ORIGINAL PAPER

RNAi-mediated downregulation of NOB1 suppresses the growthand colony-formation ability of human ovarian cancer cells

Yang Lin • Shuai Peng • Hansong Yu •

Hong Teng • Manhua Cui

Received: 12 October 2010 / Accepted: 27 December 2010 / Published online: 2 February 2011

� Springer Science+Business Media, LLC 2011

Abstract Nin one binding protein (NOB1p), encoded by

the NOB1 gene, is a crucial molecule in the maturation of

the 20S proteasome and protein degradation. The present

study evaluates whether NOB1 is an appropriate molecular

target for cancer gene therapy. In two ovarian cancer cell

lines, SKOV3 and HEY, NOB1 expression was knocked

down by a lentiviral short hairpin RNA (shRNA) delivery

system. The RNA interference (RNAi)-mediated the

downregulation of NOB1 expression markedly reduced the

proliferative and colony-formation ability of ovarian can-

cer cells. Additionally, NOB1 shRNA-expressing lentivi-

rus-treated ovarian cancer cells tended to arrest in the G0/

G1 phase. These results suggested that NOB1 may act as an

oncogenic factor in ovarian cancer and could be a potential

molecular target for ovarian cancer gene therapy.

Keywords shRNA � NOB1 � Ovarian cancer � Lentivirus �Cellular proliferation

Introduction

Protein degradation is an important process tightly regu-

lated by a diverse group of proteases. [1]. The degradation

of a protein via the ubiquitin proteasome pathway (UPP)

involves two successive steps: (1) the covalent linkage

of multiple ubiquitin molecules to the substrate and (2)

the degradation of the polyubiquitinated protein by the

26S proteasome complex with the release of free and

reusable ubiquitin [2]. The 26S proteasome is a biological

macromolecule consisting of two parts: the 19S regula-

tory particle (RP or PA700), which confers ATP depen-

dency and ubiquitinated substrate specificity on the

enzyme, and the 20S proteasome (CP), which forms the

proteolytic core [3]. Numerous studies have shown that

the ubiquitin (Ub) pathway plays a critical role in regu-

lating essential cellular processes, such as gene tran-

scription and signal transduction [4]. The Ub pathway

also takes part in the modulation of protein turnover in

the cell cycle; thus, this process is commonly mutated

and is involved in cancer development, especially in

malignant tumors [3, 5].

NOB1 was first identified in Saccharomyces cerevisiae

as an essential gene encoding the Nin one binding protein

(NOB1p), which can interact with Rpn12p, as demon-

strated previously by a two-hybrid assay [6]. The nuclear

protein NOB1p serves as a chaperone to join the 20S

proteasome with the 19S regulatory particle in the nucleus

and facilitates the maturation of the 20S proteasome.

Therefore, the function of NOB1p is necessary for UPP-

mediated proteolysis [7]. A recent study in chronic myeloid

leukemia (CML) reveals that NOB1, along with five other

genes, can be used as a diagnostic marker discriminating

chronic phase (CP) from blast crisis (BC) CML [8]. Also,

our previous investigation on ovarian cancer indicated that

the expression levels of NOB1 in ovarian cancer tissues

were remarkably higher in contrast to those of controls

(data not shown), indicating that NOB1 may act as an

oncogenic factor in ovarian cancer.

Yang Lin and Shuai Peng contributed equally to this work.

Y. Lin � H. Teng � M. Cui (&)

Department of Gynaecology and Obstetrics, The Second

Hospital of Jilin University, No. 257 Ziqiang Street, Nanguan

District, 130041 Changchun, Jilin Province, China

e-mail: manhuacui@163.com

S. Peng � H. Yu

College of Food Science and Engineering, Jilin Agricultural

University, Jilin, China

123

Med Oncol (2012) 29:311–317

DOI 10.1007/s12032-010-9808-5

To test our hypothesis, we applied RNA interference

(RNAi) technology to knock down the expression of NOB1

in two ovarian cancer cell lines, and we then investigated

the proliferation, cell cycle and colony-formation capacity

in both cell lines. Our data revealed that the inhibition of

NOB1 significantly decreased proliferation in both cell

lines, providing us with a future target for therapy.

