role for the chlamydial type iii secretion apparatus …mouse macrophages and in vitro infections....

INFECTION AND IMMUNITY, Jan. 2009, p. 76–84 Vol. 77, No. 10019-9567/09/$08.00�0 doi:10.1128/IAI.00963-08Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Role for the Chlamydial Type III Secretion Apparatus in HostCytokine Expression�

Daniel Prantner1 and Uma M. Nagarajan1,2*Department of Microbiology and Immunology, University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205,1 and

Division of Pediatric Infectious Diseases, Arkansas Children’s Hospital Research Institute, Little Rock, Arkansas 722022

Received 31 July 2008/Returned for modification 31 August 2008/Accepted 8 October 2008

In many important human pathogens, such as Shigella and Salmonella spp., the bacterial type III secretion(T3S) apparatus is required to initiate inflammation via activation of caspase-1- or NF-�B-dependent genes.Using an ex vivo infection model, the goal of the present study was to determine whether the chlamydial T3Sapparatus also modulates the host inflammatory response. Infections of mouse peritoneal macrophages wereperformed with Chlamydia muridarum, and the expression of inflammatory cytokines was monitored byquantitative reverse transcription-PCR and enzyme-linked immunosorbent assay. Since there is no currentgenetic system for Chlamydia spp., blockade of T3S was accomplished pharmacologically using a T3S inhibitorcalled INP0007. It has been previously shown that INP0007 also blocks chlamydial growth in vitro and that theaddition of exogenous iron completely reverses this deficit. The addition of iron to INP0007-treated C.muridarum-infected macrophages not only restored chlamydial growth deficit caused by INP0007 but also ledto a multi-inclusion phenotype. Overall, T3S inhibition led to decreased interleukin-6 (IL-6), IL-1�, andCXCL10, whereas the tumor necrosis factor alpha levels were unchanged. Rescue of chlamydial growth byaddition of iron sulfate did not restore cytokine production, implying that the decreased expression of manycytokines during infection was dependent on T3S and not solely on growth. In addition, the observation thatthe greatest effects of INP0007 were seen at late time points during infection suggests that a temporallyregulated T3S effector protein(s) may be triggering the host cytokine response.

Chlamydia trachomatis is an important human pathogencausing over 90 million new cases of infection per year world-wide, inducing pathology at multiple anatomical sites. Ocularserovars can cause trachoma (reviewed in reference 48), theworld’s leading cause of preventable blindness, while genitaltract infections in women can lead to ectopic pregnancy, pelvicinflammatory disease, and infertility secondary to scarring ofthe fallopian tubes (23). Studying the host inflammation cen-tral to these outcomes has become an intense focus of inves-tigation. The mouse pathogen C. muridarum has been fullysequenced, and its genome shows high conservation with C.trachomatis in both sequence and gene order (35), making C.muridarum an invaluable tool for translational studies in themouse model. In particular, it was shown that genital infectionof female Toll-like receptor 2 (TLR2) knockout (KO) miceresult in decreased production of the proinflammatory cyto-kine tumor necrosis factor alpha (TNF-�) and the neutrophilchemokine, macrophage-inflammatory protein-2 (Mip-2) com-pared to wild-type controls. Significantly, the TLR2 KO micealso had decreased oviduct pathology (8). In addition,caspase-1 KO mice, which are defective in their ability toprocess the proinflammatory cytokines interleukin-1� (IL-1�)and IL-18 (4, 14), also exhibit less oviduct pathology duringa primary infection with C. muridarum (6). Similarly, block-ing IL-1 signaling with a receptor antagonist prevented thetissue destruction of human fallopian tube organ cultures

infected with C. trachomatis (19), strengthening the associ-ation between overactive host inflammation and pathology.However, the chlamydial factors influencing inflammation areless understood.

Chlamydia spp. possess a biphasic life cycle lasting approx-imately 24 to 32 h, replicating inside a plasma membrane-derived vacuole termed the inclusion. The bacteria avoid lyso-somal degradation by modifying their inclusion, enablingescape into the host exocytic pathway (38). It is hypothesizedthat the chlamydial type III secretion (T3S) apparatus plays acentral role in this process. The T3S apparatus is a large mul-tiprotein syringelike structure that facilitates targeted secretionof bacterial effector proteins directly into the host cytosol (12).This apparatus is highly conserved among different bacteriaand is common to at least 15 gram-negative human pathogens.There are many examples in the literature addressing the in-volvement of T3S in inflammation, including studies with Sal-monella spp. (25), Yersinia spp. (40), Shigella spp. (47), Pseudo-monas spp. (11, 13, 26, 46), and Burkholderia spp. (44), whichhave shown that a functional T3S apparatus was required forcaspase-1 activation and/or IL-1� secretion. In addition, usinga broader microarray approach, a large proportion of NF-�B-dependent cytokines such as IL-6, Mip-2, and monocyte che-moattractant protein 1 were significantly upregulated in mac-rophages infected with wild-type Edwardsiella tarda comparedto infections utilizing a T3S-deficient mutant (31). Transcrip-tional analyses of transformed HeLa cervical epithelial cells(34, 52) and the human monocytic cell line THP-1 (36) havedemonstrated that inflammatory cytokines such as IL-6 andproIL-1� also get upregulated after infection with C. tracho-matis, but the T3S dependence has not yet been examined.Together, these studies highlight the rationale for determining

* Corresponding author. Mailing address: Division of Pediatric In-fectious Diseases, Arkansas Children’s Hospital Research Institute,1120 Marshall Street, Rm. 2052, Little Rock, AR 72202. Phone: (501)364-2479. Fax: (501) 364-2403. E-mail: [email protected].

� Published ahead of print on 13 October 2008.

76

on April 21, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

whether the chlamydial T3S apparatus modulates the hostinflammatory response.

Currently, there is no system for genetic manipulation ofChlamydia spp., and no known T3S mutant has been isolatedthrough other means. However, the speculation that T3S an-tagonists could be used as next-generation antibiotics, so-called “virulence blockers” (21), led to mass screening using ahigh-throughput reporter system searching for small organiccompounds that inhibit T3S in Yersinia pseudotuberculosis (20).One specific agent called either compound 1 or INP0007 wasidentified and subsequently shown to inhibit secretion of T3Seffectors in both Yersinia spp. (29) and Salmonella spp. (18).INP0007 and other structurally related salicylidene acylhydra-zide compounds were also tested for efficacy against Chlamydiaspp. and were shown to inhibit growth and development ofboth C. trachomatis and C. pneumoniae in vitro (2, 27, 41, 51),highlighting the potential necessity of chlamydial T3S for in-tracellular survival. However, this growth restriction can beovercome by the addition of exogenous iron (41), leading tospeculation that T3S effectors may also play a crucial role iniron acquisition in vivo (21). Based on the involvement of T3Sin the inflammatory response for other pathogenic bacteria, itis predicted that optimal host cytokine production during chla-mydial infection will require functional T3S. The goal of thepresent study was to examine how T3S blockade effects theinduction of inflammatory cytokine responses during in vitroC. muridarum infections.

