of the DSS model of colitis in mice and its applicability to
IBD.(Kawada, Arihiro et al. 2007) DSS exerts cytotoxic effects leading to breakdown of the
mucosal barrier and exposure of the submucosal immune system to massive stimulation by
luminal bacteria.(Wirtz, Neufert et al. 2007) Resolution of inflammation in this model is mainly
dependent on an ability to repair the breach, which is initiated by inflammation.(Khalil, Weiler et
al. 2007) Since OPN is important in both neutrophil and fibroblast recruitment and in matrix
deposition, which are essential for effective tissue repair,(Sodek, Batista Da Silva et al. 2006) it
is not surprising that, in the absence of OPN, mice are more susceptible to acute DSS colitis.(da
Silva, Pollett et al. 2006; Heilmann, Hoffmann et al. 2008) Furthermore, as shown by increased
mortality from chemical-induced colitis of rats treated with anti-L-selectin antibodies, neutrophil
function has a protective effect in this setting.(Kuhl, Kakirman et al. 2007)
Increases in spleen weight and splenocyte numbers seen in infected WT mice likely represent
pooling of immune cells into the spleen in response to infection, as observed in mice infected
with Salmonella Typhimurium.(Berntman, Rolf et al. 2005) Contrary to hindlimb-unloading, a
chronic stress model where splenic atrophy is reduced in the absence of OPN,(Wang, Shi et al.
91
2007) C. rodentium infection induced an increase in spleen mass and cellularity, which was
prevented in OPN-/-
mice. The opposite effects of OPN on the spleen in these two settings can be
explained by differences between the stress models. The former is a chronic immune suppression
model, as indicated by increased serum corticosterone levels in WT, but not OPN-/-
-stressed
mice,(Wang, Shi et al. 2007) whereas the latter is a model of an acute, immune-mediated
response to bacterial infection. In both cases, OPN serves as a central mediator of immune
function that contributes to disease phenotype.
Our results clearly demonstrate that OPN-/-
mice are protected from the effects of C. rodentium
infection, including colonic epithelial cell hyperplasia, histological changes, and bacterial
translocation. In addition, the absence of OPN impaired the ability of C. rodentium to colonize
the colons, which is likely why OPN-/-
mice are not as severely affected as WT-infected mice.
However, while exogenous intrarectal OPN was able to restore some features in OPN-/-
mice,
there was no detectible increase in colonization of these mice with C. rodentium. This
discrepancy could be explained by only partial recovery of the WT phenotype with OPN
administration to OPN-/-
mice (as shown for epithelial cell hyperplasia), a type II statistical error,
or limitations of culture-based bacterial recovery methods used in this study. Since epithelial cell
hyperplasia, pedestal formation, bacterial translocation to the liver, and splenic responses were
all increased with rectal OPN treatment, the findings support a role for OPN in mediating
responses to C. rodentium infection in this model.
OPN could either directly mediate bacterial attachment to host cells, as recently shown for
Gram-positive bacteria,(Schack, Stapulionis et al. 2009) or modify host responses to bacteria.
Alternatively, since adhesion and A/E lesion formation involve multiple complex host and
microbial factors, it is possible that other mediators downstream to OPN could also explain these
findings. For example, reduced inflammation in the absence of OPN could lead to a decrease in
the abundance of epithelial attachment sites that are required for initial bacterial
adhesion.(Higgins, Frankel et al. 1999) Since the highest increase in OPN was observed on PI
day 10, it is more likely that OPN mediates signaling events related to A/E lesion formation and
epithelial cell hyperplasia rather than being directly involved in bacterial attachment, which is
observed earlier in the course of infection, around PI day 6.(Mundy, MacDonald et al. 2005)
92
Although C. rodentium is widely used to study enteric bacterial infections and intestinal
inflammatory models,(Eckmann 2006; Frankel and Phillips 2008) adhesion pedestals have not
been demonstrated in mouse cells in vitro(Tobe and Sasakawa 2002) or in human intestinal cells,
unless C. rodentium is genetically modified to express a human enteropathogen-derived bacterial
adhesion.(Tobe and Sasakawa 2002) To our knowledge, the intimately adherent bacteria C.
rodentium and the accompanying F-actin-dense pedestals demonstrated in our study using
immortalized mouse fibroblasts, are the first to show the formation of pedestals compatible with
A/E lesions in response to C. rodentium infection in mouse cells. Furthermore, we found that the
formation of bacterial-induced changes in the host cytoskeleton were absent in cells lacking
OPN, and were restored by reintroducing human OPN into the cells, but not by pre-treating cells
with extracellular OPN. These findings indicate that OPN plays an important role in bacterial-
induced attachment pedestal formation and suggest that an intracellular form of OPN mediates
this effect since adding OPN to the medium was not sufficient to restore pedestals. In contrast,
addition of topical OPN through rectal administration in OPN-/-
mice did restore effects of C.
rodentium infection, possibly because OPN may be differentially processed and internalized in
the in vivo setting. The ability of exogenous OPN to be absorbed and attenuate DSS-induced
colitis(da Silva, Ellen et al. 2009) supports a potential use for this compound in future research.
C. rodentium attachment to cells involves either LEE-dependent (involved in A/E lesion
formation) or LEE-independent mechanisms. Since OPN was involved in pedestal formation,
this likely provides the mechanism for reduced pathogen colonization and less severe colonic
involvement in OPN-/-
mice. A specific reduction in the formation of adhesion pedestals and in
overall adhesion in vitro supports a role for actin rearrangements in anchoring bacteria and
stabilizing colonization, as demonstrated by the failure of espFu-/-
EHEC to persist colonization
in rabbits due to reduction in A/E lesions.(Ritchie, Brady et al. 2008) Furthermore, the OPN
receptor CD44 is recruited to pedestals upon EHEC infection, although, in contrast to OPN, A/E
lesions are still formed in the absence of this host protein.(Goosney, DeVinney et al. 2001) These
findings suggest that CD44 is not functional in the formation of pedestals, whereas our results
indicate that OPN is. Further in vivo evidence supporting a role for OPN in the formation of
adherence pedestals is provided by a reduction in A/E lesions in OPN-/-
mice on PI day 6, which
is likely the cause of the reduced colonization. Alternatively, it is also possible that OPN has a
93
more profound effect on the composition of the intestinal microbiota, although this was not
directly addressed in this paper. This possibility is supported by the recent description of reduced
C. rodentium colonization and reduced epithelial cell hyperplasia when mice are colonized with
a single commensal microbe.(Ivanov, Atarashi et al. 2009)
Defects in migration of cells in the absence of OPN, such as shown for neutrophil
recruitment(Koh, da Silva et al. 2007) and macrophage chemotaxis,(Zhu, Suzuki et al. 2004) are
mediated by impaired cytoskeletal responses, likely due to a reduction in association with the
CD44 receptor.(Sodek, Batista Da Silva et al. 2006; Collins, Ho et al. 2008) Furthermore, while
unchallenged OPN-null fibroblasts exhibit a normal cytoskeleton, stressed cells show defects in
rearrangements of the actin cytoskeleton and in the ability to form stress fibers and focal
adhesions.(Lenga, Koh et al. 2008) Similarly, our findings suggest a role for OPN in modulating
host responses to intestinal bacteria in infected epithelial cells, which then specifically impacts
on the development of mucosal injury and responses to enteric pathogens.
Taken together, these findings indicate that OPN is required and sufficient for the formation of
pedestals in response to bacterial infection, explaining why OPN-/-
mice are protected from the
colonic changes typically seen in response to this non-invasive, enteric bacterial infection. This
provides a rationale for future studies on the role of OPN in mediating bacterial attachment to gut
epithelia in humans with IBD.
94
3.6 Acknowledgements
The authors thank Lei Liu, University of Alberta, for technical assistance; Michael Ho and Yew
Meng Heng, Department of Pediatric Laboratory Medicine, Hospital for Sick Children for their
expertise in microscopy techniques; and Kelvin So, Toronto General Hospital, for
immunostaining. OPN-/-
mice were originally provided by Drs. Susan R. Rittling, Forsyth
Institute, Boston, MA and David T. Denhardt, Rutgers University, Piscataway, NJ. This work
was supported by an operating grant from the Canadian Institutes of Health Research (CIHR;
PMS) and operating grants from Dairy Farmers of Canada and CIHR (HAG, JS, RZ) and the
Danish Dairy Research Foundation (ESS). EW was supported by a fellowship award from the
Canadian Association of Gastroenterology/CIHR/Astra Zeneca partnership. GS is the recipient
of a CIHR Canada Graduate Scholarship Doctoral Research Award. PMS is the recipient of a
Canada Research Chair in Gastrointestinal Disease.
E.W. and G.S-T. contributed equally to this work.
95
Chapter 4.
Detergent-Resistant Microdomains Mediate Activation of Host Cell Signalling in Response to Attaching-Effacing Bacteria
Grace Shen-Tu, David B. Schauer, Nicola L. Jones, and Philip M. Sherman. Detergent-
resistant microdomains mediate activation of host cell signaling in response to attaching-
effacing bacteria. Laboratory Investigation (2010) 90, 266-281.
96
4.1 Abstract
Background: Enterohemorrhagic Escherichia coli (EHEC) O157:H7 causes outbreaks of bloody
diarrhea and the hemolytic-uremic syndrome. EHEC intimately adheres to epithelial cells,
effaces microvilli and induces attaching-effacing (AE) lesions. Detergent-resistant
microdomains (lipid rafts) serve as membrane platforms for recruitment of signaling complexes
to mediate host responses to infection.
Objective: The aim of this study was to define the role of lipid rafts in activating signal
transduction pathways in response to AE bacterial pathogens.
Methods: Epithelial cell monolayers were infected with EHEC (MOI 100:1, 3h, 37oC) and lipid
rafts isolated by buoyant density ultracentrifugation. Phosphoinositide 3-kinase (PI3K)
localization to lipid rafts was confirmed using PI3K and anti-caveolin-1 antibodies. Mice with
cholesterol storage disease Niemann-Pick, type C were used as an in vivo model to confirm the
role of lipid rafts in mediating signaling response to AE organisms.
Results: In contrast to uninfected cells, PI3K was recruited to lipid rafts in response to EHEC
infection. Metabolically active bacteria and cells with intact cholesterol-rich microdomains were
necessary for the recruitment of second messengers to lipid rafts. Recruitment of PI3K to lipid
rafts was independent of the intimin (eaeA) gene, type III secretion system and production of
Shiga-like toxins. Colonization of NPC-/-
colonic mucosa by C. rodentium and AE lesion
formation were both delayed, compared with wild-type mice infected with the murine-specific
AE bacterial pathogen. C. rodentium-infected NPC-/-
mice had reduced colonic epithelial
hyperplasia (64κm ± 8.251 vs. 112κm ± 2.958; p<0.05) and decreased secretion of IFN-γ (17.6
pg/mL ± 17.6 vs. 71pg/mL ± 26.3 , p<0.001).
Conclusions: Lipid rafts mediate host cell signal transduction responses to AE bacterial
infections both in vitro and in vivo. These findings advance current understanding of microbial-
eukaryotic cell interactions in response to enteric pathogens that hijack signaling responses
mediated through lipid rafts.
97
4.2 Introduction
Escherichia coli is a facultative gram-negative bacterium normally present in the commensal
colonic microflora. However, some E. coli strains possess specific virulence factors enabling
them to cause disease in mammalian hosts (Kaper, Nataro et al. 2004). Enterohemorrhagic
Escherichia coli (EHEC) O157:H7 is responsible for outbreaks of diarrhea, hemorrhagic colitis
and the hemolytic-uremic syndrome (HUS), which is the most common cause of acute renal
failure in children (Jandu, Shen et al. 2007). For instance, an E. coli O157:H7 outbreak in North
America was reported in the fall of 2006 initiated from the ingestion of contaminated, pre-
packaged spinach (Cooley, Carychao et al. 2007).
Several virulence factors are thought to mediate disease pathogenesis. EHEC produces a potent
cytotoxin known as Vero (Shiga-like) toxin (Rendon, Saldana et al. 2007). Verotoxin is an AB5
subunit toxin which binds to globotriaosylceramide (Gb3) localized in membrane lipid rafts of
host cells (Nutikka and Lingwood 2004), inactivates 28S ribosomal RNA to disrupt protein
synthesis and promotes apoptosis, leading to epithelial cell death (Gobert, Vareille et al. 2007).
EHEC O157:H7 infection is also characterized by intimate bacterial attachment to epithelial cells
mediated through a variety of adherence factors (Gyles 2007). E. coli secreted proteins, encoded
on a 35-kilobase pathogenicity island referred to as the locus of enterocyte effacement (LEE), are
injected into the cytosol of infected cells through a type III secretion system encoded molecular
syringe (Welinder-Olsson and Kaijser 2005). The translocating intimin receptor (Tir), also
known as EspE, acts as a receptor for the eae gene-encoded bacterial outer membrane protein,
intimin (Campellone, Robbins et al. 2004). Tir-intimin interactions give rise to intimate
attachment of EHEC O157:H7 to eukaryotic cells and the recruitment of host actin cytoskeleton
elements, which form dense adhesion pedestals and the effacement of intestinal brush-border
microvilli, collectively known as the attaching-effacing (AE) lesion (Kaper, Nataro et al. 2004).
Citrobacter rodentium is a naturally occuring mouse-specific non-invasive bacterial pathogen
that is genetically related to EHEC, because it also uses attaching-effacing lesion formation as a
mechanism of infection and colonization of the colon. Genes encoding the ability for both C.
rodentium and EHEC to induce A/E lesions are located on the LEE pathogenicity island. C.
98
rodentium infection of mice causes colonic epithelial hyperplasia that resolves spontaneously by
post-infection day 28 (Mundy, MacDonald et al. 2005).
The effector protein Tir is inserted into cholesterol- and sphingolipid-enriched microdomains in
the eukaryotic cell plasma membrane bilayer, referred to as lipid rafts (Zobiack, Rescher et al.
2002; Allen-Vercoe, Waddell et al. 2006). Cholesterol is an important component of eukaryotic
cellular membranes, which is known to dynamically associate with sphingolipids to form
heterogeneous microdomains (lipid rafts) (Simons and Toomre 2000). These cholesterol-
enriched microdomains serve as platforms for the recruitment of cell signaling complexes to a
micro-environment where they are sheltered from non-raft enzymes that can interfere with
signaling processes (Brown and London 1998; Simons and Toomre 2000). Lipid rafts contribute
to a variety of functions in eukaryotic cells, including cell signaling, trafficking and protein
sorting (Fielding and Fielding 2004; Laude and Prior 2004).
The aim of the present study was to determine if AE bacterial infections promote the recruitment
of phosphoinositide 3-kinase to lipid rafts and determine the role of these microdomains in
disease pathogenesis.
99
4.3 Materials and Methods
Tissue culture cell lines. HEp-2 human laryngeal epithelial cell line (CCL23; American Type
Culture Collection, Manassas, VA) and Intestine 407 embryonic intestinal cells (CCL-6; ATCC)
were employed as model systems in vitro. HEp-2 cells were cultured at 37oC in 5% CO2 in
minimal essential medium (MEM) supplemented with 10% fetal bovine serum, 1% sodium
bicarbonate, 1% Fungizone, and 1% penicillin-streptomycin. Intestine 407 cells were cultured in
MEM supplemented with 10% fetal bovine serum and 2% penicillin-streptomycin (all media and
supplemental reagents from Life Technologies, Grand Island, NY).
Bacterial strains and growth conditions. Bacterial strains employed in this study are shown in
Table 4.1. Enterohemorrhagic Escherichia coli O157:H7, strain CL56 and E. coli, strain CL15
(O113:H21) were stored in -80°C and re-grown on 5% sheep blood agar plates at 4oC. Colonies
were transferred from plates into Penassay broth and incubated at 37oC for 18 h and then 3 h re-
growth in antibiotic-free tissue culture medium at 37oC for mid-log phase. Heat-killed bacteria
were prepared by boiling mid-log phase bacteria at 100oC for 30 min. Formalin-fixed bacteria
were washed with PBS and treated with formaldehyde (12%) for 6 to 18 h at 4oC.
Prior to infection of tissue culture cells, bacteria were washed with PBS and resuspended in
antibiotic-free MEM medium. For chloramphenicol treatment, mid-log phase bacteria were
pelleted and resuspended in chloramphenicol (100ug/mL) for 6 to 18 h at 4oC (Ceponis, McKay
et al. 2003). Bacteria were added to epithelial cells grown in 10cm diameter tissue culture dishes
(Starstedt Inc., Montreal, Quebec, Canada), at a multiplicity of infection of 100 bacteria to 1
eukaryotic cell, for 1h at 37oC in antibiotic-free MEM. Uninfected cells were used as a negative
control. After 0.5, 1 and 3.5 h of infection, cells were washed with phosphate-buffered saline
(PBS) (pH7.0) to remove non-adherent bacteria.
Cultured supernatant and conditioned medium preparation. To collect bacterial culture
supernatants, 10mL of EHEC O157:H7 grown in Penassay broth was centrifuged at 3,000 rpm
for 15min and supernatant filtered, using a 0.45 κm filter, into a new tube for storage at -20 until
use. To collect conditioned medium, EHEC O157:H7 strain CL-56 grown overnight in 10mL
100
Table 4.1 Baterial strains and treatments used in the in vitro studies
E. coli strains Treatment Description
EHEC O157:H7
boil at 100oC for 30 min non-viable bacteria with disrupted structure
chlorophenicol stop the bacterial protein synthesis
formaldehyde kill the bacteria but keeping the structure intact
CL15 (O113:H21) -- without the LEE pathogenicity island
86-24 -- Wildtype EHEC
CVD451 -- Type III secretion-deficient mutant of parental strain 86-24
85-289 -- Wildtype EHEC
85-170 -- Stx1 and Stx2 negative mutant of parental strain 85-289
The various strains of E. coli and related mutants were grown overnight on sheep blood agar
from frozen stocks in 37°C and subsequently grown in Penassay broth overnight. The overnight
growth in broth was used to infect model cell lines to delineate microbial-host cell interaction
through signaling cross-talk.
101
Penassay broth (37°C) was used to infect monolayers of HEp-2 cells (MOI 100:1). After 1 hr,
medium was centrifuged (3,000 rpm, 15 min), 30mL of conditioned medium was pooled together
and concentrated using a 3 kilodalton Amicon Ultrafilter (Millipore). Unfiltered conditioned
medium was collected using centrifugation and 100κg/ml of chloramphenicol was added to halt
bacterial protein synthesis.
Citrobacter rodentium, strain DBS100 (ATCC 51459) was stored in Luria Bertani (LB) broth
with 50% glycerol at –80oC. Bacteria were grown from frozen stocks on LB agar plates at 37
oC
and stored at 4oC for no more than 2 wks. Bacteria were inoculated into 10 ml LB broth and
grown at 37oC overnight. Prior to infection of mice, overnight cultures were centrifuged at 3,000
rpm for 10 min. and resuspended in 2.5 ml of LB broth to obtain a concentration of 1010
bacteria/ml.
Whole-cell protein extraction. HEp-2 cells were infected either with Escherichia coli O157H7
or C. rodentium for 1, 3, and 6 hr. Cells were washed three times with ice-cold phosphate-
buffered saline (PBS, pH 7.0) and whole-cell protein extracts collected
for storage at –80°C, as
previously described (Jandu, Ceponis et al. 2006).
Depletion of cholesterol using methyl-β-cyclodextrin (MβCD). HEp-2 cells were treated with
MβCD (Sigma Chemical Co., St. Louis, MO) (1-10mM) to disrupt cholesterol-enriched
microdomains by chelating plasma membrane cholesterol (Kilsdonk, Yancey et al. 1995). Prior
to bacterial infection, epithelial cells were incubated with MβCD (10mM) in antibiotic-free
MEM for 1 h at 37oC. The medium was aspirated off cell monolayers and washed with PBS
prior to bacterial infection (Riff, Callahan et al. 2005).
Treatment with pharmacological inhibitors. Tissue culture cells were pre-incubated with
either the phosphoinositide-3 kinase inhibitor LY294002 (100κM, Sigma Chemical Co., St.
Louis, MO) or an equal concentration of the inactive analogue LY303511 for 1 h at 37oC
(Johnson-Henry, Wallace et al. 2001). After removal of the inhibitor, cells were rinsed with PBS
and infected with bacteria for 1 h at 37oC.
Isolation of detergent-resistant membranes. Infected epithelial cells were scraped and
pelleted in 4 ml of sterile PBS in 15 ml conical tubes. Cells were then lysed with 0.8mL TN
102
buffer (25 mM tris-HCl pH 7.5, 150 mM NaCl, 1 mM DTT, 10% sucrose, 1% Triton X-100,
leupeptin, 2 κg/ml pepstatin A, 10 κg/ml aprotonin, 0.5 mM PMSF, 1 mM Na3VO4) for 30 min
on ice. The samples were then mixed with 1.7 ml of OptiprepTM
(Axis-Shield PoC AS, Oslo,
Norway) and transferred into SW41 centrifuge tubes (Beckman Instruments, Inc., Palo Alto,
CA). OptiprepTM
(60%) was diluted with TN buffer to produce 35% and 5% solutions (adapted
from: (Schraw, Li et al. 2002) and (Song, Li et al. 1996)), which were then layered on top of
samples and centrifuged at 160,000 x g for 20 h at 4oC. Eight 1.5 ml fractions were then
collected from the top to bottom of the gradient generated by ultracentrifugation (Macdonald and
Pike 2005).
Immunoblotting. Aliquots (10κl) of each fraction were analyzed for PI3K and caveolin-1.
Proteins were separated by pre-cast 10% Tris-HCl (Biorad) sodium dodecyl sulphate
polyacrylamide gel electrophoresis (SDS-PAGE) with a protein ladder standard (BioRad, broad
molecular range ladder) at 120V for 1 to 1.25h at room temperature. After electrophoresis,
proteins were transferred onto nitrocellulose membranes (Pall Corporation, Pensacola, FL) at
100V for 1.5 h at 4oC and incubated in Odyssey blocking buffer (LI-COR
Biosciences, Lincoln,
NE) for 0.5 to 1h at 20°C. Blocking buffer was then decanted off and membranes probed with
anti-caveolin-1, as a lipid raft marker protein (Santa Cruz Biotechnology Inc., CA; 1:1000), and
primary antibodies against PI3-kinase p85 (Upstate Biotechnology, Lake Placid, NY; 1:1000)
overnight at 4oC on a shaker. Whole cell extracts were probed with native- and phospho-Akt
antibody (Cell Signaling, Beverly, MA; 1:1,000 dilution). After washing the membrane four
times with PBS plus 0.1% Tween (5 min. per wash), IRDye 800 goat anti-rabbit immunoglobulin
G (IgG) secondary antibody (Rockland Immunochemicals, Gilbertsville, PA; 1:20,000) was
added and incubated for 1 h at room temperature on a shaker. The blots were then washed 4
times with PBS plus 0.1% Tween and once with PBS alone. The membrane was then scanned
using the Odyssey system (LI-COR Biosciences) with the 800nm channel. The integrative
intensity of the detected bands was obtained using software provided with the infrared imaging
system (LI-COR Biosciences). Western analysis was performed on collected whole cell lysates
probed with both Akt (Cell Signaling Inc. Denvor, MA; 1:1000 dilution).
Immunostaining. HEp-2 cells were grown to subconfluency and treated with MβCD (10mM ,
Sigma Chemical Co., St. Louis, MO) for 1 hr at 37°C. To add cholesterol back into cholesterol-
103
depleted cells, 200 κg/mL of soluble cholesterol (Sigma) in antibiotic-free medium was added to
cells for 45 min at 37°C. Post depletion-repletion of cholesterol, cells were washed with PBS,
fixed in 3.7% paraformaldehyde and permeabilized with 0.1% Triton X-100. Lipid rafts were
visualized using Alexa Fluor 594 labeled cholera toxin subunit B (Invitrogen Co., Carlsbad, CA)
(Hatano, Kubo et al. 2007).
Animals. BALB/c mice (n=5 for 6 days uninfected and C. rodentium-infected; n=5 for 12 days
uninfected and C. rodentium-infected) and homozygous BALB/cNctr-npc1m1N/m1N
(Npc1-/-
) mice
(n=4 for 6 days uninfected and C. rodentium-infected; n=4 for 12 days uninfected and C.
rodentium-infected) with Niemann-Pick type C disease were obtained from Jackson Laboratory
(Bar Harbor, ME) at 4-5 weeks of age, before the onset of a progressive neurologic disorder
(Dennis, Kudo et al. 2008). Animals were housed in microisolate cages in a containment unit
and allowed free access to water and chow. All animal experiments were performed following
review and approval by Laboratory Animal Services, Hospital for Sick Children, Toronto,
Canada.
