rna interference based resistance against chili leaf curl

RNA interference based resistance against chili leaf curl disease complex

A dissertation submitted to Quaid-i-Azam University, Islamabad in

partial fulfilment of requirements for the degree of

DOCTOR OF PHILOSPHY

IN

BIOTECHNOLOGY

By

Muhammad Shafiq

National Institute for Biotechnology and Genetic Engineering

(NIBGE), Faisalabad

and

Quaid-i-Azam University Islamabad, Pakistan

2013

NIBGE |School of Biotechnology NIBGE Faisalabad [QAU Islamabad]

ii

The Controller of Examinations,

Quaid-i-Azam University

Islamabad

This thesis submitted by Mr. Muhammad Shafiq is accepted in its present form by

Quaid-i-Azam University Islamabad as satisfying the thesis requirements for the

award of the degree of Doctor of Philosophy in Biotechnology.

Supervisor: -------------------------------------------- (Dr. Yusuf Zafar T.I) Minister (Technical)

Permanent Mission of Pakistan to the IAEA

Hofzeile 13, A-1190

Vienna – Austria

Co-Supervisor: ---------------------------------- (Dr. Shaheen Aftab) National Institute for Biotechnology and Genetic

Engineering, Faisalabad.

External Examiner 1 ------------------------------------

Dr. Asif Ali Khan Professor, Department Plant Breeding and Genetics, University of Agriculture Faisalabad

External Examiner 2 ------------------------------------

Dr. Sultan Habibullah Khan Assistant Professor, Centre for Agricultural Biochemistry and Biotechnology University of Agriculture Faisalabad

Director: ------------------------------------

(Dr. Shahid Mansoor S.I) National Institute for Biotechnology and Genetic

Engineering, Faisalabad.


iii

ABSTRACT

Chilli (Capsicum annuum), a member of the family Solanaceae, is an important spice

crop cultivated in tropical and subtropical countries. Chilli leaf curl disease (ChLCD)

is a limiting factor for chilli yield across Pakistan and India. Symptoms of ChLCD

include severe upward leaf curl with cup-shape, yellowing and stunted plant growth.

This disease is caused by begomoviruses (single-stranded DNA viruses (family

Geminiviridae) that are transmitted by whiteflies). All three different types of

begomoviruses are already reported from chillies. In this study chilli samples showing

typical disease symptoms were collected from Faisalabad in the Province of Punjab

(Pakistan) during the year 2006. All samples were positive for begomoviruses and

Pepper leaf curl Lahore virus (PepLCLV) along with Tomato leaf curl New Delhi

virus DNA B and Chilli leaf curl betasatellite (ChLCB) were identified. The DNA of

Pepper leaf curl Lahore virus consisted of 2747 nucleotides and had the highest

sequence identity (99%) with PepLCLV-[PK: Lah: 04] AM404179). Agrobacterium-

mediated inoculation of the partial repeat construct of PepLCLV clone obtained in

this study to Nicotiana benthamiana induced very mild symptoms and very low flow

of viral DNA were detected in infected plant leaves. Co-inoculation of ChLCB with

PepLCLV to N. benthamiana did not affect the symptoms severity or the virus titre.

However neither the PepLCLV alone or with ChLCB was able to induce any

symptoms on N. tabacum L. and C. annuum. Inoculation of PepLCLV with DNA B

of ToLCNDV induced very severe symptoms in N. benthamiana, N. tabacum and

symptoms typical of ChLCD in C. annuum. Southern hybridization analysis showed

very high DNA accumulation for PepLCLV and DNA B of ToLCNDV in all three

plant species. Sequence analysis showed that predicted rep-binding iterons in

PepLCLV (GGGGAC) was different with two nucleotides from that of ToLCNDV

DNA B (GGTGTC). This indicated tolerance of two nucleotide differences in iterated

elements for replication. Based on this study, it is proposed that PepLCLV has been

recently mobilized into chillies upon its interaction with DNA B of ToLCNDV. This

is the first experimental demonstration of infectivity for a bipartite begomovirus

causing ChLCD in chillies from Pakistan and suggests that component capture may

contribute to the emerging complexity of begomovirus diseases in the region.


iv

The purpose of this study was to develop a broad-spectrum resistance against ChLCD

complex based on the concept of pathogen-derived resistance. A hairpin RNAi

construct (peAC1-AC2dsRNA/pFGC) based on overlapping region of highly

conserved region of Rep and TrAP of PepLCLV was produced in a binary vector

pFGC5941. In order to study silencing efficiency of peAC1-AC2dsRNA/pFGC, the

construct was transiently challenged with PepLCLV along with DNA B ToLCNDV.

Results showed that the RNAi construct was successful in blocking the viral infection

as all tested plants were symptomless. Transgenic tobacco plants expressing this

construct challenged with PepLCLV and DNA B of ToLCNDV by agroinoculation

and with viruliferous whiteflies showed variable resistance ranging from 6.6% to

93.3%. Lines showing resistance more than 75% were ranked resistant/tolerant while

lines showing resistance less than 50% were ranked susceptible. One line TA14

showing 93.3% was ranked as highly resistant/tolerant while the line TA 3.2 showing

6.6 % resistance/tolerance was ranked as highly suscepteible. These lines also

exhibited significant resistance against ToLCNDV. The relatively conserved nature of

Rep and TrAP and their ability to help in development of resistance against

heterologous virus suggested that the technology may be useful to develop broad-

spectrum resistance. Plants need broad spectrum resistance because they were often

infected with multiple begomoviruses in the field.

Some viral proteins interfere with different cell signalling pathways and induce

symptoms in plants. For example expression of P6 protein of CaMV in Arabidopsis

induced dwarfness in transgenic plants. It is reported that Arabidopsis plants with

TIR3 gene mutated (tir3) are also dwarf. P6 transgenic (A7, B6) and tir3 Arabidopsis

plants which were resistant to auxin and ethylene also showed resitance to 2,3,5-

Triiodobenzoic Acid (TIBA) treatment. It indicates that P6 interacts with a pathway

overlapped with TIR pathway. Symptoms in Arabidopsis expressing the P6 protein of

CaMV probably comes by disturbance of auxin response factor 10 (ARF10), ARF16,

and ARF17 also. Also P6-expressing transgenic Arabidopsis plants showed reduced

accumulation of miR160 which is known to regulate ARF10, ARF16 and ARF17.

A protocol was also developed for chilli plant regeneration using hypocotyl and

cotyledon explants. The study was conducted to observe the effect of genotypes,

culture conditions and growth regulators on plant regeneration of chili pepper (C.


v

annuum) genotypes grown in Pakistan including Seedex Pepper (SP), Loungi,

Tatapuri and Sanam. Of the evaluated genotypes, SP was found to be the most

responsive for both hypocotyl and cotyledon explants. Hypocotyl and cotyledon

explants were tested for transformation by A. tumefactions LBA4404 having the 35S

GFP/pFGC construct and A. tumefaciens EHA105 with peAC1-AC2dsRNA/pFGC

construct. Co-cultivation at different temperatures (22 and 25ºC), photoperiods (16h

light 8h dark, and complete darkness) as well as co-cultivation time periods, were

evaluated. GFP assays showed that putative transgenic calli had not been transformed

and calli died after 40-60 days. The experiment was repeated ten times.

The data presented in this thesis should help in devising novel control strategies

against Begomoviruses. A combination of novel sources of resistance with natural

sources of resistance may help to exploit the technology in the field conditions.

However, because most pepper varieties are recalcitrant to genetic transformation,

control of diseases caused by the ChLCD complex using this strategy awaits future

progress.


vi

Acknowledgment

All the praise and thanks to almighty Allah, who is the compassionate, the merciful,

the creator of the universe and source of all knowledge and wisdom. I offer my

humblest thanks to „The Holy Prophet Hazrat Mohammed” (Peace Be Upon Him)

who ordained every Muslim to yearn for knowledge from the cradle to grave.

It is my pleasure to thank Dr. Shahid Mansoor S.I Director NIBGE who kindly gave

me permission and access to facilities available at NIBGE to carry out this research

work. I wish to express my deep sense of gratitude for my supervisor, Dr. Yusuf

Zafar T.I Minister (Technical); Permanent Mission of Pakistan to the IAEA

Vienna - Austria who has made a great contribution for the successful completion of

this work.

I am extremely thankful to my co-supervisor Dr. Shaheen Asad (PSO). It was indeed

an honor to work under his guidance. Her personal interest, extremely amicable

encouraging behavior and ample support helped me in the successful completion of

this work.

It is my pleasure to thank Dr. Rob. W Briddon for his help, suggestions and all kind

support.

Special thanks to Mr. Muhammad Arshad (SS) for his encouraging attitude and

moral support. I am also thankful to my Dr. Zahid Mukhtar for his valuable help

open heart and cooperation.

I am at short for worlds to express my gratitude to my friends Muhammad Ikram

Anwar, Dr. Farooq, Muhammad AAmir Mehmood, Khadim Hussain,

Muhammad Arshad, Muhammad Asif Habib, Muhammad Mubin, and Mutahar

Mansoor Qaisrani for his all time available help and sincere cooperation.

I am also grateful to my other lab fellows Ghulam Raza, Kazim Ali Muhammad

Ismail Lashari, Jamil Amjad Hashmi and Arif Khan for their cooperation and nice

company.


vii

No acknowledgment would ever adequetly express my obligation to my parents,

brother Ghulam Abid, my wife and my son Muhammad Faizan Rasul (late) and

my daughter Maryam Naseem who‟s love and prays will always remain with me.

Muhammad Shafiq


viii

Dedicated

To

Prophet Muhammad

(Peace be upon him)

My mother

And

Son

(Muhammad Faizan Rasul)

ABBREVIATIONS

µL microlitre

AAP acquisition access period

AD Anno Domini


ix

asRNA anti-sense RNA

AVRDC Asian Vegetable Research and Development Centre

AZPs artificial zinc finger proteins

BC Before Christ

BND benzoylated naphthoylated DEAE BSA bovine serum albumin

CaCl2 calcium chloride cccDNA covalently closed circular DNA

CIAP calf intestine alkaline phosphatase

CLCuD cotton leaf curl disease

CP coat protein

CR common region

CTAB cetyl trimethyl ammonium bromide

DEAE diethylaminoethyl cellulose

DNA deoxyribonucleic acid

DNAi DNA interference

dNTP deoxyribonucleotide triphosphate

dsDNA double-stranded DNA

dsRNA double-stranded RNA

DTT dithiothreitol

EDTA ethylene diamine tetraacetic acid

EU European Union

FeSO4.7H2O ferrous sulphate hepta hydrate

GFP green fluorescence protein

GUS beta-glucuronidase

hpRNA hairpin RNA

HR hypersensitive response

ICTV International Committee on Taxonomy of Viruses

IPTG isopropyl-beta-D-1-thiogalactopyranoside

IR intergenic region

IRD iteron related domain K2HPO4 dipotassium phosphate

KCl potassium chloride kDa kilo Dalton

kV kilo Volt LB Luria broth

LIR large intergenic region LYMV legume yellow mosaic virus

MCS multiple cloning site

mg milligram

MgSO4 magnesium sulphate

MgSO4.7H2O magnesium sulphate heptahydrate

miRNA microRNA

mM milli molar

MP Movement Protien

mRNA messenger RNA

NaCl sodium chloride

NaH2PO4 sodium phosphate

NH4Cl ammonium chloride

NLS nuclear localization signals


x

NSP nuclear shuttle protein

nt. Nucleotide

NW New World

OD optical density

ORF open reading frame

OW Old World

PCNA proliferating cell nuclear antigen

PCR polymerase chain reaction

PDR pathogen derived resistance

pH paviour of hydrogen

Pre-miRNA precursor miRNA

PVP polyvinyl pyrrolidone

RCA rolling circle amplification

RCR rolling circle replication

RDR recombination-dependent replication

RdRP RNA dependent RNA polymerase

REn replication enhancer protein

Rep replication associated protein

RISC RNA-induced silencing complex

RNA ribonucleic acid

RNAi RNA interference

rpm revolutions per minute

SBS School of Biological Sciences

SCR satellite-conserved region

SDS sodium dodecyl sulphate

SIR small intergenic region

siRNA small interfering RNA

SSC standard sodium citrate

ssDNA single-stranded DNA

TAE tris-acetate EDTA

Taq Thermus aquaticus

ta-siRNAs trans-acting siRNAs

TGS transcriptional gene silencing

TrAP transcriptional activator protein

T-Rep truncated Rep

UV ultra violet

VIGS virus induced gene silencing

X-Gal 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside

YMD yellow mosaic disease

VIRUSES AND SATELLITES

Abutilon mosaic virus (AbMV)

African cassava mosaic virus (ACMV)

Ageratum yellow vein virus (AYVV)

Bean dwarf mosaic virus (BDMV)


xi

Bean golden yellow mosaic virus (BGYMV) Bean leaf curl China betasatellite (BLCCNB)

Bean yellow dwarf virus (BeYDV) Beet curly top virus (BCTV)

Beet severe curly top virus (BSCTV)

Cabbage leaf curl virus (CabLCuV)

Cestrum yellow leaf curling virus (CmYLCV)

Chilli leaf curl betasatellite (ChLCB)

Chilli leaf curl virus (ChiLCV)

Citrus tristezia virus (CTV)

Corchorus golden mosaic virus (CoGMV)

Corchorus yellow vein virus (CoYVV)

Cotton leaf curl Kokhran virus (CLCuKV)

Cotton leaf curl Multan betasatellite (CLCuMB) Cotton leaf curl Multan virus (CLCuMV)

Cowpea golden mosaic virus (CPGMV)

East African cassava mosaic Cameroon virus (EACMCV)

East African cassava mosaic Zanzibar virus (EACMZV)

Erectites yellow mosaic betasatellite (ErYMB)

Euphorbia leaf curl virus (EuLCV)

Horesgram yellow mosaic virus (HgYMV)

Indian cassava mosaic virus (ICMV)

Kenaf leaf curl betasatellite (KLCuB)

Kudzu mosaic virus (KuMV)

Maize streak virus (MSV)

Mesta yellow mosaic betasatellite (MeYMB) Mungbean yellow mosaic India virus (MYMIV)

Mungbean yellow mosaic virus (MYMV)

Okra leaf curl betasatellite (OLCuB)

Papaya leaf curl betasatellite (PaLCuB) Papaya leaf curl China virus (PaLCuCNV)

Papaya leaf curl Guangdong virus (PaLCuGuV)

Papaya leaf curl virus (PaLCuV)

Pedilanthus leaf curl virus (PedLCV)

Pepper leaf curl Bangladesh virus (PepLCBDV)

Pepper leaf curl Lahore virus (PepLCLV)

Potato virus X (PVX)

Squash leaf curl virus (SqLCV) Sri Lankan cassava mosaic virus (SLCMV)

Tobacco curly shoot betasatellite (TbCSB) Tobacco leaf curl betasatellite (TbLCB)

Tobacco mosaic virus (TMV)

Tobacco yellow dwarf virus (TbYDV)

Tomato golden mosaic virus (TGMV)

Tomato leaf curl Bangalore betasatellite (ToLCBB)

Tomato leaf curl Bangalore virus (ToLCBV)

Tomato leaf curl Bangladesh betasatellite (ToLCBDB)

Tomato leaf curl Bangladesh virus (ToLCBDV)

Tomato leaf curl China betasatellite (ToLCCNB)

Tomato leaf curl China virus (ToLCCNV)


xii

Tomato leaf curl Gujrat virus (ToLCGV)

Tomato leaf curl Karnatka virus (ToLCKV) Tomato leaf curl New Delhi virus (ToLCNDV)

Tomato leaf curl virus (ToLCV)

Tomato mottle virus (ToMoV)

Tomato pseudo-curly top virus (TPCTV)

Tomato yellow leaf curl China betasatellite (TYLCCNB)

Tomato yellow leaf curl China virus (TYLCCNV)

Tomato yellow leaf curl virus (TYLCV)


xiii

Table of Contents

Chapter 1 Introduction and review of literature

1.1 Plant viruses

1.2 Geminiviruses

1.3 Begomoviruses

1.4 Satellites

1.5 DNA replication of geminiviruses

1.6 Evolution of geminiviruses

1.7 Strategies for engineering broad spectrum resistance to geminiviruses

1.7.1 Resistance by the expression of proteins

1.7.2 Defective interfering DNA

1.7.3 Antisense RNA-mediated resistance

1.7.4 RNA interference

1.8 Chilli pepper

1.8.1 Plant transformation in chili pepper

Chapter 2 Materials and methods

2.1 Collection of viral infected plant samples

2.2 Isolation of total genomic DNA

2.3 DNA quantification

2.4 PCR amplification

2.5 Agarose gel electrophoresis of PCR products

2.6 Cloning of genes in a TA cloning vector pTZ57R

2.6.1 Purification and ligation of PCR product in TA vector

2.6.2 Preparation of compeent E. coli cells

2.6.3 Transformation of ligation products into E. coli strain DH5α

2.6.4 Screening of the trans-conjugant clones

2.6.5 Plasmid isolation from recombinant E. coli

2.6.6 Verification of clones

2.6.7 Agarose gel electrophoresis

2.7 DNA sequencing

2.8 Sequence analysis

2.9 Transient Assays

2.10 Plant transformation through Agrobacterium -mediated in Nicotiana tabacum

(CV. Samsun).

2.11 Isolation of total genomic DNA from Nicotiana tabacum plants

2.12 Southern blot hybridization to check the integration of the transgene

2.13 Basta sensitivity test

2.14 Isolation of total RNA

2.15 siRNA analysis of the transgenic plants

2.16 Virus resistance evaluation

2.17 Viral replication in transgenic plants


xiv

Chapter 3 Component captured by begomovirus; Pepper leaf curl Lahore

virus requires DNA B of Tomato leaf curl New Delhi to cause leaf curl

symptoms

3.1 Introduction

3.2 Material and methods 3.2.1 Collection of virus infected plant samples

3.2.2 Isolation, cloning and sequencing

3.2.3 Agrobacterium-mediated inoculation of plants

3.3 Results 3.3.1 Detection of begomovirus components in chilli samples showing leaf curl

symptoms 3.3.2 Analysis of the sequence of PGL1

3.3.3 Infectivity and symptoms of PepLCLV

3.3.4 PepLCLV trans-replicates ToLCNDV DNA B and induces leaf curl

symptoms

3.4 Discussion

Chapter 4 Resistance against chilli leaf curl disease complex (ChLCD) using

RNA interference

4.1 Introduction

4.2 Material and Methods

4.2.1 Cloning of RNAi based gene constructs

4.2.2 Transient assays

4.2.2 Plant transformation

4.2.3 Challenge with virus

4.3 Results

4.3.1 RNAi constructs silence ChLCV-M Rep in transient assays

4.3.2 RNAi constructs for PepLCLV in transient assays

4.3.3 Plant Transformation

4.3.4 Transgenic tobacco resistant to ChLCD complex

4.3.5 Transgenic tobacco resistant to heterologus virus

4.4 Discussion

Chapter 5 The role of Cauliflower mosaic virus (CaMV) defence and silencing

suppressor protein 6 (p6) in modulating auxin signaling

5.1 Introduction

5.2 Material and Methods.

5.2.1 TIBA plate Experiment

5.2.2 miRNA detection from A7, B6 and Ler gl1

5.3 Results:

5.4 Discussion

Chapter 6 Response of different (Capsicum annuum L) genotypes for callus

induction, plant regeneration and plant transformation

475bp


xv

6.1 Introduction

6.2 Materials and Methods

6.2.1 Plant material, Seed Germination and Explant preparation

6.2.2 Culture Medium and condition

6.2.3 Agrobacterium-mediated genetic transformation in chilli pepper (Capsicum

annuum L)

6.3 Results

6.3.1 Callus Induction

6.3.2 Plant regeneration from calli

6.3.3 Effect of different factors on Agrobacterium-mediated plant transformation in

chilli pepper (Capsicum annuum L)

6.4 Disscussion

Chapter 7 General discussion

Chapter 8 References


xvi

TABLES

Table 1.1 Approximate protein size and function of different ORF of geminivirus

Table 1.2 Plant RNAi transformation vectors and their attributes

Table 2.1 Names, sequences and brief description of primers used in this study.

Table 3.1 Features of the begomovirus isolated from Capsicum annuum

Table 3.2 Pairwise percent of nucleotide identities between the genomic

components and protein sequence identities of encoded genes from the

virus isolate PGL1 with the components and genes of all isolates

available in the databases of selected other begomovirus species.

Table 4.1 Primers designed for the amplification of AC1-AC2 in the sense and

antisense orientation. The restriction sites included in primers are

underlined.

Table 4.2 Regeneration and transformation efficiencies of transformed tobacco

leaf discs

Table 4.3 ChLCD resistance/tolerance pattern for peAC1-AC2dsRNA/pFGC plants at T1

stage.

Table 6.1 Chilli callus induction medium (ChC)

Table 6.2 Chilli shoot regeneration medium (ChSR)

Table 6.3 Growth regulators and their stock preparation

Table 6.4 Analysis of Variance Table for chilli callus induction

Table 6.5 Effect of genotype on chilli callus induction.

Table 6.8 Interaction of genotype and explants (hypocotyl and cotyledon)

response on chilli callus induction.

Table 6.8 Effect of combination of genotype, explants and callus induction

medium response on chilli callus induction.

Table 6.9 Analysis of variance table for plant regeneration

Table 6.10 Effect of genotype on chilli plant regeneration.

Table 6.11 Effect of combination of genotype, explant and shoot regeneration

medium on plant regeneration from chilli calli.


xvii

FIGURES

Figure 1.1 Maize streak virus particle (Geminivirus Cryo-electron microscopy

image)

Figure 1.2 Genetic organization of begoviruses

Figure 1.3 General mechanism of RNAi

Figure 3.1 Phylogenetic dendrograms based upon an alignment of selected

complete sequences (or DNA A components) of begomoviruses.

Figure 3.2 Alignment of the N-terminal amino acid sequences of the Rep protein of

PepLCLV (PGL1) clone with the sequences of other begomoviruses infecting

chilli on the Indian subcontinent.

Figure 3.3 Alignment of the intergenic region sequences of PepLCLV (PGL1),

ToLCNDV DNA A and DNA B.

Figure 3.4 Symptoms induced by PepLCLV clone PGL1 in N. benthamiana, N. tabacum

and C. annuum.

Figure 3.5 Virus replication in systemic leaves of inoculated N. benthamiana plants

probed with PGL1.

Figure 4.1 Sliding window plot showing the distribution of genetic variation

estimated by nucleotide diversity (Pi) for geminivirus infecting

Capsicum annuum in Pakistan.