Materials and methods

Lentiviral vector production

Small interfering RNA (siRNA) targeting NOB1 sequence

(AAGGTTAAGGTGAGCTCATCG) and non-silencing

sequence (AATTCTCCGAACGTGTCACGT) were trans-

formed into short hairpin RNA (shRNA) (stem–loop–stem

structure) and were cloned into pLV-THM-lentiviral vec-

tors with BamHI/EcoRI sites. Then, the recombined pLV-

THM-lentiviral vector and two-helper vector system

(GeneChem Co. LTD., Shanghai, China) were transfected

into HEK293T cells via Lipofectamine 2000 (Invitrogen,

Carlsbad, CA, USA) to generate lentivirus. After 3 days of

incubation, the lentivirus from culture medium was col-

lected and concentrated with Centricon-plus-20 (Millipore,

Billerica, MA, USA).

Cell culture and infection

SKOV3 and HEY cells were received from the American

Type Culture Collection (ATCC). Cells were grown in

DMEM (Invitrogen, Carlsbad, CA, USA) containing 10%

fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA),

2 mM L-glutamine and 1% penicillin/streptomycin at 37�C

with 5% CO2. For lentivirus infection, SKOV3 and

HEY cells were cultured in 6-well plates. Then, NOB1

shRNA-expressing lentivirus (sh-NOB1) or nontargeting

shRNA-expressing lentivirus (control) was added, with a

multiplicity of infection (MOI) of 10 in SKOV3 cells and

20 in HEY cells. After 72 h of infection, cells were

observed under fluorescence microscopy (MicroPublisher

3.3RTV; Olympus, Tokyo, Japan).

Quantitative real-time PCR

SKOV3 and HEY cells were cultured in 6-well plates and

were then infected with lentivirus for 72 h. Total RNA was

isolated from cultured cells by Trizol reagent (Invitrogen,

Carlsbad, CA, USA). cDNA was synthesized from total

RNA with random primers following the manufacturer’s

protocol (MBI Fermantas, Vilnius, Lithuania). Two sets of

primers were used for PCR. Primers were designed by

Beacon Designer 7 software (Premier Biosoft International,

Palo Alto, CA, USA) as follows: Actin-F, 50-CGGCATTG

TCACCAACTG-30, Actin-R, 50-CGCTCGGTCAGGATCT

TC-30; NOB1-F, 50-ATCTGCCCTACAAGCCTAAAC-30,NOB1-R, 5-TCCTCCTCCTCCTCCTCAC-30. The SYBR

Green Real-Time PCR assay kit (TAKARA, Otsu, Japan)

was used, and quantitative real-time PCR (qRT-PCR) was

performed according to the ABI manufacturer’s protocols

(Perkin Elmer Corp./Applied Biosystems, Foster City, CA,

USA). Fluorescence was analyzed by using the Light

Cycler Software version 3.5 (Roche Diagnostics, Meylan,

France). All samples were examined in triplicate.

Western blot analysis

Total protein was isolated from whole cells using ice-cold

protein lysis buffer (1% Triton X-100; 50 mM Tris–HCl,

pH 7.4; 150 mM NaCl; 0.1% SDS; 1 mM PMSF; 1 mM

EDTA). This was followed by 30 min of incubation on ice

and centrifugation at 10,000 9 g for 10 min at 4�C. Pro-

tein concentration was determined by BCA protein assay

(Pierce, Rockford, IL, USA). Protein extracts were sepa-

rated on a SDS-polyacrylamide gel, blotted onto a nitro-

cellulose membrane and incubated with anti-Nob1p

antibody (Abcam, Cambridge, UK) or anti-Actin antibody

(Santa Cruz, CA, USA). Western blotting was developed

using horseradish peroxidase-conjugated goat anti-mouse

or goat anti-rabbit IgG (Santa Cruz Biotechnology, Santa

Cruz, CA, USA) and was detected with enhanced chemi-

luminescence reagent (Santa Cruz Biotechnology, Santa

Cruz, CA, USA).