Infection of mice with C. rodentium. Mice were inoculated orogastrically with either 109 C.
rodentium, in 100 l LB broth, or sham infected with an equal volume of LB broth alone and
then followed for 6 to 12 days (Mundy, MacDonald et al. 2005). Mice were monitored for
bacterial shedding using rectal swabs streaked onto MacConkey lactose agar plates (Johnson-
Henry, Nadjafi et al. 2005).
Tissue Collection. At necropsy, spleens and colonic sections were harvested for further
experimental analyses. Spleens were placed into 4 ml of RPMI tissue culture medium and kept
on ice. Segments (~ 5 mm in length) of distal colon were place into Universal fixative (4%
paraformaldehyde, 1% glutaraldehyde in 0.1 M phosphate buffer) for further processing for
electron microscopy (Mogilner, Srugo et al. 2007). Segments from the remainder of the distal
colon were placed in 10% neutral-buffered formalin and processed for histological assessment.
In some experimental groups, mice were injected intraperitoneally with a 10 mg/ml 5-bromo- 2’-
deoxyuridine (BrdU; Sigma) solution in PBS at a concentration of 5 l/g 1 hour prior to
sacrifice. Mice injected with BrdU were not used to prepare splenocytes.
104
Histology and Immunohistochemistry. Formalin-fixed tissues were embedded in paraffin,
sectioned at 5-7 microns, and mounted onto positively charged microscope slides for further
processing. For histology, slides were rinsed in distilled water and stained with Mayer’s
hematoxylin for 15 min. Excess stain was removed by rinsing in water and sections fixed by
rinsing 5 times in ammonial water. Slides were then rinsed in 95% ethanol and counter-stained
in eosin for 3 min.
To detect C. rodentium bound to intestinal mucosal surfaces using immunohistochemistry,
mounted tissue sections were baked overnight at 60oC, dewaxed in xylene and hydrated to
distilled water through decreasing concentrations of ethanol. The immunohistochemical
procedure was performed on an auto-immunostainer (NEXESTM
, Vetana Medical Systems,
Tuscon AZ). Rabbit polyclonal anti-Citrobacter rodentium diluted 1:400, and secondary
antibody staining with biotinylated anti-rabbit IgG (Vector Laboratiories, Burlingame, CA) at a
dilution of 1:100, was detected using a DAB (3-3’-diaminobenzidine) detection system (Ventana
Medical Systems, Tuscon AZ). Slides were then counterstained with hematoxylin to provide
nuclear detail.
To detect apoptotic cells, the TUNEL assay for in situ end-labeling was performed and adapted
to an automated immuno/in situ hybridization instrument (DiscoveryTM
, Ventana). Prior to
staining, colonic sections were deparaffinized, as above, and blocked for endogenous peroxidase
by Protease I (Ventana Medical Systems) digestion for 12 min. Slides were then incubated with
recombinant terminal deoxynucleotidyl transferase (GIBCO BRL, Life Technologies, Grand
Island, NY) and biotin 16-dUTP (Roche Diagnostics Corporation, Indianapolis, IN) to label the
nuclei of cells undergoing programmed cell death (Kubo, Li et al. 2008). Colorimetric
visualization, using avidin-HRP and DAB, was performed as described above.
To detect proliferating cells within colonic crypts, colonic sections from mice injected
intraperitoneally with BrdU prior to euthanasia were dewaxed and hydrated, as detailed above.
Slides were then treated with pepsin digestion, acidified in 4N HCl to denature DNA, and
blocked for endogenous peroxidase. Immunohistochemical staining with a mouse anti-BrdU
antibody (Dako, Carpinteria CA) was performed on an auto-immunostainer (DiscoveryTM
,
Ventana Medical Systems) at a dilution of 1:50 using the ARKTM
kit (Dako) to prevent mouse-
105
on-mouse cross reactivity. Detection and visualization employed a peroxidase-conjugated
streptavidin secondary reagent (Dako) and the DAB chromogen substrate.
Histology and immunohistochemistry slides were viewed using a light field microscope (Leica
DM 4600B, Leica Microsystems Inc., Richmond Hill, ON, Canada). Photomicrographs were
captured with a digital camera (Leica DC 500) and analyzed using integrated software (Leica
IM500 Image Manager).
Transmission electron microscopy. Distal colonic segments fixed in Universal fixative for 24
hr were post-fixed in 2% aqueous osmium tetroxide for 1 hr at 20ºC. Dehydration was
performed in graded acetone, followed by embedding in epoxy resin. Osmium post-fixation,
dehydration and embedding were conducted in a Pelco Biowave microwave oven (Pelco
International, Redding, CA). One micrometer thick sections were stained with toluidine blue and
ultra-thin sections stained with uranyl acetate and lead citrate. Electron microscopy examination
was performed using a transmission electron microscope (JEM 1230, Joel USA Corp., Peabody,
MA).
Cytokine profiles of splenocytes. The production of IFN- and IL-10 from isolated splenocytes
was performed, as described previously (Jones, Day et al. 2002; Johnson-Henry, Nadjafi et al.
2005). Briefly, spleens were mashed through sterile filter screens in RPMI medium to obtain
single cell suspensions. Cells were incubated in red cell lysis buffer for 3 min and washed 3
times. The pellet was layered with 5 mL of lympholyte-M (Cedarlanes Laboratories Ltd.,
Hornby, ON, Canada) and spun at 1,000 rpm for 10 min. Isolated cells were washed 3 times and
resuspended in RPMI medium containing 10% fetal calf serum. Splenocytes were enumerated
and equal numbers of cells incubated with sterile C. rodentium whole-cell sonicate for 72 hr at
37oC. IFN- and IL-10 cytokine levels were then measured using commercially available
immunoassay kits (Medicorp Inc., Montreal, QC, Canada), according to the manufacturer’s
instructions.
Data analyses. Results are reported as means ± standard errors of the mean (SEM). To test for
significance between two groups, the two-tailed Student’s t test was employed, with p<0.05
considered as statistically significant. One-way analysis of variance (ANOVA) was used for
data derived from more than two study groups (Bewick, Cheek et al. 2004).
106
4.4 Results
Phosphoinositide 3-kinase (PI3K) is recruited to lipid rafts in response to enterohemorrhagic
Escherichia coli infection
Following E. coli O157:H7 infection of HEp-2 cells, PI3K was recruited to the sucrose fraction
containing caveolin-1, which was employed as a lipid raft marker protein (Jandu, Ceponis et al.
2006) (Figure 4.1a). There was a significant increase in the amount of PI3K present in the
lower density fraction of EHEC-infected cells, indicating that E coli O157:H7 induced the
translocation of PI3K to lipid rafts. Protein recruitment to lipid rafts was not observed when
tissue culture cells were infected with heat-killed bacteria (Figure 4.1a), demonstrating that
recruitment of PI3K is triggered by exposure of epithelial cells to live organisms, and not
bacterial surface-derived structural constituents. The increase of PI3K recruitment to lipid rafts
in EHEC-infected cells was quantified by using densitometry to determine integrated intensity
values (Figure 4.1b; n=5, p<0.05) Chloramphenicol-treated bacteria also markedly reduced the
recruitment PI3K to lipid rafts (Figure 4.1c), indicating that activation of these signal
transduction cascades is caused by newly synthesized bacterial proteins (Cole, Shirey et al.
2007). EHEC O157:H7-infection of Intestine 407 cells also induced activation and translocation
of PI3K (Figure 4.1d).
PI3K recruitment to lipid rafts is independent of known EHEC virulence factors
Similar to observations in EHEC O157:H7-infected cells, an increase in PI3K level in caveolin-
1-enriched fraction 3 was observed in response to infection with the eae negative E. coli, strain
CL15 (VTEC O113:H21), indicating that recruitment to lipid rafts in response to EHEC infection
(Figure 4.1a) is independent of the attaching-effacing (eae) gene, because strain CL15 does not
contain the LEE pathogenicity island required to cause AE lesions (Shen, Mascarenhas et al.
2004). Infection of HEp-2 cells with E. coli, strain CVD451, a type III secretion-deficient
mutant (Ceponis, McKay et al. 2003), also resulted in increased recruitment of PI3K to lipid rafts
(Figure 4.2a). Similarly, infection with E. coli, strain 85-170, a Stx-1 and Stx-2 negative mutant
(Ceponis, McKay et al. 2003), also demonstrated the recruitment of host signaling molecules to
107
Figure 4.1 Phosphoinositide 3-kinase (PI3K) is recruited to lipid rafts in response to
enterohaemorrhagic Escherichia coli O157:H7 infection, and newly synthesized bacterial
proteins are required for PI3K recruitment to lipid rafts. Western blots of phosphoinositide
3-kinase (PI3K) from ultracentrifugation fractions of whole cell (HEp-2) extracts. The presence
of PI3K in the caveolin-1-containing fraction indicates that it is recruited to lipid rafts in
response to bacterial infection. The presence of PI3K in fraction 3 of VTEC O113:H21 infected
cells indicate that recruitment is independent of eae gene. The lack of PI3K in fraction 3 of
uninfected and boiled EHEC-infected cells demonstrates that recruitment is induced by live
bacteria (a). Recruitment was quantified by using densitometry and expressed graphically (n=5,
p<0.05) (b). PI3K was not recruited in host cells infected with chloramphenicol-treated EHEC
O157:H7, indicating that metabolically active bacteria are required for recruitment of host
signaling proteins (c). EHEC-infected Intestine 407 cells also induced translocation of PI3K to
lipid rafts (d).
108
109
Figure 4.2 Activated phosphoinositide 3-kinase (PI3K) is recruitment to lipid rafts in
response to infection independent of the type III secretion system and Shiga-like toxins 1
and 2. Western blots of phosphoinositide 3-kinase (PI3K) from ultracentrifugation fractions of
whole cell (HEp-2) extracts. PI3K recruitment in EHEC mutant (CVD 451 and 85-170)-infected
cells indicates that signaling is independent of type III secretion system and Shiga-like toxins 1
and 2 (a). Cells treated with the PI3K inhibitor LY294002 prior to EHEC O157:H7 infection
had reduced amounts of PI3K recruited to lipid rafts, compared to the amount of PI3K recruited
in cells treated with the inactive analogue, LY303511, prior to EHEC infection (b).
110
111
lipid rafts (Figure 4.2a). Taken together, these findings indicate that recruitment of signal
transduction molecules to lipid rafts is independent of the bacterial type III secretion system and
the production of Shiga-like toxins 1 and 2.
Recruitment of PI3K to lipid rafts is blocked by a specific PI3K kinase inhibitor
Recruitment of PI3K in response to EHEC O157:H7 infection was reduced in cells pre-treated
with the PI3K inhibitor, LY294002 (100κM), by 40% (relative to EHEC-infected alone) but not
when an equal concentration of an inactive analogue (LY303511) was employed (integrated
intensity readings of the PI3K band in immunoblots, relative to caveolin-1, was 0.805 for
LY294002-treated cells, 1.229 for LY303511-treated epithilia and 1.332 for EHEC-infected
cells) (Figure 4.2b). DMSO alone, tested as a vehicle control, also did not result in a reduction
in PI3K recruitment to lipid rafts (data not shown). These findings support the hypothesis that
activated PI3K is recruited to lipid rafts in response to EHEC infection (Cantley 2002).
MβCD blocks PI3K recruitment to lipid rafts in response to EHEC infection
To confirm that EHEC O157:H7-induced translocation of host proteins to lipid rafts was
dependent on intact lipid raft microdomains, pre-treatment of cells with methyl-β-cyclodextrin
(MβCD;10mM) was used to deplete cholesterol and, thereby, disrupt lipid rafts (Riff, Callahan et
al. 2005). Cells subjected to MβCD pretreatment failed to recruit PI3K to lipid rafts in response
to EHEC O157:H7 (Figure 4.3b). To verify that MβCD induced disruption of lipid rafts,
cholera toxin B subunit staining was performed (Hatano, Kubo et al. 2007). HEp-2 cells treated
with MβCD lacked visible choleragen B subunit staining around the cells (Figure 4.3h),
compared with untreated cells (Figure 4.3f). When MβCD-treated cells were rescued with
soluble cholesterol, cholera toxin labeling again showed the presence of lipid rafts in the plasma
membrane (Figure 4.3j).
Culture supernatant and conditioned medium cannot induce the recruitment of PI3K to lipid
rafts
To determine whether bacterial secreted factors were able to elicit EHEC-induced recruitment of
PI3K to lipid microdomains, culture supernatants and conditioned media were collected. Cells
112
Figure 4.3 Intact lipid microdomains are required for EHEC induced translocation of
phosphoinositide 3-kinase (PI3K) to lipid rafts, while secreted bacterial factors are
insufficient to induce this recruitment. Conditioned medium did not induce the recruitment of
PI3K to lipid microdomains on host cell membranes (a). Disruption of lipid rafts by depleting
cellular cholesterol using MβCD (10mM) leads to decreased recruitment of the host signaling
protein, PI3K, in response to EHEC O157:H7 infection. Culture supernatant alone was unable to
induce recruitment of PI3K (b). Phosphorylation of the PI3K downstream effector Akt was not
detected in response to EHEC and C. rodentium infections (c and d), suggesting an alternative
activated pathway. Lipid raft disruption following cholesterol depleting MβCD treatment was
visualized using Alexa fluor 594-labeled cholera toxin subunit B: untreated cells (e and f),
MβCD-treated cells (g and h) and MβCD-treated epithelia replenished with soluble cholesterol
(i and j).
113
114
treated with culture supernatant and conditioned medium (either filtered or non-filtered) did not
result in the recruitment of PI3K to lipid rafts (Figure 4.3a&b).
EHEC does not activate the PI3K/Akt pathway during infection
To investigate downstream signals activated in response to EHEC-mediated PI3K recruitment to
lipid rafts, whole cell protein extracts were taken 5 min to 1 hour (Figure 4.3d), and at 3 and 6 hr
post infection (Figure 4.3c). The amount of phopho-Akt was determined by western blotting.
Although PI3K was recruited to detergent-insoluble microdomains in response to EHEC
infection, phosphorylation of Akt, which is common downstream effector (Cantley 2002), was
not detected.
Delayed colonization of NPC colonic mucosa by C. rodentium
To extend these findings to the in vivo setting, wild type BALB/c and NPC-/-
mice were
employed. BALB/c and NPC-/-
mice were infected orogastrically with the murine-specific AE
bacterium, C. rodentium (Borenshtein, McBee et al. 2008). In all mice, C. rodentium was
recovered by rectal swabbing starting at day 3 post orogastric challenge until the end of the
infection protocol, indicating that the organism was able to successfully colonize and infect both
wild type and NPC-/-
mice. Six days post challenge, there was a homogeneous bacterial
adherence pattern on the colonic mucosa in infected BALB/c mice (Figure 4.4b). By contrast,
there was minimal C. rodentium adherence detected on the colonic surface of NPC-/-
mice at 6
days post infection (Figure 4.4e). Furthermore, a more homogeneous pattern of bacterial
adhesion was detected in NPC-/-
mice at 12 days post infection (Figure 4.4f). At this time,
adherent bacteria were largely cleared from the mucosa in wild type, C. rodentium-infected mice.
C. rodentium-induced attaching-effacing lesions are delayed in NPC -/-
mice
Segments of the distal colon were assessed by transmission electron microscopy for the presence
of AE lesions, characteristic of adherent C. rodentium (Mundy, MacDonald et al. 2005). In
contrast with uninfected mice which displayed intact apical microvilli on columnar epithelia
(Figure 4.5a), wild type mice challenged with C. rodentium for 6 days had large numbers of
intimately adherent bacteria with typical actin-enriched adhesion pedestals (Figure 4.5b), but by
12 days post inoculation AE lesions were no longer observed (Figure 4.5c). In contrast, AE
115
Figure 4.4 Citrobacter rodentium colonization is delayed in the colonic mucosa of NPC -/-
mice. Immunohistochemistry of colonic mucosa stained with antibody against C. rodentium.
Uninfected wild type BALB/c (a). Wild type BALB/c infected for 6 days show a thick band of
C. rodentium adherent along the apical aspect of the luminal mucosa (b). Wild type BALB/c
mice infected for 12 days, showed C. rodentium staining of luminal contents and few adherent
bacteria (c). Uninfected NPC-/-
mouse colon (d). C. rodentium-infected NPC-/-
colonic sections
obtained 6 days following infectious challenge, demonstrate a few patches of adherent bacteria
(e). NPC-/-
tissues obtained from colons 12 days post infection showed C. rodentium binding to
mucosal surfaces of colonocytes (f). Approximate original magnifications for each
photomicrograph, X 200.
116
117
Figure 4.5 Attaching-effacing lesions induced by Citrobacter rodentium infection are
delayed in NPC -/-
mice. Transmission electron photomicrographs of distal colonic mucosa of:
uninfected BALB/c columnar epithelium with intact brush boarder (a). Higher magnification of
an attaching-effacing lesion-producing C. rodentium bacterium (cr) on a BALB/c colonocyte 6
days post inoculation (b). The attaching-effacing lesion displays characteristic effacement of
the brush boarder microvilli at the site of intimate bacterial adherence and an F-actin-enriched
pedestal underlying the adherent bacterium. BALB/c mice colonic tissue obtained 12 days post
infectious challenge was devoid of attaching-effacing lesions (c). Uninfected NPC mouse tissue
(d). NPC-/-
mouse colon collected 6 days post C. rodentium orogastric inoculation lacked
attaching-effacing lesions (e). Bound C. rodentium (cr) to an NPC-/-
colonocyte 12 days post
challenge form attaching-effacing lesions (f). Bars = 2 m.
118
119
lesions were not detected in NPC-/-
mice at 6 days post infection (Figures 4.5d and 4.5e).
Intimate bacterial adherence and adhesion pedestal formation was evident in NPC-/-
mice only
after 12 days following C. rodentium infection (Figure 4.5f).
C. rodentium-infected NPC -/- mice display reduced colonic epithelial cell hyperplasia
Compared to uninfected mice (Figure 4.6a), histological sections obtained from wild-type mice
showed an increase in thickness of the colonic epithelium at both 6 days (Figure 4.6b) and 12
days (Figure 4.6c) post C. rodentium challenge. In contrast, NPC -/-
mice had a reduction in
hyperplasia of the colonic mucosa in response to C. rodentium infection at 12 days (Figure 4.6d-
g).
The reduction in mucosal thickness of C. rodentium-infected NPC -/-
mice compared with
BALB/c mice could be due to either increased cell death or reduced cellular proliferation.
Histological sections of C. rodentium-infected wild-type and NPC -/-
colonic tissue assessed by
TUNEL assay showed no differences in surface epithelial cell apoptosis (data not shown).
However, colonocyte proliferation, assessed via BrdU staining in infected wild-type mice,
showed an increase in both the number of mitotic cells and the size of the proliferation zone at
both 6 days (Figure 4.7b) and 12 days (Figure 4.7c) post infection compared with uninfected
mice (Figure 4.7a). Colonocyte proliferation was maximal at day 6 post infection in wild-type
mice. In contrast with wild type mice, C. rodentium infection of NPC-/-
mice resulted in only
moderate increases in epithelial cell mitosis at both 6 and 12 days post infectious challenge when
maximal bacterial colonization was present (Figures 4.7e and 4.7f, respectively). These
changes were quantified as increases in the zone of proliferation – the maximal height of BrdU-
labeled cells from base of well-oriented crypts. (Figure 4.7g).
NPC -/-
mice produce reduced levels of the pro-inflammatory cytokine IFN-in response to C.
rodentium infection
The epithelial hyperplasia and colonic mucosal inflammation in C. rodentium infection is
analogous to enteric immunopathologic conditions in patients such as chronic inflammatory
bowel disease (Mundy, MacDonald et al. 2005). Multiple pro-inflammatory cytokines are
120
Figure 4.6 Citrobacter rodentium-induced epithelial cell hyperplasia is reduced in NPC-/-
mice. Photomicrographs of representative colonic sections showing increases in crypt length in
response to C. rodentium infection. Uninfected BALB/c (a), 6 day infected BALB/c (b), 12 day
infected BALB/c (c), Uninfected NPC-/-
(d), 6 day infected NPC-/-
(e), 12 day infected NPC-/-
(f).
Original magnification for all photomicrographs X200. Increases in crypt length over the
uninfected baseline values were quantified (g). A difference in the change in crypt length was
observed at 12 days post infection (64κm ± 8.251 vs. 112κm ± 2.958; *p<0.05), but not at 6 days
post infection. BALB/c = black bars, NPC-/-
= white bars.
121
122
Figure 4.7 Colonocyte proliferation is reduced in NPC -/-
mice infected with Citrobacter
rodentium. Photomicrographs of colonic sections showing proliferating colonocytes through
incorporation of BrdU during mitosis. Uninfected BALB/c crypts show few BrdU positive
dividing colonocytes (a). Large numbers of BrdU positive colonocytes are observed in BALB/c
tissue sections 6 days (b) and 12 days (c) post infection. Uninfected NPC-/-
crypts showed few
proliferating cells (d), and NPC-/-
colonic sections both 6 days (e) and 12 days (f) post infection
had just a moderate increase in the number of BrdU positive cells. Approximate original
magnification for each photomicrograph, X 200. The size of the zone of proliferation was
quantified and expressed as the change in zone size over the uninfected baseline (g).
Proliferation was maximal in BALB/c mice at day 6 post infection (71pg/mL ± 26.3 vs. 17.6
pg/mL ± 17.6, * p < 0.001). No differences were seen between BALB/c and NPC-/-
mice at 12
days post infection. BALB/c = black bars, NPC-/-
= white bars.
123
124
elicited in response to C. rodentium infection (Higgins, Frankel et al. 1999; Chen, Louie et al.
2005). Therefore, to assess the adaptive immune responses elicited, splenocytes were isolated
from uninfected and C. rodentium-challenged BALB/c and NPC-/-
mice. Isolated splenocytes
were stimulated in vitro with C. rodentium sonicate and then IFN- and IL-10 levels, measured
as representative of Th1 and Tregulatory cytokine responses, respectively (Johnson-Henry, Nadjafi
et al. 2005). As shown in Figure 4.8a, wild-type mice displayed a pro-inflammatory, Th1-
predominant cytokine response 12 days after C. rodentium exposure. By contrast, infected NPC-
/- mice had a reduced IFN- response. This response may be regulated by an increased Tregulatory
response, because higher levels of IL-10 were present in splenocytes derived from NPC-/-
mice at
both 6 and 12 days post infection, compared with wild-type mice challenged with C. rodentium
(Figure 4.8b).
125
Figure 4.8 Altered cytokine profiles in NPC -/-
mice infected with Citrobacter rodentium.
Cytokine profiles of splenocytes isolated from uninfected and C. rodentium challenged BALB/c
(black bars) and NPC-/-
(white bars) mice incubated with C. rodentium sonicates. IFN-γ
secretion at day 12 post infection was reduced in NPC-/-
mice (p < 0.05) (a). Anti-inflammatory
cytokine IL-10 secretion was increased at both 6 (p < 0.001) and 12 days (p < 0.05) following C.
rodentium infection of NPC-/-
mice (b).
126
127
4.5 Discussion
Multiple signaling molecules play a role in orchestrating host cell responses to EHEC infection
(Johnson-Henry, Wallace et al. 2001) leading to the development of mucosal inflammation
(Ismaili, Philpott et al. 1995), cytoskeleton rearrangements (Shaner, Sanger et al. 2005) and
disruption of intercellular tight junctions (Philpott, McKay et al. 1998). PI3K, a lipid kinase,
catalyzes the production of membrane-bound lipid second messengers following stimulation via
tyrosine kinases, cytokine receptors and integrin receptors (Pizarro-Cerda and Cossart 2006). In
response to pathogen infections, PI3K regulates cytoskeleton rearrangements following both
bacterial adhesion (Kierbel, Gassama-Diagne et al. 2007) and invasion (Kierbel, Gassama-
Diagne et al. 2005) of other bacterial pathogens. However, the mechanisms by which EHEC
modulates host signal transduction pathways are still largely unknown.
Akt, also known as PKB, is key regulator of host cell survival by inhibiting apoptosis, control of
the cell cycle and various pro-inflammatory responses, including the activation of the
transcription factor NFθB. Akt is activated downstream of PI3K (Wiles, Dhakal et al. 2008).
Many bacterial effector proteins trigger the Akt pathway to manipulate host cell function leading
to increase adherence and invasion and induce cytoskeletal rearrangements (Edwards and
Apicella 2006). However, in our studies phosphorylation of Akt was not detected in response to
EHEC infection, supporting previous findings that EHEC infection inhibits activation of the
Akt/NF-θB signaling cascade (Bosse, Ehinger et al. 2007). Recruitment of PI3K to lipid rafts
likely stimulates alternate signaling pathways, such as small GTP-binding proteins, leading to
pedestal formation in the apical cytoplasm beneath intimately adherent attaching-effacing
organisms (Takenouchi, Kiyokawa et al. 2004).