Figure 4.2 A diagram demonstrating the binary vector (pFGC5941) engineered

with the silencing trigger construct.

Figure 4.3 Transient assays through agro co-infiltration in young Nicotiana

benthamaiana plants.

Figure 4.4 Transient assays of construct peAC1-AC2dsRNA/pFGC in Nicotiana

benthamiana with PepLCLV and ToLCNDV DNA B.

Figure 4.5 Inhibition of virus replication in systemic leaves of agroinfiltrated N.

benthamiana plants probed

Figure 4.6 Plant transformations in N. tabacum

Figure 4.7 Confirmation of the transgenic plants

Figure 4.7 Virus resistance assay.

Figure 4.8 Dot Blot analysis of replication of PepLCLV in RNAi transgenic plant

following exposure to viruliferous whitefly


xviii

Figure 4.9 Virus resistance assay.

Figure 4.10 Southern blot analysis of transgenic plants (peAC1 -

AC2dsRNA/pFGC) inoculated with PepLCLV (PGL1) and ToLCNDV

DNA B.

Figure 4.11 Virus resistance assay

Figure 5.1 Effect of 3,5-triiodobenzoic acid (TIBA, auxin transport inhibior) on

Arabidiopsis lines

Figure 5.2 Expression of ath-MIR160 (A) and ath-MIR167 (B) miRNA probe on

P6 transgenic and wild type plant

Figure 6.1 Effect of genotype on chilli callus induction

Figure 6.2 Interaction of genotype and explants (hypocotyl and cotyledon)

response on chilli callus induction

Figure 6.3 Combination of genotype, explants and callus induction medium

response on chilli callus induction.

Figure 6.4 Effect of genotype on chilli plant regeneration

Figure 6.5 Effect of combination of genotype, explant and shoot regeneration

medium on plant regeneration from chilli calli.

Figure 6.6 Different steps in chili tissue culture

Figure 6.7 Plant transformations in chilies and transgene analysis.


1

1

1.1 Plant viruses

Viruses are small and tiny infectious and obligate intracellular pathogen and emerged

as the most difficult, formidable and complex plant pathogens [1-7]. Tobacco

mosaic virus (TMV) was identified as the first virus which was discovered [8]. ICTV

in their 9th

meeting has approved ~2284 species of viruses that infect plants. Some

plant viruses have single stranded ssDNA or double-stranded dsDNA genome,

whereas others have dsRNA genomes. Approximately 90 % of plant viruses contains

ssRNA genome. A group of viruses belongs to family Caulimoviridae are Double

stranded DNA (dsDNA) viruses whereas Nano viruses and Gemini viruses are ssDNA

viruses [9].

Plant virus genomes characterization at molecular level has been recently focused

with a particular interest in determining virus movement replication and infection in

plants. Understanding the virus gene functions has been used to explore the potential

for commercial use by biotechnology companies. Viral-derived sequences have been

particularly used to provide an understanding of novel forms of resistance [9].

1.2 Gemini viruses

Gemini viruses are ssDNA plant viruses characterized by small geminate particles

(18×20 cm) which are transmitted by insects, particularly leafhoppers and whiteflies

[10]. Gemini viruses can wipe out entire crops of many different plants [4, 6, 7, 11,

12], making them a serious threat to farming industry worldwide [12, 13]. Climate

change, food trade and agricultural practices; are major factors for the dissemination

of insect vectors and spread of geminiviruses into more temperate regions from

tropical region. [2, 14, 15]. Geminiviridae constitutes the second largest family [2,

16].

Gemini viruses replicates in the infected cells nuclei by a rolling circle mechanism

(RCR) and do not encodes for their own polymerases [17, 18,19]. However,

Gemoniviruses depends on plant factors to support their replication [20, 21]. Maize

streak virus (MSV), localize to differentiated, quiescent cells [22, 23]. By contrast,

Abutilon mosaic virus (AMV) is restricted to vascular tissues [24, 25]. Gemini viruses

http://en.wikipedia.org/wiki/Genomes


2

2 are important tools for studying virus–plant interactions, cell cycle and DNA

replication in plants [2, 26, 27]. There are seven genera in the family Geminivirdae

Gemini viruses are classified into seven major genera based on their genome structure

(mono or bi partite), insect vector, and plant host range [7, 28-31].

Nomenclature and taxonomy of geminivirus is complex because the number of

different genomic sequences in data bases are increasing [8, 32, Fauquet, 2003

#1587]. The ICTV introduced a new species demarcation criteria for which 89 %

sequence homology proposed for new species using the DNA star software clustal V

package [9] and 85–94 % nucleotide (nt) identity correspond to strain of the same

virus species and 92–100 % nucleotide identity is proposed for the new variant.

Figure 1.1

Maize streak virus particle (Geminivirus Cryo-electron microscopy image). Image reproduced from [33].

Genus Mastreviruses are leafhopper transmitted geminiviruses and has monopartite

genome and infect both dicots and monocots plants [34]. These are mostly found in

the Old World. Maiz streak virus (MSV) are the most widely characterized member

[34, 35]. Mastrevirus genome contains a small (SIR) and large (LIR) intergenic

region, which is located at opposite sides of the circular genomes. The LIR contains

ori for the synthesis of virion-strand DNA [35].


3

3 Genus Curtovirus have leafhopper-transmitted dicot infecting geminivirus with

monopartite 3.0 kb ssDNA circular genomes. [36]. The known type member of this

genus is Beet curly top virus (BCTV). Genome arrangements of curtovirus is quite

similar to that of monopartite begomoviruses. Coat protein (ORF V1) of BCTV is

necessary for systemic movement [37]. [38] recognized different regions of the beet

mild curly top virus (BMCTV) capsid protein involved in formation of virion,

systemic infection, transmission through leaf hopper and its most important role in

systemic infection [39].

The genus topocuvirus contain the sole treehopper transmitted geminivirus tomato

pseudo-curly top virus (TPCTV). This genus has a monopartite ssDNA circular

genome and its genetic organization is similar to that of curtoviruses and represents

the well characterized genus of geminiviruses [40, 41].

Genus Becurtovirus contains only one genome segment that codes for five proteins

(two reverse with spliced replication and involved in initiation of protein formation

while three forward), on virion sense strand origion of replication (TAAGATTCC)

[42]. These viruses are transmitted through leaf hoppers in to Dicotyledonous plants

[43].

Similarly Eragrovirus also contains one fragments of genome that codes for four

proteins and origin of replication TAAGATTCC on virion strand. These viruses

infects mostly monocotyledonous plants and their mode of transmission through

vector is not known.

Turncurtovirus also contain one genome fragment with six proteins (four reverse and

two forward), their vector is not still known. These viruses infect dicots and distantly

related to curtoviruses.

1.3 Begomoviruses

Begomoviruses are the whitefly transmitted dicot infecting geminivirus (WTG),

which comprises more than 200 species [3, 6, 44]. There are three types of

Begomoviruses i.e bipartite, monopartite as well as monopartite requiring beta

satellite. Bipartite begomoviruses contains Coat protein, Rep and Open reading frame


4

4 (ORF) for replication for replication and virion formation. DNA B components of

begomovirus genome contains two proteins that are involved in inter- and intra-

cellular movement of virion within the plants [26]. In genome of begomoviruses there

is conserved motif that control gene expression and replication, in the form of a stem

loop putative structure which contain a conserved nonanucleotide TAATATTAC

[26].

Bipartite begomovirus has been mostly identified in new world but now recently

bipartite begomoviruse is isolated and characterized from the old-world. ToLCNDV

is the best example of bipartite found in the old-world.and contain both DNA A and

DNA B componenet[4, 45]. However, some begomoviruses has a monopartite

genome which is associated with a single-stranded DNA betasatellite and also termed

as DNA β [46-49]. DNA A has 6-7 gene and DNA B has 2 gene and function of each

is summarized in table 1.1.

1.4 Satellites

Satellites molecules are ssDNA viruses that depend on a helper DNA A virus

component for replication and encapsidation. These satellite molecules lack sequence

homology with helper virus “genome” [50]. This type of molecules are found

commonly with RNA viruses. Satellites lessen the severity of symptoms in infected

plants by interfering with the replication of their helper viruses and [51]. Few viruses

are known that are not associated with helper viruses and produced different

symptoms [52, 53].


5

5

Table 1.1

Approximate protein size and function of different ORF of geminiviruses

ORF Appr.

Sizes

Functions

AC1 40.2 kDa, Required for replication, site-specific nuclease, ligase,

auto suppressor, and DNA sequence-specific binding

protein. Cell cycle regulatory protein [54, 55].

AC2 19.6 kDa Transactivator for AV1 and BV1 gene expression and

also suppressor of RNA silencing [56-61].

AC3 15.6 kDa Increases the replication efficiency of geminiviruses.

[56]

AC4 12.0 kDa Disease symptom and movement? [57]

AV1 29.7 kDa Capsid protein, vector specificity and may regulate the

ss/ds DNA ratio [62].

AV2 12.8 kDa Functions in virus movement in groups II [63-65].

BC1 29.6 kDa Virus movement (N.A. cell to cell trafficking), host

ranges and symptom development [66] [67, 68].

BV1 33.1 kDa Virus movement (Transport N.A. out of nuclei) and host

ranges [66-68].


6

6

Figure 1.2

Begomoviruses genetic organization


7

7

Tomato leaf curl virus satellite (ToLCV-sat); a single begomovirus approximately 682

nt was shown to be associated with a ToLCV. ToLCV-sat had no apparent effects on

viral replication and symptoms caused by ToLCV [69, 70]. ToLCV-sat is not exactly

related to ToLCV in terms of genome sequence length and needs ToLCV for

replication and insect transmission in plants.

Several satellite molecules i.e, Tomato leaf curl virus satellite were identified from

other monopartite begomoviruses and these molecules are known as beta satellites

that‟s are 1350 nt. In length. These molecules required a helper viruses for their

replication and movement in plants as well as transmission into insect vectors.

However, beta satellite effects the replication of their helper begomoviruses hence,

altered the symptoms in plants [47, 71].

Sequence analysis of beta satellite DNA molecules discovered that they are

approximately the half the size of helper virus DNA A and has only homology with

conserved hairpin structure and a TAATATTAC loop sequence, and has have little or

no resemblance to either DNA A or DNA B molecules of begomoviruses. Beta

satellite entails begomovirus DNA A helper component for replication, encapsidation,

movement in plants and insect transmission [6, 47, 51, 71]. Beta satellite has three

structural features: a 115 bp highly conserved region, βC1 gene and an adenine-rich

region, however βC1 gene, [69] which is located on complementary sense strand, is

conserved both size and position in all beta satellite species [47, 72]. βC1 gene has

the capability to encode a 13- to 14-kDa protein containing 118 amino acids [73]; [69,

74]. The accurate job of beta satellite and its C1 protein in pathogenesis is

unidentified although it has been projected that beta satellite may show a straight or

an unplanned role in replication, assisting movement, or counteracting host defense

response [75]. C1 protein binds DNA in size and a sequence specific manner. It also

exploits the host plant immune system as a suppressor of RNA silencing [75].


8

8

Alpha satellite, another types of satellite like molecules [76-78] which encode only a

single product with resemblance to the Rep protein of Nano viruses [79]; another

family of plant infecting single-stranded DNA viruses [80]. Alpha satellite has the

ability to self-replicate in the plant cell, but require the helper component of ssDNA

begomovirus for movement in plants and encapsidation for whitefly transmission.

Alpha satellite seems to have no part in the disease development, being unnecessary

both for infection and symptom stimulation in host plants [81, 82].

Begomovirus associated satellite molecules are mostly present in the old world and

are important components of plant diseases. This was a matter of urgency due to the

large number of such molecules which have been identified, characterized and

submitted to data bank [78, 83]. The ICTV Geminiviridae Study Group has recently

proposed a system of nomenclature and taxonomy for the beta satellites and alpha

satellites associated with geminiviruses. Pairwise comparisons of all available full-

length DNA beta satellite and alpha satellite nt. sequences shows that the minimum

numbers of pairs occur at a sequence homology of 78 % for beta satellites and 83 %

for alpha satellite are recommended as the species demarcation threshold (DMT) for a

dissimilar species [49].

1.5 DNA replication of geminiviruses

Rolling circle replication (RCR) is the mechanism adopted by the geminiviruses to

replicate in the nucleus of infected cells [84]; [2, 85]. Geminivirus has Rep binding

sites in the intergenic region (IR) [26].

1.6 Gemini virus Evolution

It is assumed that these viruses are evolved as episomal DNA replicons from most

ancient groups of prokaryotes that are altered from the primitive ancestor of

eukaryotes of modern plants [90]. This hypothesis could be supported with the ability

of wide range of geminivirus to replicate in Agrobacterium tumefaciens [93], and

there are several evidences of the conserved features of rep protein in prokaryotic and

eukaryotic DNA replicons, polycistronic mRNAs [91, 92]. Although in the process of

co-evolution of viruses along with their hosts, these DNA molecules attains new

properties by recombination process and formed recombinant DNA with host genome


9

9 [90]. According to phylogenetic studies [94, 95], the ancestors of geminiviruses had

single DNA A components which were involved in infection of monocots and

transmitted though leaf hopper. This trend were shifted and transmission of these

viruses‟ starts with white flies as well as infection of dicots happened due to ancestral

old world begomoviruses [96]. The attainment of second component of genome DNA

B is occurred later on the evolutionary scale, however this might be happened before

the separation of contents as new world and old word both contains the

begomoviruses [51, 90]. Monopartite begomovirus that have associated helper viruses

as beta satellites have opened a new possibility to infect new host and cause different

symptoms [76, 77, 97-100]. Recombination events between the begomovirus and

mastrevirus might have created the new one genus curtovirus [101]. Another genus

Topocovirus have emerged after the recombination of ancient curtovirus and this

virus is not related to another two genera of geminivirus [102]. Recombination is

main reason behind the diversity of geminivirus. This process of recombination

dependent replication strategy [12, 103] is most probably happened naturally by the

mixing of two different begomoviruses infection in the same cell of the plant [104].

Hence as a result of recombination large number of begomovirus species have been

evolved.

1.7 Engineering broad spectrum resistance to geminiviruses

Conventional plant breeding play an important for controlling plant pathogen [105].

Increased knowledge of plant DNA science at molecular level and the study of host

plant interaction at molecular level have stemmed in the development of a variety of

strategies to control virus disease epidemic in plants and enhancing plant virus

resistance using transgenic approach over the recent past. There are two groups of

gene sources: pathogen derived genes and non-pathogen derived genes so for virus

resistance one concept is the use of non-pathogen source which is non-pathogen

derived resistance (non-PDR) [106] and other is pathogen derived resistance (PDR)

[107]. Most strategies based on the concept of PDR [107].

1.7.1 Resistance by the expression of proteins

Transgenic virus resistant plant expressing the coat protein of TMV was produced in

1986. Some viral or non-viral proteins can be used to engineered resistance for viruses

in plants where as in Gemini viruses rep protein is very important for the replication

http://www.science.mcmaster.ca/Biology/Virology/27/PATHOGEN.HTM

http://www.science.mcmaster.ca/Biology/Virology/27/NON-PATH.HTM


10

10 of viruses. Transgenic plant producing N-terminally (T-Rep) truncated Rep showed

enhanced resistance against geminivirus infection (T-Rep; [108, 109], and T-Rep

transgenic plants showed a degree of resistance [108, 110]. Same strategies using T-

Rep was used to produced tomato and this plant shows resistance to homologous as

well as heterologous Gemini viruses [111]. Similar TGMV MP, ACMV TrAP, and

ToMoV MP [112] expressing transgenic also showed resistance to ToMoV and

CaLCuV infection [113]. The effect of virus on plants could be neutralized due to the

production of antibodies, because Plant virus particles have immunogenic properties.

However antibody producing immune system is absent in plants. [114] produced

transformed tobacco plant with a functional single-chain Fv antibody against

Artichoke mottled crinkle virus (AMCV). The antibody displayed high affinity for

AMCV coat protein of both intact virions and disrupted subunits.

1.7.2 Defective interfering DNA

Gemini virus sub genomic DNA molecule is actually defecting inferring molecule

which interferes with the replication of helper molecules. Accumulation of defective

interfering (DI) RNAs were also found in Tombus viruses and carmoviruses [115].

Transgenic N. benthamiana plant expressing DI RNA derived from RNA 2 of

Tobacco rattle virus (TRV) showed enhanced resistance against against tobacco rattle

virus disease complex [116].

1.7.3 Antisense RNA-mediated resistance

Basically transgene is negative strand that is complementary to the viral mRNA [117].

After the transcription of the complementary strand, RNA/RNA duplex formed and as

a result translation of viral protein formation stopped. Only limited resistance has

been observed by the use of this method against RNA plant viruses so far. However,

this method is preferable in case of DNA viruses that transcribe their mRNA in the

nucleus. Lindbo and Dougherty was first recognized the RNA-mediated gene

silencing in plants, who described that untranslatable viral RNA sequences could

trigger specific, post transcriptional RNA degradation of the transgene mRNA and are

linked to viral protection [118].


11

11 1.7.4 RNA interference

According to molecular biology central dogma is formation of the protein from RNA,

that predicts RNA as source of information but it is not a regulatory molecule

(universal component of gene expression). Stop of further viral replication and their

transposable elements silencing in nematodes, insects, fungi and plants by si RNAs

that are 21 nucleotide bases of dsRNA can be achieved through a technique RNA

interference (RNAi) Small interfering RNA are processed from dsRNA viral

replication intermediates [119-123].Viral RNAs translation could be suppressed

though the silencing complex that is formed with RISC and target the complementary

viral strand and chopped it in to small pieces [124]. Different pathways and

mechanisms are involved in the formation of siRNA. Two RNA three type enzymes

Drosha and DICER –LIKE (DSL) in plants, catalyze the precursor of siRNA into 21-

24nt. Duplexes [122]. siRNAs associated with hetero chromatin (24nt) that are

produced by the activities of RDR2 (RNA polymerase IV), DCL3 and also required

AGO4 to direct the methylation of DNA through cytosine and histone H3 at Lys-9

[125] [126]. The formation of post transcriptional active siRNAs from exogenous

sources (viral and transgenic), that may involve RDR1/RDR6 and DCL2 in case of

some other viruses [119, 126]. In case of endogenous small trans acting small

interfering (ta-si) RNAs from polymerase III gene that guides the cleavage of target

mRNAs and (ta-si) RNAs also need RDR6 for precursor formation as suppressor of

gene silencing 3 (SGS3) [125-129]. Also this ta-siRNA formation needs DCL1 (its

role ay be indirect)[126].

Although almost all the classes of known endogenous small RNAs required HEN1 (an

RNA methyl transferase enzyme that modifies th 3‟ end) in Arabidopsis plant [130].


12

12

Figure 1.2

General mechanism of RNAi

TAS1, TAS2, and TAS3 are known families of ta-siRNA encoding genes in A.

thaliana [131]. The TAS1 family contain three genes that encode ta-siRNAs (siR255

and siR480) that target four messenger RNAs encoding proteins of unidentified

function [132]. TAS2-derived ta-siRNAs (siR1511) targets a set of messenger RNAs

encoding pentatricopeptide repeat proteins [132]. Whereas, TAS3 locus identifies two

ta-siRNAs that target a set of messenger RNAs for several Auxin response factors

(ARFs), including ARF3 (ETTIN) and ARF4 [132].

Generally Micro RNAs are small non-coding RNAs that are expressed as primary

microRNAs in which dicer and Drosha act in a ~70 nt the stem-loop precursor and

mature 21-25nt. micro RNA respectively also it is a part of RISC complex [134].

Micro RNA targets the RISC complex to messenger RNAs with complementary

sequences and triggers the mRNA cleavage or completely inhibit translation process.

The mode of microRNA regulation can be altered in association with other proteins

and that can activate the gene expression of protein [135-137]. However the exact

mechanism of target identification is not yet clear. Although the pairing of 7-8 nt. at

5‟ end of the microRNA for multiple sites in the 3‟ end (untranslated region) is


13

13 sufficient to trigger inhibition of the translation process [138]. MicroRNAs

(miRNAs), also target several mRNAs concerned with auxin responses. MiR160

targets (ARF10, ARF16 and ARF17), out of twenty three Arabidopsis ARF genes

[139, 140]. Plants expressing a miRNA-resistant version of ARF17 have

increased ARF17 mRNA levels and altered accumulation of auxin-inducible GH3-like

mRNAs, YDK1/GH3.2, GH3.3, GH3.5, and DFL1/GH3.6, which encode auxin-

conjugating proteins [139, 140]. As a result of these defects expression changes occur

in developmental defects such as embryo, abnormalities of emerging leaves, shape of

leaf, premature inflorescence development etc. The defects suggests the importance

of miR160-directed ARF17 regulation and indicate ARF17 as a regulator (GH3-like)

of auxin response gene [139]. Several defects related to the phenotypes have been

previously observed in plants expressing viral suppressors of RNA silencing. Those

plants which have mutations in their genes are important for miRNA function and

providing a molecular rationale for phenotypes of previously studied of miRNA

function [141]. RNA silencing is a general antiviral defense mechanism in plants

[121, 134]. Pathogen derived resistance (PDR) in plants is type of resistance against

particular virus in which transgene of virus is engineered and stably transformed to

plant [118]. Pathogen derived resistance developed in plants as a result of RNA

silencing and all the RNAs with homologues sequence of the transgene degraded the

mRNA of the virus and prevent plant from infection [142; 143].

Similarly in another work it has been demonstrated that the plant viruses could also

induced RNA silencing by itself in plants termed as VIGS (virus induced gene

silencing) can be targeted to either transgenes or endogenous genes [144]. VIGS

technique has been used to screen gene function by preparing the endogenous

sequence libraries cloned into a viral vector [145].

Transient expression of reported gene from Discosoma encoded with GFP was

reduced to 47% after 24h of insertion of cognate siRNAs in BY2 protoplasts. Rep

protein of the ACMV were targeted through the co delivery of siRNA that was

designed to destroy the mRNA and stopped the accumulation by 91%. However it

also inhibits the accumulation of ACMV genomic DNA to 66% during transfection at

36 and 48 h. In case of siRNA-induced reporter gene silencing was specific for

ACMV rep and did not showed any effects on the replication of EACMCV. [145]

have made a generic vector, pHANNIBAL to take single PCR product from gene of


14

14 insert and could easily converted into a highly effective (hpRNA) silencing construct

(Table 1.2).