Methylthiazoletetrazolium cell proliferation assay

Cells infected with NOB1 shRNA lentivirus (sh-NOB1) or

non-silencing shRNA lentivirus (control), along with non-

treated cells, were seeded in a 96-well plates at a density of

2,000 cells per well. At indicated time points, 20 lL

methylthiazoletetrazolium (MTT) solution (5 mg/mL) was

added into each well. After 4 h of incubation at 37�C,

150 lL dimethyl sulfoxide (DMSO) was added to dissolve

the crystals. After 10 min at room temperature, the absor-

bance was recorded at 570 nm.

BrdU incorporation assay

Cells infected with sh-NOB1 or control, along with non-

treated cells, were cultured in 96-well plates with 2,000

cells per well. A 5-bromodeoxyuridine (BrdU) incorpora-

tion assay was performed by using the BrdU Cell Prolif-

eration Assay kit (Chemicon, Temecula, CA, USA).

Briefly, 20 lL of 1/500 diluted BrdU was added, and the

312 Med Oncol (2012) 29:311–317

123

assay was incubated for 8 h. Then, 100 lL of 1/200 diluted

anti-BrdU and peroxidase-conjugated goat anti-mouse IgG

antibodies were used successively, according the manu-

facturer’s instructions. The plates were washed, and then

100 lL TMB Peroxidase Substrate was added. Plates were

read at a dual wavelength of 450/550 nm, and the growth

rate of cells was calculated by the following equation:

Growth rate ¼ OD48h � OD24hð Þ=OD24h:

FACS analysis

Cells were cultured in 6-well plates and were then treated

with sh-NOB1 or control. At the indicated time point, cells

were collected by centrifugation at 2000 9 g for 5 min,

were washed twice with PBS, and were fixed in ethanol.

Then, cells were rehydrated and resuspended in PBS con-

taining RNase-A (100 lg/mL) on ice. After an additional

incubation at room temperature for 30 min, cells were

stained with propidium iodide (PI) and were then analyzed

by BD FACS Calibur Flow Cytometer (BD Biosciences,

San Diego, CA, USA).

Colony-formation assay

Three groups of cells (sh-NOB1, control and non-infected

cells) were plated in 6-well plates at a concentration of 200

cells per well. Cells were allowed to grow for 14 days to

form colonies. At the indicated time point, cells were

washed twice with PBS, treated with Giemsa for 10 min,

washed three times with ddH2O, and then photographed

with a digital camera. The number of colonies ([50 cells/

colony) were counted under fluorescence microscopy

(MicroPublisher 3.3RTV; Olympus, Tokyo, Japan).

Statistical analysis

The data shown are presented as the mean ± standard

deviation (SD) of three independent experiments. Statistical

significance was determined with Student’s t test. A P value

of less than 0.05 was considered significant.

Results

Knockdown of NOB1 by shRNA lentivirus system

in ovarian cancer cells

To investigate the role of NOB1 in ovarian cancer, shRNA

targeting NOB1 or non-silencing sequences were cloned

into pLV-THM-lentiviral vector, respectively. Then, NOB1

shRNA lentivirus or non-silencing shRNA lentivirus

expressing GFP were generated and infected into two

ovarian cancer cell lines, SKOV3 and HEY cells. As shown

in Fig. 1a, the infection efficiency of lentivirus was greater

than 80% after 72 h of infection. The qRT-PCR assay

suggested that NOB1 mRNA level was reduced by about

70% in both cell lines treated with NOB1 shRNA lentivi-

rus, as compared with the control group (Fig. 1b). We also

determined the level of NOB1p protein in cells after 72 h

of lentivirus infection via western blot analysis. In SKOV3

and HEY cell lines, the protein expression of NOB1p was

significantly reduced by about 50% through NOB1 shRNA

lentivirus treatment (Fig. 1c).