MATERIALS AND METHODS

Chlamydial stocks and cell lines. C. muridarum Nigg strain was propagated inMycoplasma-free McCoy cells grown in Dulbecco modified Eagle medium sup-plemented with 100 �M nonessential amino acids (Invitrogen), 2 mM L-glu-tamine (Invitrogen), 10% fetal bovine serum, 50 mg of gentamicin sulfate/ml,and 0.5 mg of cycloheximide/ml. Infectious elementary bodies were isolated fromMcCoy cells by sonication, washed in phosphate-buffered saline, resuspended inSPG buffer (250 mM sucrose, 10 mM sodium phosphate, 5 mM L-glutamic acid[pH 7.2]), and stored at �80°C.

Chemicals. The T3S inhibitor N�-(3,5-dibromo-2-hydroxybenzylidene)-4-ni-trobenzohydrazide or INP0007 (also known as compound 1) (51) was purchasedfrom ChemBridge corporation and dissolved in dimethyl sulfoxide (Sigma) at 10mM, divided into aliquots, and stored at �20°C until use. The antibiotic chlor-amphenicol was dissolved in ethanol at 10 mg/ml and stored at �20°C, whereasrifampin (Fisher) was dissolved in dimethyl sulfoxide at 35 mg/ml and stored at4°C. Iron sulfate was dissolved in Millipore water at 10 mM and stored at 4°C.The TLR3 ligand poly(I-C) (InvivoGen) was reconstituted according to manu-facturer’s instructions and frozen in aliquots at �20°C at a concentration of 2.5mg/ml.

Mouse macrophages and in vitro infections. Ten- to twelve-week-old femaleC57BL/6J mice (Jackson Laboratories) were injected in the peritoneum with 1ml of 3% thioglycolate. Three days later, the peritoneal cavities were rinsed threetimes with 3 ml of complete medium (RPMI medium supplemented with 10%fetal bovine serum, 100 mM HEPES, 1 mM sodium pyruvate, 2 mM L-glutamine,100 �M nonessential amino acids, 100 U of penicillin/ml, 100 �g of streptomycin/ml, 50 mM �-mercaptoethanol) to isolate macrophages. Cells were washed,resuspended in complete medium, and plated at 106 cells per well in 24-welltissue culture dishes (BD Falcon, San Jose, CA) in an incubator set to 37°C and5% CO2. The medium was aspirated 2 h after plating and replaced with freshmedium to remove nonadherent cells. All infections were performed in antibi-otic-free complete media on cells that were allowed to rest in culture for at least48 h after isolation from the mouse. Immediately prior to infection, the T3Sinhibitor and iron sulfate were added to the appropriate wells. C. muridarum wasintroduced at a multiplicity of infection of 1 unless otherwise noted, and the cellswere centrifuged at 1,690 � g at 37°C for 1 h. Next, the medium was aspirated,and respective wells received fresh medium containing FeSO4, INP0007, or bothFeSO4 and INP0007. At the indicated time points, supernatants were collectedand stored at �80°C until further analysis. To confirm that cells were infected,

macrophages infected in parallel, in wells containing glass coverslips, were fixedwith methanol for 30 min at room temperature at 24 h postinfection and thenstained with the fluorescein isothiocyanate-conjugated antichlamydial monoclo-nal antibody (Pathfinder; Bio-Rad, Hercules, CA) or processed for enumerationof inclusion-forming units (IFU) on a fresh McCoy monolayer as describedearlier (3).

RNA extraction and real-time PCR analysis. After removal of the superna-tants, RNA was isolated from the macrophage monolayer by using the RNeasykit from Qiagen. Approximately 1 mg from each RNA sample was DNase I(Promega) treated (30 min, 37°C; 10 min 70°C). Afterward, 200 ng of RNA wasreverse transcribed with SuperScript III (Invitrogen) enzyme according to themanufacturer’s instructions, using random hexamer and oligo(dT) for priming.Quantitative PCR was performed on samples by using an IQ-Sybr mix (Bio-Rad)and an iQ5 iCycler (Bio-Rad). The amount of cDNA present was determined foreach gene with standard curves and normalized to the housekeeping gene �-actinfor analysis. All primers were designed by using Beacon Design software (Bio-Rad) and are listed in Table 1.

Cytokine analysis. The protein levels of beta interferon (IFN-�), CXCL10,IL-6, TNF-�, and IL-1� in 50 �l of culture supernatants (1/20 of the totalvolume) were determined by using enzyme-linked immunosorbent assay(ELISA) kits (R&D Systems) performed according to the manufacturer’s sup-plied protocols. The optical densities at 450 nm were measured by using a Biotekplate reader. For analysis of intracellular IL-1�, cells were detached from theplate in phosphate-buffered saline and lysed by three cycles of freezing andthawing. The lysates were then sonicated, and 50 �l (1/10 of the total lysate) wasassayed for IL-1�.

IFU determination and fluorescence microscopy. For IFU determination,macrophage monolayers were harvested in 1 ml of SPG buffer at 24 h postin-fection. The cell suspensions were then sonicated for 30 s and serially dilutedfrom 102 to 106 before being used to infect fresh McCoy monolayers in 96-wellblack plates. Inclusions were visualized with a mouse monoclonal antibody (EVIH1) recognizing chlamydial lipopolysaccharide (LPS) (7), followed by AlexaFluor 488-conjugated anti-mouse immunoglobulin G (Southern Biotechnology)in 0.1% Evans blue solution. Inclusions were counted by using an Olympusfluorescence microscope to calculate the IFU/ml of each sample. For fluores-cence microscopic images of chlamydial infected cells, cells on coverslips werestained, mounted on slides, and visualized on a Zeiss Axioskop2 microscopeusing the �40 objective and photographed with the AxioCam MRm camera.14-3-3beta recruitment to the inclusion membrane was visualized by staininginfected and treated cells with a TRITC (tetramethyl rhodamine isothiocyanate)-labeled anti-14-3-3beta antibody (C-20; Santa Cruz Biotechnology) at a 1:50dilution.