Table 1.2

Plant RNAi transformation vectors and their attributes

Vector

pHannibal [146]

pFGC594

1 chromdb.or

g

pMCG161 chromdb.org

pHellsgate [146]

Target

Organism

dicots dicots monocots dicots

Cloning

Method

restriction

digest/ligation

restriction

digest /

ligation

restriction

digest /

ligation

Gateway

recombination

Bacterial

Selection

spectinomycin kanamycin chloramphe

nicol

spectinomycin

Plant

Selection

chloramphenicol Basta Basta chloramphenicol

dsRNA

promoter

CaMV 35S CaMV 35S CaMV 35S CaMV 35S

inverted

repeat

spacer

Pdk intron ChsA intron Waxy intron Pdk intron

1.8 Chili pepper

Chili (Capsicum annuum L.) is among the most economically important fruits and vegetables

worldwide [147-149]. The name is perhaps derived from the Latin "capsa," or box for the

pod-like fruit [150]. Pepper originated in Mexico (Southern Peru and Bolivia; [151]

and are now grown worldwide under various climatic conditions. Chili pepper

belongs to the family Solanaceae, and is closely related to the tomato, nightshade, and

potato. These are also known as Capsicum, Sweet Pepper, Red Pepper, Chili pepper

and Paprika depending upon the species and also the manner in which it is prepared

and used [148]. C. annuum is the predominant species cultivated, encompassing both

hot and sweet Pepper. Seeds straw is colored. Many different forms are known within

the capsicum species [152]. Chromosome number is 2n=24, with two pairs of


15

15 acrocentric chromosomes [153]. They are very important in almost every Asian

country. There exists a great scope for its export from Pakistan. Chilies are used as a

condiment, either green or dry, in all preparations of vegetables. The bulk of chilies in

European countries are used up in the food industry, where it is used as a colorant and

for flavoring. Chilies form an indispensable condiment in every household. The

pungency of chili is due to the presence of the active principal” Capsaicin” which is

contained in the skin and the septa of fruit [154]. It is used in homeopathy. Chilies can

be used for curing gout, paralysis, black vomit and tropical fever.

Chilies are grown all over Pakistan and India. [155]. The time of sowing of chilies in

Pakistan is largely determined by the time of transplanting in the field. In plains

having frost, nurseries are raised up in Oct-Nov and transferred in mid-April/May. In

frost-free areas nurseries are raised in July-August and transferred in Sep-Oct [156]. It

is cultivated in all four provinces of Pakistan on a total area of 56.400 hectares but

mainly grown in Punjab and Sindh. According to Agriculture statistics of Pakistan, In

2003-04 its production in Punjab was 10.8000 tonnes on a total area 6.4000 hectares

[157]. Among commercial varieties grown in Pakistan, the important ones are

Tatapuri, Gola Peshawari, Neelam, Talhar, Longi, Skyline and Sanam.

Chilies are infected by a large number of bacterial, fungal and viral diseases. In

Pakistan, diseases of viral nature are the major cause for serious yield losses of chilies

[51]. It is reported that there are 45 different viruses that infect chilies/peppers

worldwide. However the most frequently mentioned viruses that infect chilies are

begomoviruses [158, 159]. Chili leaf curl disease is a significant factor for chilies

production in the Indian subcontinent. ChLCD is transmitted by whitefly [28] and

become the cause of spread of begomoviruses [158].

The synergistic action of geminivirus disease complex comprising a monopartite and

a bipartite begomoviruses along with beta satellites attributed to incidence and

symptom severity of chili leaf curl disease [160]. Previously, Chili leaf curl virus-

Multan (ChLCuV-M) full-length DNA A was found from infected samples of chilies.

Chili leaf curl betasatelite (1390 bp) have found in a huge collection of chili samples

exhibiting leaf curl symptoms from Pakistan. These betasatelite components are

similar to that of nib-16 clone [51, 161, 162].


16

16

1.8.1 Plant regeneration and transformation in Chili

Regeneration is the biological process by which organs were formed by

differentiating a cell or a group of cells. Most often direct regeneration occurs through

shoot proliferation from previous meristems as an alternative of de novo formation of

a meristem. Usually in callus mediated regeneration organ forming capacity is

inadequate for primary callus, that specifies the potential existence of meristems

rooted in the explant [163]; [164]; [165]. First attempt to regenerate chili pepper in

vitro was made by [166]. They examined the effect of different cytokinins and

observed 6-benzyl amino purine (BAP) was more effective in producing shoots from

cotyledonary leaf. Pepper is highly recalcitrant plant and is very difficult plant to

transform [163]. Chili pepper showed a variable genetic sources. There are some

reports of genetic transformation of chilies has been reported but with low efficiency

and no reproducible results has been produced. [167-169].


17

Chapter 2

Material and Methods

2.1. Plant sample collection

Virus infected plant showing symptoms were observed in fields and photographed.

Symptomatic and non-symptomatic plants leaves were collected, labelled and

transported on ice. Samples were brought to Plant Genetic engineering lab NIBGE

Faisalabad and stored at -80ºC till the extraction of DNA.

2.2 Isolation of total genomic DNA

Total DNA was extracted from N. tabacum (leaves), N. benthamiana (leaves) and C.

annuum (leaves and calli), plants using CTAB [170].

2.3 DNA quantification

DNA was quantified by determined its concentration by spectrophotometer

(SmartSpec BIORAD, USA). The absorbance readings were taken at 260 nm

wavelength and the conversion factor was O.D260 1=50 µg ml-1

. Each sample was

diluted to a certain level before loading the sample in the cuvette and dilution factor

was set in the machine. The reading of machine was blanked by loading the water,

which was used for DNA dilution to subtract the background reading.

2.4 PCR amplification

2X dream Taq master mixture (Fermentas) was used to amplify desired fragment

from 10 pg-1µg template DNA with specific primers as described in (Table 2.1).

Following conditions were set on machine for amplification; 94˚C for 5 min, 94˚C

for 1 min followed by 35 cycles of, anneal ing temperature 48˚C to 52˚C for 1

min and 72˚C for 3 min with final extension of 10 min at 72 ˚C.

2.5 Agarose gel electrophoresis

1 % agarose gel containing ethidium bromide stain was used to check amplified DNA.

10 µl of PCR product was mixed with 6X loading dye and loaded to gel along with

1kb Ladder. Gel was run at 80 volts for 40 min and visualized in UV trans-

illuminator. Gel image was taken through Gel documentation system.

Table 2.1: Names, sequences and brief description of primers used in this study.


18

Primer name Sequence Used for

Pe AC1-AC2 SF

CCCTCGAGTAAATACCCTTAAGAAATGA To produce sense construct of AC1-AC2

Pe AC1-AC2 SR CCCCATGGTTTAAGGAATTCATGGGGGC -do-

Pe AC1-AC2 ASF GGGGATCCTCATTTCTTAAGGGTATTTA To produce antisense construct of AC1-AC2

Pe AC1-AC2 ASR GGTCTAGAAAATTCCTTAAGTACCCCCG -do-

Begomo F ACGCGT GCCGTGCTGCTGCCCCCATTGTCC For amplification of DNA-A of begomovirus

Begomo R ACGCGT ATGGGCTGYCGAAGTTSAGAC -do-

β01 GGTACCACTACGCTACGCAGCAGCC For amplification of betasatelite of begomovirus

β02 GGTACCTACCCTCCCAGGGGTACAC -do-

BC1F CACCATGGCAATAGGAAATGATGGTATGGG For amplification of DNA-B (MP) of begomovirus

BC1R AAGGATCCTCTTAATTTTTTGAATAAATTTGGC -do-

BAR Partial L GAAGTCCAGCTGCCAGAAAC For amplification and

identification of BAR gene

BAR Partial R CTCTACACCCACCTGCTGAAG -do-

35S Partial L CTACGCAGCAGGTCTCATCA For amplification and

identification of 35S

sequence

35S Partial R GAAGCAAGCCTTGAATCGTC -do-

2.6 CLONING

2.6.1 Cloning of amplified PCR product

Amplified PCR product was cloned using an InsTA clone PCR Cloning Kit

(Fermentas) according to the instructions provided by the manufacturer.

2.7 Preparation of competent cells

2.7.1 Preparation of heat shock competent E. coli cells

A single colony from the freshly grown pure cultures of E.coli was inoculated in to

20mL of LB broth medium and incubated at 37oC for overnight. Then 2 mL of

overnight culture was inoculated into 250mL LB broth and allow to grow at 37oC in a

shaking incubator until an OD600 of 0.5-1. The culture was put on ice for 50 minutes

then shifted to sterile falcon tube and centrifuge at 8,000 rpm at 4oC for 5 min.

The ce l l pe l l e t s was d i sso lved in 20 mL of 0.1 M MgCl2 and centrifuged.


19

Pellet was again washed with 20 mL of 0.1 M CaCl2 and incubated on ice for 30

minutes and centrifuged. At the end cells were re suspended in 4 mL of 0.1 M CaCl2

and m i x e d w i t h filter-sterilized cold glycerol (3:1). The cells were stored

in aliquots of 200 μL at -80oC.

2.7.2 Preparation of electro competent A. tumefaciens cells

A single colony from a freshly grown plate of A. tumefaciens (strain LBA4404)

was picked using a sterile toothpick and inoculated into 20 mL LB liquid medium

with 25 µg/mL rifampicin in a sterile 50 mL flask and placed in a shaker (160 rpm)

at 28oC for 2 days. 5 mL of the culture was inoculated into 250 mL of LB broth

medium with 25 µg/mL rifampicin and placed in a shaker at 28oC until the OD600 of

cells was 0.5-1. The cells were transferred to falcon tubes and kept on ice for 10

min and centrifuged at 8,000 rpm for 10 min at 4oC. The pellet was

dissolved in 50 mL of cold (SDW) and centrifuged. Same step was repeated.

Cells were suspended again in 10 mL SDW with 10% glycerol and centrifuged . Then

cells were suspended in 4mL of 10% cold sterile glycerol, aliquoted in

Eppendorf tubes and stored at –80oC.

2.8 Transformation of competent cells

2.8.1 Transformation of E. coli competent cells by heat-shock

Transformation of competent E. coli cells was carried out by the methods

described by [171].

2.8.2 Transformation of A. tumefaciens competent cells

2 µL of ligation mixture was added with electro-competent (A. tumefaciens) cells at

40C and shifted to electroporation cuvette. Electric shock was given to cells at

1.44 kV and 1mL of LB broth medium was mixed with cells and placed in a shaker at

28 ˚C for 2 h. The cells were spread on plates containing LBA medium with suitable

antibiotics placed in a 28˚C incubator for 48 h.

2.9 Plasmid isolation from recombinant E. coli


20

Recombinant plasmids from over-night grown cultures of E. coli at 37oC were

isolated according to the following protocol. A single colony was picked up and

cultured in LB broth medium (25ml) having 50 µg/ml kanamycin and allowed to

grow at 37oC overnight with vigorous shaking. The E. coli culture was then

centrifuged at 14000 rpm in 1.5 ml eppendorf tubes for 5 minutes. The pellet was

allowed to dry for two minutes following the decantation of the supernatant. To this

pellet 100 µl of (solution I) was added and the pellet was suspended in it by means of

vortex. Mixed well by inverting gently after addition of 150 µl of solution II.

Centrifugation was done at 14000 rpm for 5 minutes after addition of 200 µl of

solution III after thorough mixing. The supernatant was shifted to fresh Eppendorf

tube and two volumes of 100% ethanol was added to the eppendorf tube. The

eppendorf was left for 2 minutes at -20oC and centrifuged at 14000 rpm for 5 minutes.

The resultant pellet was washed with 70% ethanol and dried after centrifugation. The

pellet was suspended in 20 µl of SDW and stored at -20oC.

Plasmids were extracted using a Plasmid Miniprep Kit (Fermentas). Overnight

cultures of E. coli were transferred to 1.5 mL Eppendorf and centrifuged for 2 min

and the upper aqueous phase was removed with pipette (repeat this step to remove all

culture medium). The pellet was re suspended in 250 µL Resuspension Solution.

Cells were lysed with 250 µL Lysis Solution, neutralized with 350 µL

Neutralization Solution and the tube was centrifuged at 12000 rpm for 5 min. A

mini-column was inserted into a collection tube and the supernatant was transferred

to the column and centrifuged for 1 min and the flow- through was discarded. The

matrix ( p l a s m i d s t i c k ) was washed twice with 500 µL of Wash Solution and

centrifuged for 1 min to remove residues of Ethanol. Then the column was

transferred to new tube and the DNA was eluted in 50 µL distilled water.

2.10 Restriction Digestion of plasmid

Restriction of plasmid DNA was accomplished with enzymes and their

matching buffers according to manufacturer instructions (Fermentas). A total

volume of 10 μL (3units restriction enzyme, buffer, 500 ng DNA and sterile

distilled water) was used to confirm the insert size and 20 μL (10 units‟ restriction

enzyme, buffer, 2 µg DNA and sterile distilled water) for digestions of clone.

Reaction mixtures were incubate for 1-3 h at optimum temperatures. DNA


21

fragments size were determined on Agarose gel stained with Ethidium bromide.

2.11 Glycerol stocks Preparation

Bacterial cultures or cloned plasmids were preserved through glycerol stocks.

B r i e f l y , In Eppendorf tubes (700 µL broth culture and 300 µL sterile glycerol)

was added and mixed well, then stored at -80 ˚C freezer for future use. For the

recovery of cultures, a sterile loop was inserted on glycerol stock and streaked on

LBA plate with antibiotics and kept at 37oC.

2.12 Purification of DNA

2.12.1 PCR product purification

The amplified PCR product was p u r i f i e d b y using a Wizard SV Gel and PCR

purification kit (Promega) as described by the manufacturer.

2.12.2 Phenol-chloroform extraction of DNA

Phenol: chloroform (1:1) extraction was used to get rid of the proteins i m pu r i t i e s

from DNA. An equal volume of phenol: chloroform was added into DNA and vortex

until it turns milky and centrifuged for 10 minutes and supernatant was shifted to new

tube. 3 M sodium acetate (1/10 volume) and 2.5 volumes chilled A.E was

added and mixed with DNA solution and kept at -20˚C for o n e h o u r . Then this

mixture was centrifuged a n d D N A p e l l e t w a s washed with 70% ethanol, air

dried and dissolved in SDW.

2.13 Sequencing and sequence analysis

Cloned samples were sent to Macrogen (South Korea) for sequencing with

universal primers (M13F/ M13R [-20]). Sequence specific primers were designed to

enhance the sequence length. The sequence file were assembled and analyzed with

the help of the Lasergene package of sequence analysis software (DNAStar Inc.,

Madison, WI, USA). Sequence similarity searches (BLAST) and phylogenetic

were performed i n N C B I d a t a b a s e a n d u s i n g c l u s t a l x to compare the


22

sequence to others reported ones. [172-173]. All sequences were deposited in the

databank using EBI website

2.14 Agro inoculation

All Clones which are prepared in the binary vector pFGC4901 were electroporated

into Agrobacterium strain EHA105 whereas clones in pGreen0029 or PVX

vector pGR107 were electroporated to Agrobacterium strain LBA4404. For

agro inoculation to chilies glycerol stocks of Agrobacterium strain with required

clones were streaked on solid LB medium plates containing 12.5 µg/mL rifampicin

and 50 µg/mL kanamycin and incubated at 28 ˚C for 48 h. A single colony of

bacteria was picked with a sterile wire loop and inoculated into 50 mL LB

containing the required antibiotics and placed in a shaker (160 RPM) at 28 ˚C until

the O.D600 of the culture was 1. The cells were harvested by centrifugation at 8000

rpm for 8 min and re suspended in LB (pH 7.0) containing acetosyringone

(final concentration 100 µM). Chili seeds were surface sterilized by dipping in

70% ethanol for 1 min followed by soaking them in 0.1% HgCl2 and 1% SDS for 6

minutes. Then seeds were thoroughly rinsed three times with double distilled water

and were sown in MSO [MS salts and vitamins (Phyto Technology USA, Prod NO:

M404), Sucrose 3.0%, 0.8% agar (Sigma) and pH 5.7-5.8].

G30 syringe needle was used to puncture the hypocotyl of germinating seedlings (3-4

times) and inoculated with Agrobacterium by soaking, kept in dark at 25 ˚C for

overnight. Inoculated seedlings were washed twice with distilled water prior to

grown in pots containing silt and sand in equal proportion with a small amount

of compost. Plants were kept at 25˚C for 10 days and later on moved to a

growth chamber at 30-35˚C with 16 h light period. N. benthamiana and N. tabacum,

plants were used for agro infiltration at t 4 - 5 leaf stage. Inoculum o f

Agrobacterium was injected into broad expended leaves with 5 mL syringe.

Plants were grown at 25˚C with 16 h light in a growth room.

2.15 Plant Transformation

2.15.1 Plant transformation through Agrobacterium -mediated in N. tabacum

(CV. Samsun).


23

Seeds were surface sterilized by soaking them in 5% bleach, followed by a dip in 70%

ethanol for 1 min. Seeds were thoroughly rinsed three times with double distilled

water to remove ethanol. Seeds were sown in MSO medium (described in section

2.14). Two weeks later, plantlets were transferred to fresh MSO medium. Fully

expanded leaves were used for cutting leaf discs after 3-4 weeks.

Single colony of A. tumefaciens from EHA105 peAC1-AC2dsRNA/pFGC clone

(section 4.2) was picked by sterile tooth pick and inoculated in 25 ml of LB broth

medium (100 g/ml Rifampicin and 50 g/ml Kanamycin) and kept in shaker

incubator at 250 rpm for 2 days under dark conditions. Top three leaves were Cut in

the form of disc under aseptic conditions and placed on MS1 medium [MSO, 0.1mg/l

NAA and 1 mg/l BAP], having 15-20 discs per plate. Leaf discs were place in plate

upside down and incubated at 25 ºC with 16/8 light and dark cycles, also explants

were left for pre incubation for 24h.

Agrobacterium culture was centrifuged at 3000 rpm for 10 min and re suspended in

MSO medium with 3% sucrose to an OD of 0.4-0.5 at 590 nm. 30 ml of bacterial

suspension was placed in sterile falcon tube and leaf discs were placed in bacterial

suspension. Tube was inverted gently for about 2-5 min. leaf discs were dry on sterile

filter paper and placed on co culture medium for 48-72 h at 25 ºC with light

conditions.

Leaf discs were removed from co-culture medium and placed on MS1 selection

medium [MS1 medium, glufosinate ammonium (10mg/l) and cefotaxime (50mg/l)]

and incubated as described above. Leaves were subcultures after every 2-3 weeks and

placed on MS1 selection medium. Regeneration started after 20-25 days in tobacco.

Shoots were cut from callus when at least 1 internode was formed. Shoots were

transferred into rooting media with reduced MS2 rooting medium [MS0 medium,

glufosinate ammonium (10mg/l) and cefotaxime (50mg/l)]. Seedling plants were

washed with tap water to remove the media. Selected transgenic plants were shifted to

sterile soil pots and placed at 25 ºC under 16h photoperiod (hardening) and covered

with polyethylene bags to retain humidity for 7-10 days. After that envelops were

removed to reduce humidity slowly and plants were allowed to acclimatized with


24

humidity and temperature. For Self-fertilizations paper bags were used to enclose

flower buds.

2.16 Hybridization

2.16.1 Immobilize DNA onto a permanent substrate (membrane)

DNA samples were checked in 1% agarose gel at 70 volts for 30 min. The gel was

treated with different solutions i.e., depurination solution for 15 min,

denaturation solution for 30 min and neutralization solution for 30 min. Gel was

washed with sterile distilled water after each step and shake gently in shaker.

DNA from gel was shifted to nylon membrane in 5X SSC by capillary action,

and UV crosslinker (Crosslinker-UVP) at 120 mJ/cm2 energy was used to

crosslinked DNA on the nylon membrane .

2.16.2 Probe synthesis

2.16.2.1 Biotin labeled Probe

Biotin Deca Label DNA Labeling kit (Fermentas) was used to prepared DNA probe.

2.16.2.1 DIG labeled Probe

DIG High Prime DNA Labeling and Detection Starter Kit I (Roche Applied Science,

Indianapolis, IN, Cat. No. 11 745 832 910) was used to prepared the DIG labeled

probe followed by protocol [174].

2.16.3 Hybridization

2.16.3.1 Hybridization using Biotin labeled probe

Biotin labeled Membrane was washed with 0.1X SSC, 0.5% SDS solution for 45

min at 65˚C. Then membrane was treated with 0.2 mL/cm2 pre-hybridization

solution, 0.5% SDS, 50% deionized formamide and 50 µg/mL denatured salmon

sperm DNA) for 2-4 h in a hybridizer at 42 ˚C. Prehybridization of the

membrane was done by the manufacturer instruction (Biotin Chromogenic

Detection Kit by Fermentas).

2.16.3.2 Hybridization using DIG labeled probe

The hybridization of the biotin DIG labeled probe on the nylon memebrane was was

done according to manufacturer‟s instructions (DIG Northern Starter Kit, Roche). The


25

membrane was equibrated by equibration buffer and exposed to x-ray film (Fuji film)

after soaking in CDP-Star solution (Applied Biosystems, USA).

2.17 Basta sensitivity test

To evaluate for basta (glufosinate ammonium) sensitivity, MS0 medium plates were

prepared with 50mg/l glufosinate basta. These seeds were allowed to grow at 26 ±

2oC with 16/8 hours day/night in growth chamber. The basta resistant plantlets were

then transferred to pots/soil for glass house study. Self-fertilizations were facilitated

using paper bags to enclose flower buds

2.18 Isolation of total RNA

Concert Plant Trizol Reagent (Invitrogen USA) was used to extract the total RNA

from transgenic plant following the manufacturer‟s instructions. Infected leaves (400

mg) were cut from each transgenic plant and ground with liquid nitrogen in very fine

powder in pestle and mortar and transferred to 1.5 ml Eppendorf tube. Each sample

was added with 0.5 ml cold Concert Plant RNA Reagent and mixed by tapping and

incubated at RT for 5 min. this mixture was centrifuged at RT for 2 min at 13000 rpm

to take clear supernatant. Supernatant was taken into separate tube and 5 M NaCl (100

µl) and Chloroform (300 µl) was mixed in each tube and centrifuged at 4oC for 10

min at 13000 rpm. Supernatant was shifted to new tube and same volume of

isopropanol was mixed with it and kept for 10 min at room temperature. The tubes

were again centrifuged at 4oC for 10 min at 13000 rpm. Pellet was washed with 70 %

ethanol and centrifuged for 2 min. Dried pellet was dissolved in 30 µl RNase free

water. The quality and concentration of RNA was observed on agarose gel (1 %) and

stored at -80oC.