The characteristic attaching-effacing lesions seen in eukaryotic cells following non-invasive
EHEC O157:H7 infection involves the presence of intact specialized lipid microdomains (Riff,
Callahan et al. 2005). We show, for the first time, using antibody against two closely related
PI3K p85 subunits (α and β) (Tang, Lu et al. 2007), that EHEC hijacks epithelial cell membrane
lipid microdomains to recruit the second messenger PI3K. Such recruitment was not the result of
128
external bacterial surface structures, because PI3K recruitment to lipid rafts was only observed
when cells were infected with live microorganism and not when employing heat-killed bacteria.
Recruitment of PI3K to lipid rafts was observed when epithelial cell monolayers were infected
with EHEC strain CVD-451, a type III secretion mutant; indicating that PI3K recruitment to lipid
rafts is mediated by a non-type III secretion system bacterial effector (Guttman, Li et al. 2006).
This recruitment may be induced by secreted bacterial effectors localized in the detergent-
resistant microdomains with the ability to recruit SH2/3 ligands, leading to pedestal formation.
This has been shown previously, for example, when using Tir derived from an enteropathogenic
E. coli strain (Sason, Milgrom et al. 2009).
Cells infected with chloramphenicol-treated bacteria to block prokaryotic protein synthesis
(Jandu, Ceponis et al. 2006) reduced the recruitment of PI3K to lipid rafts during the infectious
process. This finding indicates that new bacterial protein(s) secreted into the culture medium
triggers the recruitment of PI3K to cholesterol-enriched microdomains in the host cell plasma
membrane. However, secreted bacteria factors alone (using conditioned medium collected from
host-bacteria co-cultures) did not induce the recruitment of PI3K to lipid rafts. Therefore,
bacteria attachment to cell monolayer is required. Such contact-dependent effects have been
described previously (Philpott, McKay et al. 1998).
Although production of Shiga toxins is reported to promote bacterial colonization in the human
intestine (Robinson, Sinclair et al. 2006), the ability of EHEC O157:H7 to elaborate Shiga
toxins does not play a role in recruiting PI3K to lipid rafts (Proulx, Seidman et al. 2001). The
reduction in EHEC-induced PI3K recruitment to lipid rafts in the presence of a specific
pharmacological inhibitor against PI3K suggests an activated protein was recruited. Such
recruitment likely is the first step leading epithelial barrier disruption and reorganization of the
host cell cytoskeleton.
Previous studies have shown that the presence of cholesterol-enriched plasma membrane
microdomains in vitro are required for adherence and pedestal formation by attaching-effacing E.
coli (Riff, Callahan et al. 2005; Allen-Vercoe, Waddell et al. 2006). When lipid rafts are
disrupted with the cholesterol-sequestering reagent, methyl-β-cyclodextrin, EHEC no longer
induces the translocation of PI3K to lipid rafts. The presence of caveolin-1 in low density
129
fraction even after MβCD treatment likely is due to an uneven distribution of caveolin-1 in
caveolae present on the basolateral aspect of the plasma membrane and in membranes
surrounding intracellular organelles (Absi, Burnham et al. 2007). An alternative explanation is
that cholesterol is more readily removed from non-microdomain regions than from liquid-
ordered phase where it is more tightly packed and less easily extracted by agents such as MβCD
(Marbeuf-Gueye, Stierle et al. 2007).
The interaction of microbial pathogens with host cell membrane cholesterol and lipid rafts has
become a major theme of interest in disease pathogenesis (Goluszko and Nowicki 2005; Lafont
and van der Goot 2005). Previous in vitro studies demonstrate that multiple bacteria, including
Salmonella (Catron, Sylvester et al. 2002), Shigella (Lafont, Tran Van Nhieu et al. 2002),
Brucella (Watarai, Makino et al. 2002) and E. coli (Kansau, Berger et al. 2004; Riff, Callahan et
al. 2005; Allen-Vercoe, Waddell et al. 2006), interact with these cholesterol-enriched
microdomains. However, the molecular mechanisms underlying these interactions are still
largely undefined. Direct interactions of bacterial proteins with host lipid rafts have been
described. For example, type III secretion system bacterial effectors from Salmonella PipB
(Knodler, Vallance et al. 2003) and EPEC Tir (Allen-Vercoe, Waddell et al. 2006) are targeted to
lipid rafts, whereas Salmonella SipB and Shigella IpaB are cholesterol-binding proteins
(Hayward, Cain et al. 2005).
We showed previously that depletion of cellular cholesterol decreases intimate attachment of AE
E. coli (Riff, Callahan et al. 2005). AE lesions were restored when cells are allowed to recover
cholesterol (Riff, Callahan et al. 2005). These findings were confirmed using primary fibroblasts
harboring a defect in the Niemann-Pick C 1 (NPC1) gene (Riff, Callahan et al. 2005). Niemann-
Pick type C disease is a cholesterol storage disorder resulting in neurodegeneration (Chang, Reid
et al. 2005). Mutations in npc1 and npc2 result in aberrant lipid transport (Liscum and Sturley
2004; Mukherjee and Maxfield 2004), which results in decreased lipid rafts and lipid raft-
associated markers on the plasma membrane of affected cells (Garver, Krishnan et al. 2002).
Taken together, these findings suggest that lipid rafts are required for AE lesion formation in
response to EHEC O157:H7 and C. rodentium infection in vitro. Utilizing a series of
pharmacological inhibitors, we previously identified that host enzymes, including phospholipase
130
C-γ (PLC-γ) and phosphoinositide 3-kinase (PI3-Kinase), are involved in the signal transduction
cascades leading to cytoskeletal rearrangements (Johnson-Henry, Wallace et al. 2001).
In this study, we describe the importance of cholesterol during host-pathogen interactions of the
mouse pathogen C. rodentium in vivo. To our knowledge, this is the first in vivo study
confirming an interaction between host cholesterol-enriched microdomains and an attaching-
effacing non-invasive enteric bacterial pathogen. While C. rodentium infection of wild type
BALB/c mice resulted in AE lesion formation maximally at 6 days post infection, C. rodentium-
induced lesions in NPC-/-
mice were found later during the infection period, at 12 days. This
difference is likely due to the inability of C. rodentium to bind and colonize the NPC-/-
colonic
mucosa despite similar shedding patterns in BALB/c and NPC-/-
mice. Maximum colonization
occured on days 6 and 10 post-infection in wild type mice and was decreased by post-infection
day 15 with resolution of disease. Such recovery was not observed in NPC mice infected with C.
rodentium. The colonization data suggest there could be a secondary, alternative binding
mechanism for C. rodentium to attach to the colonic mucosa. Partitioning of PI3K into
cholesterol-rich microdomains is necessary, but not sufficient, to induce attaching-effacing
lesions.
Adherence of C. rodentium to colonocytes correlated with maximal responses in cellular
proliferation. The time dependent binding could delay C. rodentium pathogenesis in the NPC-/-
mouse resulting in a less severe colonic epithelial cell hyperplasia response, compared to
infection in wild type mice. Colonization and binding of C. rodentium to mucosal surfaces
requires multiple factors. Initial adhesion of the bacterium to host cells is believed to be
accomplished by the CFC (colonization factor Citrobacter) type IV pilus (Mundy, Pickard et al.
2003). After initial adherence, attaching-effacing pathogens secrete Tir directly into the host
plasma membrane. Tir mutants are unable to colonize wild type mice and do not cause disease
(Schauer and Falkow 1993). The LEE pathogenicity island locus encodes Tir, an effector protein
which has been isolated from lipid rafts (Allen-Vercoe, Waddell et al. 2006). Furthermore, the
type III secretion system that delivers Tir to the host cell is regulated by lipid rafts (van der Goot,
Tran van Nhieu et al. 2004), and utilizes these cholesterol-rich microdomains as targets for pore
formation (Hayward, Cain et al. 2005), thereby allowing for a direct link between the bacterium
and host cells. During the normal course of infection, C. rodentium colonizes the colon within
131
the first 2 to 3 days post infection (Mundy, Pickard et al. 2003), and is recovered in fecal samples
for no more than a few weeks (Wiles, Clare et al. 2004). Non-colonizing mutants, by contrast,
are cleared within days of inoculation (Schauer and Falkow 1993). Preventing either the initial
attachment of C. rodentium to host cells or preventing Tir translocation both would serve to
inhibit the colonization that was observed in NPC-/-
-infected mice.
The observation that maximal mitotic responses (incorporation of BrdU) occurred during times
of maximal binding of bacteria to colonic surfaces confirms the belief that the hyperplastic
response is contact dependent. Thus, reduced adhesion of C. rodentium to NPC-/-
colonic
mucosa may similarly abrogate the epithelial cell hyperplasic response. Current evidence
indicates that the colonic hyperplasia is dependent on the non-LEE-encoded effector A (NleA,
also known to as EspI) (Gruenheid, Sekirov et al. 2004), since C. rodentium strains harboring
deletions in nleA do not result in colonic epithelial cell hyperplasia (Mundy, Petrovska et al.
2004).
Reductions in lipid-raft microdomains likely also impact on type III secretion. Thus, decreased
transfer of NleA in NPC-/-
mice could well play a role in reducing the proliferative responses in
colonocytes. On the other hand, C. rodentium infection also results in the production of serine
proteases, which activate the proteinase-activated receptor 2 (PAR2) (Hansen, Sherman et al.
2005). Infected mice treated with a serine proteinase inhibitor and PAR2-/-
mice both show
decreased hyperplastic changes in colonic mucosa. Whether PAR2 activation is deficient in
NPC-/-
cells is not known, but PAR2 signaling is mediated by G-proteins, which are known to
associate with lipid raft microdomains (Simons and Toomre 2000).
Another important factor impacting on the development of C. rodentium-induced colonic
epithelial cell hyperplasia is the host immune system (Artis, Potten et al. 1999). C. rodentium
elicits a distinct pro-inflammatory cytokine response characterized by high levels of Th1
cytokines, including IFN- and IL-12 (Higgins, Frankel et al. 1999). In this study, there was a
decrease in pro-inflammatory cytokine responses in NPC-/-
mice challenged with C. rodentium as
well as marked differences in secreted Tregulatory cytokine profile. IL-10 is an anti-inflammatory
cytokine, which acts to counter-balance pro-inflammatory signals (O'Garra, Vieira et al. 2004;
Powrie 2004). Other studies have noted varying effects, with increases in both Tregulatory and Th2
132
cytokines in response to C. rodentium infection. Johnson-Henry et al. (Johnson-Henry, Nadjafi
et al. 2005) observed that mice pretreated with probiotics had elevated IL-10 secretion from
splenocytes and ameliorated C. rodentium disease pathogenesis. By contrast, helminth infection,
which elevate Th2 cytokine responses, prevent colitis in non-infectious animal models (Reardon,
Sanchez et al. 2001; McKay 2006), but results in an increased severity of disease in response to
C. rodentium infection (Chen, Louie et al. 2005). A major difference between these outcomes is
the ability of C. rodentium to bind to the mucosal surface.
Taken together, these complementary in vitro and in vivo studies of host epithelial cell responses
to non-invasive, attaching-effacing pathogens demonstrate the importance of cholesterol-
enriched microdomains as signal transduction platforms which mediate signaling between the
infecting organism and the cytosol of the host epithelial cell.
133
4.6 Acknowledgements
This work was supported by operating grants from the Canadian Institute for Health Research
(CIHR). GS-T was the recipient of a CIHR Canada Graduate Scholarship – Master’s Award,
CIHR Frederick Banting and Charles Best Canada Graduate Scholarships - Doctoral Award and
research training funding support provided by the SickKids Foundation Graduate
Scholarships at the University of Toronto. The in vivo studies were conducted by Jason D.
Riff, who was supported through a studentship by the Ontario Student Opportunity Trust Fund -
Hospital for Sick Children Foundation Student Scholarship Program, and a University of
Toronto Fellowship. PMS is the recipient of a Canada Research Chair in Gastrointestinal
Disease.
134
Chapter 5.
Recruitment of Protein Kinase C to Lipid Rafts in Response to Enterohemorrhagic Escherichia coli O157:H7 is blocked by Lactobacillus helveticus R0052
135
5.1 Abstract
Background: Enterohemorrhagic Escherichia coli, serotype O157:H7 (EHEC) causes outbreaks
of diarrhea, hemorrhagic colitis, and the haemolytic uremic syndrome (HUS), which is the
leading cause of acute renal failure in children. EHEC intimately attaches to epithelial cells,
effaces microvilli, and recruits F-actin into pedestals forming attaching-effacing (A/E) lesions.
Recent studies demonstrate that lipid rafts serve as platforms for the recruitment of cell signaling
complexes that mediate host cell responses to infection.
Objective: The aim of this study was to determine if PKC is recruited to lipid rafts in response to
EHEC O157:H7 infection.
Methods: HEp-2 and Intestine 407 epithelial cell monolayers were infected with EHEC (MOI
100:1, 3h, 37oC) and cell proteins extracted in Triton X-100 at 4
oC, using buoyant-density
ultracentrifugation to isolate detergent-resistant microdomains. Immunoblot analyses for PKC
was then performed and localization in lipid rafts confirmed by using anti-caveolin-1 antibody.
Results: In contrast to uninfected cells, PKC was recruited to lipid rafts in response to EHEC
O157:H7 infection. Metabolically active bacteria and cells with intact cholesterol-rich
microdomains were necessary for the recruitment of PKC. Recruitment of PKC to lipid rafts was
independent of the intimin (eaeA) gene, type III secretion system, and the production of Shiga-
like toxins. Inhibition studies, using myristoylated PKCδ pseudosubstrate, showed that atypical
PKC isoforms were activated in response to EHEC infection. Pre-incubation with the viable
probiotic Lactobacillus helveticus, strain R0052 prevented PKC recruitment to detergent-
resistant microdomains in response to EHEC challenge.
Conclusions: Detergent-resistant microdomains mediate atypical PKC signal transduction
responses to E. coli O157:H7 infection. These findings contribute further to understanding the
complex array of microbial-eukaryotic cell interactions that occur in response to EHEC
O157:H7.
136
5.2 Introduction
Escherichia coli is a facultative, gram-negative bacterium normally present in the commensal
colonic microflora (Kaper et al., 2004), but virulent strains can be an important cause of
outbreaks of foodborne illnesses (Karmali 2004). EHEC O157:H7 is responsible for outbreaks
of diarrhea, hemorrhagic colitis, and the haemolytic uremic syndrome (HUS), which is the most
common cause of acute renal failure in children (Jandu, Shen et al. 2007). Pathogenic E. coli
strains possess virulence factors enabling them to cause disease in a colonized host (Kaper,
Nataro et al. 2004). Humans often become infected by eating contaminated food sources,
through person-to person transmission, or through direct contact with asymptomatically
colonized domesticated farm animals, particularly cattle (Barlow and Mellor 2010).
The majority of cases of diarrhea-associated HUS are caused by EHEC O157:H7. Current
treatment remains predominantly supportive in nature (Tarr, Gordon et al. 2005), because
antibiotics and non-steroidal anti-inflammatory drugs may exacerbate the condition. Instead of
eliminating cytotoxin production, these treatments kill the microorganism and release pre-formed
Shiga-like (also referred to as Vero) toxins from the periplasmic space (Panos, Betsi et al. 2006).
Therefore, alternative therapeutic approaches that will prevent the EHEC colonization without
the release of cytotoxins need to be delineated. Understanding the pathobiology of disease is
likely to yield novel approaches, which can be used to interrupt the infectious process.
EHEC O157:H7 infection is also characterized by intimate bacterial attachment to epithelial cells
through a variety of adherence factors (Gyles 2007). Bacterial effector proteins, encoded on a
35-kilobase pathogenicity island, referred to as the locus of enterocyte effacement (LEE), are
injected into the cytosol of infected cells through a type III secretion system encoded molecular
syringe (Welinder-Olsson and Kaijser 2005). EspE , also known as translocating intimin
receptor (Tir), acts as a receptor for the eaeA gene-encoded bacterial outer membrane protein,
intimin (Campellone, Robbins et al. 2004). EspE-intimin interactions give rise to intimate
attachment of EHEC O157:H7 to eukaryotic cells, the recruitment of host actin to form dense
adhesion pedestals, and the effacement of intestinal brush-border microvilli, collectively known
as the attaching-effacing lesion (Kaper, Nataro et al. 2004).
137
Recent studies indicate that the effector protein EspE is inserted into cholesterol- and
sphingolipid-enriched patches in the eukaryotic cell plasma membrane bilayer, variously referred
to as lipid rafts and detergent-resistant microdomains (Zobiack, Rescher et al. 2002; Allen-
Vercoe, Waddell et al. 2006). These are islands of liquid-ordered phase, which disperse laterally
in the two-dimensional liquid-disordered plasma membrane (van der Goot and Harder 2001;
Zaas, Duncan et al. 2005). Such cholesterol-enriched microdomains serve as platforms for the
recruitment of cell signaling complexes to a micro-environment where they are sheltered from
non-raft enzymes that can interfere with signal transduction processes (Brown and London 1998;
Simons and Toomre 2000).
Recent studies have shown that lipid rafts play an essential role in mediating signal transduction
responses in eukaryotic cells (Manes, Ana Lacalle et al. 2003). Therefore, the aims of the present
study were to elucidate the role of PKC in EHEC O157:H7-induced recruitment to lipid rafts and
AE lesion formation as well as the protective effect of Lactobacillus helveticus (R0052) and
rhamnosus (R0011) in preventing EHEC-induced recruitment of PKC to detergent resistant
microdomains.
138
5.3 Materials and Methods
Tissue culture cell lines. HEp-2 human laryngeal epithelial cell line (CCL23; American Type
Culture Collection, Manassas, VA) and Intestine 407 embryonic intestinal cells were employed
as model systems. Epithelial cells were cultured at 37oC in 5% CO2 in minimal essential
medium (MEM) supplemented with 10% fetal bovine serum, 1% sodium bicarbonate, 1%
Fungizone, and 1% penicillin-streptomycin (all media and supplemental reagents from Life
Technologies, Grand Island, NY).
Bacterial strains and growth conditions. Bacterial strains employed in this study are shown in
Table 4.1. Enterohemorrhagic Escherichia coli O157:H7, strain CL56 and E. coli, strain CL15
(O113:H21) were stored on 5% sheep blood agar plates at 4oC. Colonies were transferred from
plates into Penassay broth and incubated at 37oC for 18 h and then 3 hour re-growth at 37
oC to
achieve mid-log phase. Boiled bacteria were prepared by incubating mid-log phase bacteria at
100oC for 30 min. Formalin-fixed bacteria were washed with PBS and treated with
formaldehyde (12%) for 6 h to 18 h at 4oC.
Prior to infection of tissue culture cells, bacteria were washed with PBS and resuspended in
antibiotic-free MEM medium. For chloramphenicol treatment, mid-log phase bacteria were
pelleted and resuspended in chloramphenicol (100ug/mL) for 6 to 18 hours at 4oC (Ceponis et.
al., 2003). Bacteria were added to epithelial cells grown in 10 cm diameter tissue culture dishes
(Starstedt Inc., Montreal, Quebec, Canada), at a multiplicity of infection of 100 bacteria to 1
eukaryotic cell, for 1h at 37oC in antibiotic-free MEM. Uninfected cells were used as a negative
control. Cells incubated with the phorbol 12-myristate 13-acetate (PMA) (100nM), a general
activator of protein kinase C (Grigat, Soruri et al. 2007), was used as a positive control. After
0.5, 1, and 3.5 hours of bacterial infection, cells were washed with phosphate-buffered saline
(pH7.0) to remove nonadherent bacteria and then processed for isolation of detergent-resistant
microdomains.
Lactobacillus helveticus R0052 and Lactobacillus rhamnosus R0011, provided by Institute
Rosell-Lallemand Inc. (Montreal, Quebec, Canada), were grown overnight in 5% sheep blood
agar plates for 16 to 18 hours. Approximately 100κl was transferred into de Mann, Rogosa and
139
Sharpe (MRS) broth (Difco, Detroit, MI) and cultured aerobically at 37°C overnight. HEp-2
cells, in antibiotic-free MEM, were pretreated with 108 CFU of L. helveticus R0052, L.
rhamnosus R0011 for 3 hrs prior to EHEC infection.Depletion of cholesterol using methyl-β-
cyclodextrin (MβCD). HEp-2 cells were treated with MβCD (Sigma Chemical Co., St. Louis,
MO) (1-10 mM) to disrupt cholesterol-enriched microdomains by reduction in levels of
cholesterol in the plasma membrane (Kilsdonk et. al., 1995). Prior to bacterial infection,
epithelial cells were incubated with MβCD (10 mM) in antibiotic-free MEM for 1 h at 37oC.
The medium was aspirated off cell monolayers and washed with PBS prior to bacterial infection
(Riff, Callahan et al. 2005).
Immunofluorescence microscopy. Eukaryotic cells were seeded onto Lab-Tek four-well
chamber slides (Nalge Nunc, Inc., Naperville, IL) and allowed to adhere overnight at 37oC. The
tissue culture medium was changed to antibiotic-free medium prior to bacterial infection. Cells
were then infected with 109 E. coli in 50κl at a multiplicity of infection of 100:1 at 37
oC in 5%
CO2. After 3 to 4 h of infection, non-adherent bacteria were removed by washing the cells three
times in phosphate-buffered saline (PBS) at pH 7.4. Cells were then fixed in 100% cold
methanol for 10 min. at room temperature. Following 3 washes with PBS, fixed cells were
incubated with mouse monoclonal immunoglobulin G anti-α-actinin primary antibody (1:100
dilution) (Sigma) for 1 h at 37oC. After washing with PBS, monolayers were incubated with
fluorescein isothiocyanate-conjugated rabbit anti-mouse IgG secondary antibody at a 1-in-100
dilution (Jackson ImmunoResearch Laboratories, Inc., West Grove, Pa) for 1 h and kept from the
light. Slides were mounted using SlowFade Antifade Kits (Molecular Probes, Eugene, Oreg.)
and analyzed under alternating phase-contrast and fluorescence microscopy (Leitz Dialux 22;
Leica Canada, Inc., Toronto, Ontario, Canada).
Quantification of attaching-effacing lesions was performed by using immunofluorescence
microscopy: more than 100 cells in four random fields with at least 25 HEp-2
cells stained for -
actinin were quantified per well. Results are expressed as the average number of -actinin foci ±
standard error (SEM) per cell in four separate experiments.
Treatments with pharmacological inhibitors. Cells were pretreated for 3 h with the general
protein kinase C inhibitor bisindolylmaleimide I (10mM) (Calbiochem, La Jolla, CA), or
140
isoform-specific Gö6983 (10 or 60nM) (Calbiochem, La Jolla, CA) (Sakwe, Rask et al. 2005).
The myristoylated PKCδ pseudosubstrate or PKCα pseudosubstrate (60κM) (Biosource,
Camarillo, CA) was used to prevent activation and translocation of PKCδ to the plasma
membrane (Xin, Gao et al. 2007). Foci of α-actinin formed on cells were quantitated, as a
measure of attaching-effacing lesions (Riff, Callahan et al. 2005), after 3 to 4 h of bacterial
infection. For analysis of PKC movement to detergent-resistant membranes, epithelial cells
pretreated with inhibitors and then infected with bacteria for 1 h at 37oC.
Isolation of detergent-resistant membranes. Infected epithelial cells were scraped and
pelleted in 4 ml of sterile PBS in 15 ml conical tubes. Cells were then lysed with 0.8mL TN
buffer (25 mM tris-HCl pH 7.5, 150 mM NaCl, 1 mM DTT, 10% sucrose, 1% Triton X-100,
leupeptin, 2 κg/ml pepstatin A, 10 κg/ml aprotonin, 0.5 mM PMSF, 1 mM Na3VO4) for 30
minutes on ice and samples, mixed with 1.7 ml of OptiprepTM
(Axis-Shield PoC AS, Oslo,
Norway), transferred into SW41 centrifuge tubes (catalogue #344059, Beckman Instruments,
Inc., Palo Alto, CA). OptiprepTM
(60%) was diluted with TN buffer to produce 35% and 5%
solutions (Shen-Tu, Schauer et al. 2010), which were then layered on top of samples and
centrifuged at 160,000 x g for 20 hrs at 4oC. Eight 1.5 ml fractions were then collected from the
top to bottom of the gradient generated by ultracentrifugation (Macdonald et al., 2005).
Immunoblotting. Aliquots (10κl) of each fraction were analyzed for PKC and caveolin-1.