Statistical analysis. Three or four independent experiments were performed.For multi-inclusion counting, five fields on a �40 objective image from eachgroup were tabulated. Statistically significant differences (P 0.05) were deter-mined by using a two-tailed Student t test. For experiments with more than twotreatment groups, a one-way analysis of variance (ANOVA) with pairwise mul-tiple comparison (Holm-Sidak method) was performed. One-way ANOVA wasperformed either on the raw data obtained or after calculating the percentinhibition in expression after various treatments compared to the untreatedgroup from three or four independent experiments by using SigmaStat (SystatSoftware, Inc.).

TABLE 1. Genes and corresponding primer sequences

GenePrimer sequence (5�–3�)

Sense Antisense

�-Actin GGCTATGCTCTCCCTCACG

CGCTCGGTCAGGATCTTCAT

IFN-� ATGAACTCCACCAGCAGACAG

ACCACCATCCAGGCGTAGC

CXCL10 CCAGCCGTGGTCACATCAG

ACCTCCACATAGCTTACAGTACAG

TNF-� ACAAGGCTGCCCCGACTAC

TGGAAGACTCCTCCCAGGTATATG

IL-6 CCCAATTTCCAATGCTCTCC

TCCACAAACTGATATGCTTAGG

IL-1� ACAGCAGCACATCAACAAGAG

CCAGCAGGTTATCATCATCATCC

VOL. 77, 2009 CHLAMYDIAL T3S IN HOST CYTOKINE EXPRESSION 77


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

RESULTS

Inhibition of C. muridarum growth by the T3S inhibitorINP0007 is reversed by the addition of exogenous iron. Todetermine whether the chlamydial T3S apparatus plays a rolein cytokine generation, C. muridarum that effectively grows inmouse macrophages and induces a strong cytokine responsewas used as a model system (28). The T3S antagonist INP0007that has been previously shown to target T3S in multiple bac-teria, including C. trachomatis (27, 51), was used as a T3Sinhibitor. Macrophages infected with C. muridarum in thepresence of INP0007 did not yield any infectious chlamydiae(Fig. 1A) or form detectable inclusions (Fig. 1B). Importantly,the inability to obtain infectious chlamydiae and form inclu-sions could be completely reversed by addition of 50 �MFeSO4 (Fig. 1A and B). Both of these results are consistentwith previously reported findings using C. trachomatis (27, 41,51). Interestingly, the addition of FeSO4 to INP0007-treated

macrophages resulted in a multi-inclusion phenotype (Fig. 1B)with significantly more cells possessing two inclusions (P 0.016) and three or more inclusions (P 0.023) compared tountreated cells (Fig. 1C), illustrating a phenotypic effect ex-erted by INP0007 even after growth inhibition was reversed.

Expression of NF-�B-regulated proinflammatory cytokinesTNF-� and IL-6 are differentially affected by the T3S inhibitorINP0007. The ability of FeSO4 to restore chlamydial growth inthe presence of INP0007 was used as a means to distinguishcytokine responses that were T3S dependent but independentof chlamydial growth. Because both NF-�B activation and ex-pression of a large proportion of NF-�B-dependent cytokinessuch as IL-6, Mip-2, IL-8, and monocyte chemoattractant pro-tein 1 have been shown to be dependent upon T3S in otherbacterial models (16, 31), the effect of T3S inhibition on theexpression of NF-�B-dependent cytokines IL-6 and TNF-�was examined first. IL-6 and TNF-� are highly expressed dur-

FIG. 1. Growth of C. muridarum during T3S inhibition. (A) One million mouse macrophages were infected with C. muridarum and treated with50 �M INP0007 and 50 �M FeSO4 where indicated. Cell suspensions were collected at 24 h postinfection and assayed for IFU as described inMaterials and Methods. Error bars represent � the standard deviation (SD) of three independent experiments. (B) Macrophages on coverslipswere infected as in panel A except at a multiplicity of infection (MOI) of 5, stained for inclusions, and visualized by fluorescence microscopy ata �40 objective magnification. (I) Untreated cells; (II) cells treated with FeSO4; (III) cells treated with INP0007; (IV) cells treated with INP0007and FeSO4. (C) Five fields in the indicated groups from panel B were used to tabulate the number of cells possessing either two or more than twoinclusions. The data represent the means � the SD of five fields, and significance was determined by Student t test. Results representative fromthree experiments are shown.

78 PRANTNER AND NAGARAJAN INFECT. IMMUN.


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

ing C. muridarum infections of macrophages, although thekinetics of their induction differs greatly. IL-6 mRNA levelspeak at 24 h postinfection, and this induction is inhibited by theaddition of INP0007 (Fig. 2A) (78% inhibition; P 0.001).The addition of FeSO4 to INP0007-treated cells restores chla-mydial growth (data not shown) but not IL-6 mRNA levels(Fig. 2A) (70% inhibition; P 0.0012). Further, the additionof FeSO4 in the absence of INP0007 to the infected cells doesnot affect IL-6 mRNA levels, strongly indicating that the de-crease seen when INP0007 and FeSO4 are used in conjunctionis mediated solely by INP0007. The production of IL-6 proteinby macrophages infected but given no other treatment variedfrom 400 to 2,000 pg/ml between different experiments, but thepercent inhibition in expression after INP0007 or INP0007/FeSO4 treatment remained statistically very significant (P 0.001) by one-way ANOVA (Fig. 2B). These data imply arequirement for T3S in IL-6 induction. Conversely, inductionof TNF-�, which peaks at 3 h postinfection and stays elevateduntil 8 h (28), was unaffected by INP0007 treatment at 8 hpostinfection (Fig. 2C). Although there was a trend to de-creased levels of TNF-� mRNA at 24 h after INP0007 treat-ment, these differences were not statistically significant be-tween experiments. Secretion of TNF-� protein is alsoinsensitive to INP0007 treatment (Fig. 2D), largely reflectingthe mRNA levels from 8 h. Together, these data suggest thatmRNA induction of TNF-� that is induced early via NF-�B

activation is T3S independent, whereas IL-6 that is inducedlate is T3S dependent.