2.19 siRNA analysis of the transgenic plants

Total nucleic acids of transgenic and untransformed plants were extracted with the

help of Concert Plant Trizol Reagent (Invitrogen USA) (section 2.14). Twenty

micrograms of total RNAs were separated by denaturing Urea polyacrylamide gel

electrophoresis (PAGE) (Denaturing PAGE gel: 15% polyacrylamide, 7 M Urea, 0.5

× TBE) at 200 V for 2.5 h and transfer to Hybond-N+

membrane (Amersham


26

Pharmacia) by capillary blotting [171]. The RNA was fixed on the membrane by

crosslinking in UV crosslinker (CL-1000 Ultraviolet Crosslinker-UVP) at 120 mJcm-2

energy.

Sense AC1-AC2 PCR amplified (575bp) fragment (section 4.2.2) was cloned into

pTZ57R (Fermentas, Arlington, Canada) using the same protocol as described in

section 2.6 and resulting clone was Sense AC1-AC2/PTZ . The RNA probe was

prepared by Invitro transcription using a Sense AC1-AC2/PTZ and Roche Dig RNA

Labeling Kit (SP6/T7) Cat. No. 11 175 025 910 according to the manufacturer‟s

instructions followed by alkaline hydrolysis buffer treatment (60 mM Na2CO3; 40

mM NaHCO3; pH 10.2) and Hydrolysis-neutralization buffer (3 M sodium acetate;

1% (v/v) acetic acid; pH 6.0). Alkaline hydrolysis regulates the size of RNA probes.

The membrane were soaked in pre-hybridization solution for 1 hour at 40oC. The

probe was denatured by heating and chilling on ice and added to the pre-hybridization

solution. Hybridization of the membrane was carried out at 40 0C for 12 hour

followed by washing twice with washing buffer for 15 minutes at 50 0C. All the steps

including membrane blocking, reacting hybridized probes with Anti-Digoxigenin-AP

Fab fragments, and membrane washing was performed following the instructions of

manufacturer (DIG Northern Starter Kit, Roche). The membrane was equibrated by

equibration buffer and exposed to x-ray film (Fuji film) after soaking in CDP-Star

solution (Applied Biosystems, USA).


27

Component captured by begomovirus; Pepper leaf curl Lahore virus

requires DNA B of Tomato leaf curl New Delhi to cause leaf curl

symptoms

3.1 Introduction

Viruses that belongs to geminiviridae family have single stranded circular (ss) DNA

genomes and are divided into 4 genera on the basis of their genome organization,

insect vectors and host range. Among all four genera begomoviruses are more

destructive group of viruses which are transmitted through white fly B. tabaci and

infect dicots [175, 176]. Begomoviruses are distributed throughout world where

environmental conditions support the population of white fly and has become a most

important limitation in the crops production [14, 177, 178].

An important factor that limit the chili production on the Indian subcontinent is Chili

leaf curl disease (ChLCD) which is caused by begomoviruses [179]; [180]; [181].

These viruses often cause severe symptoms such as upward and downward leaf

curling, mottlings, yellowing, vein thickening and stunted growth. Formerly, chili leaf

curl beta satellite has been reported from the chili samples collected from all over the

Pakistan [161]. Similarly in other reports one species of beta satellite (ChLCB) was

found to be associated with this disease complex due to the same geographical

segregation [179].

One of the major cause of spread of begomoviruses in pepper could be infected

tomato crops that are growing in close relevance with pepper and become source of

infection. It was experimentally test that white flies carry this virus from infected to

healthy seedlings of tomato and chili [158]; [182], because inoculation of healthy

plants developed same typical symptoms of leaf curl disease of tomato caused by

(ToLCNDV) [182]; [160].

Diversity of the begomoviruses from large sample of chili leaf samples in Pakistan

have been studied [180]. Pepper leaf curl Lahore virus (PepLCLV) has been also

reported from Pakistan although its infectivity is not confirmed yet through

experiments [51]. However, the isolation and characterization of PepLCLV from chili


28

plant has been also studied with the interaction beta satellites and the DNA B

component of ToLCNDV as

DNA B is essential to infect plants and induction of disease symptoms but its

interaction with ChLCB is not clearly understood.

3.2 Material and methods

3.2.1 Collection of virus infected plant samples

A chili plant showing distinctive symptoms of begomovirus infection was detected in

2004 and symptomatic or healthy leaves of chili were collected from the field located

near Faisalabad, Pakistan. Samples were transported to laboratory and stored at -80ºC

for further analysis. This isolate was previously shown to harbor ChLCB–

(AM279673) [161].

3.2.2 Isolation, cloning and sequencing

Genomic DNA was extracted from healthy and symptomatic chili samples using

CTAB method described by [170]. Required fragments full-length begomovirus, beta

satellite and alpha satellite molecules were amplified through PCR using universal

primers as described in (Table 2.1) [183]; [184]; [185].

Two set of primers, BC1-F/R [158], were used to detect DNA B component of

ToLCNDV. PCR product were purified and cloned into pTZ57R/T vector

(Fermentas). PGL1 (clone) was sequenced from (Macrogen, Korea) from both sides.

DNA sequences were analyzed with Lasergene package software and multiple

sequence alignments were performed using Clustal X [172]. Phylogenetic trees were

constructed by neighbor-joining method and printed using Tree view [173].

3.2.3 Agrobacterium-mediated inoculation of plants

Partial direct and tandem repeat constructs for Agrobacterium-mediated inoculation

were produced in the binary vector pGreen standard protocol were followed [186].

PGL1 (1498 nt) fragment from the intergenic region was removed with XbaI and

EcoRI restriction endonucleases and sub cloned into the XbaI–EcoRI sites of pGreen

to produce the clone pGPeA. icPGL1 clone was produced by restriction of PGL1(full

length) with XbaI and inserted into pGPeA at its unique site XbaI and it was

confirmed by digestion with EcoRI. This partial direct repeat of PGL1 was


29

transformed into A. tumefaciens strain GV3103 electro competent cells by

electroporation.

The infectivity analysis of PGL1 was performed alone/combination with the DNA B

component of TLCNDV [31], (ChLCB-AJ316032) [179] and (CLCuMB-

AJ298903)[187] in N. benthamiana, N. tabacum cv Samsun, and C. annuum cv

Loungi by Agrobacterium-mediated inoculation (section 2.14). Ten plants were

inoculated per crop and kept at 25°C with 70% RH and 16 h/day light in greenhouse.

Daily observations of plants were made to detect appearance of symptoms.

Figure 3.1

Phylogenetic dandrogram constructed by alignment of selected complete

sequences of begomoviruses (or DNA A components)

DNA A sequences used for comparison are as follows; Cucurbit leaf crumple virus(CuLCrV),

Tomato golden mosaic virus (TGMV), Cowpea golden mosaic virus(CPGMV), Cabbage leaf

curl Jamaica virus (CabLCuJV), Okra yellow crinkle virus (OYCrV), Indian cassava mosaic

virus (ICMV), Pepper leaf curl Lahore virus (PepLCLV), Pepper leaf curl Bangladesh virus

(PepLCBDV), Cotton leaf curl Kokhran virus-Manisal (CLCuKV-Man), Chili leaf curl virus-


30

Khanewal (ChLCVKh), Bean golden yellow mosaic virus (BGYMV), Papaya leaf curl China

virus-Ageratum (PaLCuCNVAge), Chili leaf curl virus-India (ChLCV-IN),Chili leaf curl

virus-Multan(ChLCV-MU), Cotton leaf curl Multan virus-Rajasthan (CLCuMVRaj),Cotton

leaf curl Multan virus-Bhatinda (CLCuMV-Bha), Cotton leaf curl Multan virus-Faisalabad

(CLCuKV-Fai), Mungbean yellow mosaic India virus (MYMIV), Tobacco curly shoot virus

(TbCSV), Radish leaf curl virus (RaLCV), Indian cassava mosaic virus-India (ICMV-IN).

The tree was arbitrarily rooted on the sequence of Tomato leaf curl New Delhi virus

associated DNA B which is distinct sequence with same size. The database accession number

in each case is given. Isolate and strain descriptors are as given in [188].

3.3 Results

3.3.1 Detection of begomovirus components in chili samples

Leaf curl symptom in chili plants are linked with monopartite begomoviruses along

with betasatelite and ToLCNDV [160]. The presence of a virus in the symptomatic

sample were analyzed through PCR using universal primers (BegomoF/R) that could

amplify begomovirus of DNA A [185]. A PCR product of 2.8 kb was amplified from

the symptomatic chili plant, while no amplification event was found with healthy chili

plants that confirmed the relation of begomovirus with induction of disease symptom.

The DNA B of ToLCNDV was detected using primer pair BC1F/BC1R [158].

Specific primers of movement protein (MP) gene of ToLCNDV were used to amplify

a fragment of 850 nucleotides which is the indication of virus in plants. Similarly the

presence of a beta satellite in samples was detected using the universal primer pair

(Beta01/Beta02) [184] with amplified product length 1350 nucleotide. Earlier

betasaltelite was characterized as an isolate of ChLCB [161].

3.3.2 Analysis of the sequence of PGL1

PGL1 clone (2747 nt) sequence is available in the databases with accession number

AM691745. Comparison of this Sequence with other reported sequences revealed that

the genome had the highest sequence identity (99%) with PepLCLV-[PK: Lah: 04]

(AM404179) followed by 89% with PepLCuBDV-PK [PK: Kha: 04] (DQ116881).

This showed that PGL1 is an isolate of PepLCLV -[PK:Fai:04] [188]. Phylogenetic

dandrogram were constructed to group PGL1 with other isolates of PepLCLV for


31

which a full-length sequence is available in the databases (PepLCLV-[PK:Lah:04])

and to be closely related to PepLCBDV (Figure 3.1).

The clone shows the typical genome organization of begomoviruses with 2 ORFs in

the virion-sense strand (V1 and V2) and 4 ORFs (C1, C2, C3 and C4) in the

complementary-sense [176]. Genetic characters of this Begomovirus are described in

table 3.1. Minute different were found in gene that encode for replication-associated

protein (Rep).Uptil now the Rep protein of the PepLCLV isolate is larger than that of

other isolates of this viruse characterized [51], as well as from other begomoviruses.

Mainly the Rep protein has fourteen amino acid leader sequence at the N-terminal end

that is absent in other closely related begomoviruses that infects pepper (Figure 3.2).

The intergenic region (IR) of PepLCLV contains nearly 241 nucleotides and is similar

to those are found in isolates of ToLCNDV (Figure 3.3, Table 3.2). In all

begomoviruses a nine nucleotide long (TAATATTAC) conserved region is found in

stem loop and which is characterized as the origin of virion-strand DNA replication

[189]. Inside the IR region partial direct repeats of an iterons (GGGGAC) were

identified that lies near TATA box of the Rep promoter and generally these sequences

are species specific Rep binding motifs [190]; [96].


32

Table 3.1 Features of the begomovirus isolated from C. annuum

*Gene

s are

indicat

ed as

coat

protein

(CP),

replicat

ion-associated protein (Rep), transcriptional activator protein (TrAP), and replication enhancer (REn).

The products encoded by ORFs V2 and C4 have yet to be named.

ORF* Start codon

(nucleotide

coordinates)

Stop codon

(nucleotide

coordinates)

Predicted size of

ORFs

(nt)

Predicted size of

protein

(no. of amino acids)

V2 510 145 365 122

CP 1075 305 770 257

Rep 2651 1524 1127 376

TrAP 1621 1217 404 134

REn 1476 1072 404 134

C4 2452 2195 257 86


33

Table 2

Pairwise Nucleotide identities between the components of genome and protein

encoded genes sequence identities from isolate PGL1 in comparison with the

components and genes of all isolates available in the databases.

* Numbers of sequences from the databases used in the comparisons.

# Gene names are as indicated in Table 1.

Begomovirus Complet

e

sequence

(percent

age

nucleoti

de

sequence

identity)

Intergen

ic region

(percent

age

nucleoti

de

sequence

identity)

Gene#

(percentage amino acid sequence identity)

AV2 CP REn TrAP Rep AC4

ChLCV [11]* 84–87.2 77.3-

88.3

87.9-

92.4

94.4-

98.4

75.8-

91.7

82.6-

97.7

75.2-

91

39.3-

92.9

CLCuMV [10]* 74–74.6 59.4-

63.8

63-

74.1

82.3-

94.4

63.6-

76.9

57.6-

68.2

69.8-

72.4

40.5-

46.4

EACMV [10]* 69.6-

69.9

62.4-64 62.1-

62.9

75.4-

76.2

68.9-

70.5

63.6-

65.2

53.6-

65.8

26-

27.3

PapLCV [5]* 72.3-87 61.9-

85.9

69.1-

90.5

92.5-

97.6

73.5-

90.9

70.5-

95.5

61.3-

91

40.5-

94

PepLCV [4]* 74-86.7 51.7-

80.4

75-

91.4

78.1-

98

66.7-

90.9

71.2-

91.7

69.6-

75.8

34.5-

35.7

PepLCBDV [3]* 88.6-

89.4

78.7-

85.8

89.7-

92.2

94.8-

96

90.2-

95.4

93.9-

97.7

90.7-

93.5

92.9-

92.9

PepLCLV [2]* 98.9-99 96.2-

96.7

97.4-

98.3

98-

98.4

99.2-

99.2

100-

100

97.5-

98.3

97.6-

100

ToLCNDV-

Chili [4]*

71.4-

71.8

64.8-66 68.2-

70

92.1-

93.3

63.6-

67.4

54.5-

56.8

67.2-

68.6

39.7-

41.4

ToLCGV[7]* 77.8-

78.5

73.5-

75.1

85-

86.7

78.6-

78.6

79.5-

81.8

87.9-

90.9

74.4-

75.6

34.5-

36.9


34

34

3.3.3 Infectivity and symptoms of PepLCLV

The infectivity of clone PGL1 (PepLCLV) was studied in N. tabacum Samsun,

N. benthamiana and C. annuum by Agrobacterium-mediated inoculation (Table 3.3).

Low infectivity (2/10) in N. benthamiana was observed after the inoculation of

PepLCLV and mild leaf curl were observed in infected plants (Figure 3.4). Presence

of virus was detected through PCR with specific primers but it was absent in case of

Sothern blot hybridization as shown in (figure 3.5), representing very a minor virus

DNA accumulation rate in inoculated plants. ChLCB along the helper virus Cotton

leaf curl Multan virus was found infectious to N. benthamiana and produced severe

leaf curling among infected plants (Table 3.3), demonstrating that the ChLCB clone is

infectious and responsible for symptoms development through helper virus.

Conversely, when inoculated in the presence of ChLCB and PepLCLV, plant

produced mild symptoms in N. benthamiana (Figure 3.4) and virus level were below

the detection limit when assessed through Southern blot hybridization (Figure 3.5).

Inoculation of PepLCLV to N. tabacum, either alone or with ChLCB did not cause

infection. Further, the interaction of PepLCLV with beta satellites, infectious clone

was inoculated beta satellite of CLCuMB [179]. However, no infection was found

after the inoculation with beta satellites so CLCuMB and ChLCB were found to be

infectious in N. benthamiana along with helper virus CLCuMV as described in (Table

3.3).

3.3.4 PepLCLV trans-replicates ToLCNDV DNA B and induces leaf curl

symptoms

Agro inoculation of plants were performed with partial repeats of PepLCLV along

with the DNA B of ToLCNDV [31] which induced symptoms leaf curl in N. tabacum

Samsun, N. benthamiana, and C. annuum. The symptoms in N. benthamiana were

consist of severe stunting and upward leaf curling. Southern hybridization was used to

detect the typical begomovirus replication intermediates using PepLCLV as probe

(Figure 3.5). However the level of virus accumulation in plants inoculated alone with

PepLCLV were not detectable by Southern hybridization (Figure 3.6, lane 2).


35

35

Inoculation of PepLCLV with ToLCNDV DNA B and ChLCB resulted in disease

symptoms but the virus levels were lower (Figure 3.6, lanes 3 and 4) as compared to

plants inoculated with PepLCLV and ToLCNDV DNA B (Figure 3.6, lanes 5-7). In

case of N. tabacum and chili plants downward leaf curling and yellowing were found

as most prominent symptom.


36

36

Table 3.3 Infectivity and symptoms induced by Pepper leaf curl Lahore virus

(PepLCLV)

Plant

species

Inoculums Infectivity (plants

infected/inoculated)

Symptoms

Experiment

I II III IV Total

N. benthami

ana

PepLCLV 2/10 1/6 0/7 1/5 4/28 Very mild leaf curling

PepLCLV + ChLCB 1/10 0/6 1/7 0/5 2/28 Very mild leaf curling

PepLCLV + ToLCND +

DNA B

9/10 6/6 6/7 4/5 25/28 severe downward leaf

curling

PepLCLV + ToLCND

DNAB + ChLCB

8/10 5/6 7/7 4/5 24/28 severe downward leaf

curling

PepLCLV + CLCuMB 0/10 - - - 0/10 No symptoms

PepLCLV + TbLCB . - - 0/5 0/5 No symptoms

CLCuMV + ChLCB 4/5 5/6 - - 9/11 Severe leaf curling

CLCuMV + CLCuMB 5/5 - - - 5/5 Severe leaf curling

N. tabacum PepLCLV + ChLCB 0/10 0/4 - - 0/14 No symptoms

PepLCLV+ToLCND DNA

B

8/10 3/6 - - 11/16 Leaf curling

C. annuum PepLCLV + ChLCB 0/10 0/5 - - 0/15 No symptoms

PepLCLV + ToLCND

DNA B

`5/10 3/6 - - 8/16 Leaf curling


37

37

Figure 3.2

Alignment of the N-terminal amino acid sequences of the Rep protein of PepLCLV with

other reported sequence of begomoviruses that infects chili on the Indian subcontinent.

Alignment were optimized by the introduction of Gaps (-) into the sequences. So Conserved

sequences are marked (*). The begomovirus (DNA A component) sequences of (ChLCV),

(CLCuKV), (PaLCuV), (PepLCBDV), (PepLCLV) and (ToLCNDV) were used for the

alignment. The database accession number of each is given in [188].


38

38

Figure 3.3

Alignment of the IR regions of PepLCLV, ToLCNDV DNA A and DNA B. Conserved

sequences in the alignment are marked (*). The positions of the stem (light orange color) and

conserved nona nucleotide (TAATATTAC) sequences (lime color) of the predicted stem-loop

structure, the TATA box of the Rep promoter (violet color) and predicted iterons (dark green

color) for PepLCLV, while blue for ToLCNDV (DNA A) component and red for ToLCNDV

(DNA B) are designated.


39

39

Figure 3.4

Symptoms induced by PepLCLV clone PGL1 in N. benthamiana, N. tabacum and C.

annuum. a) N. benthamiana plant infected with PepLCLV at 20 dpi b) N. benthamiana

plant infected with PepLCLV and ChLCB at 20 dpi. c) A N. benthamiana plant infected with

PepLCLV and ToLCNDV DNA B at 14 dpi. d) A N. benthamiana plant infected with

PepLCLV, ChLCB and ToLCNDV DNA B at 14 dpi. e) A N. tabacum plant infected with

PepLCLV and ToLCNDV DNA B at 30 dpi. f) A C. annuum plant infected with PepLCLV

and ToLCNDV DNA B at 40 dpi.


40

40

Figure 3.5

Virus replication in inoculated leaves of N. benthamiana plants probed with PGL1.

(Lane 1) Plants were agro inoculated with PepLCLV, (lane 2) PepLCLV and ChLCB, (lanes

3, 4) PepLCLV, ChLCB and ToLCNDV DNA B, (lanes 5-7) PepLCLV and ToLCNDV DNA

B. lane 8 represent DNA that was isolated from chili plants infected with PepLCLV taken

from fields. 10 μg of genomic DNA was loaded on gel for each sample.

3.4 Discussion

Geminiviruses are on the top of rapidly emerging plant viruses that are cause of

destructive diseases in crops, including several factors such as increase population of

vectors as well as presence of an alternate host. Geminiviruses are rapidly evolving

group of plant virus due to changed climatic conditions such as abrupt change of

environment and frequency of vector population. The success rate of association of

beta satellites with district group of begomoviruses could be determined by the ability

of beta satellites to replicate [191]. The driving force ahead for rapid emergence and

resistance breakdown through begomovirus-beta satellite complexes are due to the

interaction of begomoviruses with their diverse beta satellites, the movement of

components of begomovirus to alternate hosts and recombination among them [14].

Several reported have been published on the mixed infection of geminiviruses and


41

41

about their complex interaction with host plants i.e. Cassava plant were infected by

two different strains of begomovirus species and the synergistic interaction cause the

severe disease [57]. It is very interesting fact about ToLCNDV (bipartite

begomovirus) has been also detected in other hosts because this virus has ability to

interact with other components of begomovirus and help to increase its host range.

(160) reported the interaction of ToLCNDV with ChLCB in open field environment

consequently severe symptoms appear, in another such type of report Tomato leaf curl

Gujarat virus (ToLCGV) interact with ToLCNDV (DNA B component) subsequently

sever symptoms appears [192]; [193]. Recently it has been found that ToLCGV lacks

DNA B and over winter an alternate host in weeds (manuscript in preparation), which

suggests that this virus was move to tomato crop from weeds after interaction with

DNA B component of ToLCNDV and formed a complex that results in severity of

viral symptoms and ultimately loses in crops . Geminiviruses replicate through the

process of rolling circle replication that is initiated by Rep protein (replication

enhancer protein) (26). Rep bind to specific sequence in the intergenic region in loop

that contains nonanucleotide sequence (TAATATTAC) where Rep initiate replication

of geminivirus through nicking. In case of bipartite virus which contains two

components DNA A and DNA B in which Rep protein is responsible for the

replication and maintain reliability of the split genome.

Although the sequence and mutational analysis of viral isolates recommends that

these viruses can tolerate the changes in the intergenic region which showed no

effects on the Rep recognition. But in this study predicted iteron sequence of

PepLCLV (GGGGAC) as compare to the iteron sequence of ToLCNDV (GGTGTC)

as shown in figure 3.5. It means that first three bases are crucial for the recognition of

Rep protein in iteron sequence of begomovirus. One of the remarkable finding of this

research work is that PepLCLV isolate has limited ability to trans-replicate beta

satellites.