NOB1 is important for ovarian cancer cell growth

To further assess the role of NOB1 in regulating ovarian

cancer cell proliferation, MTT assays were performed on

both SKOV3 and HEY cells following lentivirus infection

for 72 h. Figure 2a shows that there were no statistically

significant differences in viability between control cells

and non-infected cells, indicating that the lentiviral system

itself had no cytotoxic effect on cells, whereas the viability

of HEY cells was markedly inhibited by NOB1 knockdown

(P \ 0.05 compared to control). In another ovarian cancer

cell line, SKOV3, the inhibitory effect of sh-NOB1 on cell

proliferation can be observed beginning on day 2; it

became more obvious on days 4 and 5 (P \ 0.05 compared

with the control). Moreover, BrdU incorporation assays

also revealed that the inhibition of NOB1 expression sig-

nificantly reduced the growth rate of SKOV3 and HEY

ovarian cancer cells during the 48-h incubation period

(P \ 0.05 compared with the control, Fig. 2b). These

findings sustained the notion that the knockdown of NOB1

greatly diminished cell proliferative ability.

Knockdown of NOB1 repressed cell colony formation

We then studied the colony-formation capacity of SKOV3

cells treated by NOB1 shRNA lentivirus. HEY cells were

not used in this experiment because they could only form

small colonies, as compared with SKOV-3 cells. Three

groups of SKOV3 cells (sh-NOB1, control and non-infec-

ted cells) were allowed to grow for 14 days to form colo-

nies. As shown in Fig. 3a and b, NOB1 knockdown resulted

in a nearly 0.3-fold decrease in the number of colonies, as

compared with the two control groups (P \ 0.01), whereas

no obvious difference in the number of colonies was found

between control lentivirus-infected cells and non-infected

cells.

Inhibition of NOB1 induced G0/G1 arrest

Knowing that the inhibition of NOB1 in both SKOV3 and

HEY cells markedly slows cell proliferation, we further

Med Oncol (2012) 29:311–317 313

123

employed cell-cycle analysis to uncover the mechanism

governing the inhibitory effect of sh-NOB1 on cell prolif-

eration. As shown in Fig. 4, in SKOV3 cells, an obvious

increase in G1-phase cell population (P \ 0.01) was

observed in the sh-NOB1 group accompanied by a slight

decrease in the S-phase cell population, as compared with

the two control groups. Moreover, HEY cells were slow to

progress through the cell cycle, having a marked G0/G1

phase delay. Our results revealed that sh-NOB1 exerted an

inhibitory effect on ovarian cell proliferation via G0/G1

Fig. 1 NOB1 silencing efficiency by shRNA lentivirus. a Lentivirus

infection in ovarian cancer cell lines. Fluorescence photomicrographs

of ovarian cells infected by lentivirus. Pictures were taken 72 h after

infection at a magnification of 9100. b Identification of NOB1knockdown efficiency using shRNA lentivirus by real-time PCR in

SKOV3 and HEY cells. c Identification of NOB1 knockdown

efficiency using shRNA lentivirus by western blot analysis. Reduced

NOB1p protein levels in SKOV3 and HEY cells are shown. Actin was

used as a loading control. (control: non-silencing shRNA lentivirus;

sh-NOB1: NOB1 shRNA lentivirus). * P \ 0.05 compared with the

control

Fig. 2 NOB1 is important for ovarian cancer cell proliferation.

a NOB1 silencing by shRNA lentivirus resulted in growth inhibition

as detected by MTT assay in SKOV3 and HEY cells. Cells infected

with NOB1 shRNA lentivirus (sh-NOB1) or non-silencing shRNA

lentivirus (control) for 72 h, along with non-treated cells, were seeded

in a 96-well plates, and cell viability was determined at indicated time

points. b NOB1 silencing by shRNA lentivirus led to ovarian cell

growth inhibition as detected by a BrdU incorporation assay. The

growth rates in SKOV3 and HEY cells were calculated. All assays

were performed in triplicate. * P \ 0.05 compared with the control

314 Med Oncol (2012) 29:311–317

123

cell-cycle arrest, indicating that NOB1 may promote cancer

cell growth.