Proteins were separated by pre-cast 10% Tris-HCl (Biorad) sodium dodecyl sulphate
polyacrylamide gel electrophoresis (SDS-PAGE) with a protein ladder standard (BioRad, broad
molecular range ladder) at 120 volts for 1 to 1.25hr at room temperature. After electrophoresis,
proteins were transferred onto nitrocellulose membranes (Pall Corporation, Pensacola, FL) at
100 volts for 1.5 hrs at 4oC and incubated in Odyssey blocking buffer (LI-COR
Biosciences,
Lincoln, NE) for 0.5 to 1hr at room temperature. Blocking buffer was then decanted off and the
membrane probed with anti-caveolin-1 (Santa Cruz Biotechnology Inc., CA; 1:1000) and
primary antibodies against PKC (Santa Cruz; 1:1000) overnight at 4oC on a shaker. After
washing the membrane four times (5 min. per wash) with PBS plus 0.1% Tween, IRDye 800
goat anti-rabbit immunoglobulin G (IgG) secondary antibody (Rockland Immunochemicals,
Gilbertsville, PA; 1:20,000) was added and incubated for 1 hour at room temperature on a
shaker. The blots were then washed with PBS plus 0.1% Tween for 4 times and with PBS alone
141
once. The membrane was then scanned and bands detected using the Odyssey system (LI-COR
Biosciences) with the 800nm channel. The integrative intensity of detected bands was obtained
using software provided with the infrared imaging system (LI-COR Biosciences).
Mass spectrometry of protein kinase C isoforms recruited to lipid rafts. Coomassie brilliant
blue and silver staining was used to visualize protein bands on an Odyssey infrared imaging
system. Bands corresponding to PKC (85kDa) were then cut from the gel. Excised bands were
analysed by Liquid Chromatography/Mass Spectrometry/Mass Spectrometry (LC-MS/MS)
(Johnson-Henry, Wallace et al. 2001). Protein sequence data generated from the experimental
samples were analyzed by Sequest® software and searched against a eukaryotic database created
from the NCBI website (Moore, Young et al. 2002; Johnson-Henry, Hagen et al. 2007).
Data analyses. Results are reported as means ± standard errors of the mean (SEM). To test for
significance between two groups, the two-tailed Student’s t test was employed, with p<0.05
considered as statistically significant. One-way analysis of variance (ANOVA) was used for
data derived from more than two experimental conditions (Bewick, Cheek et al. 2004).
142
5.4 Results
Protein kinase C (PKC) is recruited to detergent-resistant microdomains in response to
enterohemorrhagic Escherichia coli infection.
Following E. coli O157:H7 infection of HEp-2 cells, PKC was recruited to the sucrose fraction
containing caveolin-1 (Figure 5.1), which was used as a marker protein for detergent-resistant
microdomains (Shen-Tu, Schauer et al. 2010). PKC movement to detergent-resistant membranes
was not observed when tissue culture cells were infected with boiled bacteria, demonstrating that
recruitment of PKC was triggered by exposure of epithelial cells to live organisms.
Chloramphenicol-treated bacteria also did not induce the movement of PKC to detergent-
resistant microdomains (Figure 5.2), indicating that signalling is induced by newly synthesized
bacterial proteins. Translocation of PKC to detergent-resistant membranes was also observed
when Intestine 407 cells were infected with EHEC O157:H7 (Figure 5.3).
PKC recruitment to lipid rafts is independent of known EHEC virulence factors
An increase in PKC expression in caveolin-enriched fractions was observed in response to
infection with E. coli, strain CL15 (serotype O113:H21), indicating that PKC recruitment to
detergent-resistant microdomains is independent of the attaching and effacing (eae) gene,
because this strain is eaeA negative and does not cause attaching-effacing lesions (Shen et. al.,
2004). Infection of HEp-2 cells with EHEC strain CVD451, a type III secretion-deficient mutant
(Ceponis, McKay et al. 2003), also resulted in increased PKC in detergent-resistant membranes
(Figure 5.4). Similarly, E. coli 85-170, a Stx-1 and Stx-2 negative mutant (Ceponis, McKay et
al. 2003), also demonstrated PKC movement to detergent-resistant, caveolin-1-enriched fractions
(Figure 5.4). Taken together, these findings indicate that PKC movement to detergent-resistant
membranes in infected epithelia is independent of the EHEC type III secretion system and the
production of Shiga-like toxins 1 and 2.
MβCD blocks PKC recruitment to lipid rafts in response to EHEC infection.
143
Figure 5.1 PKC is recruited to lipid rafts during EHEC O157:H7 infection. A: Western
blots of protein kinase C from ultracentrifugation fractions of whole cell extracts. The presence
of PKC in the caveolin-1-containing fraction indicates that it is recruited to lipid rafts in response
to bacterial infection. The presence of PKC in fraction 3 of VTEC O113:H21 infected HEp-2
cells indicates that recruitment is independent of the attaching and effacing (eae) gene. The lack
of PKC in fraction 3 of uninfected and boiled EHEC-infected cells demonstrates that live
bacteria are required for recruitment. B: Integrated intensity of PKC expression over caveolin-1
expression in the 3rd
fraction of EHEC-infected and uninfected cells (n=4; *p<0.05). [MOI
100:1; rabbit anti-PKC and rabbit anti-caveolin-1 primary antibody (1:1000); IRDye 800 goat
anti-rabbit secondary antibody (1:20000)]
144
145
Figure 5.2 Newly synthesized bacterial proteins and intact lipid rafts are required for PKC
recruitment to lipid rafts in response to EHEC infection. Western blots of protein kinase C
from ultracentrifugation fractions of whole cell extracts. PKC is not recruited in host cells
infected with chloramphenicol treated EHEC O157:H7, indicating that metabolically active
bacteria are required for host signalling protein recruitment. Migration of lipid rafts to fraction 3
is indicated by the presence of caveolin-1. [MOI 100:1; rabbit anti-PKC and rabbit anti-
caveolin-1 primary antibody (1:1000); IRDye 800 goat anti-rabbit secondary antibody (1:20000)]
146
147
Figure 5.3 Western blots of protein kinase C from ultracentrifugation fractions of whole
cell extracts (Intestine 407 cells). The presence of PKC in the caveolin-1-containing fraction
indicates that it is recruited to lipid rafts in response to bacterial infection. [MOI 100:1; rabbit
anti-PKC and rabbit anti-caveolin-1 primary antibody (1:1000); IRDye 800 goat anti-rabbit
secondary antibody (1:20000)]
148
149
Figure 5.4 Recruitment of PKC is independent of the type III secretion system and the
production of Shiga toxins 1 and 2. The recruitment of PKC to lipid rafts was observed in both
type III secretion mutant, CVD 451, infected and Shiga toxins-negative mutant, 85-170, infected
cells. This suggests that EHEC-induced recruitment of host signalling proteins is independent of
the EHEC type III secretion system and production of shiga toxins. [MOI 100:1; rabbit anti-
PKC and rabbit anti-caveolin-1 primary antibody (1:1000); IRDye 800 goat anti-rabbit
secondary antibody (1:20000)]
150
151
To confirm that EHEC O157:H7-induced translocation of PKC was dependent on an intact lipid
raft microdomain, methyl-β-cyclodextrin (10mM) was employed to pre-treat cells and deplete
cholesterol from the plasma membrane and, thereby, disrupt lipid rafts (Riff, Callahan et al.
2005). Cells subjected to MβCD pretreatment did not result in PKC in caveolin-enriched
microdomains in response to EHEC O157:H7 challenge (Figure 5.5), indicating that intact lipid
rafts likely play a role in epithelial cell PKC signal transduction responses to EHEC infection.
Recruitment of PKC to lipid rafts and AE lesion formation in response to EHEC infection is
blocked by specific inhibitors.
Treatment with the phorbol ester PMA (100nM), which results in the activation of conventional
PKC isoforms (Dries, Gallegos et al. 2007), did not induce translocation of PKC to caveolin-1-
enriched membrane fractions (data not shown). Pre-treatment of epithelial cells with the pan-
PKC inhibitor bisindolylmaleimide I (10mM) for 3 hrs prior to EHEC O157:H7 infection also
did not result in a reduction in PKC movement to detergent-resistant microdomains following
EHEC infection (Figure 5.6). Similarly, cells pre-treated with a low dose of the PKC inhibitor
Gö6983 (10nM) did not block translocation of PKC to lipid rafts in response to EHEC O157:H7
infection. By contrast, epithelial cells pre-treated with a higher dose of PKC inhibitor Gö6983
(60nM) resulted in a reduction in PKC levels in detergent-resistant microdomains (Figure 5.7),
suggesting that an atypical PKC isoform was recruited to lipid rafts in response to EHEC
O157:H7 infection (Cuschieri, Umanskiy et al. 2004). Myristoylated PKC-zeta pseudosubstrate
pre-treated epithelial cells also exhibited a decrease in the amount of PKC recruited to caveolin-
1-enriched membrane fractions in response to EHEC O157:H7 infection (Figure 4.8), indicating
the PKCδ isoform is activated in EHEC-infected epithelial cells. PKCδ is also involved in
EHEC-induced AE lesion formation. In contrast to the observed AE lesions on EHEC-infected
cells pretreated with PKCα pseudosubstrate, infected cells pretreated with PKCδ pseudosubstrate
did not exhibit AE lesions (Figure 4.9).
Recruitment of second messengers to detergent-resistant membranes is inhibited by
pretreatment with Lactobacillus helveticus R0052
Pre-treatment of epithelial cells with Lactobacillus helveticus R0052 3 hr prior to EHEC
O157:H7 infection resulted in a reduction in levels of both PKC and PI3K in detergent resistant
152
membranes in response to EHEC O157:H7 infection (Figure 5.10A). Immunoblotting results
were quantified by densitometry and showed a significant reduction in levels of both PKC and
PI3K present in caveolin-1-enriched membrane fractions when epithelial cells were pre-
incubated with L. helveticus R0052 prior to EHEC infection (Figure 5.10B). This effect was
specific, because a similar effects was not observed in epithelial cells pretreated with
Lactobacillus rhamnosus, strain R0011 (Figure 5.10C)
153
Figure 5.5 Recruitment of PKC is dependent on intact lipid rafts on the plasma membrane
of host epithelial cells. When lipid rafts are disrupted by depleting cholesterol using MβCD,
there is a decrease in PKC recruitment, indicating that functional lipid rafts are required for
recruitment. [MOI 100:1; rabbit anti-PKC and rabbit anti-caveolin-1 primary antibody (1:1000);
IRDye 800 goat anti-rabbit secondary antibody (1:20000)]
154
155
Figure 5.6 EHEC-induced recruitment of PKC is not blocked by bisindolylmaleimide I.
HEp-2 cells pretreated with bisindolylmaleimide I did not block the recruitment of PKC to lipid
rafts in response to EHEC O157:H7 infection, indicating that the classical and novel isoforms of
PKC are not the ones involved in the infection process. [MOI 100:1; rabbit anti-PKC and rabbit
anti-caveolin-1 primary antibody (1:1000); IRDye 800 goat anti-rabbit secondary antibody
(1:20000)]
156
157
Figure 5.7 PKC inhibitor Gö6983 prevents recruitment of protein kinase C (PKC) to lipid
rafts in response to Escherichia coli O157:H7 infection. Representative western blots of
protein kinase C in ultracentrifugation fractions of whole cell extracts. Migration of lipid rafts to
fraction 3 is indicated by the presence of caveolin-1. PKC recruitment to rafts in both EHEC-
infected and infected cells treated with the PKC inhibitor Gö6983 (at 10 nM) suggests that
neither the classical nor the novel isoforms of PKC are involved in PKC recruitment to lipid rafts
in response to infection. By contrast, a reduction of recruited PKC in infected epithelium treated
with a higher concentration (60 nM) of the same inhibitor indicates that atypical PKC isoforms
are likely involved in EHEC O157:H7 induced protein recruitment. [n=3; MOI 100:1; rabbit
anti-PKC and rabbit anti-caveolin-1 primary antibody (1:1000); IRDye 800 goat anti-rabbit
secondary antibody (1:20000)]
158
159
Figure 5.8 Atypical isoform of PKC is involved in the recruitment of PKC to lipid rafts in
response to EHEC O157:H7 infection. A: Western blots of protein kinase C (PKC) from
ultracentrifugation fractions of whole cell extracts. Cells treated with 60κM of PKC-zeta
inhibitor resulted in a significant decrease in the amount of PKC translocation to lipid rafts in
response to EHEC infection. B: Significant reduction in the amount of PKCδ recruited to lipid
rafts is shown by densitometry of PKC present in lipid raft-containing fraction 3 in cells treated
with 60κM of PKC-zeta pseudosubstrate prior to EHEC O157:H7 infection (MOI 100:1; 1h,
n=4; *P<0.05).
160
161
Figure 5.9 An atypical isoform of PKC is involved in EHEC O157:H7-induced AE lesion
formation. When cells were treated with PKCα pseudosubstrate (60µM) prior to infection,
EHEC-induced actin cytoskeletal rearrangement was still present. However, cells treated with
60κM of PKC-δ pseudosubstrate resulted in amelioration of EHEC-induced attaching-effacing
lesions.
162
163
Figure 5.10 The recruitment of host signalling proteins is blocked by pretreating the cells
with probiotics. Translocation of host signalling molecules PKC in response to EHEC infection
was inhibited when cells were pre-treated with the probiotic A: L. helveticus R0052 (*p<0.05),
but not B: L. rhamnosus strain R0011. These findings indicate that strain R0052 possesses a
factor, absent in strain R0011, that is able to attenuate the infectious process. C: One of the
distinguishing factor, S-layer protein, has been ruled out as the factor inhibiting EHEC-induced
recruitment of host proteins to lipid rafts. [MOI 100:1; rabbit anti-PKC and rabbit anti-caveolin-
1 primary antibody (1:1000); IRDye 800 goat anti-rabbit secondary antibody (1:20000)]
164
165
5.5 Discussion
We have shown, for the first time, that EHEC hijacks epithelial cell membrane lipid
microdomains to recruit and activate second messengers PKC in order to cause intestinal damage
and elicit further pathogenic effects. Such recruitment is not the result of non-bacterially related
external factors, because this phenomenon was only observed when cells were infected with live
microorganisms and not heat-killed bacteria. This recruitment still occurred when epithelial
monolayers were infected with EHEC strain CVD-451, a type III secretion mutant; indicating
that PKC recruitment to lipid rafts is mediated by a non-type III secretion system bacterial
effector. It is known that both EHEC O157:H7 and enteropathogenic Escherichia coli O127:H6
are capable of disrupting intestinal barrier function and cause inflammation in the gut by
manipulating key signaling cascades inside host cells (Guttman, Li et al. 2006).
Previous studies have shown that the presence of cholesterol enriched host plasma membrane
microdomains are required for adherence and pedestal formation by these attaching and effacing
Escherichia coli (Riff, Callahan et al. 2005; Allen-Vercoe, Waddell et al. 2006). When lipid
rafts are disrupted with the cholesterol-sequestering reagent, methyl-β-cyclodextrin, EHEC no
longer induced the translocation of PKC to lipid rafts. This finding provides evidence that
EHEC O157:H7 induces rearrangements in the host cytoskeleton and the formation of adhesion
pedestals by activating PLC-gamma and PI3K pathways via functionally intact lipid raft
signaling complexes.
Cells infected with chloramphenicol treated bacteria to block prokaryotic protein synthesis
(Jandu, Ceponis et al. 2006) did not initiate the recruitment of PKC to lipid rafts during the
infectious process. This finding indicates that new bacterial protein(s) secreted into the culture
medium triggers the recruitment and activation of both PKC to cholesterol-enriched
microdomains in the host cell plasma membrane.
Although production of Shiga toxins is reported to promote bacterial colonization in human
intestine (Robinson, Sinclair et al. 2006), the ability of EHEC O157:H7 to elaborate Shiga-like
toxins did not play a role in recruiting PKC to lipid rafts (Proulx, Seidman et al. 2001).
166
Phospholipase Cγ also plays a role in microbial-host interactions following pathogenic E. coli
infection, triggering an increase in intracellular calcium (Kenny and Finlay 1997). This pathway
mediates EHEC-induced attaching-effacing lesions (Johnson-Henry, Wallace et al. 2001). The
downstream second messenger, protein kinase C (PKC), was found in lipid rafts one hour post
EHEC infection. This finding shows that PKC also plays key role in the regulation of
cytoskeleton dynamics in response to infection, leading to the formation of attaching-effacing
lesion formation and the disruption of inter-cellular tight junctions (Tomson, Koutsouris et al.
2004).
Protein kinase C has been implicated in the regulation of diverse cellular events (Dempsey,
Newton et al. 2000). Due to its complex functions in the cell, complementary experimental
approaches have been developed to investigate the biology of PKC. Traditionally, both
antibodies and inhibitors have been used to study the expression, as well as the activity, of PKC
in cells in the presence of specific stimuli (Mochly-Rosen, Henrich et al. 1990; Disatnik, Buraggi
et al. 1994). Protein kinase C comprises a complex family of serine/threonine protein kinases
involved in the regulation of multiple cellular responses (Dempsey, Newton et al. 2000). There
are three PKC subfamilies and approximately 12 isoforms currently identified, which are
activated and translocated through differential mechanisms (Steinberg 2004).
The possibility of atypical PKC, instead of classical PKC, involvement in EHEC O157:H7
infectious process was first suggested when the positive control phorbol 12-myristate 13-acetate
(PMA), as a surrogate of DAG (Foey and Brennan 2004), did not activate and translocate PKC
from the cytosol to lipid rafts. Similarly, pre-treating cells with a classical PKC inhibitor
(Cuschieri, Umanskiy et al. 2004), bisindolylmaleimide I, prior to infection did not result in the
inhibition of EHEC-induced translocation of PKC to lipid rafts. Cells pretreated with the lower
dosage of the concentration dependent PKC inhibitor Gö6983 also verified this result.
Furthermore, the higher dosage of Gö6983 significantly reduced the amount of PKC recruited to
lipid rafts in response to EHEC O157:H7 infection, indicating that EHEC was activating PKCδ
through lipid rafts. Finally, a highly specific myristolated PKCδ pseudosubstrate confirmed that
PKCδ was the PKC isoform responding to EHEC challenge of epithelial cells.
167
The atypical isoform of PKC, including PKC, are key regulators of critical intracellular
siganlling pathways induced by extracellular stimuli (Hirai and Chida 2003). Recent studies
show that PKCδ controls colonic epithelial cell proliferation (Umar, Sellin et al. 2000), regulates
tight junctions (Tomson, Koutsouris et al. 2004), and mediates the activation of host immune
responses to bacterial infection (Savkovic, Koutsouris et al. 2003). Further studies in appropriate
animal models (Duran, Rodriguez et al. 2004) now have to be conducted to confirm the specific
roles of PKCδ in the pathobiology of EHEC-induced disease.
The adhesion of enteric pathogens to intestinal epithelial cells can also be blocked as an
alternative way to interrupt the infectious process (Collado, Meriluoto et al. 2007). Side effects
and resistance to antibiotics has prompted studies investigating whether beneficial organisms,
referred to as probiotics (29), can act as a barrier to infection by preventing colonization of
enteric pathogens (Sherman, Ossa et al. 2009). Probiotics, including Lactobacillus helveticus,
strain R0052 prevent E. coli O157:H7-mediated pathogenesis in vitro (Sherman, Johnson-Henry
et al. 2005) and the pathobiology of Citrobacter rodentium infection in a murine model of
infection in vivo.
There is an increasing literature indicating that probiotics can be used as treatment for a spectrum
of intestinal diseases. For instance, in animal models of inflammatory bowel disease,
Lactobacillus plantarum stabilizes the mucosal barrier and prevents gut inflammation in the
interleukin-10 gene knockout mouse model of colitis (Kennedy, Kirk et al. 2001; Schultz,
Veltkamp et al. 2002). Other bifidobacteria and lactobacilli decrease intestinal
permeability(Johnson-Henry, Donato et al. 2008), enhance mucosal IgA responses (Chen, Louie
et al. 2005), and increase levels of anti-inflammatory cytokines (Lamine, Eutamene et al. 2004).
Evidence also suggests that mixtures of probiotics can reduce relapse rates in the setting of
pouchitis in humans (Guslandi, Mezzi et al. 2000; Guslandi, Giollo et al. 2003; Rolfe, Fortun et
al. 2006)In this study, epithelial cell monolayers pre-incubated with probiotics inhibited EHEC
from hijacking host membrane rafts and manipulating PKC signalling pathways.
168
Chapter 6.
Discussion, Future Directions, and Significance
169
6.1 Discussion
Enterhemorrhagic Escherichia coli (EHEC) is one of the most important food-borne pathogens
and its clinical outcomes pose a huge health care burden on society (Manning, Motiwala et al.
2008). EHEC O157:H7 is the most prevalent EHEC serotype in North America contributing to
>75,000 human infections, approximately 5,000 deaths, and an average of 17 outbreaks a year.
Some of the major outbreaks over the years include: the 1993 outbreak in western North
America due to ingestion of undercooked ground hamburger purchased at a fast food chain
(CDC 1993), the large 1996 outbreak in Japan related to contaminated radish sprouts, which had
low rates of HUS (Michino, Araki et al. 1999), and the 2006 outbreak related to contaminated
spinach in North America, which had high rates of hospitalization and HUS (CDC 2006). New
routes of infection, such as direct contact with animals in petting zoos and the ability of EHEC to
survive in a variety of food items has become the major sources of new disease outbreaks and are
contributing to the widespread occurrences of outbreaks of the infection (Lim, Yoon et al. 2010).
The treatment of EHEC O157:H7 infection is largely supportive (Panos, Betsi et al. 2006).
Dehydration that is associated with infection is treated with oral or intravenous rehydration to
reduce the stress of volume depletion on kidneys. Anti-diarrheal medications are avoided
because decrease intestinal motility may delay clearance of the pathogen, increase toxin
absorption, and increase the risk or severity of HUS (Wong, Jelacic et al. 2000). Most common
preventative strategies include avoiding eating undercooked ground beef and avoiding the
consumption of unpasteurized milk and unchlorinatied water.
Several studies have shown that antibiotics are not efficacious as treatment for EHEC infections
(Kimmitt, Harwood et al. 2000). Mechanisms that have been postulated to explain the
ineffectiveness: antibiotics may eliminate competing intestinal microflora leading to overgrowth
and colonization of EHEC O157:H7; antibiotics can cause lysis of the bacteria followed by the
release of toxins that then can be absorbed systemically; or antibiotics might induce the
expression of toxin encoding genes. Clinical studies have shown that the use of antibiotics is
associated with longer duration of bloody diarrhea in patients, increases the risk of developing
HUS, and enhances acquisition of a secondary person-to-person EHEC O157:H7 infection with
an increased mortality rate (Carter, Borczyk et al. 1987).
170
It is unclear why the severity of EHEC outbreaks, illness, and frequency varies dramatically in
various outbreaks, but this point out the need for better EHEC detection ability, swiftness of
diagnosis, and enhanced treatment regimens. In order to see improvements in all these aspects of
management, a better understanding of the disease and underlying infection mechanisms are
needed.
Host cell responses against EHEC O157:H7 infection are diverse and intricate (Bhavsar,
Guttman et al. 2007). There are multiple signalling molecules involved in orchestrating host
responses including: the development of mucosal injury, cytoskeleton rearrangements, and the
disruption of tight junction integrity. Attaching and effacing Escherichia coli infection of
intestinal epithelial cells induces an inflammatory response in which NF-θB is activated and
induces upregulation of the chemokine CXCL-8 (previously referred to as intereukin-8)
expression (Gobert, Vareille et al. 2007).
An association between osteopontin (OPN) and chronic inflammatory bowel diseases (IBD) was
recently assessed using dextran sodium sulphate (DSS) to induce colitis in both wild-type and
OPN knock-out mice, but the results presented in published studies are conflicting (da Silva,
Pollett et al. 2006; Heilmann, Hoffmann et al. 2008; da Silva, Ellen et al. 2009). Our interest
was defining association between OPN and gut inflammation, using Citrobacter rodentium as a
murine model of infectious colitis. In the absence of OPN, there was a decrease in bacterial
colonization and colonic epithelial cell hyperplasia. This protective effect was associated with a
reduction in actin dense foci directly underneath the adherent C. rodentium both in vitro and in
vivo. These findings indicate that OPN may be either directly or indirectly involved in mediating
bacterial attachment to host intestinal epithelial cells.
Most previous studies looking at the function of OPN suggest that OPN plays a key role in
inflammatory regulation, because disease is attenuated when OPN is absent and OPN is involved
in integrin adhesion (Kon, Ikesue et al. 2008), inflammatory cell chemotaxis (Zhu, Suzuki et al.