These finding are comparable with the results of [51], revealed the association

ChLCB with PepLCLV from Pakistan. The inability of the virus to trans replicate beta


42

42

satellites is might be due to N terminal leader sequence of the putative Rep protein of

virus as shown in figure 3.2. However, there is need of an evidence to support this

hypothesis so to confirm through mutagenesis. So other possible reason could be that

natural variant of PepLCLV may lack leader peptide sequence in Rep that is might be

responsible for the interaction of this virus with beta satellites. Moreover, these effort

to characterize begomoviruses are not complete to understand hidden mechanisms

involved and perhaps another begomovirus strain could interact with beta satellite in a

naturally infected chili plant in field conditions. In chili plant monopartite, bipartite

and monopartite associated with beta satellite has been previously identified [158,

160, 161]. The full length clone PGL1of begomovirus associated ChLCD, has 2747

nt. In sequence which showed (99%) with (PepLCLV) refer to it an isolate of

PepLCLV on the basis of 89% SDT (species demarcation threshold) for

begomoviruses [188].

Inoculum of this clone was introduced into N. benthamaiana that produced only mild

symptoms. However, inoculation of beta satellite and clone of ChLCD infected plant

produced similar mild symptoms whereas virus titer were not detected through

Southern hybridization. Although, when plants were inoculated with DNA B

component of ToLCNDV typical symptoms of ChLCD were found in N.

benthamiana, N. tabacum and C. annuum. These results provides the evidence that

this indentified virus might be bipartite. Plants inoculated PepLCLV, ToLCNDV

DNA B and ChLCB showed surprising results with low viral DNA load as compared

to the plant where ChLCB was absent as shown in figure 3.5. This experiment first

time provides the demonstrations of infectivity analysis for a bipartite begomovirus

which is responsible for ChLCD [51]. The exact mechanism of interaction between

the rep and beta satellite replication is not clearly understood as beta satellite lack the

iteron sequence responsible for the replication and encoded by the helper virus

component [191], so it required further confirmation through experiments.


43

43

Due to the variations in to the expected iteron sequence of ToLCNDV and PepLCLV

Both has ability to trans replicate DNA B of ToLCNDV and produced chili leaf curl

disease in experimental host and chili crop. Despite the interaction of PepLCLV with

beta satellites, both has ability to reduce the virus load and symptoms severity, due to

the interference this happened.

Future studies will focus on interference to combat the viruses and may offer a tool

for attaining resistance to viruses causing chili leaf curl disease. The complex nature

of these ChLCD complex in Indian subcontinents would be a great task for the

development of resistant varieties from old and new methods. High yield loses due to

the chili leaf curl disease complex are imposing serious threat to chili cultivation and

forcing farmers to grow alternate crops instead of chili to avoid these viruses.


44

44

Resistance against chili leaf curl disease complex (ChLCD)

using RNA interference

4.1 Introduction

Chili leaf curl disease (ChLCD); whitefly transmitted begomoviruses disease complex

is major root cause for reduction of chili production in the Pakistan [158, 182, 194].

The higher incidence of chili leaf curl disease with severe symptoms may be due to

the synergistic effect of Gemini virus disease complex that includes monopartite,

bipartite begomoviruses and beta satellite [194]. Due to the higher loses, chili

cultivation is badly effected and is forcing farmers to grow other crops.

RNA silencing mediated by short-interfering RNA (siRNA) is used by plants as a

defense against viruses [195, 196]. The RNA silencing phenomenon was first

discovered in plants [197]. In the case of Gemini viruses, viral DNA is targeted at the

transcriptional level, and viral mRNA is targeted at post transcriptional level [196].

Several reports are now available on application of RNAi for developing resistance

against Gemini viruses with different levels of success [117, 198-201]. Here RNA

interference had been used for developing resistance against this disease. The most

conserved regions among the begomoviruses infecting chili crop prevailing in this

region were dissected out and targeted through RNAi.

4.2 Material and Methods

4.2.1 Cloning of RNAi based gene constructs

The extent of variation and highly conserved region of begomoviruses causing

ChLCD in subcontinent was evaluated using DNASP version 4.10.3. The level of

variation of seven begomoviruses infecting C. annuum isolates was estimated by the

average number of nucleotide differences per site (Pi) at all sites along the genome.

The hairpin gene constructs based on overlapping and the conserved region of C1, C2

and C3 region (575 bp) of Pepper leaf curl Lahore virus DNA A (accession

AM691745) was constructed as described by [202]. The construct was designated as

AC1-AC2dsRNA/pFGC based on overlapping regions of AC1 and AC2. The primers

(Table 2.1) were designed to amplify the AC1-AC2 region (575 bp) of DNA A in

sense and antisense orientations on the basis of sequences of PepLCLV (AM691745).


45

45

The primer sequences used in this study are given in Table (2.1). In forward and

reverse primers for sense cloning, XhoI and NcoI restrictions sites were incorporated,

respectively. Whereas BamHI and XbaI were introduced forward and reverse primers

for cloning in antisense, respectively.

4.2.2 Transient assays

To check the efficiency of peAC1-AC2dsRNA/pFGC transient assays were done

along with Ch Rep/PVX, (already available in the lab) and infectious clone of

PepLCLV with DNA B components of ToLCNDV (Section 3.2.3) through agro

infiltration in N. benthamaiana, N. tabacum and C. annuum. Respective

Agrobacterium suspension carrying clones were pelleted and resuspended separately

in a solution containing 10 mM MgCl2 and 150 g/ml acetosyringone to an optical

density of 1 at 600 nm. Co-infiltration experiments were performed in the following

combinations.

1. Ch Rep/PVX + AC1-AC2dsRNA/pFGC (mixed in a ratio 1:1)

2. Ch Rep/PVX

3. PepLCLV A + ToLCNDV B + peAC1-AC2dsRNA/pFGC (mixed in a ratio

1:1:1)

4. PepLCLV A + ToLCNDV B (mixed in a ratio 1:1)

4.2.2 Plant transformation

The construct peAC1-AC2dsRNA/pFGC was transformed into A.tumefaciens strain

EHA105 by electroporation (section 2.15). N. tabacum was transformed by the

Agrobacterium-mediated leaf disk method (section 2.15). The putative peAC1-

AC2dsRNA/pFGC transgenic plants were selected on ammonium glufosinate (10

mg/l) respectively. PCR analysis (section 2.4) was carried out to confirm the presence

of transgene as well as selection marker gene using respective pair of primers (Table

2.1). The transgene integration in plants was determined by Southern blot

hybridization. A DIG labeled probe of respective gene was prepared (Section 2.16).

The transgene specific siRNA was also detected (section 2.19).

4.2.3 Challenge with virus


46

46

15 T1 plants from 9 transgenic lines of N. tabacum (peAC1-AC2dsRNA/pFGC) plants

were exposed to viruliferous whiteflies in glasshouse. The 10 plants in each line of T1

generation of these transgenic lines with peAC1-AC2dsRNA/pFGC construct were

also agro infiltrated with infectious clones of PepLCLV DNA A and ToLCNDV B

[194]. Then the resistant lines (peAC1-AC2dsRNA/pFGC construct) were also

injected with infectious clones of ToLCNDV DNA A and ToLCNDV B. Non-

transgenic tobacco plants of the same age were used as control [194] (Chapter 3). The

replication of begomoviruses was detected through Southern or Dot Blot

hybridization using full length viruses as biotin or DIG labeled probe (section 2.16).

Relative level of viral DNA were quantified through semi quantitative PCR as

southern blot hybridization do not give quantitative estimation (section 2.16).

Figure 4.1

Plot showing the distribution of genetic variation estimated by nucleotide diversity

(Pi) for Gemini virus infecting c. annuum in Pakistan. The relative positions of the

ORFs of viral DNA genome are illustrated above the plot in linear DNA format.


47

47

Figure 4.2

A diagram demonstrating the binary vector (pFGC5941) engineered with the

silencing trigger construct.

4.3 Results

In the present research, a study was conducted on silencing of ChLCD complex

through RNAi. Gene constructs; peAC1-AC2dsRNA/pFGC based on region

overlapping Rep and TrAP of DNA A (Figure 4.1, 4.2) was cloned. RNAi gene

construct was transformed in N. tabacum through Agrobacterium-mediated plant

transformation (Figure 4.6). The silencing efficiency of construct was checked

through transient assays in N. benthamaiana, N. tabacum and C. annuum.

4.3.1 RNAi constructs silence ChLCV-M Rep in transient assays

There are many draw backs of transgenic plant use to test the viral constructs

including time span, labor work required for transformation and regeneration. Thus

transient assay system has been developed by [203]; [204] co-inoculation of virus

with and hairpin construct targeting the virus in a leaves, suspension culture or

protoplast. Replication protein of ChLCV-M (chili leaf curl Multan virus Rep/PVX)

produces downward leaf curling in N. benthamaiana plants when expressed through

PVX. Silencing efficiency of peAC1-AC2dsRNA/pFGC, were checked in N.

benthamiana plants using transient assays. Agrobacterium culture harboring peAC1-

AC2dsRNA/pFGC and chili Rep/PVX were grown at 28°C for 48 hours and activated

with MgCl2 and acetosyringone. The activated cultures were mixed with different

O.Ds of the cultures and co-infiltrated in N. benthamiana plants. The plants infiltrated

with only Chili Rep/PVX were used as positive control (Figure 4.3). After 10 days of

post inoculation, the plants used as positive control developed severe leaf curl


48

48

symptoms in systemic leaves while those co-inoculated with peAC1-

AC2dsRNA/pFGC did not produce typical symptoms but only developed PVX

symptoms. These results clearly show that the gene constructs targeting Rep-TrAP of

PepLCLV efficiently silence Rep when expressed through PVX, respectively.

Figure 4.3

Transient assays through agro co-infiltration in N. benthamaiana and C. annuum

plants. A) peAC1-AC2dsRNA/pFGC co-infiltrated with Chili Rep/PVX, only PVX

symptoms were visible on the N. benthamaiana and no symptoms were produced by

Rep of PepLCLV. B) Control N. benthamaiana agro infiltrated with Chili Rep/PVX

construct. Plants exhibited leaf curl symptoms after 7 days. C) peAC1-

AC2dsRNA/pFGC co-infiltrated with Chili Rep/PVX, only PVX symptoms were

visible on the C. annuum plants and no symptoms were produced by Rep of

PepLCLV. D) Control C. annuum plant agro infiltrated with Chili Rep/PVX

construct. Plants exhibited leaf curl symptoms after 15 days.

4.3.2 RNAi constructs for PepLCLV in transient assays

475bp


49

49

When plants were injected with infectious clone of PepLCLV (section 3.2.3) beside

DNA B component of ToLCNDV [94], leaf curl in N. benthamiana, N. tabacum and

C. annuum [194] were observed. The symptom vary in plants as in case of N.

benthamiana severe upward leaf curling and stunting were observed as compared to

chilies and tobacco where, downward leaf curling and yellowing were most prominent

[194].

Inoculated plants accumulated higher levels of viral DNA in systemic as compared to

when those co-inoculated with peAC1-AC2dsRNA/pFGC and also did not produce

typical symptoms (Figure 4.4). This displays that constructs targeting Rep and Trap

gene of the virus efficiently silenced PepLCLV. Southern hybridization was used to

confirm the viral replication in infected leaves. The virus was not detected in plants

infiltrated with RNAi constructs showing inhibition or reduction in viral replication

(Fig 4.4), (Fig 4.5). These results suggested that RNAi construct (peAC1-

AC2dsRNA/pFGC) targeting Rep-Trap sequences were able to block systemic

infection of the virus. These results suggested that RNAi construct (peAC1-

AC2dsRNA/pFGC) targeting Rep-Trap sequences were able to block systemic

infection of the virus.

Figure 4.4

Transient assays of construct peAC1-AC2dsRNA/pFGC in N. benthamiana with

PepLCLV and ToLCNDV DNA B. A) N. benthamiana agro inoculated with

PepLCLV and ToLCNDV DNA B along with construct peAC1-AC2dsRNA/pFGC.

B) N. benthamiana injected with PepLCLV and ToLCNDV DNA B as a control.


50

50

Figure 4.5

Replication of virus infected leaves of N. benthamiana plants probed with PepLCLV

Inhibition of virus replication agro infiltrated leaves of N. benthamiana plants probed

with PGL1. N. benthamiana agro inoculated with PepLCLV and ToLCNDV DNA B

along with construct peAC1-AC2dsRNA/pFGC in systemic leaves (Lane 1-3). N.

benthamiana agro inoculated with PepLCLV and ToLCNDV DNA B along with

construct peAC1-AC2dsRNA/pFGC in inoculated leaves (Lane 4-5) N. benthamiana

agro inoculated with PepLCLV and ToLCNDV DNA B as a control in systemic

leaves (Lane 6-7).

4.3.3 Plant Transformation

Invitro regeneration and genetic transformation of Pepper is extremely difficult [163].

Major problem that arises during gene transfer in chili are i) difficulty of regeneration

of plants from tissue culture; ii) procurement of transformed pepper tissues; iii)

regeneration of plants following transformation [164]. Due to the problem of stable

transformation, RNAi studies are difficult in C. annuum (section 2.10.2). The

infectivity of PepLCLV to N.tabacum (Chapter 3) concludes using this model host for

investigating the use of RNAi to obtain resistance to ChLCD. The gene constructs


51

51

AC1-AC2dsRNA/pFGC was transformed in N. tabacum through Agrobacterium-

mediated transformation by leaf disc method (Section 2.10). From the transformation

experiment, 17 T1 independent transformations were obtained, but nine of them were

apparently normal/healthy plants were selected randomly for further assessment using

PCR, southern and Northern blot techniques. These analyses showed that RNAi

construct was integrated into the plant genome (Figure 4.7 A) and transgene produce

Rep-Trap specific siRNA (Figure 4.7 B).

Figure 4.6

Plant transformation in N. tabacum transgene analysis.

A) Callus induction B) shoot regeneration C) root formation on selection media D)

Putative transgenic plants shifted in the soil.


52

52

Table 4.1

Regeneration and transformation efficiencies of transformed tobacco leaf discs

Sr.

No

No.of explants

placed on

shoot

induction

medium (A)

No. of explants

producing shoot

(B)

Regeneratio

n efficiency

(%)

explants No

producing

roots

(C)

Transform

ation

efficiency

(%)

1 15 10 67 8 53

2 15 11 73 9 60

Tot

al

30 21 70 17 57

A) B)

Figure 4.7

Confirmation of the transgenic plants

A) Southern blot analysis of transgenic plants for integration events (Lane 1-5)

transgenic tobacco with peAC1-AC2dsRNA/pFGC construct probed with AC1-AC2

B) RNA gel blot analysis of AC1-AC2 specific small interfering RNAs (siRNAs) in

AC1-AC2dsRNA/pFGC transgenic plant lines . (Lane 1-5) transgenic tobacco with

peAC1-AC2dsRNA/pFGC construct (Lane 6) Negative control plant (Lane 7)

positive control (primer AC1-Ac2)

4.3.4 Transgenic tobacco resistant to ChLCD complex

Gene constructs; PeAC1-AC2dsRNA/pFGC was found to be the best for silencing of

PepLCLV in transient assay. N. tabacum transgenic lines were developed with this

construct (Figure 4.6). 15 T1 plants from 9 lines of peAC1-AC2dsRNA/pFGC


53

53

construct were positive for 35S promoter and specific gene , with similar number of

control plants which were assessed for virus resistance. Young T1 plants were

exposed to around 30 white flies (acquired virus) in each plant under controlled glass

house kept for 120 days. These white files were infected with ChLCD and reared on

chili plants for experimental use.

For the whole season in glass house the high number of white flies (30/plant) was

retained. Plants were observed regularly on weekly basis for presence of disease

symptoms and the percentage of disease incidence was calculated according to the

data. Our data specified that non-transgenic plants developed infection in early growth

stage of plant. Due to a high amount of virus acquired white-flies, disease occurrence

was relatively high as shown in figures. Plant that can be host of virus, could be

resistant if it inhibit the virus multiplication and subsequently stopped disease

symptoms development [205]. Our results showed that some transgenic N.

benthamiana lines were not produce symptoms after inoculation through large

number of white flies. However, our results suggested that all peAC1-

AC2dsRNA/pFGC lines showed variable resistance pattern against chili leaf curl

disease ranging from 6.6 - 93.3 %. Those lines which showed resistance above 75%

were consider as resistant or tolerant whereas lines with 50% resistance were ranked

as susceptible. One line peAC1-AC2dsRNA/pFGC TA14 line was categorized as

extremely tolerant display 93.3% resistance against chili leaf curl disease whereas,

the line peAC1-AC2dsRNA/pFGC TA 3.2 exhibits 6.6 % resistance was classified as

highly susceptible line. However, non-transgenic control plants presented no disease

tolerance as shown in table 4.2. DNA from all the transgenic lines of peAC1-

AC2dsRNA/pFGC TA14 and investigated for virus replication and multiplication

using dot blot hybridization as shown in figure 4.8. PCR reaction with specific

primers were performed to observe the presence or absence of particular gene in T1

generation of transgenic lines. According to results transgenic peAC1-

AC2dsRNA/pFGC plant showing significantly high resistance against chili lead curl

disease (table 4.2 and figure 4.10).

In another experiments N. tabacum 20 plants each of transgenic lines (TA 14.1 and

TA 2.2) and control plant were agro infiltrated with PepLCLV and DNA B

component of ToLCNDV and kept under controlled conditions. 25 days after agro


54

54

infiltration, virus replication was checked by Southern blot hybridization (Fig 4.10).

In control plants, there was a very strong signal of virus but virus was not detected in

transgenic plants. Thus, the constitutive formation of dsRNA in transgenic plants

efficiently blocked virus replication. Virus resistance evaluation experiments with

PepLCLV and DNA B component of ToLCNDV were repeated with T2 plants as

well.

Figure 4.7

Virus resistance assay. A) Tobacco control showing ChLCD symptoms infected with

ChLCD viruliferous white flies B) Transgenic peAC1-AC2dsRNA/pFGC tobacco

resistant to ChLCD infected viruliferous white flies


55

55

Table 4.1 ChLCD resistance/tolerance pattern for peAC1-AC2dsRNA/pFGC plants at T1

stage.

Transgenic

event.

Transgenic

Plants*

Plants with

symptoms

Plants without

symptoms

%age of

resistanc

e

TA 13.1 15 4 11 73.3 TA 14.1 15 1 14 93.3 TA 8.3 15 9 6 40.0 TA 3.2 15 14 1 6.66

TA 15.1 15 3 12 80.0 TA 1.1 15 14 1 6.66

TA 2.2 15 2 13 86.6

TA 10.1 15 14 1 6.66

TA 11.2 15 5 10 66.6

Control 15 15 0 0

* Plant PCR positive with 35 S promoter and AC1-AC2 primers were exposed to

ChLCD infected white-flies


56

56

Figure 4.8

Dot Blot analysis of replication of PepLCLV in RNAi transgenic plant following

exposure to viruliferous whitefly

(A1-A2) Transgenic tobacco plant of peAC1-AC2dsRNA/pFGC without exposure to white

fly (A3-A4, B1-B4, C1-C4) Transgenic tobacco plant (peAC1-AC2dsRNA/pFGC) after

exposure to white -fly (20dpi) (D1-D4) Control untransformed tobacco plant after exposure to

white-fly (20dpi)


57

57

Figure 4.9

Virus resistance assay. A) Tobacco control showing symptoms of PepLCLV and

ToLCNDV DNA B. B) Transgenic peAC1-AC2dsRNA/pFGC tobacco resistant to

PepLCLV and ToLCNDV DNA B.


58

58

Figure 4.10

Southern blot analysis using biotin labeled PepLCLV probe of transgenic plants

(peAC1 -AC2dsRNA/pFGC) inoculated with ChLCD (PepLCLV and DNA B of

ToLCNDV). Transgenic plants without inoculation (Lane 1), Plasmid Control (Lane

2), Transgenic plants inoculated with (PepLCLV and DNA B of ToLCNDV) (Lane

3-4) Non transgenic inoculated (PepLCLV and DNA B of ToLCNDV) (Lane 5-7).

4.3.5 Transgenic tobacco resistant to heterologous virus

ToLCNDV produce stunting with leaf curling in N. Tabacum within twenty one days

of inoculation [64]. 15 transgenic plant line TA 14.1 T2 plants was infiltrated with

ToLCNDV. The 10 control plants infiltrated with only ToLCNDV were used as

positive control. Symptoms appeared on all control plants (10/10) after 25-30 days.

Different phenotypes in the transgenic plants were observed, including (7/15) showed

mild symptoms after 35-40 days and 8/15 delay in symptoms with no modification of

symptoms in two lines. So it was found that the hairpin construct also block

replication of ToLCNDV (Fig 4.11). So this construct shows resistance against

homologus as well as Heterologous plant viruses.

1 2 3 4 5 6 7


59

59

Figure 4.11

Virus resistance assay A) Transgenic tobacco plant with construct peAC1-

AC2dsRNA/pFGC agro inoculated with both components of ToLCNDV B) Tobacco

agro inoculated with bi partite ToLCNDV as a control.


60

60

4.4 Discussion

Chili pepper is an important vegetable crop cultivated through Pakistan. Chili

genotypes commonly grown in Punjab are susceptible to ChLCD complex [194].

Whenever a plant is confronted with virus, some complex changes in the host

undergoes to activate defense mechanism and also these changes need for the

replication as well as virus movement inside plant. RNA silencing has key role in the

defense against plant viruses to the regulation of gene expression and chromosome

organization [15, 206, 207]. At present, RNA silencing seems to be the most

favorable choice for developing resistance against Gemini viruses [200, 206-208].

Some sources especially genetically engineered resistance in plant has been reported

as a potential source of control against viruses. Most of the work on the use of RNA

silencing have been reported against against TGMV, TYLCSV and TYLCV, where

expression of sense and antisense RNA in transgenic plants have been employed

successfully to control these viruses [209-213] produced transgenic plants with

expression of siRNAs against TYLCSV and ToCMoV, respectively. Hence thèse

plants often exibited delay in symptoms development, mainly with low inoculum in

comparaison to the situation with RNA viruses [214], entirely resistant lines were not

observed. In conclusion of this whole process viral mRNA of all RNA viruses are

main target of RNA silencing so the success of this strategy depends on the relevance

of the target genes. RNAi technique has been investigated as a source of delivering

resistance to plants against begomoviruses [199, 200].The first successful field tests

of RNAi-based resistant plant lines has been conducted for the first time [215]. In this

study we selected the region (overlapping region of Rep and TrAP) that are the

potential target for siRNA in the field infected plants. This region is also conserved

among the begomoviruses [201, 216].