IL-1� secretion but not induction of proIL-1� mRNA isinhibited by the T3S inhibitor INP0007. Another importantmember of the host proinflammatory response whose expres-sion is regulated by NF-�B is IL-1�. Like TNF-�, the inductionof proIL-1� mRNA is greatest early during infection, and thispeak expression is not inhibited by treatment with INP0007(Fig. 3A). In addition, a general decrease in proIL-1� mRNAwas noted in INP0007-treated cells at 24 h, but this change wasnot statistically significant between experiments. Secretion ofmature IL-1� protein is controlled at posttranslational levelsince it requires cleavage of proIL-1� by the host proteasecaspase-1 (4). IL-1� secretion following infection with C. muri-darum is sensitive to INP0007 (P 0.001) (Fig. 3B) and onlypartly restored by the addition of FeSO4 (P 0.03). Thesedata suggest a role for both chlamydial growth and T3S inIL-1� secretion. However, it must be noted that IL-1� proteinlevels detected in the supernatants of infected cells were low,approaching the limits of detection of the assay itself. It hasbeen demonstrated that detectable amounts of mature IL-1�are also present inside C. muridarum-infected macrophages(6). Therefore, intracellular lysates of infected cells were alsoassayed. INP0007 prevented optimal accumulation of intracel-lular IL-1� whether or not FeSO4 was present to restoregrowth (Fig. 3C). The absence of secreted and intracellular

FIG. 2. Expression of IL-6 and TNF-� during T3S inhibition. Macrophages were infected with C. muridarum in the presence of 50 �M INP0007and 50 �M FeSO4 where indicated. (A and C) At 8 and 24 h postinfection, RNA was isolated from cells to examine expression of IL-6 (A) andTNF-� (C). Results representative of three experiments are shown, with error bars calculated from the SD of samples assayed in duplicate. (B andD) At 24 h postinfection, supernatants were assayed by ELISA for IL-6 (B) and TNF-� (D) protein, expressed as pg/ml. The data for TNF-�represent the mean � the SEM of three independent experiments, and significance was determined by one-way ANOVA. The data for the IL-6ELISA are representative of three experiments showing mean values � the SD of samples assayed in duplicate.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

IL-1� despite strong mRNA induction in the presence ofINP0007 suggests a role for T3S in caspase-1 activation.

Expression of host type I IFN response gene CXCL10 issensitive to the T3S inhibitor INP0007. Type I IFNs and IFNresponse genes represent another class of genes that are up-regulated during infection of macrophages with C. muridarum,but the bacterial contributions to this process is unclear. Theobservation that the functionally analogous but evolutionaryunrelated type IV secretion (T4S) apparatus is required to

initiate the IFN response in two other bacterial models (37, 42)suggests that the T3S apparatus may be a crucial element in theresponse to C. muridarum. Based on this premise, expressionof IFN-� and the interferon response gene CXCL10 wereexamined during C. muridarum infections with or without T3Sinhibition. Treatment of macrophages with INP0007 led to asignificant reduction in chlamydia-induced IFN-� mRNA(76% inhibition; P 0.001) (Fig. 4A) and IFN-� protein (P 0.003) (Fig. 4B) secretion whether or not FeSO4 is present to

FIG. 3. Expression of IL-1� during T3S inhibition. Macrophages were infected with C. muridarum in the presence of 50 �M INP0007 and 50�M FeSO4 where indicated. (A) At 8 and 24 h postinfection, RNA was isolated from cells to examine the expression of IL-1�. Resultsrepresentative of three experiments are shown, with error bars calculated from the SD of samples assayed in duplicate. At 24 h postinfection,supernatants (B) or intracellular lysates (C) were assayed for the presence of IL-1� (B) by ELISA. The data in panel B represent means � thestandard errors of the mean of three independent experiments, and significance was determined by one-way ANOVA. The data in panel Crepresent the means � the SD of samples assayed in duplicate.

FIG. 4. Expression of IFN-� and the IFN response gene, CXCL10, during T3S inhibition. Macrophages were infected with C. muridarum inthe presence of 50 �M INP0007 and 50 �M FeSO4 where indicated. At 8 and 24 h postinfection, RNA was isolated from cells to examineexpression of IFN-� (A) and CXCL10 (C). Results representative of three experiments are shown, with error bars calculated from the SD ofsamples assayed in duplicate. At 24 h postinfection, supernatants were assayed for the presence of IFN-� (B) or CXCL10 (D) by ELISA. The datarepresent the means � the standard errors of the mean of three independent experiments, and significance was determined by one-way ANOVA.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

restore growth. However, the addition of FeSO4 in the absenceof INP0007 treatment also led to a significant decrease inIFN-� induction (50% inhibition; P 0.004) and secretion(P 0.019). This effect of FeSO4 on IFN-� induction was C.muridarum specific because FeSO4 did not diminish the re-sponse to the Escherichia coli LPS or poly(I-C) (data notshown). However, due to the “nonspecific” effect of FeSO4 onIFN-� induction, the role for chlamydial T3S in IFN-� secre-tion remains inconclusive. IFN response genes such asCXCL10, a T-cell chemokine, require the same transcriptionfactors that induce IFN-�, such as IRF3, but are also furtheramplified by type I IFN signaling (24, 28). Initial induction ofCXCL10 at 8 h postinfection appears to be independent ofINP0007, but peak mRNA induction and protein secretion at24 h was significantly decreased when INP0007 was present(81% inhibition; P 0.001 for RNA and P 0.03 for protein)(Fig. 4C and D). This deficit was not reversed by addition ofFeSO4 (77% inhibition; P 0.001 for RNA and P 0.006 forCXCL10 protein). Further, the addition of FeSO4 to infectedcells in the absence of INP0007 did not decrease CXCL10mRNA or protein levels. It is important to note that the in-duction of both IFN-� and CXCL10 mRNA at 24 h postinfec-tion is inhibited by 50 mg of chloramphenicol/ml (Fig. 5) and150 mg of rifampin/ml (data not shown), indicating that denovo bacterial protein synthesis and bacterial transcription areessential for this response. Together, these data suggest a rolefor T3S in addition to growth for chlamydia-induced CXCL10secretion.

The T3S secretion inhibitor INP0007 does not inhibit TLRsignaling in the presence or absence of FeSO4. The actualbacterial target for INP0007 is unknown, but the drug has beenshown to bind iron in vitro (41). Theoretically, this could in-fluence events in the host cell such as TLR signaling pathwaysand cytokine production independent of its action on bacterialphysiology. To address this possibility, macrophages weretreated with the TLR ligand poly(I-C), which has been shownto cause upregulation of cytokines such as IFN-� and CXCL10via TLR3 (1). Importantly, neither FeSO4 nor INP0007 had adetrimental effect individually or collectively on TLR3-medi-ated induction of IFN-� (Fig. 6A) or CXCL-10 (Fig. 6B) whenadded in tandem with poly(I-C). Similar results were also ob-tained with TLR4-mediated induction of CXCL10 and IL-6

after E. coli LPS treatment (data not shown). This implies thatthe cytokine modulation seen during INP0007 treatment ismediated by its effect on the chlamydiae and not on the hostcell.