2004), and in enhanced neutrophil function (Koh, da Silva et al. 2007). Our findings highlight
the immune regulatory role of OPN in response to C. rodentium infection, because there was a
reduction in the increase of IFN in OPN-/- mice. This demonstrates that OPN serves as a
crucial mediator of innate immune function. There was partial restoration of the WT phenotype
171
with exogenous, intrarectal administration of OPN, but this also suggests the possibility that
intracellular OPN may play a role in C. rodentium-induced disease pathogenesis. These evidence
also indicate that C. rodentium can also hijack host cell inflammatory responses against the
pathogen to elicit host damage (Croxen and Finlay 2010). Host immune mechanism involving
OPN is being hijacked by C. rodentium to induce disease and injury to the intestine. Ways in
which microbial pathogens hijack host machinery to elicit disease and the host molecules used
by EHEC and C. rodentium are still largely unclear. This project has shown that host membrane
rafts provide a means for EHEC and C. rodentium to usurp host signalling molecules for
inducing host injury.
An increase in IP3 response is observed in EHEC O157:H7-infected epithelial cells (Frankel,
Phillips et al. 1998). Infection of HEp-2 cells with EHEC O157:H7, strain CL56 triggers
hydrolysis of phosphatidylinositol 4,5-bisphosphate into IP3 and diacylglycerol (DAG) (Dytoc,
Fedorko et al. 1994; Foubister, Rosenshine et al. 1994). This increase in IP3 causes an increase
in flux of intracellular Ca2+
(Ismaili, Philpott et al. 1995) which, together with the elevated
concentration of DAG, activates protein kinase C. Phosphoinositide mediated signal
transduction pathways play a crucial role in actin remodeling and plasma membrane dynamics
(Di Paolo, Lenci et al. 2006). Several intracellular pathogens interfere with phosphoinositide
signalling cascades to invade into host eukaryotic cells. Induction of A/E lesion formation by
EHEC is associated with changes in the host cell signal transduction machinery.
Our laboratory has shown previously that depletion of cellular cholesterol, using methyl-β-
cyclodextrin inhibits EHEC O157:H7-induced A/E lesions. The pathogenic effects of EHEC are
restored when epithelial cells grown in tissue culture are allowed to recover cholesterol (Riff,
Callahan et al. 2005). These findings suggest that lipid rafts are required for bacterial adherence
and A/E lesion formation. Using a series of pharmacological inhibitors of cell-signalling, our
laboratory also previously identified that enzymes, including phospholipase C-γ (PLC-γ) and
phosphoinositide 3-kinase (PI3K), could be involved in the signal transduction cascades leading
to cytoskeletal rearrangements in response to EHEC O157:H7 infection (Johnson-Henry,
Wallace et al. 2001).
172
Herein, we now provide additional experimental evidence that EHEC O157:H7 infection induces
the recruitment of host signalling molecules, including PI3K and PKC, to lipid rafts leading to
AE lesion formation. Such recruitment is dependent on the integrity of host cell plasma
membrane rafts. Sequestering cholesterol and, thereby, disrupting the structure of lipid rafts
decreases the ability of EHEC O157:H7 to efficiently activate host signalling pathways involving
both PI3K and PKC to elicit its pathogenic effects.
Live and metabolically active bacteria are necessary for the mobilization of PKC and PI3K to
lipid rafts. Translocation of PKC and PI3K to lipid rafts is independent of the eaeA (intimin)
gene, type III secretion system, and production of Shiga-like toxins. Bacterial factors secreted
into culture supernatants and conditioned medium did not induce the translocation of host
signalling proteins to lipid rafts. This result suggests either a structural feature or bacteria
surface membrane protein that is eliciting the recruitment of host proteins to lipid rafts in
response to EHEC infection. . Interestingly, EHEC O157:H7 did not activate Akt, the common
downstream molecule from PI3K. This suggests that the mobilization of PI3K to lipid rafts
likely is associated with activation of alternative signal transduction pathways, such as small
GTPases (Zeidan, Paylor et al. 2007), to induce pedestal formation underneath intimately
adherent bacteria.
The mobilization of PKC to lipid rafts in response to EHEC O157:H7 infection was inhibited by
specific PKC isoform inhibitors. By using concentration-dependent PKC isoform-specific
inhibitors and myristoylated PKC pseudosubstrate, PKC was found to be the activated in
response to EHEC infection. This suggests that atypical PKC could play a role in the
pathogenesis of EHEC O157:H7infection - similar to its role in the pathogenesis of other
pathogenic bacteria, such as Helicobacter pylori (Tan, Tompkins et al. 2009), Staphylococcus
aureus (Ohnemus, Kohrmeyer et al. 2008), Mycobacterium tuberculosis (Yang, Lee et al. 2007),
and non-typhoidal Salmonellae (Procyk, Rippo et al. 1999).
EHEC O157:H7 does not colonize the gut or cause disease in mice, unless the animals are pre-
treated with broad-spectrum antibiotics (Wadolkowski, Burris et al. 1990). Therefore, C.
rodentium is widely used as an animal model to study the infection mechanisms of virulence of
non-invasive A/E organisms (Vallance, Deng et al. 2003).
173
NPC-/- mice serve as an animal model to delineate the role of lipid rafts in an in vivo setting.
The lack of lipid rafts in a gene knockout mouse results in colonization delay and adherence of
C. rodentium to the colonic mucosa (12 vs. 6 days in NPC-/- and wild type mice, respectively)
and the delayed appearance of C. rodentium-induced AE lesions. These findings indicate that
lipid rafts play a role in both the adhesion of non-invasive, pathogenic bacteria to intestinal
epithelial cells as well as initiating signalling cascades in host cells to induce AE lesion
formation.
NPC-/- mice also showed a reduction in colonic epithelial cell hyperplasia in response to C.
rodentium infection, compared to wild-type-infected mice. This reduction was a result of a
decrease in mitotic cells and a decrease in the size of the proliferation zone in NPC-/- mice in
comparison to wild-type mice. A decrease in proinflammatory cytokine response in infected
NPC-/- mice was also observed; specifically, levels of IFN- and IL-12.
OPN could directly mediate bacterial adherence and actin cytoskeleton rearrangement leading to
AE lesions. OPN could also act in conjunction with its receptor CD44 to mediate the
pathogenesis of EHEC O157:H7 and C. rodentium infections. Alternatively, OPN could mediate
AE lesion formation and tight junction disruption via its association with EHEC-activated host
signalling pathways, involving lipid raft microdomains and signalling molecules such as PLC,
PI3K, and isoforms of PKC (Figure 6.1).
174
Figure 6.1 Schematic diagram of suggested infectious process of EHEC O157:H7, leading
to AE lesion formation and barrier disruption. EHEC O157:H7 attach and intimately adhere
to host cell surface in close proximity to lipid raft microdomains where the TTSS is activated and
various bacterial virulence factors are secreted. These secreted virulence factors act to induce
the translocation of host signalling proteins to lipid rafts thereby activating downstream
signalling cascades involving PI3K, PKC, and OPN, leading to cytoskeletal rearrangements,
attaching-effacing lesions, and tight junction disruption.
175
176
6.2 Future Directions
Host cell factors likely play a crucial role in recruiting PKC and PI3K to lipid rafts in response to
EHEC O157:H7 infection. For instance, PKC is one of the major signalling proteins that leads to
NF-θB activation in response to bacterial infections (Savkovic, Koutsouris et al. 2003).
Therefore, cyclohexamide (10κg/ml; Sigma) could be used to halt eukaryotic de novo protein
synthesis and, thereby, determine if new host cell protein synthesis is involved in the observed
recruitment of PKC and PI3K in response to EHEC O157:H7 infection (Sanfilippo, Chirimuuta
et al. 2004). Moreover, PKC might serve as a downstream target of PI3K signalling in response
to EHEC infection. A co-immunoprecipitation experiment would be able to determine if PI3K
and PKC physically act in conjunction following EHEC infection in the formation of AE lesions
and tight junction disruption.
The contribution of various PKC isozymes to the pathogenesis of Escherichia coli O157:H7
infection still remains unclear. Recent studies, using in vitro models, indicate that PKC likely
plays crucial role in EHEC-induced signalling responses, which leading to A/E lesions formation
(Johnson-Henry, Wallace et al. 2001), disruption of barrier function (Ceponis, Riff et al. 2005),
and activation of pro-inflammatory cytokines (Savkovic, Koutsouris et al. 2003).
Transgenic mouse models have been used to detect the functional activities of individual PKC
isozymes (Dorn, Souroujon et al. 1999; Reyland, Anderson et al. 1999; Fields, Murray et al.
2003) For instance, PKCε is suggested to play a role in myocardial infarction and in heart failure
(Koyanagi, Noguchi et al. 2007). Atypical PKCδ controls colonic epithelial cell proliferation
(Umar, Sellin et al. 2000). To corroborate my in vitro findings of the involvement of protein
kinase C in EHEC O157:H7 infection, an animal model of infection can now be used. There are
several PKC knockout mice available commercially (ie. PKCα, , and ) and PKCδ knockout
mice have been described (Martin, Duran et al. 2002). Such mice should now be used to further
delineate the role of PKC-mediated signalling in response to C. rodentium infection.
To complement studies using gene knockout mice, relatively specific pharmacological inhibitors
can be orally administered to wild-type, C. rodentium-infected mice (Table 6.1)
177
Table 6.1 PKC inhibitors used in vitro, in vivo, as well as in human studies
178
(Birchall, Bishop et al. 1994; Wakasaki, Koya et al. 1997; Koya, Haneda et al. 2000; Hambleton,
Hahn et al. 2006; Mendez-Samperio, Alba et al. 2007). Previous studies by Birchall et al. (1994)
showed that an orally administered, selective inhibitor of PKC was effective in preventing T-cell
activation in rats leading to chronic inflammatory responses in vivo. Studies by Chmura et al.
(2000) showed that mice with tumour cells injected into their hind limbs followed by treatment
with a selective PKC inhibitor, chelerythrine chloride (Sigma Chemical Corp., St. Louis, MO),
resulted in tumour regression. Future studies could employ chelerythrine chloride in the C.
rodentium infection model to determine the function of PKC in the pathogenesis of attaching-
effacing bacterial infection in vivo.
Short interfering RNA (siRNA) can also be used to knock down atypical PKCs in mice prior to
infection (Parkinson, Le Good et al. 2004). In recent years, numerous studies have been
conducted to find more efficient ways to deliver siRNAs to target organs; however, silencing
genes are still limited by the stability of siRNAs molecules in vivo and limited efficiency of their
up-take by target cells and tissues (Dillon, Sandy et al. 2005). However, more recent evidence
provides for an efficient method of siRNA delivery in mice (Baregamian, Rychahou et al. 2007).
These siRNA pretreated mice could then be subjected to C. rodentium infection, as described in
this thesis.
Even though our recent findings indicate that OPN plays a role in EHEC and C. rodentium-
induced AE lesion formation and in vivo colonic epithelial cell hyperplasia, its precise
mechanism of action remains unknown. Further biochemical analysis is required to determine if
OPN is directly involved in EHEC-induced host signalling cascades leading to its pathogenic
effects and whether lipid rafts are required for the activation and recruitment of OPN to AE
lesions. The presence of CD44, the receptor for OPN, in host cell membrane lipid microdomains
during EHEC infection should be analyzed and downstream targets should also be deduced using
complementary co-immunoprecipitation and immunostaining experimental techniques.
179
6.3 Significance
Defining the function of lipid-rich membrane microdomains, which mediates signal transduction
pathways such as PLC, PI3K, PKC, and OPN is required to better define host responses to
EHEC O157:H7 infection. . Such knowledge could lead, ultimately, to the development of novel
strategies to interrupt the infectious process and reduce the complications of human disease
(D'Adamo 2009). By investigating the role of cholesterol-rich lipid rafts and host signalling
molecules, in the pathogenesis of C. rodentium in a murine model of AE infection, can further
contribute to current understanding of host-microbe interactions.
180
Chapter 7.
References
181
Abi-Mosleh, L., R. E. Infante, et al. (2009). "Cyclodextrin overcomes deficient lysosome-to-
endoplasmic reticulum transport of cholesterol in Niemann-Pick type C cells." Proc Natl
Acad Sci U S A 106(46): 19316-21.
Absi, M., M. P. Burnham, et al. (2007). "Effects of methyl beta-cyclodextrin on EDHF responses
in pig and rat arteries; association between SK(Ca) channels and caveolin-rich domains."
Br J Pharmacol 151(3): 332-40.
Acheson, D. W. and S. Luccioli (2004). "Microbial-gut interactions in health and disease.
Mucosal immune responses." Best Pract Res Clin Gastroenterol 18(2): 387-404.
Agnholt, J., J. Kelsen, et al. (2007). "Osteopontin, a protein with cytokine-like properties, is
associated with inflammation in Crohn's disease." Scand J Immunol 65(5): 453-60.
Allen-Vercoe, E., B. Waddell, et al. (2006). "Enteropathogenic Escherichia coli Tir translocation
and pedestal formation requires membrane cholesterol in the absence of bundle-forming
pili." Cell Microbiol 8(4): 613-24.
Altmann, S. W., H. R. Davis, Jr., et al. (2004). "Niemann-Pick C1 Like 1 protein is critical for
intestinal cholesterol absorption." Science 303(5661): 1201-4.
Andjelkovic, M., D. R. Alessi, et al. (1997). "Role of translocation in the activation and function
of protein kinase B." J Biol Chem 272(50): 31515-24.
Andjelkovic, M., T. Jakubowicz, et al. (1996). "Activation and phosphorylation of a pleckstrin
homology domain containing protein kinase (RAC-PK/PKB) promoted by serum and
protein phosphatase inhibitors." Proc Natl Acad Sci U S A 93(12): 5699-704.
Arcaro, A., M. Aubert, et al. (2007). "Critical role for lipid raft-associated Src kinases in
activation of PI3K-Akt signalling." Cell Signal 19(5): 1081-92.
Arend, W. P., G. Palmer, et al. (2008). "IL-1, IL-18, and IL-33 families of cytokines." Immunol
Rev 223: 20-38.
Artis, D. and R. K. Grencis (2008). "The intestinal epithelium: sensors to effectors in nematode
infection." Mucosal Immunol 1(4): 252-64.
Artis, D., C. S. Potten, et al. (1999). "Trichuris muris: host intestinal epithelial cell
hyperproliferation during chronic infection is regulated by interferon-gamma." Exp
Parasitol 92(2): 144-53.
Ashkar, S., G. F. Weber, et al. (2000). "Eta-1 (osteopontin): an early component of type-1 (cell-
mediated) immunity." Science 287(5454): 860-4.
Baregamian, N., P. G. Rychahou, et al. (2007). "Phosphatidylinositol 3-kinase pathway regulates
hypoxia-inducible factor-1 to protect from intestinal injury during necrotizing
enterocolitis." Surgery 142(2): 295-302.
182
Barlow, R. S. and G. E. Mellor (2010). "Prevalence of Enterohemorrhagic Escherichia coli
Serotypes in Australian Beef Cattle." Foodborne Pathog Dis.
Barthel, M., S. Hapfelmeier, et al. (2003). "Pretreatment of mice with streptomycin provides a
Salmonella enterica serovar Typhimurium colitis model that allows analysis of both
pathogen and host." Infect Immun 71(5): 2839-58.
Basavappa, S., S. R. Vulapalli, et al. (2005). "Chloride channels in the small intestinal cell line
IEC-18." J Cell Physiol 202(1): 21-31.
Batchelor, M., S. Prasannan, et al. (2000). "Structural basis for recognition of the translocated
intimin receptor (Tir) by intimin from enteropathogenic Escherichia coli." EMBO J
19(11): 2452-64.
Bavaro, M. F. (2009). "Escherichia coli O157: what every internist and gastroenterologist should
know." Curr Gastroenterol Rep 11(4): 301-6.
Bean, G. J. and K. J. Amann (2008). "Polymerization properties of the Thermotoga maritima
actin MreB: roles of temperature, nucleotides, and ions." Biochemistry 47(2): 826-35.
Benz, I. and M. A. Schmidt (1989). "Cloning and expression of an adhesin (AIDA-I) involved in
diffuse adherence of enteropathogenic Escherichia coli." Infect Immun 57(5): 1506-11.
Bergstrom, K. S., V. Kissoon-Singh, et al. (2010). "Muc2 protects against lethal infectious colitis
by disassociating pathogenic and commensal bacteria from the colonic mucosa." PLoS
Pathog 6(5): e1000902.
Berntman, E., J. Rolf, et al. (2005). "The role of CD1d-restricted NK T lymphocytes in the
immune response to oral infection with Salmonella typhimurium." Eur J Immunol 35(7):
2100-9.
Bewick, V., L. Cheek, et al. (2004). "Statistics review 9: one-way analysis of variance." Crit
Care 8(2): 130-6.
Bhavsar, A. P., J. A. Guttman, et al. (2007). "Manipulation of host-cell pathways by bacterial
pathogens." Nature 449(7164): 827-34.
Bi, K. and A. Altman (2001). "Membrane lipid microdomains and the role of PKCtheta in T cell
activation." Semin Immunol 13(2): 139-46.
Bilbo, S. D., J. L. Wieseler, et al. (2010). "Neonatal bacterial infection alters fever to live and
simulated infections in adulthood." Psychoneuroendocrinology 35(3): 369-81.
Birchall, A. M., J. Bishop, et al. (1994). "Ro 32-0432, a selective and orally active inhibitor of
protein kinase C prevents T-cell activation." J Pharmacol Exp Ther 268(2): 922-9.
183
Bommarius, B., D. Maxwell, et al. (2007). "Enteropathogenic Escherichia coli Tir is an SH2/3
ligand that recruits and activates tyrosine kinases required for pedestal formation." Mol
Microbiol 63(6): 1748-68.
Borenshtein, D., M. E. McBee, et al. (2008). "Utility of the Citrobacter rodentium infection
model in laboratory mice." Curr Opin Gastroenterol 24(1): 32-7.
Borenshtein, D., P. R. Nambiar, et al. (2007). "Development of fatal colitis in FVB mice infected
with Citrobacter rodentium." Infect Immun 75(7): 3271-81.
Bosse, T., J. Ehinger, et al. (2007). "Cdc42 and phosphoinositide 3-kinase drive Rac-mediated
actin polymerization downstream of c-Met in distinct and common pathways." Mol Cell
Biol 27(19): 6615-28.
Brennan, M. J., Z. M. Li, et al. (1988). "Identification of a 69-kilodalton nonfimbrial protein as
an agglutinogen of Bordetella pertussis." Infect Immun 56(12): 3189-95.
Brown, D. A. (2006). "Lipid rafts, detergent-resistant membranes, and raft targeting signals."
Physiology (Bethesda) 21: 430-9.
Brown, D. A. and E. London (1998). "Functions of lipid rafts in biological membranes." Annu
Rev Cell Dev Biol 14: 111-36.
Brown, D. A. and J. K. Rose (1992). "Sorting of GPI-anchored proteins to glycolipid-enriched
membrane subdomains during transport to the apical cell surface." Cell 68(3): 533-44.
Bruewer, M., A. Luegering, et al. (2003). "Proinflammatory cytokines disrupt epithelial barrier
function by apoptosis-independent mechanisms." J Immunol 171(11): 6164-72.
Bulgin, R., B. Raymond, et al. (2010). "Bacterial guanine nucleotide exchange factors SopE-like
and WxxxE effectors." Infect Immun 78(4): 1417-25.
Bulgin, R. R., A. Arbeloa, et al. (2009). "EspT triggers formation of lamellipodia and membrane
ruffles through activation of Rac-1 and Cdc42." Cell Microbiol 11(2): 217-29.
Burckhardt, C. J. and U. F. Greber (2009). "Virus movements on the plasma membrane support
infection and transmission between cells." PLoS Pathog 5(11): e1000621.
Byres, E., A. W. Paton, et al. (2008). "Incorporation of a non-human glycan mediates human
susceptibility to a bacterial toxin." Nature 456(7222): 648-52.
Campellone, K. G., D. Robbins, et al. (2004). "EspFU is a translocated EHEC effector that
interacts with Tir and N-WASP and promotes Nck-independent actin assembly." Dev
Cell 7(2): 217-28.
Canny, G. O. and B. A. McCormick (2008). "Bacteria in the intestine, helpful residents or
enemies from within?" Infect Immun 76(8): 3360-73.
184
Cantley, L. C. (2002). "The phosphoinositide 3-kinase pathway." Science 296(5573): 1655-7.
Cantor, H. and M. L. Shinohara (2009). "Regulation of T-helper-cell lineage development by
osteopontin: the inside story." Nat Rev Immunol 9(2): 137-41.
Cantrell, D. A. (2001). "Phosphoinositide 3-kinase signalling pathways." J Cell Sci 114(Pt 8):
1439-45.
Capaldo, C. T. and A. Nusrat (2009). "Cytokine regulation of tight junctions." Biochim Biophys
Acta 1788(4): 864-71.
Caradonna, L., L. Amati, et al. (2000). "Enteric bacteria, lipopolysaccharides and related
cytokines in inflammatory bowel disease: biological and clinical significance." J
Endotoxin Res 6(3): 205-14.
Caron, E., V. F. Crepin, et al. (2006). "Subversion of actin dynamics by EPEC and EHEC." Curr
Opin Microbiol 9(1): 40-5.
Carter, A. O., A. A. Borczyk, et al. (1987). "A severe outbreak of Escherichia coli O157:H7--
associated hemorrhagic colitis in a nursing home." N Engl J Med 317(24): 1496-500.
Casadevall, A. and L. A. Pirofski (2000). "Host-pathogen interactions: basic concepts of
microbial commensalism, colonization, infection, and disease." Infect Immun 68(12):
6511-8.
Catalan, M., M. I. Niemeyer, et al. (2004). "Basolateral ClC-2 chloride channels in surface colon
epithelium: regulation by a direct effect of intracellular chloride." Gastroenterology
126(4): 1104-14.
Catron, D. M., M. D. Sylvester, et al. (2002). "The Salmonella-containing vacuole is a major site
of intracellular cholesterol accumulation and recruits the GPI-anchored protein CD55."
Cell Microbiol 4(6): 315-28.
CDC (1993). "Update: multistate outbreak of Escherichia coli O157:H7 infections from
hamburgers--western United States, 1992-1993." MMWR Morb Mortal Wkly Rep
42(14): 258-63.
CDC (2006). "Ongoing multistate outbreak of Escherichia coli serotype O157:H7 infections
associated with consumption of fresh spinach--United States, September 2006." MMWR
Morb Mortal Wkly Rep 55(38): 1045-6.
Ceponis, P. J., D. M. McKay, et al. (2003). "Enterohemorrhagic Escherichia coli O157:H7
disrupts Stat1-mediated gamma interferon signal transduction in epithelial cells." Infect
Immun 71(3): 1396-404.
Ceponis, P. J., J. D. Riff, et al. (2005). "Epithelial cell signaling responses to enterohemorrhagic
Escherichia coli infection." Mem Inst Oswaldo Cruz 100 Suppl 1: 199-203.
185
Chabas, D., S. E. Baranzini, et al. (2001). "The influence of the proinflammatory cytokine,
osteopontin, on autoimmune demyelinating disease." Science 294(5547): 1731-5.
Chang, T. Y., P. C. Reid, et al. (2005). "Niemann-Pick type C disease and intracellular
cholesterol trafficking." J Biol Chem 280(22): 20917-20.
Chen, C. C., S. Louie, et al. (2005). "Concurrent infection with an intestinal helminth parasite
impairs host resistance to enteric Citrobacter rodentium and enhances Citrobacter-
induced colitis in mice." Infect Immun 73(9): 5468-81.
Chen, C. C., S. Louie, et al. (2005). "Preinoculation with the probiotic Lactobacillus acidophilus
early in life effectively inhibits murine Citrobacter rodentium colitis." Pediatr Res 58(6):
1185-91.
Cheng, H. C., B. M. Skehan, et al. (2008). "Structural mechanism of WASP activation by the
enterohaemorrhagic E. coli effector EspF(U)." Nature 454(7207): 1009-13.
Chesarone, M. A., A. G. DuPage, et al. (2010). "Unleashing formins to remodel the actin and
microtubule cytoskeletons." Nat Rev Mol Cell Biol 11(1): 62-74.
Chichlowski, M. and L. P. Hale (2008). "Bacterial-mucosal interactions in inflammatory bowel
disease: an alliance gone bad." Am J Physiol Gastrointest Liver Physiol 295(6): G1139-
49.
Cho, H. J. and H. S. Kim (2009). "Osteopontin: a multifunctional protein at the crossroads of
inflammation, atherosclerosis, and vascular calcification." Curr Atheroscler Rep 11(3):
206-13.
Chung, J., T. C. Grammer, et al. (1994). "PDGF- and insulin-dependent pp70S6k activation
mediated by phosphatidylinositol-3-OH kinase." Nature 370(6484): 71-5.
Cole, L. E., K. A. Shirey, et al. (2007). "Toll-like receptor 2-mediated signaling requirements for
Francisella tularensis live vaccine strain infection of murine macrophages." Infect Immun
75(8): 4127-37.