Furthermore, it was found that Rep protein is responsible for the replication and

symptom determinant, when expressed through PVX in N. benthamaiana [217]. Rep

protein perform multiple function [218-220]. For the rolling circle replication this

protein identifies the common region (CR) that are


61

61 facilitated by the presence of four highly sequence-specific Rep binding sites [220,

221]. AC2 which is also know as TrAP protein and is also known to control the

function of host genes expression [222]. Thus, these sequences provide a better

target for providing better protection against the disease. Based on all these work, it

was concluded that both of these regions can be an important target for developing

RNAi based resistance against this virus. So, in this research work, chili Rep-TrAP

expression was silenced by making RNAi constructs targeting Rep-TrAP (AC1-AC2)

in transient assays. Hairpin RNAi construct AC1-AC2 dsRNA/pFGC targeting Rep-

TrAP (575 bp fragment containing 400 bp region of Rep at C-terminal and 175 bp of

TrAP at N-terminal). Then this construct AC1-AC2 dsRNA/pFGC was analyzed by

co-infiltration with Ch.Rep/PVX. RNAi construct blocks rep expression and the

plants had developed only PVX symptoms, Rep of ChLCV-M is different from other

Gemini viruses when expressed through PVX because in this particular case Rep

produces downward leaf curling in N. benthamaiana plants.

Another strategy termed as Post transcriptional gene silencing was established to

control the viruses when plant cells at once transfected with ACMV [CM], so

therefore siRNA was designed synthetically to target the AC1 gene of virus. As a

result reduction in the accumulation levels of AC1 mRNA by more than 90% and

viral DNA by 70% were observed in comparison to control plants [223]. Resistance

against CLCuV in tobacco were observed in response to transgenic expression of

AC1-antisense [117] and for BGMV in case of bean [224]. Therefore it has been

concluded that RNAi-based resistance against geminiviruses appears to be highly

encouraging for developing resistance when AC1 gene was targeted.

In another experiments transient assays were used to check the effect of RNAi gene

constructs on virus levels in inoculated and systemic leaves. N. benthamiana and C.

annuum were used for transient assay. The southern analysis of these inoculated

plants have shown the replication of the virus in the inoculated leaves but the titer of

the virus in the systemic leaves has been found to be very reduced. The detection of

the virus in inoculated leaves confirmed reliable infiltration. The decrease in the virus

titer in systemic leaves shows that silencing signal generated in the inoculated leaves.

Furthermore, RNAi constructs were also transformed stably in N. tabacum to see if

transgenic plants were protected from the disease. Transgene plants looks


62

62 morphologically normal as compared to non-transgene plants and showed no adverse

effects on plant growth. The work carried out here showed that targeting of these

conserved regions through RNAi significantly reduced the level of viral DNA in

transgenic plant when these transgenic plant was inoculated with ChLCD infected

viruliferous whitefly. The virus replication was reduced to undetectable level in some

cases when checked by Southern blot hybridization but could be detected by PCR.

Thus, silencing of these sequences could effectively control chili leaf curl disease

component through RNAi. In further it would be interesting to see silencing of whole

virus complex is because of siRNA generated from AC1 or AC2 in transgenic plant.

If plant suppress the multiplication and accumulation of virus and subsequently

disease symptoms appearance that it could be known as resistant [205]. There are

several levels of resistance in plants such as high to moderate in which no virus

accumulates in the plant rendering it. Whereas in case of low resistance virus

accumulate in plant at low level as compared to susceptible and mild symptoms could

be found. However in tolerance plant expresses mild symptoms but looks healthy and

have normal level of virus in it [205].

Here some lines showed resistance above 75% (resistant) where as other lines show

less than 50% resistance were consider as susceptible. Only TA14 with 93.3% level of

resistance were ranked as highly resistant against ChLCD (Table 4.2). Although virus

transmitted through whiteflies led to the milder infection as compared to the artificial

infiltration of virus into plants for experimental purpose [225].

Plants (20 of each) of transgenic lines TA 14.1 and TA 2.2 (ranked as highly

resistant/tolerant in whitefly infected with CLCD exposure) and twenty healthy plants

of N. tabacum were inoculated with (PepLCLV + DNA B component of ToLCNDV)

and kept under controlled conditions. As a results after three weeks of inoculation

typical symptoms of PepLCLV, upward leaf curling and stunting were found in all

twenty non-transgenic plants. As a comparison no such type of symptoms were

observed on TA 14.1 and TA 2.2 transgenic plants as shown in figure 4.13. Twenty

five days after agro infiltration of non-transgenic leaves Southern blot hybridization

were performed to check the presence of viral DNA. So the results was clearly

showed the presence of viral DNA in non-transgenic plants as compared to transgenic

ones as shown in figure 4.14a.


63

63

To further investigate the presence of virus in transgenic plants PCR technique was

used in which primers designed to target DNA A. This study helps to explore the

presence of virus in (13 out of 20 plants) in TA 2.2 while in (10 out of 20) in TA14.1

transgenic plants, but only at low dilutions; whereas in non-transgenic infected plants

viral DNA was detected at all dilutions (Figure 4.14b). RNA silencing is sequence

homology based and is important in case of engineering resistance. ToLCNDV is a

bipartite begomoviruses [31], and it infects chilies, tomato and watermelon crops in

the Indian subcontinent [158, 226]. ToLCNDV produced typical of leaf curling and

stunting in N. tabacum within three weeks of inoculation [64]. In order to understand

that how much sequence homology is required for the efficient gene silencing and

also to see that whether the transgenic peAC1-AC2dsRNA/pFGC plant can block

heterologus viruses. 15 TA 14.1 transgenic plants were also infiltrated with

ToLCNDV. The 10 control plants infiltrated with only ToLCNDV were used as

positive control. Symptoms appeared on control plants after 25-30 days. The

transgenic plants inoculated with ToLCNDV also showed mild symptoms after 35-40

days. So it was found that the hairpin construct can efficiently block ToLCNDV. (Fig

4.9). Rep-TrAP 575 bp fragment (containing 400 bp region of Rep at C-terminal and

175 bp of TrAP at N-terminal was used in hairpin construct) of PepLCLV showed

89% resemblance to ToLCNDV (Accession No DQ629102) Rep-TrAP region. These

findings revealed that transgenic plants with peAC1-AC2dsRNA/pFGC constructs

were capable to prevent the replication and movement of virus; as 3 out of 9

transgenic lines were found immune for the virus.

The basic objective of this study was to search the possibility of attaining resistance to

ChLCD complex by silencing the Rep and Trap gene of PepLCLV. As these genes

are conserved among begomoviruses that belongs to Old World [57, 216, 227].

However this strategy could be used to develop in different crops against particular

begomoviruses specie which may cause sever diseases.

In this research plant transformation system in a local variety of chilies through

Agrobacterium mediated plant transformation as RNAi gene constructs are working,

these can inhibited the replication of ChLCD complex in transgenic chili plants. This

work can lead to the development of virus resistant chili crop in Pakistan.


64

64 The role of Cauliflower mosaic virus (CaMV) defense and

silencing suppressor protein 6 (p6) in modulating auxin

signaling

5.1 Introduction

Introduction

Cauliflower mosaic virus (CaMV) is the type member of the genus

caulimoviruses, which is one amongst the six genera of the family Caulimoviridae.,

including Para retroviruses that infect plants and replicate by reverse transcription of a

circular ds DNA genomes (1). Para retroviruses replicate just like retroviruses through

reverse transcription while the viral particles contain DNA instead of RNA (2).

Genome of CaMV comprises of six genes and it is approximately of 8kb in size (3).

Gene VI of CaMV, encodes a multifunctional P6 protein with 62 kD polypeptide,

which is main genetic cause of symptom appearance and viral pathogenicity (4) and

can also influence the compatibility and host range (5). As P6 stores in the form of

inclusion bodies in the cytoplasm of infected cells (6), and has numerous functional

domains, comprising of an RNA binding domain, a translational transactivator, and a

zinc finger domain, these all domains are essential for viral infectivity (7 Four main

role of P6 protein of CaMV has been identified so far which includes interaction with

two other proteins of CaMV that involved in aphid transmission, P2 and P3 (8). P6

form cytoplasmic inclusion bodies of different sizes; among them smaller one move

dynamically through endoplasmic reticulum along actin filaments (9). This movement

is most important for virus trade in intracellularly in plant cells and P6 also interacts

with P1 (movement protein) of CaMV (10) and CHUP1, which intermediates

association between chloroplasts and the cytoskeleton (11). In case of Arabidopsis

and N. benthamiana P6 affects signaling pathways mediated by Salicylic acid,

Jasmonic acid, Ethylene and auxin synthesis (12).

Isolates of CaMV Bari-1 or Cabb B-JI display minor and severe symptoms in

Arabidopsis but isolate Baji-31 which is recombinant P6 protein of CaMv in

Arabidopsis transgenic lines showed very severe symptoms (14). 14) studied 41

transgenic lines of Arabidopsis out of which 17 lines (A7 & B6) showed minor to

severe vein chlorosis and stunting. In another study 15) were mutagenized the A7 line

seeds by gamma radiation and seedlings were screened for inhibited indications of


65

65 restricted growth and chlorosis. Mutants having wild type phenotypes were labeled as

(b4-2 and b2-3) but had functional transgene. When these two mutant lines (b4-2 and

b2-3 were backcrossed to Arabidopsis col-o (wild type) to obtain plants with -

irradiated mutation without P6 transgene.

Auxin is an important and multifunctional hormone that can effect in plant growth

(16). Even though auxin-dependent growth is observable among plant tissues,

produced primarily in apical regions of the shoot and move in a polar manner to

different locations in plant (17). Auxin is reallocated to root tips from root apex

through cortical and epidermal tissues (18). Plant hormone auxin is transported into

plants through a dynamic process of polar auxin transport in cell to cell manner and

polarity is its main feature (19, 20). Although polar auxin transport has coordinative

role for plant development (21). BIG/TIR3 gene from Arabidopsis encode a huge

calossin-like protein which is responsible for polar auxin transport (22). Arabidopsis

mutant tir3 (transport inhibitor response 3), have a pleotropic phenotype, containing

fewer and shorter siliques, reduced inflorescence height, reduced petiole and root

length, and decreased apical dominance (24). TIBA which is known as 2, 3,5-

triiodobenzoic acid is an inhibitor of polar auxin transport (PAT) system (23). TIBA

blocked the process of embryo formation from embryogenic cells but cell division

remain unaffected (25). Also TIBA inhibition could induced abnormal development

of embryos subsequently result as plantlets without shoots and roots (26).

Systemic virus infection did some morphogenetic modifications in plants as well as

weakens the state of auxin hormone. Hence it‟s suggested by some reports that auxin

activity reduced in infected plants and also become cause of stunting growth in plants

(25).The molecular mechanisms involved in the alteration of auxins metabolism and

its transport is still not known (27). The previous studies described that signaling

pathway of auxin is involved in symptoms appearance during viral infection (28). It is

clearly known that auxin response factors are synchronized through gene silencing

mechanism (29) and P6 protein is the pathogenicity determined and suppressor of

RNA silencing in case of (30). So the basic aim of current study was to examine the

effects of cauliflower mosaic virus P6 protein on auxin signaling pathways and also


66

66 its involvement in assembly of ARF (siRNA/miRNA) species and its subsequent

effects on plant growth.

Material and Methods

TIBA plate Experiment

The seeds of the 21), b4-2, b2-3 [f], CSE 1, CSE 2 (Geri 2004) and Col-O, Ler

Gl1 (wild type) were taken. ½ strength MS medium was prepared and autoclaved.

For each genotypes, different plates were prepared which comprised of MS media and

(0, 5, 10, 35, 50 and 70 um TIBA). Seeds of each genotype were kept on each

individual conc. of TIBA separately and incubate at 4ºC for 4 days and then shifted to

Growth room. After that data for the seed germination was noted after 15 days from

each plate.

Detection of miRNA from (A7, B6 and Ler gl1)

Arabidopsis seeds A7, B6 and wild type Ler gl1 were grown under a 9h photoperiod

and at 21 2C temperature was maintained (32). Tri Reagent (Sigma) was used to

extract total RNA from A7, B6 and wild type plants and separated on 15%

polyacrylamide gels electrophoresis 33) and ath-MIR167 (Wu, 2006) were prepared

by annealing primers sets (ath-MIR160) and (ath-MIR167). These were used at 250

nM as templates for in vitro transcription with α-

32P UTP by T7 RNA polymerase at

22°C.

Results:

Five different concentrations of TIBA (i.e., 0, 5, 10, 35, 50 and 70 um) and

Arabidopsis lines A7 and B6, TIR3 mutant seeds were grown on MS media, similarly

transgenic P6 (b4-2 and b2-3) with gamma radiation mutation, (CSE 1A and CSE 2A)

mutants without P6 gene and (Col-O and LerG1) control plants. Data was collected

after two weeks and it was found that (0, 5 and 10 um conc.) of TIBA had no

influence on the development of wild type Arabidopsis as well as control plants.

However, conc. of TIBA (50 and100 um) were lethal for all types of plants used.

However 35 um conc. suppressed the growth of wild plants while A7, B6 and tir3

mutants were unaffected. Though wild type Arabidopsis (b4-2, b2-3, CSE1A and

CSE2A) lines were killed by 35um conc. of TIBA as shown in figure 1.


67

67

Aforementioned results revealed that there might be a strong relationship among P6

protein of CaMv to modulate auxin signal and also termed as ARF, which are

synchronized by gene silencing (34). To observe either P6 controls the manufacture of

auxin response factors with regulation of siRNA/miRNA species in Arabidopsis

microRNAs ath-MIR160 a, b,c and ath-MIR167 a, were tested in wild type (lerge1)

and A7 and B6 lines by Northern blot analysis (Figure 2). No significant effect was

found on ath-MIR167 and the level of ath-MIR160 was reduced in A7 and B6 lines.

Discussion

Various proteins of virus could disturb signaling pathways of cell. Certain studies on

the direct relations between auxin signaling and gibberellin levels for Tobacco mosaic

virus (TMV) and Rice dwarf virus (RDV) have been conducted (35). The rep protein

of TMV altered the localization and stability of interacting auxin/indole acetic acid

(Aux/IAA) proteins in Arabidopsis, it is also responsible for the alteration of auxin-

mediated gene regulation as well as promotes disease development (33. Similar kind

of replicase-Aux/IAA interaction in tomato plant was identified that could affect

disease development (36).

Arabidopsis plants of P6 transgenic (A7, B6) and TIR mutant (tir) showed resistance

to toxic effect of TIBA after treatment with TIBA. P6 gene expression provokes

symptoms like phenotype without virus infection in both host (N. tabacum) and non-

host (Arabidopsis) plants of CaMV (37). There are reports on the P6-transgenic (38)

and tir3 plants that are entirely unresponsive to ethylene and auxin (29) transgenes

although, gamma radiation mutation that suppress the gene product are quite sensitive

to TIBA.These test transgene plants were also found to be susceptible for ethylene

(suppress gene product formation), perhaps its role is to mediate characteristics of P6

gene of CaMV with host during infection (30). P6-transgenic and CaMV-infected

plants showed symptoms of chlorosis and stunting are mainly dependent on

interaction of P6 and different components involved in ethylene signaling, also it may

function to extend these interactions as ethylene suppress gene products formation

(31). The suppressor gene product may act as a complementary helpful regulator of

ethylene signaling, maybe towards downstream region (35 whereas, P6 gene also

stimulates chlorosis and suppression of plant defense mechanism.


68

68

Perhaps this interaction will be abolish with the deletion of this suppressor gene and

leads to reduced susceptibility in plants against viral infection (36). Different proteins

of virus can also affect miRNA pathway and could effect on improvement after

expression in plants (37). Plants that are expressing viral proteins (P1/HC-Pro, p19,

p15, and p21) showed small amount of miRNA-directed ARF proteins can activate or

suppress transcription that depends on the nature of middle domain of protein (38). In

present study P6-expressing transgenic plants exhibited less buildup of MiR160 that

could targets ARF10, ARF16, and ARF17 (39). Whereas auxin response factors are

plant-specific family of DNA (40).

Aux/IAA proteins are nuclear proteins that survive for short span and can

heterodimerize with activating (41). Domains of C-terminal Aux/IAA proteins

mediate heterodimerization and preserved with the CTD of Auxin response factors

proteins (41). Increase level of auxin enhance the proteolysis of Aux/IAA proteins

and allow these proteins to homodimerize and also induced early gene expression of

ARF gene.

MiRNA-resistant ARF17 plants which showed increase level of mRNA expression

and improved buildup of auxin-inducible GH3-like mRNAs comprising

(YDK1/GH3.2, GH3.3, GH3.5, and DFL1/GH3.6), that code for auxin-conjugating

proteins (42). Basically theses alteration in expression correlates with growth related

imperfections, containing embryo and emerging leaf symmetry irregularities, leaf

shape defects and root growth defects etc. (45). These defects determine the

importance of miR160-directed ARF17 regulation and implicate ARF17 as a regulator

of GH3-like early auxin response genes (44).

Mutations in DCL1, AGO1, HYL1, and HEN1 genes of Arabidopsis plant, damage

the miRNA pathway and lead to developmental defects that overlap with those

exhibited by ARF17 plants. Particularly hypo morphic ago1 rosette leaves are serrated

and ago1, hyl1, and hen1 null mutant‟s show upward curled rosette leaves and a

dwarfed stature.

Indeed, miR160 accumulation is reduced and ARF17 mRNA accumulation is

increased in dcl1, ago1, hyl1, and hen1 mutants (46), there is a probability of reduced


69

69 miR160-directed ARF17 regulation responsible for growth related anomalies of

mutants.

Figure 1: Effect of 3, 5-triiodobenzoic acid (TIBA) on Arabidopsis lines, P6

transgenic with gamma radiation mutation, mutants which lacks P6 gene and control

plants.

Figure 2: Expression of ath-MIR160 (A) and ath-MIR167 (B) miRNA probe on P6

transgenic and wild type plant (Lane 1) Lrg1 (Lane 2) A7 (Lane 3) B6


70

70 Response of different (Capsicum annuum L) genotypes for

callus induction, plant regeneration and plant

transformation

6.1 Introduction

Chili pepper belongs to the genus Capsicum, which is from the family Solanaceae,

subfamily Solanoideae and tribe Solaneae [163, 274, 275]. The genus Capsicum

comprises of 5 cultivated and 26 wild species [274]. C. annuum is the most broadly

cultivated species and economically important crop of Pakistan. Chili occupies 19%

of the total area among vegetable cultivation and is grown on an area of 38.4 thousand

hectares with 90.4 thousand tones yield [276]. In Pakistan, Sindh province is the main

producer of chilies followed by Punjab and Baluchistan. Different types of sweet

pepper, pungent chili peppers are cultivated and in common used in the world [274]

as, or a source of dried powders of various colors, yet it suffers great losses due to

infection by various viruses. It has been reported that there are 45 different viruses

that infect chilies/peppers world-wide [276]. Genetic engineering holds great promise

for the effective control of plant viruses [277, 278]. Therefore, it was deemed

necessary to genetically engineer the pepper plant, since it has many useful traits.

Genetic transformation is now a routine procedure to insert genes into diverse plant

species, containing vegetable and fiber crops [279, 280].

Current progress in plant genetics and biotechnology is extremely dependent upon the

use of in-vitro tissue culture, hence the establishment of effective plant regeneration

system [281]. Among the various systems applied somatic embryogenesis (SE)

through callus induction is of special value [281]. It also offers opportunities for In

vitro production of plants through clonal propagation and genetic modification

through genetic transformation. As a result, increasing number of protocols describing

efficient in-vitro regeneration are being published [163, 164, 282, 283].

In chili pepper, several protocols are available for inducing in-vitro plant regeneration

[163, 164, 168, 284, 285]. However, some of these reports suggest a strong influence

of genotype, [286, 287] culture medium composition, explants source, and

environment on the regeneration process. Among them the genotype [287] and


71

71 nutrient composition [288] are regarded to be the major sources of variation in in-

vitro culture [164] and had been studied.

Pepper belongs to the family Solanaceae, whose members are certainly responsive to

tissue culture and transformation practices, however pepper is considered to be an

tremendously problematic and resistant species for in-vitro regeneration and genetic

transformation [163].

The gene transfer in chili is difficult and there are several obstacles i) whole plant

regeneration through tissue culture ii) procurement of transformed tissues iii) plant

regeneration after transformations [163]. In last ten years scientists have made great

progress in chili transformation worldwide [163, 164, 168, 284, 285 ]. Transgenic

pepper expressing the coat protein gene of CMV [289] and plants that expressed

CMV satellite RNA [290] were obtained with low regeneration and transformation

efficiencies. However, the published protocols could not be repeated in other

laboratories. RNAi has been used to engineer resistance against ChLCD (section 4.3).

Transgenic peAC1-AC2dsRNA/pFGC tobacco plant showed considerable

resistance/tolerance against ChLCD (Table 4.2 and Figure 4.10). Due to the problem

of stable transformation, RNAi studies are difficult in C. annuum.

This study was therefore conducted to screen Pakistani chili commercial genotypes

for callusing response and to develop an efficient in-vitro clonal propagation protocol.

This protocol demonstrates the genotype independent response for morphogenic

callus formation and genotype dependent response for plant regeneration. Different

factors influencing genetic transformation in local chili pepper genotype were also

investigated.

6.2 Materials and Methods

6.2.1 Plant material, Seed Germination and Explant preparation

The main objectives of this study was to examine the effects of various plant growth

regulators, genotypes and explants on chili tissue culture as no reports of such type of

effects on chili regeneration was available from Pakistan so far. Commercial

genotypes of C. annuum (Loungi and Sanam) seeds were taken from Ayub


72

72 Agricultural Research Institute, Faisalabad Pakistan and C. annuum genotypes

[Seedex pepper (SP) and Tatapuri (TP)] seeds from Sindh Horticulture Research

Institute, Mirpurkhas were obtained and used in this study. Chili seeds were surface

sterilized (section 2.14) and were sown in MSO medium (section 2.15). The

hypocotyls and cotyledons were excised from seedlings after 12 days of germination

and used as explants for callus induction. The hypocotyl explants were cut into 3.5-

4.5 mm long pieces and cotyledons were transversely cut into two parts. The explants

were cultured immediately in order to prevent the drying of cut edges of the explants.