Addition of iron during INP0007 treatment restores IncGsecretion to the inclusion membrane independent of the multi-inclusion phenotype. In the present study a multi-inclusionphenotype was observed in C. muridarum (Fig. 1B)-infectedcells treated with INP0007 and FeSO4, suggesting that inclu-sion (Inc) proteins facilitating fusion might still be blockedafter chlamydial growth restoration by FeSO4. Therefore, se-cretion of the putative T3S effector IncG was monitored bystaining cells for 14-3-3beta, a host protein that is recruited to

FIG. 5. Chlamydial growth dependence for IFN-� and IFN response genes. IFN-� (A) and CXCL-10 (B) induction in mouse macrophages thatwere infected with C. muridarum. Where indicated, 50 �g of chloramphenicol/ml (CAM) was added immediately prior to infection. Resultsrepresentative of four experiments are shown, with error bars calculated from the SD of samples assayed in duplicate.

FIG. 6. Role of INP0007 and FeSO4 on TLR signaling. (A and B)IFN-� (A) and CXCL-10 (B) induction in mouse macrophages thatwere incubated with 10 �g of the TLR3 ligand poly(I-C)/ml for 6 h inthe presence 50 �M INP0007 and 50 �M FeSO4. Results representa-tive of two experiments are shown, with error bars calculated from theSD of samples assayed in duplicate.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

the inclusion membrane in a IncG-dependent manner (39).Recruitment of 14-3-3beta to the inclusion membrane in in-fected cells leads to a ring-like staining pattern (Fig. 7B) asopposed to diffuse staining in uninfected or INP0007-treatedcells (Fig. 7A and C). However, when infected cells are treatedwith both INP0007 and FeSO4, 14-3-3beta recruitment isclearly restored (Fig. 7D), even though the multi-inclusionphenotype is still visible. These data suggest that FeSO4 treat-ment of INP0007-treated cells restores the secretion of someputative T3S proteins such as IncG but does not restore nor-mal inclusion phenotype and other likely T3S proteins thataffect cytokine induction or secretion.

DISCUSSION

Small organic molecules targeting the T3S apparatus ofmany human pathogens have been proposed as a new class ofantimicrobial agents called virulence blockers (21). Consistentwith prior studies using C. trachomatis and further supportingthe possible use of these compounds as antibiotics, the addi-tion of the T3S inhibitor INP0007 prevented the growth of C.muridarum in a tissue culture infection model. Interestingly,INP0007 treatment also led to decreased secretion of manyhost cytokines, including IL-1�, IL-6, and CXCL10, suggestinga role for chlamydial growth or T3S secretion in the expressionof these cytokines. Interestingly, restoration of chlamydialgrowth by the addition of FeSO4 to INP0007-treated cells doesnot fully restore the expression of IL-6, IL-1�, or CXCL10.This indicates for the first time a correlation between thechlamydial T3S apparatus and the expression of a number ofthe host cytokines that have been shown to play an importantrole in the development of oviduct pathology during genitalchlamydial infection (6, 8). Interestingly, a recent study showed

a decreased inflammatory response in a bovine ileal loopmodel of Salmonella enterica infection when the bacteria werepretreated with INP0007 (18), raising the distinct possibilitythat in vitro findings concerning inflammation may extend to invivo infections.

INP0007 has been shown to inhibit secretion of the T3Seffector proteins SipA (18) and YopH (29) in vitro by S. en-terica and Y. pseudotuberculosis, respectively. However, the ex-act bacterial targets for INP0007 or how it inhibits T3S has notbeen elucidated. The fact that it works against such a broadspectrum of pathogens indicates that its target must be a highlyconserved structure such as the T3S apparatus. The specificchlamydial effectors that are affected by T3S inhibitors, in thepresence or absence of iron have not yet been defined, partiallydue to the lack of T3S expression/reporter systems for Chla-mydia spp. In particular, although it was demonstrated previ-ously that iron rescues the growth defect mediated by INPcompounds (41), the potential ability of iron to also restoresecretion of putative chlamydial T3S effectors such as Inc pro-teins (43) was not determined. In the present study a multi-inclusion phenotype was observed in C. muridarum infectedcells treated with INP0007 and FeSO4 (Fig. 1B), hinting thatInc protein secretion may still be prevented. However, IncG-dependent recruitment of 14-3-3beta (39) to the inclusionmembrane was restored in cells treated with INP0007 andFeSO4, although the multi-inclusion phenotype was still appar-ent (Fig. 7). A possible interpretation from these results wouldbe that INP0007 targets the secretion of only a subset of thechlamydial T3S effectors (33). This implies that those blockedare required for induction of cytokines and fusion of multipleinclusions but dispensable for growth as long as sufficient ironis available. Overall, this hypothesis leads to the possibility thatone or more chlamydial T3S effectors are responsible eitherdirectly or indirectly for propagating the host cytokine re-sponse during infection. The most likely prospect that couldinfluence IL-1� secretion would seem to be the T3S translo-cator protein CopB (10) because the homologous T3S trans-locator proteins Shigella IpaB (5, 17, 49) and Salmonella SipB(9, 15) have been shown to colocalize with caspase-1 and arenecessary and sufficient for its activation. Conversely, activa-tion of caspase-1 by Yersinia pestis KIM was shown to bedependent on the T3S effector YopJ (22), illustrating thattranslocators are not the only possible candidates. Also, it isimportant to note that the effectors that are recognized by hostreceptors to induce the expression of these cytokines need notbe typical T3S effectors, as evidenced by the T3S-dependentsecretion of monomeric flagellin into host cytosol by Salmo-nella enterica (45). However, as long as the bacterial target forINP0007 is unresolved, it can be argued that the phenotypesexerted by this compound are independent of T3S.