Discussion

The cellular proteome is in a dynamic state consisting of

synthesis and degradation. Degradation of extracellular

proteins is mainly mediated non-specifically by the lyso-

somes or released proteases, while the proteolysis of

intracellular protein, including nuclear proteins, is cata-

lyzed by the ubiquitin–proteasome pathway [9]. NOB1p is

a nuclear protein involved in protein degradation and

controlled proteolysis. NOB1p regulates the maturation of

the 20S proteasome and is then degraded to complete 26S

proteasome biogenesis [7]. In light of the important role of

NOB1 and the critical function of ubiquitin-dependent

proteolysis in universal biological processes, we assumed

that NOB1 may influence oncogenesis through UPP-med-

iated protein degradation.

A number of studies have underscored the link between

UPP and cancer. Decades ago, a number of oncogene and

suppressor gene products were found to be targets of

ubiquitination. For example, nuclear oncoproteins, such as

c-myc, c-fos, p53 and E1A, are among the most rapidly

degraded intracellular proteins. In vitro studies show that

Fig. 3 NOB1 silencing repressed ovarian cancer cell colony forma-

tion. a Photomicrographs of Giemsa-stained colonies of SKOV3 cells

growing in 6-well plates for 14 days after infection. b The number of

cells in each colony of SKOV3 cells was counted. Cell number in sh-

NOB1 group was significantly reduced, as compared with the control

group (* P \ 0.05)

Fig. 4 NOB1 silencing induced a G0/G1 arrest in ovarian cancer

cells. a FACS histograms and cell-cycle analysis of SKOV3 and HEY

cells following non-silencing shRNA or NOB1 shRNA lentivirus

infection. b Quantification of the percentage of cells in cell-cycle

phases G1, S, and G2/M. In the sh-NOB1 group, an obvious increase

in the G1-phase cell population and a significant decrease in the

S-phase cell population was observed, as compared with the control

group (* P \ 0.05)

Med Oncol (2012) 29:311–317 315

123

the ubiquitin system can mediate the degradation of these

oncoproteins [10–12]. Also, a number of oncogenic

mutations and suppressor gene disruptions have been

shown to affect ubiquitination and proteasomal degradation

[5]. In colorectal cancer, mutations at several points of the

b-catenin gene disrupt its ubiquitination and degradation,

leading to the accumulation of b-catenin in the cells [13].

Moreover, a clinical study investigating mantle cell lym-

phoma (MCL) shows that MCLs have normal p27Kip-1

mRNA expression but increased p27Kip-1 protein degra-

dation activity via the proteasome pathway, which is

associated with a decreased overall survival in patients

[14]. Therefore, the ubiquitin system may mediate the

degradation of cancer-related genes that are important in

tumorigenesis. However, the specific functions of the

proteins in UPP, especially the roles of NOB1 in ovarian

cancer, are still unclear.

In this study, we presumed that NOB1 may act as an

oncogenic factor in ovarian cancer development. Given the

prevalence and availability of RNAi technology in cancer

research or cancer therapy [15], we used a lentivirus

shRNA system that can effectively knock down the

expression of NOB1 at both the RNA and protein levels. As

shown in Fig. 1, qRT-PCR and western blot analysis

showed sufficient silencing of NOB1, thus ensuring the

credibility of the subsequent assays. Predictably, reduced

expression of NOB1 in both ovarian cell lines greatly

decreased cancer cell proliferation, as confirmed by MTT

and BrdU cell proliferation assays (Fig. 2). We also proved

that knockdown of NOB1 notably inhibited the colony-

formation capacity of SKOV3 cells (Fig. 3). However,

HEY cells did not easily form colonies in this assay, as

reported previously [16]; thus, they were omitted. Toge-

ther, these results indicate that NOB1 is important for

ovarian cancer cell growth in the short or relative long

term. We then applied a cell-cycle analysis by FACS,

attempting to uncover the mechanism by which sh-NOB1

controls ovarian cell growth. Intriguingly, our data reveal

that sh-NOB1 had an inhibitory effect on ovarian cancer

cell growth via G0/G1 arrest (Fig. 4).

In addition, the present study provided new evidence

pertinent to the role and function of UPP-related proteins in

cancer research. In this study, however, we did not discover

exactly how NOB1 influences cancer cell proliferation. We

inferred that the dysregulation of NOB1 may affect the Ub

pathway and degradation of certain proteins that govern

cell cycling, such as p27Kip-1 or other cell-cycle regulators.