6.2.2 Culture Medium and condition

The hypocotyl and cotyledon explants were placed on three different compositions of

chili callus induction media [(ChC1, ChC2 and ChC3) (Table 6.1)] at a temperature of

25 ± 2°C under 16/8 h photoperiod. For plant regeneration, calli obtained from each

combination were divided into three parts and cultured on three different compositions of

(ChSR1, ChSR2 and ChSR3) shoot regeneration media (Table 6.2). All the media were

solidified with 0.8% (w/v) tissue culture grade agar. The pH was adjusted to 5.8 prior

to autoclaving. Sterilized medium was poured into Petri plates and the plates were

sealed with parafilm. The elongated multiple shoots (3–4 cm long) were excised

individually and cultured on MSO chili root proliferation medium (section 2.10.1) for

fifty days and allow to developed roots. After the rooting agar was removed from

plantlets through washing and plantlets were shifted to pots containing soil:

Vermiculite (1:1) mixture. Plats were kept in shade for 15 days and watered regularly

and after that transferred to green house. Fifty hypocotyl explants and fifty cotyledon

explants (10 explants in 5 replicates) of each genotype were used in these

experiments. The mean ± SE values have been calculated from all the data of

experiments using Statistix 8.1 and were presented in the results.

6.2.3 Agrobacterium-mediated genetic transformation in chili pepper (C. annuum

L)

Hypocotyl and cotyledon explants of C. annuum SP (section 6.2.1) were obtained

(Section 6.2.2). A single clone of A. tumefaciens LBA 4404 35S GFP/pFGC

(Provided by Molecular virology and Gene silencing Lab, NIBGE) and A.

tumefaciens EHA105 peAC1-AC2dsRNA/pFGC (section 4.2.6) was inoculated in 20

ml LB liquid medium supplemented with 50 mg/l kanamycin, 100 mg/l streptomycin


73

73 (section 2.10.1) and cultured on a rotary shaker at 28°C, 180 rpm, for 24 h. The

bacterial cells were then centrifuged and the pellet suspended in MS0 liquid medium

[MS0 (section 2.10.1) without agar] to O.D.600=0.38–0.42. Hypocotyl and cotyledon

explants were inoculated with the cultures of A. tumefaciens LBA4404 having 35S

GFP/pFGC construct and A. tumefaciens EHA105 peAC1-AC2dsRNA/pFGC for 8–

10 min, followed by co-culture on ChC2 medium (Section 6.2, Table 6.1) at different

temperatures (22 and 25ºC), photoperiod (16h light 8h dark, and complete darkness)

and co-cultivation time periods. Explants were separated from co-culture medium and

kept on ChC2 selection medium [ChC2 medium, glufosinate ammonium (Basta, 4

mg/l) and cefotaxime (50 mg/l)] and incubated (Section 2.14). Explants were

subcultures after every 2-3 weeks and placed on ChC2 selection medium. GFP

fluorescence was observed in putative transgenic calli using 100-W long wave UV

lamp (Blak-Ray Model B 100YP; UV Products). Total genomic DNA of callus of

chilies was extracted by CTAB method (section 2.2). The transgene in callus was

confirmed through PCR with specific primers of the transgene. Calli became

brownish and dead after 40 days. 200 hypocotyl and 150 cotyledon explants of both

genotypes in 10 different batches (with different experimental condition) were

evaluated in these experiments.


74

74

Table 6.1

Chili callus induction medium (ChC)

Chili Callus

induction media

Basal media

Φ

Sucrose

(g/L)

BA

(mg/L)

IAA

(mg/L)

NAA

(mg/L)

Agar

(mg/L)

ChC1 MS salts +

vitamins

30 2.0 - 1.0 9.0

ChC2 MS salts +

vitamins

30 3.0 0.5 - 8.5

ChC3 MS salts +

vitamins

30 4.0 0.5 - 9.0

Φ MS salts and vitamins (Phyto Technology USA, Prod NO: M404)


75

75

Table 6.2

Chili shoot regeneration medium (ChSR)

Chili Shoot

Regeneration media

Basal

medium Φ

Sucrose

(g/l)

BA

(mg/l)

NAA

(mg/l)

GA3

(mg/l)

Agar

(mg/l)

ChSR1 MS salts +

vitamins

30 5.0 0.05 - 9.0

ChSR2 MS salts +

vitamins

30 4.0 0.05 2 8.5

ChSR3 MS salts +

vitamins

30 3.0 0.05 - 9.0

Φ MS salts and vitamins (Phyto Technology USA, Prod No: M404)


76

76

Table 6.3

Growth regulators and their stock preparation

Growth

Regulator

Stock

Conc.

Preparation* Storage

IAA 1,000

ppm

Dissolved 100 mg IAA in 10 ml

water then made the volume with

water to 100 ml

Below 0°C

NAA 1,000

ppm

Dissolved 100 mg NAA in 5 ml of IN

NaOH then made the volume with

water to 100 ml

4°C

BA 1,000

ppm

Dissolved 100mg BA in 5 ml of 1N

NaOH, then made the volume with

water to 100 ml

4°C

GA3 1,000

ppm

Dissolved 100mg GA3 in 5 ml of IN

NaOH then made the volume with

water to 100 ml

4°C

*Used double distilled deionized water


77

77 6.3 Results

6.3.1 Callus Induction

The data for the callus induction was recorded after 30-32 days. Callus was induced

from both hypocotyl and cotyledon explants from all chili genotype. Factorial analysis

of variance (ANOVA) test was carried out to detect differences among the factors

tested. The data were analyzed and statistical analysis revealed that there is no

significant difference on type of explants and medium used in this study on frequency

of callus induction (Table 6.6). For all four genotypes, callus induction from

cotyledons was quicker than hypocotyls. Calli appeared from the cut edges of both

hypocotyls and cotyledon explants after about 3-4 weeks culture with variable

proliferation rates. Most of the calli obtained were compact with opaque or yellowish

color and some were soft, watery, morphogenic calli with translucent or light yellow

in color. Callus was formed in both explants tissues (hypocotyl and cotyledon)

segments of 2 spinach cultivars, but the percentage of callus formation were not

variable in different explants.

Loungi showed the lowest callus induction potential (52.6%), while SP showed

maximum callus induction growth. Among the media composition, callus induction

medium having IAA 1 mg/l + BA 3 mg/l was found to be most effective for callus

induction but the differences were statistically non-significant (Table 6.6). Callus

obtained from this medium were quite good in texture and friable in nature than other

medium, SP hypocotyl explants showed maximum callus induction on medium

containing IAA 1 mg/l + BA 3 mg/l while Sanam cotyledons showed maximum callus

induction on medium having IAA 1 mg/l and BA 2 mg/l. Rhizogenic calli were

obtained from hypocotyl explants of Loungi that were non-regenerable in ChC1

medium.


78

78

Table 6.4

ANOVA showing the effect of explants, genotypes and Media interaction (%) for

chili callus induction

Source DF SS MS F P

Explant 1 7.008 7.0083 2.30 ns

Genotype 3 44.758 14.9194 4.90 s

Media 2 5.600 2.8000 0.92 ns

Explant *Genotype 3 98.692 32.8972 10.80 s

Explant *Media 2 11.667 5.8333 1.92 ns

Genotype*Media 6 25.867 4.3111 1.42 ns

Explant *Genotype*Media 6 91.133 15.1889 4.99 s

Error 96 292.400 3.0458

Total 119 577.125

Grand mean 5.8750 CV 29.71

Significant value (P >0.05), significant difference (s), non-significant difference (ns)


79

79

Table 6.5

Effect of genotype on chili callus induction.

Genotype Mean

(%)

Homogeneous

Groups

SP 68.3 A

TP 59.6 Ab

Sanam 54.3 B

Loungi 52.6 B

Figure 6.1

Effect of genotype on chili callus induction

Callus Induction After 32 days

0

20

40

60

80

1

Genotype

Mean

Call

us I

nd

ucti

on

(%)

SP TP Sanam Loungi


80

80 Table 6.6

Interaction of genotype and explants (hypocotyl and cotyledon) response on chilli

callus induction.

Figure 6.2

Interaction of genotype and explants (hypocotyl and cotyledon) response on chilli

callus induction.

Callus Induction After 32 days

0

20

40

60

80

100

1

Genotypes

Mean

Call

us

Ind

ucti

on

(%

)

Hypocotyl SP Hypocotyl TP Cotyledon Loungi Cotyledon SP

Cotyledon Sanam Hypocotyl Sanam Cotyledon TP Hypocotyl Loungi

Explants Genotype Mean

(%)

Homogeneous

Groups

Hypocotyl SP 76.6 A

Hypocotyl TP 73.3 Ab

Cotyledon Loungi 62.0 Bc

Cotyledon SP 60.0 C

Cotyledon Sanam 57.3 CD

Hypocotyl Sanam 51.3 CDE

Cotyledon TP 46.0 DE

Hypocotyl Loungi 43.3 E


81

81 Table 6.7 Effect of combination of genotype, explants and callus induction medium

response on chili callus induction.

Explant Genotype Media Mean

(%)

Homogeneous

Groups

Hypocotyl SP ChC2 80.0 a

Hypocotyl SP ChC3 80.0 a

Hypocotyl TP ChC1 80.0 a

Hypocotyl TP ChC3 80.0 a

Cotyledon Sanam ChC2 76.0 ab

Cotyledon Loungi ChC3 70.0 abc

Hypocotyl SP ChC1 70.0 abc

Cotyledon Loungi ChC2 68.0 abcd

Hypocotyl Sanam ChC3 68.0 abcd

Cotyledon SP ChC1 66.0 abcde

Cotyledon SP ChC3 62.0 abcde

Hypocotyl TP ChC2 60.0 abcde

Cotyledon Sanam ChC1 60.0 abcde

Hypocotyl Sanam ChC1 56.0 bcdef

Cotyledon TP ChC1 56.0 bcdef

Cotyledon SP ChC2 52.0 cdefg

Hypocotyl Loungi ChC1 50.0 cdefgh

Cotyledon TP ChC3 48.0 defgh

Cotyledon Loungi ChC1 48.0 defgh

Hypocotyl Loungi ChC2 46.0 efgh

Cotyledon Sanam ChC3 36.0 fgh

Hypocotyl Loungi ChC3 34.0 gh

Cotyledon TP ChC2 34.0 gh

Hypocotyl Sanam ChC2 30.0 h


82

82

Figure 6.3 Combination of genotype, explants and callus induction medium response

on chili callus induction.

Chili Callus Induction After 32 days

0

20

40

60

80

100

Mean(%)

Explant, Genotype and Media

Mean

Callu

s In

du

cti

on

(%

) Hypocotyl SP ChC2

Hypocotyl SP ChC3

Hypocotyl TP ChC1

Hypocotyl TP ChC3

Cotyledon Sanam ChC2

Cotyledon Loungi ChC3

Hypocotyl SP ChC1

Cotyledon Loungi ChC2

Hypocotyl Sanam ChC3

Cotyledon SP ChC1

Cotyledon SP ChC3

Hypocotyl TP ChC2

Cotyledon Sanam ChC1

Hypocotyl Sanam ChC1


83

83 6.3.2 Chili Plant regeneration

Three different chili shoot regeneration media (ChSR1, ChSR2 and ChSR3) based on

MS salts supplemented with 1% (w/v) sucrose, 0.05 mg/l NAA, 3-5 mg/l BA alone or

in combination of GA3 2 mg/l (Table 5.4) were used to define suitable medium for

chili plant regeneration from calli. Significant difference at (P >0.05) in plant

regeneration system was observed in the genotypes. All the 4 genotypes showed

different regeneration response on three different combinations but none of them gave

any regeneration response on MS without any hormones. SP showed the highest

regeneration efficiency and TP did not response to plant regeneration. Interestingly

the genotype SP which showed a high regeneration potential also performed better in

callus induction. Shoot regeneration was started 30-40 days after culturing on shoot

regeneration medium (Figure 6.1). Regeneration frequency varied between 0 and 16

% in hypocotyl explants. Highest regeneration frequency (16 %) was obtained from

genotype SP. In cotyledon explants, maximum regeneration frequency (8.0 %) was

obtained in genotype SP.


84

84

Table 6.8

Analysis of variance table for plant regeneration

Source DF SS MS F P

Genotype 3 16.7583 5.58611 29.79 s

Media 2 0.6167 0.30833 1.64 ns

Explant 1 0.0750 0.07500 0.40 ns

Genotype*media 6 0.9167 0.15278 0.81 ns

Genotype*Explant 3 1.2917 0.43056 2.30 ns

Media*Explant 2 0.1500 0.07500 0.40 ns

Genotype*Media*Explant 6 0.9833 0.16389 0.87 ns

Error 96 18.0000 0.18750

Total 119 38.7917

Grand mean 0.2917 CV 148.46

Significant value (P >0.05), significant difference (s), non-significant difference (ns)


85

85 Table 6.9

Effect of genotype on chili plant regeneration.

Genotype Mean

(%)

Homogeneous Groups

SP 9.33 A

Loungi 1.33 B

Sanam 1.00 B

TP 0.00 B

Figure 6.4

Effect of genotype on chili plant regeneration.

Chilli Plant Regeneration

0

2

4

6

8

10

1

Genotypes

Mean

Pla

nt

Reg

en

era

tio

n %

SP Loungi Sanam TP


86

86

Table 6.10

Effect of combination of genotype, explant and shoot regeneration medium on plant

regeneration from chili calli.

Genotype Explant Media Mean(%) Homogeneous

Groups

SP

Hypocotyl

ChSR1 10.0 b

ChSR2 8.0 bc

ChSR3 16.0 a

Cotyledon

ChSR1 8.0 bc

ChSR2 6.0 bcd

ChSR3 8.0 bc

Loungi

Hypocotyl ChSR1 2.0 de

ChSR2 0.0 e

ChSR3 0.0 e

Cotyledon ChSR1 2.0 de

ChSR2 0.0 e

ChSR3 4.0 cde

Sanam Hypocotyl ChSR1 0.0 e

ChSR2 0.0 e

ChSR3 2.0 de

Cotyledon ChSR1 2.0 de

ChSR2 2.0 de

ChSR3 0.0 e

TP Hypocotyl ChSR1 0.0 e

ChSR2 0.0 e

ChSR3 0.0 e

Cotyledon ChSR1 0.0 e

ChSR2 0.0 e

ChSR3 0.0 e


87

87

Figure 6.5

Effect of combination of genotype, explant and shoot regeneration medium on plant

regeneration from chili calli.

Chilli Plant Regeneration

0

5

10

15

20

1

Genotype, Explant, Media

Mean

Pla

nt

Reg

en

era

tio

n

(%)

SP Hypocotyl ChSR1

SP Hypocotyl ChSR2

SP Hypocotyl ChSR3

SP Cotyledon ChSR1

SP Cotyledon ChSR2

SP Cotyledon ChSR3

Loungi Hypocotyl ChSR1



Loungi Cotyledon ChSR1



Sanam Hypocotyl ChSR1

Sanam Hypocotyl ChSR2


88

88

Figure 6.6

Different step in chili tissue culture

A) Callus induction from cotyledon explants B) Callus induction from hypocotyl

explants C) Rhizogenic callus D) Shoot regeneration E) Multiple shoot induction F)

regenerated plant


89

89

Figure 6.7

Plant transformation in chilies and transgene analysis.

A-C) Chili callus after inoculation with A. tumefaciens LBA4404 35S GFP/pFGC and

A. tumefaciens EHA105 peAC1-AC2dsRNA/pFGC. D) PCR confirmation of the

transgene using specific primers of the transgene in calli.


90

90 6.3.4 Effect of different factors on Agrobacterium-mediated plant transformation

in chili pepper (C. annuum L)

One of our research goals was to develop a transformation system that allows

homogeneous transgene expression of local chili genotype with GFP/pFGC. The

ultimate goal was to transform local cultivar with peAC1-AC2dsRNA/pFGC35S

GFP/pFGC construct. The hypocotyl and cotyledon explants (SP genotypes) from 10-

15 days old seedlings were placed on ChC2 (Table 6.1) medium supplemented with

different concentration (0, 2, 3, 4, 5 and 6 mg/l) of glufosinate ammonium (Basta).

After 25 days the callus differentiation rates of the explants were investigated. The

explants tested induced callus on basta free medium. But only the cotyledon explants

could tolerate a basta concentration of 4 mg/l. When the level of basta was 5 mg/l or

higher, calli could not be induced for any explants. Hence, 5 mg/l Basta considered to

be the minimal lethal dose.

In the preliminary experiments of this study various factors that influence the

efficiency of T-DNA delivery in Chili plant was assessed. Factors includes two

explant types A. tumefaciens cells inoculation at 22 and 25ºC, as well as photoperiod

(16h light/ 8h dark and complete darkness) and time spans of co-cultivations.

Explants were inoculated and co-cultured with A. tumefaciens LBA4404 having 35S

GFP/pFGC construct and A. tumefaciens EHA105 peAC1-AC2dsRNA/pFGC for 8–

10 minutes. Transient GFP expression was observed with very low frequencies in

hypocotyl explants after 2 or 3 days of co-culture under complete darkness (data not

shown). Transient GFP gene expression was lost completely from the tissue 20 days

after transformation. Calli became brownish and dead after 40-45 days (Figure 6.7C).

PCR analysis showed that the transgene was present in the putative transgenic callus

(Figure 6.7).

5.4 Discussion

The concept of In vitro culture which exploits the ability of plant cells to regenerate

was proposed by [291] and demonstrated for the first time by [292]. Previous studies

have revealed the several aspects of inherent problems that are associated with in vitro

studies of chili i.e, non-availability of morphogenic calli, severe recalcitrance, less

defined shoot buds, genotypic requirement which can expose to tissue culture and


91

91 plant improvement through genetic transformation system [163]. Chili has less ability

to regenerate while other Solanaceae crops such as tomato, tobacco, potato are

frequently used as model systems due to their ability to regenerate plants.

Regardless of the fact many findings had been conducted for the relative success of

regeneration system in different crops [164, 293, 294 ] on shoot morphogenesis in

chili but genetic engineering is still restricted by the low morphogenetic potential of

these species [168 , 295, 296]. Proper explants selection at specific stage of plant ,

alteration of different constituents in nutrient media and additives could help to lessen

recalcitrance [163].

Effort has been made to identify suitable explant in chili for morphogenic callus

induction and subsequent plant growth. Different types of explants comprises of

cotyledons, hypocotyls, leaves, shoot tips, and roots etc. have been employed for plant

regeneration in chili [164, 294, 297-299]. In this study hypocotyl and cotyledon

explants were used from 10-15 days old seedlings. No significant difference was

observed for type of explants for callus formation and plant regeneration. But in this

study by defining a suitable medium composition, morphogenic callus induction was

achieved from hypocotyl explants of SP chili genotype (Table 6.8, Figure 6.4 and

Table 6.11). The results of this study were supported by the finding of [167] and [283]

which also showed that callus induction and shoot initiation was higher in hypocotyls

and embryos than cotyledons.

Auxins and cytokinins are mandatory to induce cell division and growth in tissue

cultures system [163]. In this study four different chili genotypes were tested for

morphogenic callus induction on modified MS and B5 media containing different

concentration of BA (2-4 mg/L) in combination with IAA (0.5 mg/L) or BA 2.0mg/L

in combination with NAA (1.0 mg/L) (Table 6.4). Callus induction from hypocotyl

explant ranged from 70-80 % for SP; 30-60 % for Sanam; 60-80 % for TP and 34-70

% for Loungi (Table 6.8) on three medium. Callus induction from cotyledon explant

ranged from 52-66 % for SP; 36-76 % for Sanam; 34-56 % for TP and 48-70 % for

Loungi (Table 6.8) on three different media. It can be concluded from these results

that increasing BA concentration in the callus induction media generally have no

effect on chili callus induction from hypocotyl as show in Table 6.8. The ChC2


92

92 (medium containing BA 3 mg/L and IAA 0.5 mg/L) is the best medium for callus

induction from both hypocotyl and cotyledon explants. these findings match with the

results of [300] who also favored the role of BA over Kin for induction of shoot

formation in chili. [297] found that IAA and BA produced best results for shoot bud

formation, when applied in combination. Of the four genotypes evaluated, only SP

developed watery, green fluffy and morphogenetic calli. [274, 301] also reported

similar observation with other genotypes of C. annuum viz., Americano and Dulce

Italiano.

Plant regeneration was achieved in 3 chili genotype but with very low plant

regeneration frequency. Three different mixtures of regeneration media were tested

(Table 6.2). A combination of high cytokinin to auxin ratio in the regeneration media was

found to be effective for chili plant regeneration [302]. Plant regeneration frequency varied

between 0-16 percent (Table 6.11). Maximum shoot regeneration was observed in SP (16.0) genotype

calli (Calli obtained from hypocotyl explants), While TP (Calli obtained from both hypocotyl and

cotyledon explants) did not showed any response to plant regeneration potential. ChSR3 (medium

containing BA 3mg/L and IAA 0.05 mg/L) the best medium for plant regeneration from

hypocotyl calli but there is no effect of different concentrations of BA (3-5mg/L) on

plant regeneration from cotyledon explants (Table 6.11). It was thus noted that the

hypocotyl explant gave maximum regeneration potential on low concentration of BA

(Table 6.2) but hypocotyl callus transformed to brownish-black and non-regenerable

upon increasing the concentration of BA up to 5 mg/l. Regenerated plantlets were

rooted in nutrients and hormone free MS medium. 3-4 weeks later, rooted plants were

shifted to soil for acclimatization.

Plant regeneration of pepper plants via callus is not common due to the problems during callus

induction and its development into plant [287, 299]. In case of other genotypes the shoot buds either do

not elongate or may produce distorted leaves [303, 304]. Same difficulties were experienced in our

present study and very low shoot elongation was obtained. Attempts to elongate these shoot buds, such

as culture in high BA and low IAA [299] and addition of GA3 or AgNO3 were unsuccessful.

In this study the more callus formation but low rate of regeneration was found higher

that might be attributed to comparatively higher doses of auxin which is used to

induced callus in medium. However, the exact level of hormones in callus initiation

medium need compromise between callus induction and regeneration frequency.


93

93 Transfer of material from callus induction medium to plant regeneration medium

promoted the regeneration capability of the genotype otherwise prolonged culturing

on the callus induction medium made callus compact and non-regenerable. So it is

advisable to transfer the material soon after induction of callus to shoot regeneration

medium.

Dependence of genotype is critical factor that could impacts the organogenesis in chili

tissue cultures. As different cultivars of chili have strong genotype specificity for

regeneration and considered as critical factor for previously employed regeneration

protocols for specific cultivars.

Superficial regeneration of shoots from genetically manipulated cells is among the

two strategies used commonly. However, selection of responsive genotype and

explant source is first strategy while optimization of cultural and environmental

conditions for the enhance genetic potential is second one. Before deciding the

genotype for tissue culture, there should be comparison with other genotypes to

establish an efficient regeneration system. The logic behind this could be different

parts of genotypes could be more adaptive in contrast to former ones while not in the

case of others. In our study, the results have shown that SP responded best on

hypocotyl explants than cotyledon while TP did not in any combination of hormone

used, so TP is highly recalcitrant genotype. Thus, C. annuum genotype SP was found

to be the most suitable among the four genotypes studied for subsequent genetic

transformation studies. Its calli will be used as recipients of exogenous DNA in

genetic manipulation.