It has been previously published in studies with C. tracho-matis that the addition of exogenous iron or holotransferrin asiron donors during T3S-mediated inhibition completely re-stored growth (41). Further, using the E-lux expression systemin Y. pseudotuberculosis, the same authors claimed no effect ofexcess iron on the expression of any T3S genes examined or ofYopH secretion when used in conjunction with T3S inhibitors(41), although this was not tested for chlamydiae. Taken to-gether, it was suggested that the iron-binding ability of the T3Sdrugs was independent of its effect on T3S. The observation

FIG. 7. 14-3-3� staining on infected cells treated with INP0007with or without Iron. Macrophages on coverslips were infected with C.muridarum, treated with INP0007 with or without FeSO4 and stainedusing TRITC-conjugated 14-3-3beta. (A) Uninfected cells; (B) in-fected cells; (C) infected cells treated with INP0007; (D) infected cellstreated with INP0007 and FeSO4.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

that the addition of iron did not affect the INP0007 depen-dence of any of the host cytokines genes examined abovesuggests that T3S inhibition by these compounds is separatefrom their role in iron sequestration. Conversely, it has alsobeen proposed that the chlamydial T3S system may be involvedin iron acquisition and thereby necessary for chlamydial growth(21). The fact that iron restores the growth defect caused byT3S inhibition would then indicate that C. muridarum hasT3S-independent means to thrive in cells in vitro as long asiron is not limiting. Interestingly, iron depletion has beenshown to induce persistence in C. pneumoniae (50), and arecent study shows that iron depletion limits intracellular chla-mydial growth in macrophages (32). This leads to anotherpossibility that INP0007 could function as a siderophore anddeplete iron besides its T3S inhibition function. Determiningthe link between iron acquisition by chlamydiae and the T3Sapparatus is clearly necessary to resolve this conundrum.

An independent question to address is which host receptorsare involved in triggering the T3S-induced cytokine response.This is particularly important because the observed differencein cytokine expression in INP0007-treated cells could be due toa direct effect of the drug on host receptors or their signalingpathways. Cytokine expression by TLR3 (Fig. 6) and TLR4(data not shown) pathways were not affected by INP0007 oriron treatment, illustrating that the effects of these additiveswere specific to chlamydial infection and not due to a eukary-otic target. The TLR2-MyD88 pathway plays a role in TNF-�and IL-1� induction during chlamydial infection (8), althoughthe receptors involved in the induction of IL-6, IFN-�, andCXCL10 are still unclear. All of the cytokines that were ex-amined are NF-�B dependent, although individual gene pro-moters have additional regulatory elements. Interestingly, theinduction of TNF-� and IL-1� RNA were not T3S dependent(Fig. 3B). Both of these genes are induced and peak early (3 h)postinfection (28), unlike IL-6, IFN-�, and CXCL10, whichpeak much later at 24 h postinfection (Fig. 3A). It has beensuggested that the earliest chlamydial T3S effectors, such asTARP, may not be completely blocked by T3S inhibitor treat-ment (27), so genes such as TNF-� could be triggered follow-ing recognition of these early effectors. Alternatively, NF-�Bactivation following a direct interaction of chlamydiae withTLR2 may play a dominant role for TNF-� expression (30) butnot for IL-6. As for IL-1� protein secretion, transcriptionalupregulation is not sufficient. A second independent signal isrequired to activate the host protease caspase-1 in order tocleave proIL-1� to its active form. The fact that mRNA induc-tion of IL-1� is INP0007 independent implies that theINP0007-mediated decrease in IL-1� secretion is due to ablock in caspase-1 activation. This observation is consistentwith the finding by Wolf et al. that the addition of INP0007prevented the activation of caspase-1 in HeLa cells infectedwith C. trachomatis L2 (51). During infection of macrophagesin vitro with C. muridarum, detection of active caspase-1 frag-ments by Western blotting occurs at 12 to 24 h postinfection(6). In general, INP0007 seems to have its greatest effects oncytokines expressed or enzymatically cleaved at later points ofa primary infection. This observation raises the possibility thatthe effector inducing this response could be temporally regu-lated.

Overall, in the present study a well-established pharmaco-

logical inhibitor of T3S was used to illustrate the importantrole for chlamydial T3S in the establishment of the host cyto-kine response. In order to understand this phenomenon better,it will be crucial to determine how INP0007 impairs T3S inhi-bition, how iron reverses this chlamydial growth defect, andfinally which specific chlamydial effector molecule(s) initiatethe cytokine response.

ACKNOWLEDGMENTS

This study was supported by Public Health Service grant AI067678(U.M.N.) from the National Institutes of Health and in part by theArkansas Bioscience Institute, Arkansas Children Hospital ResearchInstitute, to U.M.N.

We thank Patrick Bavoil and Roger Rank for critical reading of themanuscript. A T3S inhibitor INP0400 structurally similar to INP0007was provided by Pia Keyser (Innate Pharmaceuticals, Umea, Sweden).

REFERENCES

1. Alexopoulou, L., A. C. Holt, R. Medzhitov, and R. A. Flavell. 2001. Recog-nition of double-stranded RNA and activation of NF-�B by Toll-like recep-tor 3. Nature 413:732–738.

2. Bailey, L., A. Gylfe, C. Sundin, S. Muschiol, M. Elofsson, P. Nordstrom, B.Henriques-Normark, R. Lugert, A. Waldenstrom, H. Wolf-Watz, and S.Bergstrom. 2007. Small molecule inhibitors of type III secretion in Yersiniablock the Chlamydia pneumoniae infection cycle. FEBS Lett. 581:587–595.

3. Caldwell, H. D., J. Kromhout, and J. Schachter. 1981. Purification andpartial characterization of the major outer membrane protein of Chlamydiatrachomatis. Infect. Immun. 31:1161–1176.

4. Cerretti, D. P., L. T. Hollingsworth, C. J. Kozlosky, M. B. Valentine, D. N.Shapiro, S. W. Morris, and N. Nelson. 1994. Molecular characterization ofthe gene for human interleukin-1 beta converting enzyme (IL1BC). Genom-ics 20:468–473.

5. Chen, Y., M. R. Smith, K. Thirumalai, and A. Zychlinsky. 1996. A bacterialinvasin induces macrophage apoptosis by binding directly to ICE. EMBO J.15:3853–3860.

6. Cheng, W., P. Shivshankar, Z. Li, L. Chen, I. T. Yeh, and G. Zhong. 2008.Caspase-1 contributes to Chlamydia trachomatis-induced upper urogenitaltract inflammatory pathologies without affecting the course of infection.Infect. Immun. 76:515–522.

7. Cotter, T. W., Q. Meng, Z. L. Shen, Y. X. Zhang, H. Su, and H. D. Caldwell.1995. Protective efficacy of major outer membrane protein-specific immu-noglobulin A (IgA) and IgG monoclonal antibodies in a murine model ofChlamydia trachomatis genital tract infection. Infect. Immun. 63:4704–4714.

8. Darville, T., J. M. O’Neill, C. W. Andrews, Jr., U. M. Nagarajan, L. Stahl,and D. M. Ojcius. 2003. Toll-like receptor-2, but not Toll-like receptor-4, isessential for development of oviduct pathology in chlamydial genital tractinfection. J. Immunol. 171:6187–6197.