Collado, M. C., J. Meriluoto, et al. (2007). "Role of commercial probiotic strains against human
pathogen adhesion to intestinal mucus." Lett Appl Microbiol 45(4): 454-60.
Collins, C. B., J. Ho, et al. (2008). "CD44 deficiency attenuates chronic murine ileitis."
Gastroenterology 135(6): 1993-2002.
Cooley, M., D. Carychao, et al. (2007). "Incidence and Tracking of Escherichia coli O157:H7 in
a Major Produce Production Region in California." PLoS ONE 2(11): e1159.
Craig, A. M., M. Nemir, et al. (1988). "Identification of the major phosphoprotein secreted by
many rodent cell lines as 2ar/osteopontin: enhanced expression in H-ras-transformed 3T3
cells." Biochem Biophys Res Commun 157(1): 166-73.
186
Crane, J. K., S. S. Choudhari, et al. (2006). "Mutual enhancement of virulence by
enterotoxigenic and enteropathogenic Escherichia coli." Infect Immun 74(3): 1505-15.
Crane, J. K. and J. S. Oh (1997). "Activation of host cell protein kinase C by enteropathogenic
Escherichia coli." Infect Immun 65(8): 3277-85.
Crane, J. K. and C. M. Vezina (2005). "Externalization of host cell protein kinase C during
enteropathogenic Escherichia coli infection." Cell Death Differ 12(2): 115-27.
Crepin, V. F., F. Girard, et al. (2010). "Dissecting the role of the Tir:Nck and Tir:IRTKS/IRSp53
signalling pathways in vivo." Mol Microbiol 75(2): 308-23.
Croxen, M. A. and B. B. Finlay (2010). "Molecular mechanisms of Escherichia coli
pathogenicity." Nat Rev Microbiol 8(1): 26-38.
Cuschieri, J., K. Umanskiy, et al. (2004). "PKC-zeta is essential for endotoxin-induced
macrophage activation." J Surg Res 121(1): 76-83.
D'Adamo, D. (2009). "Advances in the treatment of gastrointestinal stromal tumor." Adv Ther
26(9): 826-37.
da Silva, A. P., R. P. Ellen, et al. (2009). "Osteopontin attenuation of dextran sulfate sodium-
induced colitis in mice." Lab Invest 89(10): 1169-81.
da Silva, A. P., A. Pollett, et al. (2006). "Exacerbated tissue destruction in DSS-induced acute
colitis of OPN-null mice is associated with downregulation of TNF-alpha expression and
non-programmed cell death." J Cell Physiol 208(3): 629-39.
Davidson, C. D., N. F. Ali, et al. (2009). "Chronic cyclodextrin treatment of murine Niemann-
Pick C disease ameliorates neuronal cholesterol and glycosphingolipid storage and
disease progression." PLoS One 4(9): e6951.
Davies, J. P., F. W. Chen, et al. (2000). "Transmembrane molecular pump activity of Niemann-
Pick C1 protein." Science 290(5500): 2295-8.
Dean, P. and B. Kenny (2004). "Intestinal barrier dysfunction by enteropathogenic Escherichia
coli is mediated by two effector molecules and a bacterial surface protein." Mol
Microbiol 54(3): 665-75.
Dempsey, E. C., A. C. Newton, et al. (2000). "Protein kinase C isozymes and the regulation of
diverse cell responses." Am J Physiol Lung Cell Mol Physiol 279(3): L429-38.
Deng, W., C. L. de Hoog, et al. (2010). "A comprehensive proteomic analysis of the type III
secretome of Citrobacter rodentium." J Biol Chem 285(9): 6790-800.
Deng, W., Y. Li, et al. (2001). "Locus of enterocyte effacement from Citrobacter rodentium:
sequence analysis and evidence for horizontal transfer among attaching and effacing
pathogens." Infect Immun 69(10): 6323-35.
187
Deng, W., J. L. Puente, et al. (2004). "Dissecting virulence: systematic and functional analyses
of a pathogenicity island." Proc Natl Acad Sci U S A 101(10): 3597-602.
Deng, W., B. A. Vallance, et al. (2003). "Citrobacter rodentium translocated intimin receptor
(Tir) is an essential virulence factor needed for actin condensation, intestinal colonization
and colonic hyperplasia in mice." Mol Microbiol 48(1): 95-115.
Denhardt, D. T., C. M. Giachelli, et al. (2001). "Role of osteopontin in cellular signaling and
toxicant injury." Annu Rev Pharmacol Toxicol 41: 723-49.
Dennis, A., T. Kudo, et al. (2008). "The p50 subunit of NF-kappaB is critical for in vivo
clearance of the noninvasive enteric pathogen Citrobacter rodentium." Infect Immun
76(11): 4978-88.
Devlin, C., N. H. Pipalia, et al. (2010). "Improvement in lipid and protein trafficking in
Niemann-Pick C1 cells by correction of a secondary enzyme defect." Traffic 11(5): 601-
15.
Di Paolo, D., I. Lenci, et al. (2006). "Extended double-dosage HBV vaccination after liver
transplantation is ineffective, in the absence of lamivudine and prior wash-out of human
Hepatitis B immunoglobulins." Dig Liver Dis 38(10): 749-54.
Diacovich, L. and J. P. Gorvel (2010). "Bacterial manipulation of innate immunity to promote
infection." Nat Rev Microbiol 8(2): 117-28.
Diekmann, D., S. Brill, et al. (1991). "Bcr encodes a GTPase-activating protein for p21rac."
Nature 351(6325): 400-2.
Dillon, C. P., P. Sandy, et al. (2005). "Rnai as an experimental and therapeutic tool to study and
regulate physiological and disease processes." Annu Rev Physiol 67: 147-73.
Disatnik, M. H., G. Buraggi, et al. (1994). "Localization of protein kinase C isozymes in cardiac
myocytes." Exp Cell Res 210(2): 287-97.
Donato, K. A., M. Zareie, et al. (2008). "Escherichia albertii and Hafnia alvei are candidate
enteric pathogens with divergent effects on intercellular tight junctions." Microb Pathog.
Donnenberg, M. S. and T. S. Whittam (2001). "Pathogenesis and evolution of virulence in
enteropathogenic and enterohemorrhagic Escherichia coli." J Clin Invest 107(5): 539-48.
Dorn, G. W., 2nd, M. C. Souroujon, et al. (1999). "Sustained in vivo cardiac protection by a
rationally designed peptide that causes epsilon protein kinase C translocation." Proc Natl
Acad Sci U S A 96(22): 12798-803.
Dries, D. R., L. L. Gallegos, et al. (2007). "A single residue in the C1 domain sensitizes novel
protein kinase C isoforms to cellular diacylglycerol production." J Biol Chem 282(2):
826-30.
188
Duran, A., A. Rodriguez, et al. (2004). "Crosstalk between PKCzeta and the IL4/Stat6 pathway
during T-cell-mediated hepatitis." Embo J 23(23): 4595-605.
Dykstra, M., A. Cherukuri, et al. (2003). "Location is everything: lipid rafts and immune cell
signaling." Annu Rev Immunol 21: 457-81.
Dytoc, M., L. Fedorko, et al. (1994). "Signal transduction in human epithelial cells infected with
attaching and effacing Escherichia coli in vitro." Gastroenterology 106(5): 1150-61.
Eckmann, L. (2006). "Animal models of inflammatory bowel disease: lessons from enteric
infections." Ann N Y Acad Sci 1072: 28-38.
Edwards, J. L. and M. A. Apicella (2006). "Neisseria gonorrhoeae PLD directly interacts with
Akt kinase upon infection of primary, human, cervical epithelial cells." Cell Microbiol
8(8): 1253-71.
Falkenburger, B. H., J. B. Jensen, et al. (2010). "Phosphoinositides: lipid regulators of membrane
proteins." J Physiol.
Fedarko, N. S., B. Fohr, et al. (2000). "Factor H binding to bone sialoprotein and osteopontin
enables tumor cell evasion of complement-mediated attack." J Biol Chem 275(22):
16666-72.
Feng, P. C., S. R. Monday, et al. (2007). "Genetic diversity among clonal lineages within
Escherichia coli O157:H7 stepwise evolutionary model." Emerg Infect Dis 13(11): 1701-
6.
Fielding, C. J. and P. E. Fielding (2004). "Membrane cholesterol and the regulation of signal
transduction." Biochem Soc Trans 32(Pt 1): 65-9.
Fields, A. P., N. R. Murray, et al. (2003). "Characterization of the role of protein kinase C
isozymes in colon carcinogenesis using transgenic mouse models." Methods Mol Biol
233: 539-53.
Finlay, B. B. and G. McFadden (2006). "Anti-immunology: evasion of the host immune system
by bacterial and viral pathogens." Cell 124(4): 767-82.
Foey, A. D. and F. M. Brennan (2004). "Conventional protein kinase C and atypical protein
kinase Czeta differentially regulate macrophage production of tumour necrosis factor-
alpha and interleukin-10." Immunology 112(1): 44-53.
Folkesson, A., S. Lofdahl, et al. (2002). "The Salmonella enterica subspecies I specific
centisome 7 genomic island encodes novel protein families present in bacteria living in
close contact with eukaryotic cells." Res Microbiol 153(8): 537-45.
Foubister, V., I. Rosenshine, et al. (1994). "A diarrheal pathogen, enteropathogenic Escherichia
coli (EPEC), triggers a flux of inositol phosphates in infected epithelial cells." J Exp Med
179(3): 993-8.
189
Frankel, G. and A. D. Phillips (2008). "Attaching effacing Escherichia coli and paradigms of
Tir-triggered actin polymerization: getting off the pedestal." Cell Microbiol 10(3): 549-
56.
Frankel, G., A. D. Phillips, et al. (1998). "Enteropathogenic and enterohaemorrhagic Escherichia
coli: more subversive elements." Mol Microbiol 30(5): 911-21.
French, C. T., E. M. Panina, et al. (2009). "The Bordetella type III secretion system effector
BteA contains a conserved N-terminal motif that guides bacterial virulence factors to
lipid rafts." Cell Microbiol 11(12): 1735-49.
Gareau, M. G., P. M. Sherman, et al. (2010). "Probiotics and the gut microbiota in intestinal
health and disease." Nat Rev Gastroenterol Hepatol.
Gareau, M. G., E. Wine, et al. (2010). "Probiotics prevent death caused by Citrobacter
rodentium infection in neonatal mice." J Infect Dis 201(1): 81-91.
Garmendia, J., A. D. Phillips, et al. (2004). "TccP is an enterohaemorrhagic Escherichia coli
O157:H7 type III effector protein that couples Tir to the actin-cytoskeleton." Cell
Microbiol 6(12): 1167-83.
Garrett, W. S., J. I. Gordon, et al. (2010). "Homeostasis and inflammation in the intestine." Cell
140(6): 859-70.
Garver, W. S., K. Krishnan, et al. (2002). "Niemann-Pick C1 protein regulates cholesterol
transport to the trans-Golgi network and plasma membrane caveolae." J Lipid Res 43(4):
579-89.
Gassler, N., F. Autschbach, et al. (2002). "Expression of osteopontin (Eta-1) in Crohn disease of
the terminal ileum." Scand J Gastroenterol 37(11): 1286-95.
Giachelli, C. M. and S. Steitz (2000). "Osteopontin: a versatile regulator of inflammation and
biomineralization." Matrix Biol 19(7): 615-22.
Gobert, A. P., M. Vareille, et al. (2007). "Shiga toxin produced by enterohemorrhagic
Escherichia coli inhibits PI3K/NF-kappaB signaling pathway in globotriaosylceramide-
3-negative human intestinal epithelial cells." J Immunol 178(12): 8168-74.
Goluszko, P. and B. Nowicki (2005). "Membrane cholesterol: a crucial molecule affecting
interactions of microbial pathogens with mammalian cells." Infect Immun 73(12): 7791-
6.
Goosney, D. L., R. DeVinney, et al. (2001). "Recruitment of cytoskeletal and signaling proteins
to enteropathogenic and enterohemorrhagic Escherichia coli pedestals." Infect Immun
69(5): 3315-22.
190
Gordon, J. N. and T. T. MacDonald (2005). "Osteopontin: a new addition to the constellation of
cytokines which drive T helper cell type 1 responses in Crohn's disease." Gut 54(9):
1213-5.
Grassl, G. A. and B. B. Finlay (2008). "Pathogenesis of enteric Salmonella infections." Curr
Opin Gastroenterol 24(1): 22-6.
Grassme, H., E. Gulbins, et al. (1997). "Acidic sphingomyelinase mediates entry of N.
gonorrhoeae into nonphagocytic cells." Cell 91(5): 605-15.
Grigat, J., A. Soruri, et al. (2007). "Chemoattraction of macrophages, T lymphocytes, and mast
cells is evolutionarily conserved within the human alpha-defensin family." J Immunol
179(6): 3958-65.
Groschwitz, K. R. and S. P. Hogan (2009). "Intestinal barrier function: molecular regulation and
disease pathogenesis." J Allergy Clin Immunol 124(1): 3-20; quiz 21-2.
Gruenheid, S., I. Sekirov, et al. (2004). "Identification and characterization of NleA, a non-LEE-
encoded type III translocated virulence factor of enterohaemorrhagic Escherichia coli
O157:H7." Mol Microbiol 51(5): 1233-49.
Guani-Guerra, E., T. Santos-Mendoza, et al. (2010). "Antimicrobial peptides: general overview
and clinical implications in human health and disease." Clin Immunol 135(1): 1-11.
Guslandi, M., P. Giollo, et al. (2003). "A pilot trial of Saccharomyces boulardii in ulcerative
colitis." Eur J Gastroenterol Hepatol 15(6): 697-8.
Guslandi, M., G. Mezzi, et al. (2000). "Saccharomyces boulardii in maintenance treatment of
Crohn's disease." Dig Dis Sci 45(7): 1462-4.
Guttman, J. A. and B. B. Finlay (2009). "Tight junctions as targets of infectious agents."
Biochim Biophys Acta 1788(4): 832-41.
Guttman, J. A., Y. Li, et al. (2006). "Attaching and effacing pathogen-induced tight junction
disruption in vivo." Cell Microbiol 8(4): 634-45.
Gyles, C. L. (2007). "Shiga toxin-producing Escherichia coli: an overview." J Anim Sci 85(13
Suppl): E45-62.
Hamada, D., M. Hamaguchi, et al. (2010). "Cytoskeleton-modulating effectors of
enteropathogenic and enterohemorrhagic Escherichia coli: a case for EspB as an
intrinsically less-ordered effector." FEBS J 277(11): 2409-15.
Hambleton, M., H. Hahn, et al. (2006). "Pharmacological- and gene therapy-based inhibition of
protein kinase Calpha/beta enhances cardiac contractility and attenuates heart failure."
Circulation 114(6): 574-82.
191
Hansen, J. J., L. Holt, et al. (2009). "Gene expression patterns in experimental colitis in IL-10-
deficient mice." Inflamm Bowel Dis 15(6): 890-9.
Hansen, K. K., P. M. Sherman, et al. (2005). "A major role for proteolytic activity and
proteinase-activated receptor-2 in the pathogenesis of infectious colitis." Proc Natl Acad
Sci U S A 102(23): 8363-8.
Hashimoto-Tane, A., T. Yokosuka, et al. (2010). "TCR-microclusters critical for T-cell
activation are formed independently of lipid raft clustering." Mol Cell Biol.
Hashimoto, M., D. Sun, et al. (2007). "Osteopontin-deficient mice exhibit less inflammation,
greater tissue damage, and impaired locomotor recovery from spinal cord injury
compared with wild-type controls." J Neurosci 27(13): 3603-11.
Hatano, T., S. Kubo, et al. (2007). "Leucine-rich repeat kinase 2 associates with lipid rafts." Hum
Mol Genet 16(6): 678-90.
Hawkins, P. T., K. E. Anderson, et al. (2006). "Signalling through Class I PI3Ks in mammalian
cells." Biochem Soc Trans 34(Pt 5): 647-62.
Hawkins, P. T., A. Eguinoa, et al. (1995). "PDGF stimulates an increase in GTP-Rac via
activation of phosphoinositide 3-kinase." Curr Biol 5(4): 393-403.
Hayward, R. D., R. J. Cain, et al. (2005). "Cholesterol binding by the bacterial type III translocon
is essential for virulence effector delivery into mammalian cells." Mol Microbiol 56(3):
590-603.
Hayward, R. D., P. J. Hume, et al. (2009). "Clustering transfers the translocated Escherichia coli
receptor into lipid rafts to stimulate reversible activation of c-Fyn." Cell Microbiol 11(3):
433-41.
Heilmann, K., U. Hoffmann, et al. (2008). "Osteopontin as two-sided mediator of intestinal
inflammation." J Cell Mol Med 13: 1162-1174.
Hemrajani, C., C. N. Berger, et al. (2010). "NleH effectors interact with Bax inhibitor-1 to block
apoptosis during enteropathogenic Escherichia coli infection." Proc Natl Acad Sci U S A
107(7): 3129-34.
Higaki, K., D. Almanzar-Paramio, et al. (2004). "Metazoan and microbial models of Niemann-
Pick Type C disease." Biochim Biophys Acta 1685(1-3): 38-47.
Higgins, L. M., G. Frankel, et al. (1999). "Role of bacterial intimin in colonic hyperplasia and
inflammation." Science 285(5427): 588-91.
Higgins, L. M., G. Frankel, et al. (1999). "Citrobacter rodentium infection in mice elicits a
mucosal Th1 cytokine response and lesions similar to those in murine inflammatory
bowel disease." Infect Immun 67(6): 3031-9.
192
Higgins, S. E., G. F. Erf, et al. (2007). "Effect of probiotic treatment in broiler chicks on
intestinal macrophage numbers and phagocytosis of Salmonella enteritidis by abdominal
exudate cells." Poult Sci 86(11): 2315-21.
Hirai, T. and K. Chida (2003). "Protein kinase Czeta (PKCzeta): activation mechanisms and
cellular functions." J Biochem (Tokyo) 133(1): 1-7.
Hoffmann, C., D. A. Hill, et al. (2009). "Community-wide response of the gut microbiota to
enteropathogenic Citrobacter rodentium infection revealed by deep sequencing." Infect
Immun 77(10): 4668-78.
Horne, C., B. A. Vallance, et al. (2002). "Current progress in enteropathogenic and
enterohemorrhagic Escherichia coli vaccines." Expert Rev Vaccines 1(4): 483-93.
Houde, M., P. Laprise, et al. (2001). "Intestinal epithelial cell differentiation involves activation
of p38 mitogen-activated protein kinase that regulates the homeobox transcription factor
CDX2." J Biol Chem 276(24): 21885-94.
Hu, Q., A. Klippel, et al. (1995). "Ras-dependent induction of cellular responses by
constitutively active phosphatidylinositol-3 kinase." Science 268(5207): 100-2.
Huang, J. and J. H. Brumell (2009). "Autophagy in immunity against intracellular bacteria." Curr
Top Microbiol Immunol 335: 189-215.
Hunter, G. K., B. Grohe, et al. (2009). "Role of phosphate groups in inhibition of calcium oxalate
crystal growth by osteopontin." Cells Tissues Organs 189(1-4): 44-50.
Hur, E. M., S. Youssef, et al. (2007). "Osteopontin-induced relapse and progression of
autoimmune brain disease through enhanced survival of activated T cells." Nat Immunol
8(1): 74-83.
Iguchi, A., N. R. Thomson, et al. (2009). "Complete genome sequence and comparative genome
analysis of enteropathogenic Escherichia coli O127:H6 strain E2348/69." J Bacteriol
191(1): 347-54.
Ikonen, E. and M. Holtta-Vuori (2004). "Cellular pathology of Niemann-Pick type C disease."
Semin Cell Dev Biol 15(4): 445-54.
Ingelmo-Torres, M., K. Gaus, et al. (2009). "Triton X-100 promotes a cholesterol-dependent
condensation of the plasma membrane." Biochem J 420(3): 373-81.
Inukai, K., M. Funaki, et al. (2001). "Five isoforms of the phosphatidylinositol 3-kinase
regulatory subunit exhibit different associations with receptor tyrosine kinases and their
tyrosine phosphorylations." FEBS Lett 490(1-2): 32-8.
Ismaili, A., D. J. Philpott, et al. (1995). "Signal transduction responses following adhesion of
verocytotoxin-producing Escherichia coli." Infect Immun 63(9): 3316-26.
193
Ivanov, II, K. Atarashi, et al. (2009). "Induction of intestinal Th17 cells by segmented
filamentous bacteria." Cell 139(3): 485-98.
Ivanov, A. I., A. Nusrat, et al. (2004). "Endocytosis of epithelial apical junctional proteins by a
clathrin-mediated pathway into a unique storage compartment." Mol Biol Cell 15(1):
176-88.
Iwasaki, A. and R. Medzhitov (2004). "Toll-like receptor control of the adaptive immune
responses." Nat Immunol 5(10): 987-95.
Jandu, N., P. J. Ceponis, et al. (2006). "Conditioned medium from enterohemorrhagic
Escherichia coli-infected T84 cells inhibits signal transducer and activator of
transcription 1 activation by gamma interferon." Infect Immun 74(3): 1809-18.
Jandu, N., S. Shen, et al. (2007). "Multiple seropathotypes of verotoxin-producing Escherichia
coli (VTEC) disrupt interferon-gamma-induced tyrosine phosphorylation of signal
transducer and activator of transcription (Stat)-1." Microb Pathog 42(2-3): 62-71.
Jaureguiberry, M. S., M. A. Tricerri, et al. (2010). "Membrane organization and regulation of
cellular cholesterol homeostasis." J Membr Biol 234(3): 183-94.
Johannes, L. and W. Romer (2010). "Shiga toxins--from cell biology to biomedical
applications." Nat Rev Microbiol 8(2): 105-16.
Johnson-Henry, K., J. L. Wallace, et al. (2001). "Inhibition of attaching and effacing lesion
formation following enteropathogenic Escherichia coli and Shiga toxin-producing E. coli
infection." Infect Immun 69(11): 7152-8.
Johnson-Henry, K. C., K. A. Donato, et al. (2008). "Lactobacillus rhamnosus strain GG prevents
enterohemorrhagic Escherichia coli O157:H7-induced changes in epithelial barrier
function." Infect Immun 76(4): 1340-8.
Johnson-Henry, K. C., K. E. Hagen, et al. (2007). "Surface-layer protein extracts from
Lactobacillus helveticus inhibit enterohaemorrhagic Escherichia coli O157:H7 adhesion
to epithelial cells." Cell Microbiol 9(2): 356-67.
Johnson-Henry, K. C., M. Nadjafi, et al. (2005). "Amelioration of the effects of Citrobacter
rodentium infection in mice by pretreatment with probiotics." J Infect Dis 191(12): 2106-
17.
Jones, D. R., C. Paneda, et al. (2005). "Phosphorylation of glycosyl-phosphatidylinositol by
phosphatidylinositol 3-kinase changes its properties as a substrate for phospholipases."
FEBS Lett 579(1): 59-65.
Jones, N. L., A. S. Day, et al. (2002). "Enhanced disease severity in Helicobacter pylori-infected
mice deficient in Fas signaling." Infect Immun 70(5): 2591-7.
194
Kabouridis, P. S. (2006). "Lipid rafts in T cell receptor signalling." Mol Membr Biol 23(1): 49-
57.
Kalischuk, L. D., G. D. Inglis, et al. (2009). "Campylobacter jejuni induces transcellular
translocation of commensal bacteria via lipid rafts." Gut Pathog 1(1): 2.
Kang, J. A., Y. Zhou, et al. (2008). "Osteopontin regulates actin cytoskeleton and contributes to
cell proliferation in primary erythroblasts." J Biol Chem 283(11): 6997-7006.
Kang, Y. J., M. Otsuka, et al. (2010). "Epithelial p38alpha controls immune cell recruitment in
the colonic mucosa." PLoS Pathog 6(6): e1000934.
Kansau, I., C. Berger, et al. (2004). "Zipper-like internalization of Dr-positive Escherichia coli
by epithelial cells is preceded by an adhesin-induced mobilization of raft-associated
molecules in the initial step of adhesion." Infect Immun 72(7): 3733-42.
Kapeller, R., K. V. Prasad, et al. (1994). "Identification of two SH3-binding motifs in the
regulatory subunit of phosphatidylinositol 3-kinase." J Biol Chem 269(3): 1927-33.
Kaper, J. B., J. P. Nataro, et al. (2004). "Pathogenic Escherichia coli." Nat Rev Microbiol 2(2):
123-40.
Kaptzan, T., S. A. West, et al. (2009). "Development of a Rab9 transgenic mouse and its ability
to increase the lifespan of a murine model of Niemann-Pick type C disease." Am J Pathol
174(1): 14-20.