For example, the levels of p27Kip-1 are largely controlled

by post-transcriptional ubiquitin-mediated degradation

[17]. Therefore, aberrant regulation of NOB1 may even-

tually influence the levels of p27Kip-1 and may disrupt cell

growth control. To test this hypothesis, further research

examining the interaction between NOB1p and its down-

stream target proteins is needed.

Conclusion

The present study proved for the first time that RNAi-

mediated knockdown of NOB1 suppresses the growth and

colony-formation ability of ovarian cancer cells. In addi-

tion, NOB1 inhibition arrests the cell cycle in the G0/G1

phase. Our data indicated that NOB1 may serve as an

oncogene in ovarian cancer development. Therefore, NOB1

has considerable potential to be a new therapeutic target for

the treatment of ovarian cancer.

Acknowledgments The authors are thankful for financial support

from the National Natural Science Foundation of China (30973187)

and Jilin Science and Technology Funds (200705203, 20080134 and

200905146).

References

1. Simpson MV. The release of labeled amino acids from the pro-

teins of rat liver slices. J Biol Chem. 1953;201:143–54.

2. Glickman MH, Ciechanover A. The ubiquitin-proteasome pro-

teolytic pathway: destruction for the sake of construction. Physiol

Rev. 2002;82:373–428.

3. Ferrell K, Wilkinson CR, Dubiel W, Gordon C. Regulatory

subunit interactions of the 26S proteasome, a complex problem.

Trends Biochem Sci. 2000;25:83–8.

4. Hershko A, Ciechanover A. The ubiquitin system. Annu Rev

Biochem. 1998;67:425–79.

5. Mani A, Gelmann EP. The ubiquitin-proteasome pathway and its

role in cancer. J Clin Oncol. 2005;23:4776–89.

6. Tone Y, et al. Nob1p, a new essential protein, associates with the

26S proteasome of growing saccharomyces cerevisiae cells.

Gene. 2000;243:37–45.

7. Tone Y, Toh EA. Nob1p is required for biogenesis of the 26S

proteasome and degraded upon its maturation in Saccharomyces

cerevisiae. Genes Dev. 2002;16:3142–57.

8. Oehler VG, et al. The derivation of diagnostic markers of chronic

myeloid leukemia progression from microarray data. Blood.

2009;114:3292–8.

9. Bader N, Jung T, Grune T. The proteasome and its role in nuclear

protein maintenance. Exp Gerontol. 2007;42:864–70.

10. Rogers S, Wells R, Rechsteiner M. Amino acid sequences com-

mon to rapidly degraded proteins: the PEST hypothesis. Science.

1986;234:364–8.

11. Ciechanover A, Finley D, Varshavsky A. Ubiquitin dependence

of selective protein degradation demonstrated in the mammalian

cell cycle mutant ts85. Cell. 1984;37:57–66.

12. Ciechanover A, et al. Degradation of nuclear oncoproteins by the

ubiquitin system in vitro. Proc Natl Acad Sci USA.

1991;88:139–43.

13. Sparks AB, Morin PJ, Vogelstein B, Kinzler KW. Mutational

analysis of the APC/beta-catenin/Tcf pathway in colorectal can-

cer. Cancer Res. 1998;58:1130–4.

14. Chiarle R, et al. Increased proteasome degradation of cyclin-

dependent kinase inhibitor p27 is associated with a decreased

316 Med Oncol (2012) 29:311–317

123

overall survival in mantle cell lymphoma. Blood. 2000;95:

619–26.

15. Izquierdo M. Short interfering RNAs as a tool for cancer gene

therapy. Cancer Gene Ther. 2005;12:217–27.

16. Xu Y, Fang XJ, Casey G, Mills GB. Lysophospholipids activate

ovarian and breast cancer cells. Biochem J 1995;309:933–40.

17. Shirane M, et al. Down-regulation of p27(Kip1) by two mecha-

nisms, ubiquitin-mediated degradation and proteolytic process-

ing. J Biol Chem. 1999;274:13886–93.

Med Oncol (2012) 29:311–317 317

123