9. Dreher, D., M. Kok, C. Obregon, S. G. Kiama, P. Gehr, and L. P. Nicod.2002. Salmonella virulence factor SipB induces activation and release ofIL-18 in human dendritic cells. J. Leukoc. Biol. 72:743–751.

10. Fields, K. A., E. R. Fischer, D. J. Mead, and T. Hackstadt. 2005. Analysis ofputative Chlamydia trachomatis chaperones Scc2 and Scc3 and their use inthe identification of type III secretion substrates. J. Bacteriol. 187:6466–6478.

11. Franchi, L., J. Stoolman, T. D. Kanneganti, A. Verma, R. Ramphal, and G.Nunez. 2007. Critical role for Ipaf in Pseudomonas aeruginosa-inducedcaspase-1 activation. Eur. J. Immunol. 37:3030–3039.

12. Galan, J. E., and A. Collmer. 1999. Type III secretion machines: bacterialdevices for protein delivery into host cells. Science 284:1322–1328.

13. Galle, M., P. Schotte, M. Haegman, A. Wullaert, H. J. Yang, S. Jin, and R.Beyaert. 2007. The Pseudomonas aeruginosa type III secretion system plays adual role in the regulation of caspase-1 mediated IL-1� maturation. J. CellMol. Med. doi: 10.1111/j.1582-4934.2007.00190.x.

14. Ghayur, T., S. Banerjee, M. Hugunin, D. Butler, L. Herzog, A. Carter, L.Quintal, L. Sekut, R. Talanian, M. Paskind, W. Wong, R. Kamen, D. Tracey,and H. Allen. 1997. Caspase-1 processes IFN-gamma-inducing factor andregulates LPS-induced IFN-gamma production. Nature 386:619–623.

15. Hersh, D., D. M. Monack, M. R. Smith, N. Ghori, S. Falkow, and A. Zych-linsky. 1999. The Salmonella invasin SipB induces macrophage apoptosis bybinding to caspase-1. Proc. Natl. Acad. Sci. USA 96:2396–2401.

16. Hii, C. S., G. W. Sun, J. W. Goh, J. Lu, M. P. Stevens, and Y. H. Gan. 2008.Interleukin-8 induction by Burkholderia pseudomallei can occur withoutToll-like receptor signaling but requires a functional type III secretion sys-tem. J. Infect. Dis. 197:1537–1547.

17. Hilbi, H., J. E. Moss, D. Hersh, Y. Chen, J. Arondel, S. Banerjee, R. A.Flavell, J. Yuan, P. J. Sansonetti, and A. Zychlinsky. 1998. Shigella-inducedapoptosis is dependent on caspase-1 which binds to IpaB. J. Biol. Chem.273:32895–32900.



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

18. Hudson, D. L., A. N. Layton, T. R. Field, A. J. Bowen, H. Wolf-Watz, M.Elofsson, M. P. Stevens, and E. E. Galyov. 2007. Inhibition of type IIIsecretion in Salmonella enterica serovar Typhimurium by small-moleculeinhibitors. Antimicrob. Agents Chemother. 51:2631–2635.

19. Hvid, M., A. Baczynska, B. Deleuran, J. Fedder, H. J. Knudsen, G. Chris-tiansen, and S. Birkelund. 2007. Interleukin-1 is the initiator of Fallopiantube destruction during Chlamydia trachomatis infection. Cell Microbiol.9:2795–2803.

20. Kauppi, A. M., R. Nordfelth, H. Uvell, H. Wolf-Watz, and M. Elofsson. 2003.Targeting bacterial virulence: inhibitors of type III secretion in Yersinia.Chem. Biol. 10:241–249.

21. Keyser, P., M. Elofsson, S. Rosell, and H. Wolf-Watz. 2008. Virulence block-ers as alternatives to antibiotics: type III secretion inhibitors against gram-negative bacteria. J. Intern. Med. 264:17–29.

22. Lilo, S., Y. Zheng, and J. B. Bliska. 2008. Caspase-1 activation in macro-phages infected with Yersinia pestis KIM requires the type III secretionsystem effector YopJ. Infect. Immun. 76:3911–3923.

23. Mardh, P. A. 2004. Tubal factor infertility, with special regard to chlamydialsalpingitis. Curr. Opin. Infect. Dis. 17:49–52.

24. McWhirter, S. M., K. A. Fitzgerald, J. Rosains, D. C. Rowe, D. T. Golenbock,and T. Maniatis. 2004. IFN-regulatory factor 3-dependent gene expression isdefective in Tbk1-deficient mouse embryonic fibroblasts. Proc. Natl. Acad.Sci. USA 101:233–238.

25. Miao, E. A., C. M. Alpuche-Aranda, M. Dors, A. E. Clark, M. W. Bader, S. I.Miller, and A. Aderem. 2006. Cytoplasmic flagellin activates caspase-1 andsecretion of interleukin 1� via Ipaf. Nat. Immunol. 7:569–575.

26. Miao, E. A., R. K. Ernst, M. Dors, D. P. Mao, and A. Aderem. 2008.Pseudomonas aeruginosa activates caspase 1 through Ipaf. Proc. Natl. Acad.Sci. USA 105:2562–2567.

27. Muschiol, S., L. Bailey, A. Gylfe, C. Sundin, K. Hultenby, S. Bergstrom, M.Elofsson, H. Wolf-Watz, S. Normark, and B. Henriques-Normark. 2006. Asmall-molecule inhibitor of type III secretion inhibits different stages of theinfectious cycle of Chlamydia trachomatis. Proc. Natl. Acad. Sci. USA 103:14566–14571.

28. Nagarajan, U. M., D. M. Ojcius, L. Stahl, R. G. Rank, and T. Darville. 2005.Chlamydia trachomatis induces expression of IFN-gamma-inducible protein10 and IFN-beta independent of TLR2 and TLR4, but largely dependent onMyD88. J. Immunol. 175:450–460.

29. Nordfelth, R., A. M. Kauppi, H. A. Norberg, H. Wolf-Watz, and M. Elofsson.2005. Small-molecule inhibitors specifically targeting type III secretion. In-fect. Immun. 73:3104–3114.

30. O’Connell, C. M., I. A. Ionova, A. J. Quayle, A. Visintin, and R. R. Ingalls.2006. Localization of TLR2 and MyD88 to Chlamydia trachomatis inclusions.Evidence for signaling by intracellular TLR2 during infection with an obli-gate intracellular pathogen. J. Biol. Chem. 281:1652–1659.