Karam, S. M. (1999). "Lineage commitment and maturation of epithelial cells in the gut." Front
Biosci 4: D286-98.
Karch, H. (2001). "The role of virulence factors in enterohemorrhagic Escherichia coli (EHEC)--
associated hemolytic-uremic syndrome." Semin Thromb Hemost 27(3): 207-13.
Karmali, M. A. (2004). "Infection by Shiga toxin-producing Escherichia coli: an overview." Mol
Biotechnol 26(2): 117-22.
Karmali, M. A., M. Mascarenhas, et al. (2003). "Association of genomic O island 122 of
Escherichia coli EDL 933 with verocytotoxin-producing Escherichia coli seropathotypes
that are linked to epidemic and/or serious disease." J Clin Microbiol 41(11): 4930-40.
Karmali, M. A., M. Petric, et al. (1985). "The association between idiopathic hemolytic uremic
syndrome and infection by verotoxin-producing Escherichia coli." J Infect Dis 151(5):
775-82.
Kawada, M., A. Arihiro, et al. (2007). "Insights from advances in research of chemically induced
experimental models of human inflammatory bowel disease." World J Gastroenterol
13(42): 5581-93.
195
Kennedy, R. J., S. J. Kirk, et al. (2001). "Probiotics (Br J Surg 2001; 88: 161-2)." Br J Surg
88(7): 1018-9.
Kenny, B. and B. B. Finlay (1997). "Intimin-dependent binding of enteropathogenic Escherichia
coli to host cells triggers novel signaling events, including tyrosine phosphorylation of
phospholipase C-gamma1." Infect Immun 65(7): 2528-36.
Khalil, P. N., V. Weiler, et al. (2007). "Nonmyeloablative stem cell therapy enhances
microcirculation and tissue regeneration in murine inflammatory bowel disease."
Gastroenterology 132(3): 944-54.
Kierbel, A., A. Gassama-Diagne, et al. (2005). "The phosphoinositol-3-kinase-protein kinase
B/Akt pathway is critical for Pseudomonas aeruginosa strain PAK internalization." Mol
Biol Cell 16(5): 2577-85.
Kierbel, A., A. Gassama-Diagne, et al. (2007). "Pseudomonas aeruginosa exploits a PIP3-
dependent pathway to transform apical into basolateral membrane." J Cell Biol 177(1):
21-7.
Kilsdonk, E. P., P. G. Yancey, et al. (1995). "Cellular cholesterol efflux mediated by
cyclodextrins." J Biol Chem 270(29): 17250-6.
Kimmitt, P. T., C. R. Harwood, et al. (2000). "Toxin gene expression by shiga toxin-producing
Escherichia coli: the role of antibiotics and the bacterial SOS response." Emerg Infect
Dis 6(5): 458-65.
Kirkham, M. and R. G. Parton (2005). "Clathrin-independent endocytosis: new insights into
caveolae and non-caveolar lipid raft carriers." Biochim Biophys Acta 1746(3): 349-63.
Klapproth, J. M., M. Sasaki, et al. (2005). "Citrobacter rodentium lifA/efa1 is essential for
colonic colonization and crypt cell hyperplasia in vivo." Infect Immun 73(3): 1441-51.
Kline, M. A., E. S. O'Connor Butler, et al. (2010). "A simple method for effective and safe
removal of membrane cholesterol from lipid rafts in vascular endothelial cells:
implications in oxidant-mediated lipid signaling." Methods Mol Biol 610: 201-11.
Knodler, L. A., B. A. Vallance, et al. (2003). "Salmonella type III effectors PipB and PipB2 are
targeted to detergent-resistant microdomains on internal host cell membranes." Mol
Microbiol 49(3): 685-704.
Koh, A., A. P. da Silva, et al. (2007). "Role of osteopontin in neutrophil function." Immunology
122(4): 466-75.
Koh, A., A. P. da Silva, et al. (2007). "Role of osteopontin in neutrophil function." Immunology.
Kok, K., B. Geering, et al. (2009). "Regulation of phosphoinositide 3-kinase expression in health
and disease." Trends Biochem Sci 34(3): 115-27.
196
Kon, S., M. Ikesue, et al. (2008). "Syndecan-4 protects against osteopontin-mediated acute
hepatic injury by masking functional domains of osteopontin." J Exp Med 205(1): 25-33.
Kooijman, E. E., K. E. King, et al. (2009). "Ionization properties of phosphatidylinositol
polyphosphates in mixed model membranes." Biochemistry 48(40): 9360-71.
Kosicek, M., M. Malnar, et al. (2010). "Cholesterol accumulation in Niemann Pick type C (NPC)
model cells causes a shift in APP localization to lipid rafts." Biochem Biophys Res
Commun 393(3): 404-9.
Koya, D., M. Haneda, et al. (2000). "Amelioration of accelerated diabetic mesangial expansion
by treatment with a PKC beta inhibitor in diabetic db/db mice, a rodent model for type 2
diabetes." Faseb J 14(3): 439-47.
Koyanagi, T., K. Noguchi, et al. (2007). "Pharmacological inhibition of epsilon PKC suppresses
chronic inflammation in murine cardiac transplantation model." J Mol Cell Cardiol.
Kruidenier, L., I. Kuiper, et al. (2003). "Intestinal oxidative damage in inflammatory bowel
disease: semi-quantification, localization, and association with mucosal antioxidants." J
Pathol 201(1): 28-36.
Ku, N. O., X. Zhou, et al. (1999). "The cytoskeleton of digestive epithelia in health and disease."
Am J Physiol 277(6 Pt 1): G1108-37.
Kubo, M., T. S. Li, et al. (2008). "Hypoxic preconditioning increases survival and angiogenic
potency of peripheral blood mononuclear cells via oxidative stress resistance." Am J
Physiol Heart Circ Physiol 294(2): H590-5.
Kuhl, A. A., H. Kakirman, et al. (2007). "Aggravation of different types of experimental colitis
by depletion or adhesion blockade of neutrophils." Gastroenterology 133(6): 1882-92.
Kumar, H., T. Kawai, et al. (2009). "Pathogen recognition in the innate immune response."
Biochem J 420(1): 1-16.
Lafont, F., G. Tran Van Nhieu, et al. (2002). "Initial steps of Shigella infection depend on the
cholesterol/sphingolipid raft-mediated CD44-IpaB interaction." Embo J 21(17): 4449-57.
Lafont, F. and F. G. van der Goot (2005). "Bacterial invasion via lipid rafts." Cell Microbiol
7(5): 613-20.
Lamine, F., H. Eutamene, et al. (2004). "Colonic responses to Lactobacillus farciminis treatment
in trinitrobenzene sulphonic acid-induced colitis in rats." Scand J Gastroenterol 39(12):
1250-8.
Larsson, C. (2006). "Protein kinase C and the regulation of the actin cytoskeleton." Cell Signal
18(3): 276-84.
197
Larzabal, M., E. C. Mercado, et al. (2010). "Designed coiled-coil peptides inhibit the type three
secretion system of enteropathogenic Escherichia coli." PLoS One 5(2): e9046.
Latz, E., A. Visintin, et al. (2003). "The LPS receptor generates inflammatory signals from the
cell surface." J Endotoxin Res 9(6): 375-80.
Laude, A. J. and I. A. Prior (2004). "Plasma membrane microdomains: organization, function
and trafficking." Mol Membr Biol 21(3): 193-205.
Laukoetter, M. G., M. Bruewer, et al. (2006). "Regulation of the intestinal epithelial barrier by
the apical junctional complex." Curr Opin Gastroenterol 22(2): 85-9.
Le Clainche, C. and M. F. Carlier (2008). "Regulation of actin assembly associated with
protrusion and adhesion in cell migration." Physiol Rev 88(2): 489-513.
Le Good, J. A., W. H. Ziegler, et al. (1998). "Protein kinase C isotypes controlled by
phosphoinositide 3-kinase through the protein kinase PDK1." Science 281(5385): 2042-5.
LeBlanc, P. M., G. Yeretssian, et al. (2008). "Caspase-12 modulates NOD signaling and
regulates antimicrobial peptide production and mucosal immunity." Cell Host Microbe
3(3): 146-57.
Lee, J. L., M. J. Wang, et al. (2008). "CD44 engagement promotes matrix-derived survival
through the CD44-SRC-integrin axis in lipid rafts." Mol Cell Biol 28(18): 5710-23.
Leibfried, A., R. Fricke, et al. (2008). "Drosophila Cip4 and WASp define a branch of the
Cdc42-Par6-aPKC pathway regulating E-cadherin endocytosis." Curr Biol 18(21): 1639-
48.
Lencer, W. I. and D. Saslowsky (2005). "Raft trafficking of AB5 subunit bacterial toxins."
Biochim Biophys Acta 1746(3): 314-21.
Lenga, Y., A. Koh, et al. (2008). "Osteopontin expression is required for myofibroblast
differentiation." Circ Res 102(3): 319-27.
Li, J., K. L. O'Connor, et al. (2005). "Myristoylated alanine-rich C kinase substrate-mediated
neurotensin release via protein kinase C-delta downstream of the Rho/ROK pathway." J
Biol Chem 280(9): 8351-7.
Lim, J. Y., J. Yoon, et al. (2010). "A brief overview of Escherichia coli O157:H7 and its plasmid
O157." J Microbiol Biotechnol 20(1): 5-14.
Lin, C. W., S. C. Shen, et al. (2010). "12-O-tetradecanoylphorbol-13-acetate-induced
invasion/migration of glioblastoma cells through activating PKCalpha/ERK/NF-kappaB-
dependent MMP-9 expression." J Cell Physiol.
Ling, H., A. Boodhoo, et al. (1998). "Structure of the shiga-like toxin I B-pentamer complexed
with an analogue of its receptor Gb3." Biochemistry 37(7): 1777-88.
198
Lingwood, C. A. (1996). "Role of verotoxin receptors in pathogenesis." Trends Microbiol 4(4):
147-53.
Liscum, L. and S. L. Sturley (2004). "Intracellular trafficking of Niemann-Pick C proteins 1 and
2: obligate components of subcellular lipid transport." Biochim Biophys Acta 1685(1-3):
22-7.
Lupp, C., M. L. Robertson, et al. (2007). "Host-mediated inflammation disrupts the intestinal
microbiota and promotes the overgrowth of Enterobacteriaceae." Cell Host Microbe 2(2):
119-29.
Lusa, S., T. S. Blom, et al. (2001). "Depletion of rafts in late endocytic membranes is controlled
by NPC1-dependent recycling of cholesterol to the plasma membrane." J Cell Sci 114(Pt
10): 1893-900.
Macdonald, J. L. and L. J. Pike (2005). "A simplified method for the preparation of detergent-
free lipid rafts." J Lipid Res 46(5): 1061-7.
Mahfoud, R., A. Manis, et al. (2009). "Fatty acid-dependent globotriaosyl ceramide receptor
function in detergent resistant model membranes." J Lipid Res 50(9): 1744-55.
Manes, S., R. Ana Lacalle, et al. (2003). "From rafts to crafts: membrane asymmetry in moving
cells." Trends Immunol 24(6): 320-6.
Manning, S. D., A. S. Motiwala, et al. (2008). "Variation in virulence among clades of
Escherichia coli O157:H7 associated with disease outbreaks." Proc Natl Acad Sci U S A
105(12): 4868-73.
Marbeuf-Gueye, C., V. Stierle, et al. (2007). "Perturbation of membrane microdomains in GLC4
multidrug-resistant lung cancer cells--modification of ABCC1 (MRP1) localization and
functionality." Febs J 274(6): 1470-80.
Marchiando, A. M., W. V. Graham, et al. (2010). "Epithelial barriers in homeostasis and
disease." Annu Rev Pathol 5: 119-44.
Marteau, P. (2009). "Bacterial flora in inflammatory bowel disease." Dig Dis 27 Suppl 1: 99-
103.
Martin, P., A. Duran, et al. (2002). "Role of zeta PKC in B-cell signaling and function." Embo J
21(15): 4049-57.
Masuda, H., Y. Takahashi, et al. (2003). "Distinct gene expression of osteopontin in patients with
ulcerative colitis." J Surg Res 111(1): 85-90.
Maynard, C. L. and C. T. Weaver (2009). "Intestinal effector T cells in health and disease."
Immunity 31(3): 389-400.
McKay, D. M. (2006). "The beneficial helminth parasite?" Parasitology 132(Pt 1): 1-12.
199
Medzhitov, R. (2007). "Recognition of microorganisms and activation of the immune response."
Nature 449(7164): 819-26.
Mellitzer, G., A. Beucher, et al. (2010). "Loss of enteroendocrine cells in mice alters lipid
absorption and glucose homeostasis and impairs postnatal survival." J Clin Invest 120(5):
1708-21.
Mendez-Samperio, P., L. Alba, et al. (2007). "Mycobacterium bovis bacillus Calmette-Guerin
(BCG)-induced CXCL8 production is mediated through PKCalpha-dependent activation
of the IKKalphabeta signaling pathway in epithelial cells." Cell Immunol 245(2): 111-8.
Michail, S. a. S. P. M. (2009). Probiotics in Pediatric Medicine. Totowa, Humana Press.
Michino, H., K. Araki, et al. (1999). "Massive outbreak of Escherichia coli O157:H7 infection in
schoolchildren in Sakai City, Japan, associated with consumption of white radish
sprouts." Am J Epidemiol 150(8): 787-96.
Miki, H. and T. Takenawa (2003). "Regulation of actin dynamics by WASP family proteins." J
Biochem 134(3): 309-13.
Mirpuri, J., J. C. Brazil, et al. (2010). "Commensal Escherichia coli reduces epithelial apoptosis
through IFN-alphaA-mediated induction of guanylate binding protein-1 in human and
murine models of developing intestine." J Immunol 184(12): 7186-95.
Mochly-Rosen, D., C. J. Henrich, et al. (1990). "A protein kinase C isozyme is translocated to
cytoskeletal elements on activation." Cell Regul 1(9): 693-706.
Mogilner, J. G., I. Srugo, et al. (2007). "Effect of probiotics on intestinal regrowth and bacterial
translocation after massive small bowel resection in a rat." J Pediatr Surg 42(8): 1365-71.
Moll, H. (2003). "Dendritic cells and host resistance to infection." Cell Microbiol 5(8): 493-500.
Moore, R. E., M. K. Young, et al. (2002). "Qscore: an algorithm for evaluating SEQUEST
database search results." J Am Soc Mass Spectrom 13(4): 378-86.
Morimoto, J., M. Inobe, et al. (2004). "Osteopontin affects the persistence of beta-glucan-
induced hepatic granuloma formation and tissue injury through two distinct
mechanisms." Int Immunol 16(3): 477-88.
Morimoto, J., S. Kon, et al. (2010). "Osteopontin; as a target molecule for the treatment of
inflammatory diseases." Curr Drug Targets 11(4): 494-505.
Moser, M. and K. M. Murphy (2000). "Dendritic cell regulation of TH1-TH2 development." Nat
Immunol 1(3): 199-205.
Mougous, J. D., M. E. Cuff, et al. (2006). "A virulence locus of Pseudomonas aeruginosa
encodes a protein secretion apparatus." Science 312(5779): 1526-30.
200
Mukherjee, S. and F. R. Maxfield (2004). "Lipid and cholesterol trafficking in NPC." Biochim
Biophys Acta 1685(1-3): 28-37.
Mundy, R., T. T. MacDonald, et al. (2005). "Citrobacter rodentium of mice and man." Cell
Microbiol 7(12): 1697-706.
Mundy, R., L. Petrovska, et al. (2004). "Identification of a novel Citrobacter rodentium type III
secreted protein, EspI, and roles of this and other secreted proteins in infection." Infect
Immun 72(4): 2288-302.
Mundy, R., D. Pickard, et al. (2003). "Identification of a novel type IV pilus gene cluster
required for gastrointestinal colonization of Citrobacter rodentium." Mol Microbiol
48(3): 795-809.
Muza-Moons, M. M., E. E. Schneeberger, et al. (2004). "Enteropathogenic Escherichia coli
infection leads to appearance of aberrant tight junctions strands in the lateral membrane
of intestinal epithelial cells." Cell Microbiol 6(8): 783-93.
Nakajima, H., N. Kiyokawa, et al. (2001). "Kinetic analysis of binding between Shiga toxin and
receptor glycolipid Gb3Cer by surface plasmon resonance." J Biol Chem 276(46): 42915-
22.
Narita, K., A. Choudhury, et al. (2005). "Protein transduction of Rab9 in Niemann-Pick C cells
reduces cholesterol storage." FASEB J 19(11): 1558-60.
Neish, A. S. (2009). "Microbes in gastrointestinal health and disease." Gastroenterology 136(1):
65-80.
Nell, S., S. Suerbaum, et al. (2010). "The impact of the microbiota on the pathogenesis of IBD:
lessons from mouse infection models." Nat Rev Microbiol 8(8): 564-77.
Nunbhakdi-Craig, V., T. Machleidt, et al. (2002). "Protein phosphatase 2A associates with and
regulates atypical PKC and the epithelial tight junction complex." J Cell Biol 158(5):
967-78.
Nunes, J. S., S. D. Lawhon, et al. (2010). "Morphologic and cytokine profile characterization of
Salmonella enterica serovar typhimurium infection in calves with bovine leukocyte
adhesion deficiency." Vet Pathol 47(2): 322-33.
Nutikka, A. and C. Lingwood (2004). "Generation of receptor-active, globotriaosyl
ceramide/cholesterol lipid 'rafts' in vitro : A new assay to define factors affecting
glycosphingolipid receptor activity." Glycoconj J 20(1): 33-8.
O'Garra, A., P. L. Vieira, et al. (2004). "IL-10-producing and naturally occurring CD4+ Tregs:
limiting collateral damage." J Clin Invest 114(10): 1372-8.
201
Ohnemus, U., K. Kohrmeyer, et al. (2008). "Regulation of epidermal tight-junctions (TJ) during
infection with exfoliative toxin-negative Staphylococcus strains." J Invest Dermatol
128(4): 906-16.
Ohno, S. and Y. Nishizuka (2002). "Protein kinase C isotypes and their specific functions:
prologue." J Biochem 132(4): 509-11.
Olson, E. N. and A. Nordheim (2010). "Linking actin dynamics and gene transcription to drive
cellular motile functions." Nat Rev Mol Cell Biol 11(5): 353-65.
Pamer, E. G. (2007). "Immune responses to commensal and environmental microbes." Nat
Immunol 8(11): 1173-8.
Panos, G. Z., G. I. Betsi, et al. (2006). "Systematic review: are antibiotics detrimental or
beneficial for the treatment of patients with Escherichia coli O157:H7 infection?"
Aliment Pharmacol Ther 24(5): 731-42.
Parkinson, S. J., J. A. Le Good, et al. (2004). "Identification of PKCzetaII: an endogenous
inhibitor of cell polarity." Embo J 23(1): 77-88.
Passeggio, J. and L. Liscum (2005). "Flux of fatty acids through NPC1 lysosomes." J Biol Chem
280(11): 10333-9.
Patarca, R., R. A. Saavedra, et al. (1993). "Molecular and cellular basis of genetic resistance to
bacterial infection: the role of the early T-lymphocyte activation-1/osteopontin gene."
Crit Rev Immunol 13(3-4): 225-46.
Patterson, M. C., D. Vecchio, et al. (2010). "Long-term miglustat therapy in children with
Niemann-Pick disease type C." J Child Neurol 25(3): 300-5.
Petrilli, V., S. Papin, et al. (2007). "Activation of the NALP3 inflammasome is triggered by low
intracellular potassium concentration." Cell Death Differ 14(9): 1583-9.
Petty, N. K., R. Bulgin, et al. (2010). "The Citrobacter rodentium genome sequence reveals
convergent evolution with human pathogenic Escherichia coli." J Bacteriol 192(2): 525-
38.
Philpott, D. J., D. M. McKay, et al. (1998). "Signal transduction pathways involved in
enterohemorrhagic Escherichia coli-induced alterations in T84 epithelial permeability."
Infect Immun 66(4): 1680-7.
Pike, L. J. (2003). "Lipid rafts: bringing order to chaos." J Lipid Res 44(4): 655-67.
Pike, L. J. (2009). "The challenge of lipid rafts." J Lipid Res 50 Suppl: S323-8.
Pizarro-Cerda, J. and P. Cossart (2006). "Bacterial adhesion and entry into host cells." Cell
124(4): 715-27.
202
Pleiman, C. M., W. M. Hertz, et al. (1994). "Activation of phosphatidylinositol-3' kinase by Src-
family kinase SH3 binding to the p85 subunit." Science 263(5153): 1609-12.
Powrie, F. (2004). "Immune regulation in the intestine: a balancing act between effector and
regulatory T cell responses." Ann N Y Acad Sci 1029: 132-41.
Prince, C. W. and W. T. Butler (1987). "1,25-Dihydroxyvitamin D3 regulates the biosynthesis of
osteopontin, a bone-derived cell attachment protein, in clonal osteoblast-like
osteosarcoma cells." Coll Relat Res 7(4): 305-13.
Procyk, K. J., M. R. Rippo, et al. (1999). "Distinct mechanisms target stress and extracellular
signal-activated kinase 1 and Jun N-terminal kinase during infection of macrophages with
Salmonella." J Immunol 163(9): 4924-30.
Pronio, A., C. Montesani, et al. (2008). "Probiotic administration in patients with ileal pouch-
anal anastomosis for ulcerative colitis is associated with expansion of mucosal regulatory
cells." Inflamm Bowel Dis.
Proulx, F., E. G. Seidman, et al. (2001). "Pathogenesis of Shiga toxin-associated hemolytic
uremic syndrome." Pediatr Res 50(2): 163-71.
Psotka, M. A., F. Obata, et al. (2009). "Shiga toxin 2 targets the murine renal collecting duct
epithelium." Infect Immun 77(3): 959-69.
Qu-Hong and A. M. Dvorak (1997). "Ultrastructural localization of osteopontin
immunoreactivity in phagolysosomes and secretory granules of cells in human intestine."
Histochem J 29(11-12): 801-12.
Raetz, C. R. and C. Whitfield (2002). "Lipopolysaccharide endotoxins." Annu Rev Biochem 71:
635-700.
Raffatellu, M., M. D. George, et al. (2009). "Lipocalin-2 resistance confers an advantage to
Salmonella enterica serotype Typhimurium for growth and survival in the inflamed
intestine." Cell Host Microbe 5(5): 476-86.
Reardon, C., A. Sanchez, et al. (2001). "Tapeworm infection reduces epithelial ion transport
abnormalities in murine dextran sulfate sodium-induced colitis." Infect Immun 69(7):
4417-23.
Ren, C. P., S. A. Beatson, et al. (2005). "The Flag-2 locus, an ancestral gene cluster, is
potentially associated with a novel flagellar system from Escherichia coli." J Bacteriol
187(4): 1430-40.
Rendon, M. A., Z. Saldana, et al. (2007). "Commensal and pathogenic Escherichia coli use a
common pilus adherence factor for epithelial cell colonization." Proc Natl Acad Sci U S
A 104(25): 10637-42.
203
Reyland, M. E., S. M. Anderson, et al. (1999). "Protein kinase C delta is essential for etoposide-
induced apoptosis in salivary gland acinar cells." J Biol Chem 274(27): 19115-23.
Riethmuller, J., A. Riehle, et al. (2006). "Membrane rafts in host-pathogen interactions."
Biochim Biophys Acta 1758(12): 2139-47.
Riff, J. D., J. W. Callahan, et al. (2005). "Cholesterol-enriched membrane microdomains are
required for inducing host cell cytoskeleton rearrangements in response to attaching-
effacing Escherichia coli." Infect Immun 73(11): 7113-25.
Rigot, V., M. Lehmann, et al. (1998). "Integrin ligation and PKC activation are required for
migration of colon carcinoma cells." J Cell Sci 111 ( Pt 20): 3119-27.
Ritchie, J. M., M. J. Brady, et al. (2008). "EspFU, a type III-translocated effector of actin
assembly, fosters epithelial association and late-stage intestinal colonization by E. coli
O157:H7." Cell Microbiol 10(4): 836-47.
Rittling, S. R., H. N. Matsumoto, et al. (1998). "Mice lacking osteopontin show normal
development and bone structure but display altered osteoclast formation in vitro." J Bone
Miner Res 13(7): 1101-11.
Robinson, C. M., J. F. Sinclair, et al. (2006). "Shiga toxin of enterohemorrhagic Escherichia coli
type O157:H7 promotes intestinal colonization." Proc Natl Acad Sci U S A 103(25):
9667-72.
Rodriguez-Viciana, P., P. H. Warne, et al. (1994). "Phosphatidylinositol-3-OH kinase as a direct
target of Ras." Nature 370(6490): 527-32.