31. Okuda, J., Y. Arikawa, Y. Takeuchi, M. M. Mahmoud, E. Suzaki, K.Kataoka, T. Suzuki, Y. Okinaka, and T. Nakai. 2006. Intracellular replica-tion of Edwardsiella tarda in murine macrophage is dependent on the type IIIsecretion system and induces an up-regulation of antiapoptotic NF-�B targetgenes protecting the macrophage from staurosporine-induced apoptosis. Mi-crob. Pathog. 41:226–240.

32. Paradkar, P. N., I. De Domenico, N. Durchfort, I. Zohn, J. Kaplan, andD. M. Ward. 2008. Iron depletion limits intracellular bacterial growth inmacrophages. Blood 112:866–874.

33. Peters, J., D. P. Wilson, G. Myers, P. Timms, and P. M. Bavoil. 2007. TypeIII secretion a la Chlamydia. Trends Microbiol. 15:241–251.

34. Rasmussen, S. J., L. Eckmann, A. J. Quayle, L. Shen, Y. X. Zhang, D. J.Anderson, J. Fierer, R. S. Stephens, and M. F. Kagnoff. 1997. Secretion ofproinflammatory cytokines by epithelial cells in response to Chlamydia in-

fection suggests a central role for epithelial cells in chlamydial pathogenesis.J. Clin. Investig. 99:77–87.

35. Read, T. D., R. C. Brunham, C. Shen, S. R. Gill, J. F. Heidelberg, O. White,E. K. Hickey, J. Peterson, T. Utterback, K. Berry, S. Bass, K. Linher, J.Weidman, H. Khouri, B. Craven, C. Bowman, R. Dodson, M. Gwinn, W.Nelson, R. DeBoy, J. Kolonay, G. McClarty, S. L. Salzberg, J. Eisen, andC. M. Fraser. 2000. Genome sequences of Chlamydia trachomatis MoPn andChlamydia pneumoniae AR39. Nucleic Acids Res. 28:1397–1406.

36. Ren, Q., S. J. Robertson, D. Howe, L. F. Barrows, and R. A. Heinzen. 2003.Comparative DNA microarray analysis of host cell transcriptional responsesto infection by Coxiella burnetii or Chlamydia trachomatis. Ann. N. Y. Acad.Sci. 990:701–713.

37. Roux, C. M., H. G. Rolan, R. L. Santos, P. D. Beremand, T. L. Thomas, L. G.Adams, and R. M. Tsolis. 2007. Brucella requires a functional type IVsecretion system to elicit innate immune responses in mice. Cell Microbiol.9:1851–1869.

38. Scidmore, M. A., E. R. Fischer, and T. Hackstadt. 2003. Restricted fusion ofChlamydia trachomatis vesicles with endocytic compartments during the ini-tial stages of infection. Infect. Immun. 71:973–984.

39. Scidmore, M. A., and T. Hackstadt. 2001. Mammalian 14-3-3beta associateswith the Chlamydia trachomatis inclusion membrane via its interaction withIncG. Mol. Microbiol. 39:1638–1650.

40. Shin, H., and G. R. Cornelis. 2007. Type III secretion translocation pores ofYersinia enterocolitica trigger maturation and release of pro-inflammatoryIL-1�. Cell Microbiol. 9:2893–2902.

41. Slepenkin, A., P. A. Enquist, U. Hagglund, L. M. de la Maza, M. Elofsson,and E. M. Peterson. 2007. Reversal of the antichlamydial activity of putativetype III secretion inhibitors by iron. Infect. Immun. 75:3478–3489.

42. Stetson, D. B., and R. Medzhitov. 2006. Recognition of cytosolic DNAactivates an IRF3-dependent innate immune response. Immunity 24:93–103.

43. Subtil, A., C. Parsot, and A. Dautry-Varsat. 2001. Secretion of predicted Incproteins of Chlamydia pneumoniae by a heterologous type III machinery.Mol. Microbiol. 39:792–800.

44. Sun, G. W., J. Lu, S. Pervaiz, W. P. Cao, and Y. H. Gan. 2005. Caspase-1-dependent macrophage death induced by Burkholderia pseudomallei. CellMicrobiol. 7:1447–1458.

45. Sun, Y. H., H. G. Rolan, and R. M. Tsolis. 2007. Injection of flagellin into thehost cell cytosol by Salmonella enterica serotype Typhimurium. J. Biol.Chem. 282:33897–33901.

46. Sutterwala, F. S., L. A. Mijares, L. Li, Y. Ogura, B. I. Kazmierczak, and R. A.Flavell. 2007. Immune recognition of Pseudomonas aeruginosa mediated bythe IPAF/NLRC4 inflammasome. J. Exp. Med. 204:3235–3245.

47. Suzuki, T., L. Franchi, C. Toma, H. Ashida, M. Ogawa, Y. Yoshikawa, H.Mimuro, N. Inohara, C. Sasakawa, and G. Nunez. 2007. Differential regu-lation of caspase-1 activation, pyroptosis, and autophagy via Ipaf and ASC inShigella-infected macrophages. PLoS Pathog. 3:e111.

48. Tabbara, K. F. 2001. Trachoma: a review. J. Chemother. 13(Suppl. 1):18–22.49. Thirumalai, K., K. S. Kim, and A. Zychlinsky. 1997. IpaB, a Shigella flexneri

invasin, colocalizes with interleukin-1�-converting enzyme in the cytoplasmof macrophages. Infect. Immun. 65:787–793.

50. Wehrl, W., T. F. Meyer, P. R. Jungblut, E. C. Muller, and A. J. Szczepek.2004. Action and reaction: Chlamydophila pneumoniae proteome alterationin a persistent infection induced by iron deficiency. Proteomics 4:2969–2981.

51. Wolf, K., H. J. Betts, B. Chellas-Gery, S. Hower, C. N. Linton, and K. A.Fields. 2006. Treatment of Chlamydia trachomatis with a small moleculeinhibitor of the Yersinia type III secretion system disrupts progression of thechlamydial developmental cycle. Mol. Microbiol. 61:1543–1555.

52. Xia, M., R. E. Bumgarner, M. F. Lampe, and W. E. Stamm. 2003. Chlamydiatrachomatis infection alters host cell transcription in diverse cellular path-ways. J. Infect. Dis. 187:424–434.

Editor: A. J. Baumler



http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

role for the chlamydial type iii secretion apparatus …mouse macrophages and in vitro infections....

Documents