Rolfe, V. E., P. J. Fortun, et al. (2006). "Probiotics for maintenance of remission in Crohn's
disease." Cochrane Database Syst Rev(4): CD004826.
Roy, C. R. and E. S. Mocarski (2007). "Pathogen subversion of cell-intrinsic innate immunity."
Nat Immunol 8(11): 1179-87.
Sakwe, A. M., L. Rask, et al. (2005). "Protein kinase C modulates agonist-sensitive release of
Ca2+ from internal stores in HEK293 cells overexpressing the calcium sensing receptor."
J Biol Chem 280(6): 4436-41.
Sanfilippo, C. M., F. N. Chirimuuta, et al. (2004). "Herpes simplex virus type 1 immediate-early
gene expression is required for the induction of apoptosis in human epithelial HEp-2
cells." J Virol 78(1): 224-39.
Santos, R. L., S. Zhang, et al. (2002). "Morphologic and molecular characterization of
Salmonella typhimurium infection in neonatal calves." Vet Pathol 39(2): 200-15.
Sason, H., M. Milgrom, et al. (2009). "Enteropathogenic Escherichia coli subverts
phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate upon
epithelial cell infection." Mol Biol Cell 20(1): 544-55.
204
Sato, T., T. Nakai, et al. (2005). "Osteopontin/Eta-1 upregulated in Crohn's disease regulates the
Th1 immune response." Gut 54(9): 1254-62.
Savkovic, S. D., A. Koutsouris, et al. (2003). "PKC zeta participates in activation of
inflammatory response induced by enteropathogenic E. coli." Am J Physiol Cell Physiol
285(3): C512-21.
Sayre, N. L., V. M. Rimkunas, et al. (2010). "Recovery from liver disease in a Niemann-Pick
type C mouse model." J Lipid Res.
Scatena, M., L. Liaw, et al. (2007). "Osteopontin: a multifunctional molecule regulating chronic
inflammation and vascular disease." Arterioscler Thromb Vasc Biol 27(11): 2302-9.
Schack, L., A. Lange, et al. (2009). "Considerable variation in the concentration of osteopontin
in human milk, bovine milk, and infant formulas." J Dairy Sci 92(11): 5378-85.
Schack, L., R. Stapulionis, et al. (2009). "Osteopontin enhances phagocytosis through a novel
osteopontin receptor, the alphaXbeta2 integrin." J Immunol 182(11): 6943-50.
Schauer, D. B. and S. Falkow (1993). "The eae gene of Citrobacter freundii biotype 4280 is
necessary for colonization in transmissible murine colonic hyperplasia." Infect Immun
61(11): 4654-61.
Schauer, D. B., B. A. Zabel, et al. (1995). "Genetic and biochemical characterization of
Citrobacter rodentium sp. nov." J Clin Microbiol 33(8): 2064-8.
Schechtman, D. and D. Mochly-Rosen (2001). "Adaptor proteins in protein kinase C-mediated
signal transduction." Oncogene 20(44): 6339-47.
Schmidt, D. R., S. R. Holmstrom, et al. (2010). "Regulation of bile acid synthesis by fat-soluble
vitamins A and D." J Biol Chem 285(19): 14486-94.
Schonichen, A. and M. Geyer (2010). "Fifteen formins for an actin filament: a molecular view on
the regulation of human formins." Biochim Biophys Acta 1803(2): 152-63.
Schraw, W., Y. Li, et al. (2002). "Association of Helicobacter pylori vacuolating toxin (VacA)
with lipid rafts." J Biol Chem 277(37): 34642-50.
Schuller, S., G. Frankel, et al. (2004). "Interaction of Shiga toxin from Escherichia coli with
human intestinal epithelial cell lines and explants: Stx2 induces epithelial damage in
organ culture." Cell Microbiol 6(3): 289-301.
Schultz, M., C. Veltkamp, et al. (2002). "Lactobacillus plantarum 299V in the treatment and
prevention of spontaneous colitis in interleukin-10-deficient mice." Inflamm Bowel Dis
8(2): 71-80.
Serhan, C. N., S. D. Brain, et al. (2007). "Resolution of inflammation: state of the art, definitions
and terms." FASEB J 21(2): 325-32.
205
Shames, S. R., S. D. Auweter, et al. (2009). "Co-evolution and exploitation of host cell signaling
pathways by bacterial pathogens." Int J Biochem Cell Biol 41(2): 380-9.
Shaner, N. C., J. W. Sanger, et al. (2005). "Actin and alpha-actinin dynamics in the adhesion and
motility of EPEC and EHEC on host cells." Cell Motil Cytoskeleton 60(2): 104-20.
Shen-Tu, G., D. B. Schauer, et al. (2010). "Detergent-resistant microdomains mediate activation
of host cell signaling in response to attaching-effacing bacteria." Lab Invest 90(2): 266-
81.
Shen, L., E. D. Black, et al. (2006). "Myosin light chain phosphorylation regulates barrier
function by remodeling tight junction structure." J Cell Sci 119(Pt 10): 2095-106.
Shen, L., L. Su, et al. (2009). "Mechanisms and functional implications of intestinal barrier
defects." Dig Dis 27(4): 443-9.
Shen, L., C. R. Weber, et al. (2008). "The tight junction protein complex undergoes rapid and
continuous molecular remodeling at steady state." J Cell Biol 181(4): 683-95.
Shen, S., M. Mascarenhas, et al. (2004). "Evidence for a hybrid genomic island in verocytotoxin-
producing Escherichia coli CL3 (serotype O113:H21) containing segments of EDL933
(serotype O157:H7) O islands 122 and 48." Infect Immun 72(3): 1496-503.
Sherman, P. M., K. C. Johnson-Henry, et al. (2005). "Probiotics reduce enterohemorrhagic
Escherichia coli O157:H7- and enteropathogenic E. coli O127:H6-induced changes in
polarized T84 epithelial cell monolayers by reducing bacterial adhesion and cytoskeletal
rearrangements." Infect Immun 73(8): 5183-8.
Sherman, P. M., J. C. Ossa, et al. (2009). "Unraveling mechanisms of action of probiotics." Nutr
Clin Pract 24(1): 10-4.
Shifflett, D. E., D. R. Clayburgh, et al. (2005). "Enteropathogenic E. coli disrupts tight junction
barrier function and structure in vivo." Lab Invest 85(10): 1308-24.
Shinohara, M. L., M. Jansson, et al. (2005). "T-bet-dependent expression of osteopontin
contributes to T cell polarization." Proc Natl Acad Sci U S A 102(47): 17101-6.
Shirai, Y. and N. Saito (2002). "Activation mechanisms of protein kinase C: maturation, catalytic
activation, and targeting." J Biochem 132(5): 663-8.
Simons, K. and D. Toomre (2000). "Lipid rafts and signal transduction." Nat Rev Mol Cell Biol
1(1): 31-9.
Sinclair, J. F. and A. D. O'Brien (2004). "Intimin types alpha, beta, and gamma bind to nucleolin
with equivalent affinity but lower avidity than to the translocated intimin receptor." J Biol
Chem 279(32): 33751-8.
206
Skinn, A. C., N. Vergnolle, et al. (2006). "Citrobacter rodentium infection causes iNOS-
independent intestinal epithelial dysfunction in mice." Can J Physiol Pharmacol 84(12):
1301-12.
Sleat, D. E., J. A. Wiseman, et al. (2004). "Genetic evidence for nonredundant functional
cooperativity between NPC1 and NPC2 in lipid transport." Proc Natl Acad Sci U S A
101(16): 5886-91.
Slutsker, L., A. A. Ries, et al. (1997). "Escherichia coli O157:H7 diarrhea in the United States:
clinical and epidemiologic features." Ann Intern Med 126(7): 505-13.
Snoeck, V., B. Goddeeris, et al. (2005). "The role of enterocytes in the intestinal barrier function
and antigen uptake." Microbes Infect 7(7-8): 997-1004.
Sodek, J., A. P. Batista Da Silva, et al. (2006). "Osteopontin and mucosal protection." J Dent Res
85(5): 404-15.
Soltyk, A. M., C. R. MacKenzie, et al. (2002). "A mutational analysis of the
globotriaosylceramide-binding sites of verotoxin VT1." J Biol Chem 277(7): 5351-9.
Song, K. S., S. Li, et al. (1996). "Co-purification and direct interaction of Ras with caveolin, an
integral membrane protein of caveolae microdomains. Detergent-free purification of
caveolae microdomains." J Biol Chem 271(16): 9690-7.
Sorensen, E. S. and T. E. Petersen (1993). "Purification and characterization of three proteins
isolated from the proteose peptone fraction of bovine milk." J Dairy Res 60(2): 189-97.
Spahn, T. W., M. Ross, et al. (2008). "CD4+ T cells transfer resistance against Citrobacter
rodentium-induced infectious colitis by induction of Th 1 immunity." Scand J Immunol
67(3): 238-44.
Spears, K. J., A. J. Roe, et al. (2006). "A comparison of enteropathogenic and
enterohaemorrhagic Escherichia coli pathogenesis." FEMS Microbiol Lett 255(2): 187-
202.
Stadnyk, A. W., C. D. Dollard, et al. (2000). "Neutrophil migration stimulates rat intestinal
epithelial cell cytokine expression during helminth infection." J Leukoc Biol 68(6): 821-
7.
Stahl, A. L., M. Svensson, et al. (2006). "Lipopolysaccharide from enterohemorrhagic
Escherichia coli binds to platelets through TLR4 and CD62 and is detected on circulating
platelets in patients with hemolytic uremic syndrome." Blood 108(1): 167-76.
Stecher, B., M. Barthel, et al. (2008). "Motility allows S. Typhimurium to benefit from the
mucosal defence." Cell Microbiol 10(5): 1166-80.
Stecher, B., R. Robbiani, et al. (2007). "Salmonella enterica serovar typhimurium exploits
inflammation to compete with the intestinal microbiota." PLoS Biol 5(10): 2177-89.
207
Steinberg, S. F. (2004). "Distinctive activation mechanisms and functions for protein kinase
Cdelta." Biochem J 384(Pt 3): 449-59.
Stender, S., A. Friebel, et al. (2000). "Identification of SopE2 from Salmonella typhimurium, a
conserved guanine nucleotide exchange factor for Cdc42 of the host cell." Mol Microbiol
36(6): 1206-21.
Strauss, K., C. Goebel, et al. (2010). "Exosome secretion ameliorates lysosomal storage of
cholesterol in Niemann-Pick type C disease." J Biol Chem.
Sturley, S. L., M. C. Patterson, et al. (2004). "The pathophysiology and mechanisms of NP-C
disease." Biochim Biophys Acta 1685(1-3): 83-7.
Sugimoto, Y., H. Ninomiya, et al. (2001). "Accumulation of cholera toxin and GM1 ganglioside
in the early endosome of Niemann-Pick C1-deficient cells." Proc Natl Acad Sci U S A
98(22): 12391-6.
Suh, J. K., C. J. Hovde, et al. (1998). "Shiga toxin attacks bacterial ribosomes as effectively as
eucaryotic ribosomes." Biochemistry 37(26): 9394-8.
Szabo, G., A. Dolganiuc, et al. (2007). "TLR4, ethanol, and lipid rafts: a new mechanism of
ethanol action with implications for other receptor-mediated effects." J Immunol 178(3):
1243-9.
Takenouchi, H., N. Kiyokawa, et al. (2004). "Shiga toxin binding to globotriaosyl ceramide
induces intracellular signals that mediate cytoskeleton remodeling in human renal
carcinoma-derived cells." J Cell Sci 117(Pt 17): 3911-22.
Tan, S., L. S. Tompkins, et al. (2009). "Helicobacter pylori usurps cell polarity to turn the cell
surface into a replicative niche." PLoS Pathog 5(5): e1000407.
Tang, C. H., D. Y. Lu, et al. (2007). "Leptin-induced IL-6 production is mediated by leptin
receptor, insulin receptor substrate-1, phosphatidylinositol 3-kinase, Akt, NF-kappaB,
and p300 pathway in microglia." J Immunol 179(2): 1292-302.
Tarr, P. I. (1995). "Escherichia coli O157:H7: clinical, diagnostic, and epidemiological aspects
of human infection." Clin Infect Dis 20(1): 1-8; quiz 9-10.
Tarr, P. I., C. A. Gordon, et al. (2005). "Shiga-toxin-producing Escherichia coli and haemolytic
uraemic syndrome." Lancet 365(9464): 1073-86.
Tauschek, M., J. Yang, et al. (2010). "Transcriptional analysis of the grlRA virulence operon
from Citrobacter rodentium." J Bacteriol.
Thodeti, C. K., R. Albrechtsen, et al. (2003). "ADAM12/syndecan-4 signaling promotes beta 1
integrin-dependent cell spreading through protein kinase Calpha and RhoA." J Biol Chem
278(11): 9576-84.
208
Tlaskalova-Hogenova, H., R. Stepankova, et al. (2004). "Commensal bacteria (normal
microflora), mucosal immunity and chronic inflammatory and autoimmune diseases."
Immunol Lett 93(2-3): 97-108.
Tobe, T., S. A. Beatson, et al. (2006). "An extensive repertoire of type III secretion effectors in
Escherichia coli O157 and the role of lambdoid phages in their dissemination." Proc Natl
Acad Sci U S A 103(40): 14941-6.
Tobe, T. and C. Sasakawa (2002). "Species-specific cell adhesion of enteropathogenic
Escherichia coli is mediated by type IV bundle-forming pili." Cell Microbiol 4(1): 29-42.
Toker, A. and L. C. Cantley (1997). "Signalling through the lipid products of phosphoinositide-
3-OH kinase." Nature 387(6634): 673-6.
Tomson, F. L., A. Koutsouris, et al. (2004). "Differing roles of protein kinase C-zeta in
disruption of tight junction barrier by enteropathogenic and enterohemorrhagic
Escherichia coli." Gastroenterology 127(3): 859-69.
Turnbaugh, P. J., R. E. Ley, et al. (2007). "The human microbiome project." Nature 449(7164):
804-10.
Turner, J. R. (2009). "Intestinal mucosal barrier function in health and disease." Nat Rev
Immunol 9(11): 799-809.
Turner, J. R., B. K. Rill, et al. (1997). "Physiological regulation of epithelial tight junctions is
associated with myosin light-chain phosphorylation." Am J Physiol 273(4 Pt 1): C1378-
85.
Ulici, V., K. D. Hoenselaar, et al. (2008). "The PI3K pathway regulates endochondral bone
growth through control of hypertrophic chondrocyte differentiation." BMC Dev Biol 8:
40.
Umar, S., J. H. Sellin, et al. (2000). "Increased nuclear translocation of catalytically active PKC-
zeta during mouse colonocyte hyperproliferation." Am J Physiol Gastrointest Liver
Physiol 279(1): G223-37.
Utech, M., A. I. Ivanov, et al. (2005). "Mechanism of IFN-gamma-induced endocytosis of tight
junction proteins: myosin II-dependent vacuolarization of the apical plasma membrane."
Mol Biol Cell 16(10): 5040-52.
Vaishnava, S., C. L. Behrendt, et al. (2008). "Paneth cells directly sense gut commensals and
maintain homeostasis at the intestinal host-microbial interface." Proc Natl Acad Sci U S
A 105(52): 20858-63.
Vallance, B. A., W. Deng, et al. (2003). "Host susceptibility to the attaching and effacing
bacterial pathogen Citrobacter rodentium." Infect Immun 71(6): 3443-53.
209
van der Goot, F. G. and T. Harder (2001). "Raft membrane domains: from a liquid-ordered
membrane phase to a site of pathogen attack." Semin Immunol 13(2): 89-97.
van der Goot, F. G., G. Tran van Nhieu, et al. (2004). "Rafts can trigger contact-mediated
secretion of bacterial effectors via a lipid-based mechanism." J Biol Chem 279(46):
47792-8.
van der Meer-Janssen, Y. P., J. van Galen, et al. (2010). "Lipids in host-pathogen interactions:
pathogens exploit the complexity of the host cell lipidome." Prog Lipid Res 49(1): 1-26.
Van der Sluis, M., B. A. De Koning, et al. (2006). "Muc2-deficient mice spontaneously develop
colitis, indicating that MUC2 is critical for colonic protection." Gastroenterology 131(1):
117-29.
van Mourik, A., L. Steeghs, et al. (2010). "Altered linkage of hydroxyacyl chains in lipid A of
Campylobacter jejuni reduces TLR4 activation and antimicrobial resistance." J Biol
Chem 285(21): 15828-36.
Vanhaesebroeck, B., J. Guillermet-Guibert, et al. (2010). "The emerging mechanisms of isoform-
specific PI3K signalling." Nat Rev Mol Cell Biol 11(5): 329-41.
Vanhaesebroeck, B., S. J. Leevers, et al. (1997). "Phosphoinositide 3-kinases: a conserved family
of signal transducers." Trends Biochem Sci 22(7): 267-72.
Vanier, M. T. (1999). "Lipid changes in Niemann-Pick disease type C brain: personal experience
and review of the literature." Neurochem Res 24(4): 481-9.
Vanier, M. T. (2010). "Niemann-Pick disease type C." Orphanet J Rare Dis 5(1): 16.
Varma, J. K., K. D. Greene, et al. (2003). "An outbreak of Escherichia coli O157 infection
following exposure to a contaminated building." JAMA 290(20): 2709-12.
Venkatasubramanian, J., M. Ao, et al. (2010). "Ion transport in the small intestine." Curr Opin
Gastroenterol 26(2): 123-8.
Vingadassalom, D., A. Kazlauskas, et al. (2009). "Insulin receptor tyrosine kinase substrate links
the E. coli O157:H7 actin assembly effectors Tir and EspF(U) during pedestal
formation." Proc Natl Acad Sci U S A 106(16): 6754-9.
Viswanathan, V. K., S. Lukic, et al. (2004). "Cytokeratin 18 interacts with the enteropathogenic
Escherichia coli secreted protein F (EspF) and is redistributed after infection." Cell
Microbiol 6(10): 987-97.
Wadolkowski, E. A., J. A. Burris, et al. (1990). "Mouse model for colonization and disease
caused by enterohemorrhagic Escherichia coli O157:H7." Infect Immun 58(8): 2438-45.
210
Wakasaki, H., D. Koya, et al. (1997). "Targeted overexpression of protein kinase C beta2
isoform in myocardium causes cardiomyopathy." Proc Natl Acad Sci U S A 94(17):
9320-5.
Walker, E. H., O. Perisic, et al. (1999). "Structural insights into phosphoinositide 3-kinase
catalysis and signalling." Nature 402(6759): 313-20.
Walkley, S. U. and K. Suzuki (2004). "Consequences of NPC1 and NPC2 loss of function in
mammalian neurons." Biochim Biophys Acta 1685(1-3): 48-62.
Wang, K. X., Y. Shi, et al. (2007). "Osteopontin regulates hindlimb-unloading-induced lymphoid
organ atrophy and weight loss by modulating corticosteroid production." Proc Natl Acad
Sci 104(37): 14777-82.
Watarai, M., S. Makino, et al. (2002). "Macrophage plasma membrane cholesterol contributes to
Brucella abortus infection of mice." Infect Immun 70(9): 4818-25.
Weber, G. F. (2002). "Meeting report: the next interleukin?" Sci STKE 2002(147): pe37.
Welinder-Olsson, C. and B. Kaijser (2005). "Enterohemorrhagic Escherichia coli (EHEC)."
Scand J Infect Dis 37(6-7): 405-16.
Wiles, S., S. Clare, et al. (2004). "Organ specificity, colonization and clearance dynamics in vivo
following oral challenges with the murine pathogen Citrobacter rodentium." Cell
Microbiol 6(10): 963-72.
Wiles, T. J., B. K. Dhakal, et al. (2008). "Inactivation of host Akt/protein kinase B signaling by
bacterial pore-forming toxins." Mol Biol Cell 19(4): 1427-38.
Williams, A. P., K. A. McGregor, et al. (2008). "Persistence and metabolic activity of
Escherichia coli O157:H7 in farm animal faeces." FEMS Microbiol Lett 287(2): 168-73.
Winter, S. E., A. M. Keestra, et al. (2010). "The blessings and curses of intestinal inflammation."
Cell Host Microbe 8(1): 36-43.
Wirtz, S., C. Neufert, et al. (2007). "Chemically induced mouse models of intestinal
inflammation." Nat Protoc 2(3): 541-6.
Wong, C. S., S. Jelacic, et al. (2000). "The risk of the hemolytic-uremic syndrome after antibiotic
treatment of Escherichia coli O157:H7 infections." N Engl J Med 342(26): 1930-6.
Wymann, M. P. and L. Pirola (1998). "Structure and function of phosphoinositide 3-kinases."
Biochim Biophys Acta 1436(1-2): 127-50.
Xavier, R. J. and D. K. Podolsky (2007). "Unravelling the pathogenesis of inflammatory bowel
disease." Nature 448(7152): 427-34.
211
Xie, Z., M. Singh, et al. (2003). "Osteopontin inhibits interleukin-1beta-stimulated increases in
matrix metalloproteinase activity in adult rat cardiac fibroblasts: role of protein kinase C-
zeta." J Biol Chem 278(49): 48546-52.
Xin, M., F. Gao, et al. (2007). "Protein kinase Czeta abrogates the proapoptotic function of Bax
through phosphorylation." J Biol Chem 282(29): 21268-77.
Xu, G., H. Nie, et al. (2005). "Role of osteopontin in amplification and perpetuation of
rheumatoid synovitis." J Clin Invest 115(4): 1060-7.
Xu, X., R. Bittman, et al. (2001). "Effect of the structure of natural sterols and sphingolipids on
the formation of ordered sphingolipid/sterol domains (rafts). Comparison of cholesterol
to plant, fungal, and disease-associated sterols and comparison of sphingomyelin,
cerebrosides, and ceramide." J Biol Chem 276(36): 33540-6.
Yang, C. S., J. S. Lee, et al. (2007). "Protein kinase C zeta plays an essential role for
Mycobacterium tuberculosis-induced extracellular signal-regulated kinase 1/2 activation
in monocytes/macrophages via Toll-like receptor 2." Cell Microbiol 9(2): 382-96.
Yang, Z., J. Kim, et al. (2009). "Genomic instability in regions adjacent to a highly conserved
pch prophage in Escherichia coli O157:H7 generates diversity in expression patterns of
the LEE pathogenicity island." J Bacteriol 191(11): 3553-68.
Yuhan, R., A. Koutsouris, et al. (1997). "Enteropathogenic Escherichia coli-induced myosin
light chain phosphorylation alters intestinal epithelial permeability." Gastroenterology
113(6): 1873-82.
Yumoto, K., M. Ishijima, et al. (2002). "Osteopontin deficiency protects joints against
destruction in anti-type II collagen antibody-induced arthritis in mice." Proc Natl Acad
Sci U S A 99(7): 4556-61.
Zaas, D. W., M. Duncan, et al. (2005). "The role of lipid rafts in the pathogenesis of bacterial
infections." Biochim Biophys Acta 1746(3): 305-13.
Zeidan, A., B. Paylor, et al. (2007). "Actin cytoskeleton dynamics promotes leptin-induced
vascular smooth muscle hypertrophy via RhoA/ROCK- and phosphatidylinositol 3-
kinase/protein kinase B-dependent pathways." J Pharmacol Exp Ther 322(3): 1110-6.
Zhong, J., E. R. Eckhardt, et al. (2006). "Osteopontin deficiency protects mice from Dextran
sodium sulfate-induced colitis." Inflamm Bowel Dis 12(8): 790-6.
Zhu, B., K. Suzuki, et al. (2004). "Osteopontin modulates CD44-dependent chemotaxis of
peritoneal macrophages through G-protein-coupled receptors: evidence of a role for an
intracellular form of osteopontin." J Cell Physiol 198(1): 155-67.
Zobiack, N., U. Rescher, et al. (2002). "Cell-surface attachment of pedestal-forming
enteropathogenic E. coli induces a clustering of raft components and a recruitment of
annexin 2." J Cell Sci 115(Pt 1): 91-8.
212
Zohar, R., B. Zhu, et al. (2004). "Increased cell death in osteopontin-deficient cardiac fibroblasts
occurs by a caspase-3-independent pathway." Am J Physiol Heart Circ Physiol 287(4):
H1730-9.
Zolotarevsky, Y., G. Hecht, et al. (2002). "A membrane-permeant peptide that inhibits MLC
kinase restores barrier function in in vitro models of intestinal disease." Gastroenterology
123(1): 163-72.
Zyrek, A. A., C. Cichon, et al. (2007). "Molecular mechanisms underlying the probiotic effects
of Escherichia coli Nissle 1917 involve ZO-2 and PKCzeta redistribution resulting in
tight junction and epithelial barrier repair." Cell Microbiol 9(3): 804-16.