Classical plant breeding techniques have been widely used to rise chili yields with

improved varieties selection [305, 306] which are tolerant to abiotic stress [305-308]

Unluckily, some important factors i.e., resistance to herbicides and pathogens, and

absent from the genetic pools of chili genotypes [309-311]. The use of plant

transformation techniques to introduce resistance genes into plant genomes may have

a

significant effect on quality and yield of chili. Establishment of a successful

transformation system for chili plant for the regeneration of particular specie is critical

step for its transformation.


94

94 A protocol for chili plant regeneration was developed (section 6.3 and 6.4). Among

the four genotypes, calli of genotype SP displayed morphogenetic potential and

capacity to regenerate complete plantlets. Thus, C. annuum genotype SP was found to

be the most suitable among the four genotypes studied for subsequent genetic

transformation studies (section 6.4). SP explants (both hypocotyl and cotyledon) were

used as recipients of exogenous DNA in genetic manipulation. The first most

important step to be considered is optimization of Agrobacterium mediated plant

interaction which includes the reliability of the bacterial strain that can developed a

localized necrosis process in wounded tissues [312]. The effects of explant and

different conditions for co-cultivation with A. tumefaciens, on the transformation

efficiency of SP genotypes were examined. Explants were inoculated and co-cultured

with two different Agrobacterium strain (A. tumefaciens LBA4404 having 35S

GFP/pFGC construct and A. tumefaciens EHA105 peAC1-AC2dsRNA/pFGC) for 8–

10 minutes. A. tumefaciens cell inoculate at different temperatures (22 and 25ºC),

photoperiod (16h light 8h dark and complete darkness) and co-cultivation time

periods (01, 02 and 03 minutes). Acetosyringone – used as indicator of A. tumefaciens

vir genes improve the transformation efficiency. Absolute acetosyringone -

dependency has been observed in C. annuum [295], where acetosyringone was one of

the essential components for transformation. However, after inoculating explants with

A. tumefaciens, transient expression of the green florescent protein (GFP) reporter

gene was very low. GFP activity was only exhibited by explants that were inoculated

with A. tumefaciens culture having acetosyringone. Reporter gene expression

generally was lost completely from the tissue 20 days after transformation and calli

become dead after 40-45 days.

The problems of poor survival rate of calli during Agrobacterium-mediated

transformation were due to hypersensitive response. In-vitro recalcitrance of plants

have been related to reactive oxygen species (ROS) production [313]. Higher levels

of free radical activity were found in resistant genotypes of potato and grape as well

as in non-embryogenic calli of rice crop [314, 315]. The use of an antioxidant silver

oxide in sugarcane transformation caused an 80 % cell death which was reduced in

comparison to controls, and the quality of the callus was not disturbed in any phase

of tissue culture [316]. Silver nitrate (2mg/l) in ChC2 selection medium, attempted to

reduce ROS response and it also did not affect the transformation efficiency but in the


95

95 presence of silver nitrate calli remained green and watery up to 50-60 days. The

transgene in callus was confirmed through PCR with specific primers of the transgene

(Figure 6.7). The main objective of this work was to control ChLCD through genetic

engineering techniques. However, pepper genotypes are recalcitrant to genetic

transformation, control of diseases caused by ChLCD complex using this strategy

awaits future progress. This procedure could be applied to other cultivars of pepper to

induced genetic resistance aiming to produced resistance for pathogen and metabolic

engineering


96

96 Chapter 7

General Discussion

Chili pepper is an important spice and vegetable economic crop in Pakistan. It is one

of the World‟s staple vegetables and classified among the Solanaceae. However,

losses are high due to susceptibility of the crop to plant viruses [158, 160, 194, 317].

Whitefly transmitted ssDNA viruses (family Geminiviridae, genus Begomovirus) are

the causal agents of severe diseases of crops in Indian subcontinent [191, 195]. The

modern agriculture management ways and human activity are the major cause of

begomoviruses emergence in different countries of world.

To fulfil the hunger need of people, newly introduced crops and changing of cropping

patterns, use of susceptible genotype, insecticides and introduction of exotic viruses

with their vectors have been concerned in the etiology of geminiviruses spread in

crops [4, 177, 195]. Although inherent characters of begomoviruses such as their

evolutionary aptitudes by recombination events, can give rise to novel species or

variants which can spread new disease epidemics [318]. In cassava crop there was a

mixed infection of two different species of bipartite begomoviruses [57].

Both components of bipartite begomoviruses demonstrates that the two molecules

(DNA A and B) have diverse molecular evolutionary histories based on phylogenetic

analysis [193]. ToLCNDV, has been regularly identified in numerous plant species

across India, Bangladesh and Pakistan and suggest that this bipartite begomoviruses

help other begomoviruses to expand host range. ToLCGV exists without DNA B in

certain weeds [319] and therefore suggested that ToLCGV was spread to tomato from

a weed host on its interaction with ToLCNDV (DNA B component). However due to

the mixing of viral components on weed hosts results in new disease complexes were

found with increased level of virulence to agricultural crops.

Chili leaf curl disease complex is the most damaging factor that effects the pepper

production in Pakistan [320], as this disease has been established during the 1960s in

Indian subcontinent [321]. Although this virus has become prevalent in the chili

cultivated areas of Asia including India and Pakistan from past decades [322], and till

today [161, 323].Increase incidence of this disease in chili found in Indian sub


97

97 continents demanded the use of some suitable strategy to minimize losses and to

managed it through resistant cultivars.

This manuscript is part of this effort aiming to understand and manage the chili

begomoviruses complex in Pakistan. Characterization of viruses is the most important

step to initiate the suitable disease control strategy through the development of

resistant cultivars. Pepper leaf curl Lahore virus (PepLCLV) is a newly reported

begomoviruses along with betasatelite from the chili field near Lahore [51]. Identity

and genetic diversity of begomoviruses was performed through the establishment of

ChLCD associated with chili field in Faisalabad, Pakistan. During current study a

novel new variant of Pepper leaf curl Lahore virus was found which gives maximum

(99%) homology with PepLCLV (AM404179). As this distinct variant of virus

(PGL1) of PepLCLV was unable to replicate betasatelite and gives leaf curl symptom

only with the interaction of DNA B component of ToLCNDV as shown in figure 3.4.

Putative rep protein analysis revealed that protein sequence has a leader sequence at

its N-terminal (Figure 3.3) which may be remarkably significant to determine the

failure of the virus to replicate beta satellites.

Begomovirus has typical genome organization with four open reading frames (Rep,

TrAP, REn and C4) in the complementary sense while two (CP and pre CP) ORF in

the virion sense. Sequence analysis of PGL1 revealed that the iteron on PepLCLV

(GGGGAC) differ from the iteron found on ToLCNDV (GGTGTC) with two bases

only as shown in figure 3.4. Therefore, it is assumed that the first 2 -3 bases might

have some role in recognition of rep binding site. Most interesting finding of this

study is that pepper leaf curl Lahore virus (PepLCLV) is not capapble to replicate beta

satellites, however this hypothesis need confirmations through mutagenesis.

Information of the host range of particular virus is so important to understand the

epidemiology and could be useful for identification of virus and effective control

stretegy [324]. The experimental host range data imply that can infect N. tabaccum,

N. benthamiana and C. annuum. Mild symptoms on the tobacco plant was found after

agroinfiltration of cloned virus. When PepLCLV clone with beta satellites was

inoculated into tobacco plants similar kind of symptoms were observed. However

when agroinfiteration of the DNA B component of ToLCNDV was performed in N.

benthamiana, and N. tabacum plants it induced typical symptoms of ChLCD.


98

98 This finding suggests that virus characterized here may be bipartite. This is first

attempt to experimentally test the infectivity for a bipartite begomoviruses producing

ChLCD. This indicates that isolate probable represents a new species of Begomovirus.

However for the first time this experiment was performed to confirm Koch‟s

postulates with the help of cloned of viral DNA that is associated with chili leaf curl

disease along with DNA B. The management of begomoviruses disease complex is

quite difficult [325] , expensive [326]. Use of chemicals and cultural practices is not

an efficient method to control the viruses. The loss of natural enemies due to

extensive use of insecticide could developed resistance against insecticides and

contribute to ineffective control and environmental problems. However the most

effective strategy for begomoviruses could be the use of integrated management with

resistant cultivars along with used of cultural practices and pesticides aim to reduce

the viral titer. So the long term control strategy could be the breeding of

begomoviruses resistant plants. The breeding for developing virus resistance in

commercial varieties of chili is problematic and so far managed to some extent by

cultural practices [327]. On the other hand genetic engineering/biotechnology

provides the understanding of the broad-spectrum and stable resistance which may be

pathogen derived resistance (PDR) or non-pathogen based. RNA (dsRNA) mediated

interference, through a complex process protects plants from invasive viruses.

Recently, RNA interference has been reported as a natural defense system against

virus infection [328]. RNA interference has emerged as a robust and breakthrough

technology for engineering virus resistance in plants. RNA interference is a

mechanism that involved mRNA degradation of specific sequence, which is

conserved across the kingdom [329]. [212] produced transgenic plants based on RNA

interference against TYLCSV. However, delay of symptoms were found in these

plant mainly at low level of inoculum.

Begomoviruses encode limited no. of genes and mostly depend on host factors for

successful infection. Replication associated protein encoded by members of family

Geminiviridae is the only essential protein required by virus for successful infection

[40]. It is a pleiotropic gene with several function including sequence specific

binding, cleavage, oligomerization, helicase activity, transcriptional regulation,

replication activity, ATP dependent topoisomerase activity and several interactions

with host proteins [330]. AC2 is suppressor of RNA silencing [2]. Data base search


99

99 results indicate that the region selected is not only conserved (89%-100%) in different

ChLCD causing begomoviruses i.e PepLCLV, ChLCV, CLCV, and ToLCNDV, but

also in heterologous viruses including malvestrum, tomato, papaya, okra, cassava,

hollyhock infecting begomoviruses (85-95%). This region also produced maximum

siRNA in naturally begomoviruses infected plant. Pathogen-derived resistance” has

been focused on the overlapping region of AC1 and AC2 using hairpin construct.

Thus, these sequences provide a better target for providing better protection against

the disease. So, in this research work, we have silenced chili Rep-AC2 expression by

making RNAi constructs targeting Rep-TrAP (AC1-AC2) in transient assays. We

amplified 575 bp fragment containing 400 bp region of Rep at C-terminal and 175 bp

of TrAP at N-terminal. The amplified fragment was cloned in a dsRNA binary vector

(pFGC5941) in sense and antisense orientation flanked by intron cloning gene

constructs in such a way when introduced within plant cell produces inverted repeat

dsRNA which can more efficiently block the gene of homologous sequence [331].

Then this construct AC1-AC2 dsRNA/pFGC was analyzed by co-infiltration with

Ch.Rep/PVX. RNAi construct blocks rep expression and the plants had developed

only PVX symptoms, we have seen the Rep of ChLCV-M is different from other

geminiviruses when expressed through PVX because in this particular case Rep

produces leaf curling in N. benthamaiana plants.

RNAi gene constructs and PepLCLV were also transiently co-expressed in N.

benthamiana and C. annuum and virus levels was checked in inoculated and systemic

leaves. The Southern analysis of these inoculated plants have shown the replication of

the virus in the inoculated leaves but the titer of the virus in the systemic leaves has

been found to be reduced (Figure 4.5). The detection of the virus in inoculated leaves

confirmed reliable infiltration. The decrease in the virus titer in systemic leaves shows

that silencing signal generated in the inoculated leaves. The reason for this

improvement may be the target sequence difference, different assay approach,

conditions and the fact that large amount of siRNA could be generated in vivo through

RNAi construct. The construct AC1-AC2 dsRNA/pFGC was transformed in tobacco

and evaluation of transgenic plants showed that targeting of these conserved regions

through RNAi significantly reduced the level of viral DNA in transgenic plant when

these transgenic plants was inoculated with ChLCD infected viruliferous whitefly.

The virus replication was reduced to undetectable level in some cases when checked


100

100 by Southern blot hybridization but could be detected by PCR. Thus, silencing of these

sequences could effectively control ChLCD component through RNAi. The two

transgenic line TA14 line and TA15.1 was ranked as highly resistant/tolerant showing

93.3% and 80.0% resistance/tolerance against ChLCD (Table 4.2). Both lines showed

resistance against homolougus (PepLCLV) and heterologous (ToLCNDV) virus.

AC1-AC2 575 bp fragment (containing 400 bp region of Rep at C-terminal and 175

bp of TrAP at N-terminal used peAC1-AC2dsRNA/pFGC hairpin construct) of

PepLCLV showed 71.8% resemblance to same ToLCNDV AC1-AC2 region. These

results revealed that peAC1-AC2dsRNA/pFGC transgenic plants were capable of

prevention of replication and movement whereas, 3 out of 9 transgenic lines were

found resistant. The basic aim of current investigation was to explore the ChLCD

complex resistance by silencing the Rep-Trap gene of PepLCLV. Hence, it is

suggested that AC1-AC2 silencing is a useful strategy for the development of broad-

spectrum resistance to cope with various other disease of begomoviruses.

Results presented in this project show that the two components essentially required

for the disease can be silenced successfully through RNAi. Results reported in this

thesis have added several novel concepts in generating durable resistance against

begomoviruses that cause important diseases on several crops in Pakistan and other

parts of the world. The spread of silencing is an important area that requires further

investigation and can be addressed by determining the origin of siRNA from resistant

plants challenged with the virus. siRNA originating from non-target viral sequences

would suggest spread of gene silencing.

Viruses are the natural artist and have been determinant in helping us to unravel

mechanisms used not only by the viruses themselves, but also by cell systems [144,

332, 333]. P6 protein expression in cauliflower mosaic virus in Arabidopsis induced

the dwarfness in transgenic lines of plants [236]; [252]. However, Arabidopsis plants

with mutated (tir3) are also exhibit dwarfness [260]. P6 transgenic (A7, B6) and tir3

Arabidopsis plants were found resistant to Auxin, ethylene and TIBA treatment. This

study revealed that P6 interacts with a pathway overlay with TIR pathway. Symptoms

appearance in Arabidopsis with P6 protein of CaMV is due to the disruption of Auxin

response factors (ARF10, ARF16, and ARF17). Hence Arabidopsis plants exhibited


101

101 less accumulation of miR160 which is responsible for the regulation of ARF10,

ARF16 and ARF17 [139].

Classical plant breeding techniques have been widely used to rise chili yields with

improved varieties selection [305, 306] which are tolerant to abiotic stress. Unluckily,

some important factors i.e., resistance to herbicides and pathogens, and absent from

the genetic pools of chili genotypes [309-311]. Use of genetic engineering may be

helpful to introduced resistance genes into plants could be a better remedy for these

biotic stress and will impart beneficial impacts on chili yield. Introduction of genes to

Pepper plant is difficult and has resisted the efforts from many years [163, 295]. In

this à Protocol was developed for chili plant regeneration (section 6.3 and 6.4). In-

vitro response of four genotypes; Tata puri, SP, Sanam and Lungi was studied to find

out a suitable genotype for genetic transformation experiments section 6.3 and 6.4).

Among the four chili genotypes. C. annuum genotype SP showed reproducible plant

regeneration ability. The effects of explant and different conditions for co-cultivation

with A. tumefaciens, on the transformation efficiency of SP genotypes were also

examined. The transgene in callus was confirmed through PCR with specific primers

of the transgene (Figure 6.7) but the plant was unable to regenerate after

transformation. The main aim of this thesis is to control ChLCD through genetic

engineering techniques. However, pepper genotypes are recalcitrant to genetic

transformation, control of diseases caused by ChLCD complex using this strategy

awaits future progress.

This study represents the first report that RNAi could be used for inhibition of pepper

leaf curl virus thus also provides evidence that RNAi has the potential to be developed

into a novel antiviral approach provided that efficient plant transformation system in a

local variety of chilies through Agrobacterium mediated plant transformation for

RNAi constructs into local cultivars (chili) through Agrobacterium mediated plant

transformation system. RNAi gene constructs are working; these can inhibit the

replication of ChLCD complex in transgenic chili plants. Research work from this

thesis could provide important information for the development of virus resistant chili

crop in Pakistan.


102

102 References

1. Anderson PK, Cunningham AA, Patel NG, Morales FJ, Epstein PR, Daszak P:

Emerging infectious diseases of plants: pathogen pollution, climate

change and agrotechnology drivers. Trends Ecol Evol 2004, 19(10):535-

544.

2. Pranjal Y, Geeta S, Sunil KM: Begomovirus DNA replication and

pathogenicity. Current Science 2010, 98(3):360-368.

3. Albuquerque LC, Inoue-Nagata AK, Pinheiro B, Ribeiro Sda G, Resende RO,

Moriones E, Navas-Castillo J: A novel monopartite begomovirus infecting

sweet potato in Brazil. Archives of virology 2011, 156(7):1291-1294.

4. Zhang H, Ma XY, Qian YJ, Zhou XP: Molecular characterization and

infectivity of Papaya leaf curl China virus infecting tomato in China.

Journal of Zhejiang University Science 2010, 11(2):109-114.

5. Hull R: Genome organization of retroviruses and retoelements:

evolutionary considerations and implications. Seminars in Virology 1992,

3:373-382.

6. Tiendrebeogo F, Lefeuvre P, Hoareau M, Villemot J, Konate G, Traore AS,

Barro N, Traore VS, Reynaud B, Traore O et al: Molecular diversity of

cotton leaf curl Gezira virus isolates and their satellite DNAs associated

with okra leaf curl disease in Burkina Faso. Virology journal 2010, 7:48.

7. Kim SH, Oh S, Oh TK, Park JS, Kim SC, Kim SH, Kim YS, Hong JK, Sim

SY, Park KS et al: Genetic diversity of tomato-infecting Tomato yellow

leaf curl virus (TYLCV) isolates in Korea. Virus genes 2011, 42(1):117-

127.

8. King AMQ, Adams, M.J., Carstens, E.B. and Lefkowitz, E.J. San Diego:

Virus taxonomy: classification and nomenclature of viruses: Ninth Report

of the International Committee on Taxonomy of Viruses. Elsevier

Academic Press 2011:1338.

9. Fauquet C, Stanley J: Geminivirus classification and nomenclature:

progress and problems. Annals of Applied Biology 2003, 142:165-189.

10. Bull SE, Tsai W-S, Briddon RW, Markham PG, Stanley J, Green SK:

Diversity of begomovirus DNA b satellites of non-malvaceous plants in

east and south east Asia. Archives of virology 2004, 149:1193 - 1200.

11. Mubin M, Shahid MS, Tahir MN, Briddon RW, Mansoor S:

Characterization of begomovirus components from a weed suggests that

begomoviruses may associate with multiple distinct DNA satellites. Virus

genes 2010, 40(3):452-457.

12. Paprotka T, Boiteux LS, Fonseca ME, Resende RO, Jeske H, Faria JC, Ribeiro

SG: Genomic diversity of sweet potato geminiviruses in a Brazilian

germplasm bank. Virus research 2010, 149(2):224-233.

13. Padidam M, Sawyer S, Fauquet CM: Possible emergence of new

geminiviruses by frequent recombination. Virology 1999, 265(2):218-225.

14. Mansoor S, Briddon RW, Zafar Y, Stanley J: Geminivirus disease

complexes: an emerging threat. Trends in plant science 2003, 8(3):128-134.

15. Mansoor S, Amin I, Hussain M, Zafar Y, Briddon RW: Engineering novel

traits in plants through RNA interference. Trends in plant science 2006,

11(11):559-565.

16. Gutierrez C: Geminiviruses and the plant cell cycle. Plant molecular biology

2000, 43(5-6):763-772.


103

103 17. Vanitharani R, Chellappan P, Fauquet CM: Geminiviruses and RNA

silencing. Trends in plant science 2005, 10(3):144-151.

18. Orozco BM, Hanley-Bowdoin L: A DNA structure is required for

geminivirus replication origin function. Journal of virology 1996,

70(1):148-158.

19. Orozco BM, Kong LJ, Batts LA, Elledge S, Hanley-Bowdoin L: The

multifunctional character of a geminivirus replication protein is reflected

by its complex oligomerization properties. The Journal of biological

chemistry 2000, 275(9):6114-6122.

20. Coello P, Rodriquez R, Garcia E, Vazquez-Ramos JM: A DNA polymerase

from maize axes: its purification and possible role. Plant molecular biology

1992, 20(6):1159-1168.

21. Nagar S, Pedersen TJ, Carrick KM, Hanley-Bowdoin L, Robertson D: A

geminivirus induces expression of a host DNA synthesis protein in

terminally differentiated plant cells. The Plant cell 1995, 7(6):705-719.

22. Esau K: Virus-like particles in nuclei of phloem cells in spinach leaves

infected with the curly top virus. JUltrastructural Res 1977, 61:78-88.

23. Lucy AP, Boulton MI, Davies JW, Maule AJ: Tissue specificity of Zea mays

infection by maize streak virus. Molecular Plant-Microbe Interactions 1996,

9(1):22-31.

24. Horns T, Jeske H: Localization of abutilon mosaic virus (AbMV) DNA

within leaf tissue by in situ hybridization. Virology 1991, 181:580-588.

25. Sanderfoot AA, Lazarowitz SG: Getting it together in plant virus

movement: cooperative interactions between bipartite geminivirus

movement proteins. Trends in cell biology 1996, 6:353-358.

26. Hanley-Bowdoin L, Settlage SB, Orozco BM, Nagar S, Robertson D:

Geminviruses: models for plant DNA replication, transcription, and cell

cycle regulation. Critical Reviews in Plant Sciences 1999, 18:71-106.

27. Voinnet O, Pinto YM, Baulcombe DC: Suppression of gene silencing: a

general strategy used by diverse DNA and RNA viruses of plants.

Proceedings of the National Academy of Sciences of the United States of

America 1999, 96(24):14147-14152.

28. Ahmed MZ, De Barro PJ, Greeff JM, Ren SX, Naveed M, Qiu BL: Genetic

identity of the Bemisia tabaci species complex and association with high

cotton leaf curl disease (CLCuD) incidence in Pakistan. Pest management

science 2011, 67(3):307-317.

29. Rybicki EP: A phylogenetic and evolutionary justification for three genera

of Geminiviridae. Archives of virology 1994, 139(1-2):49-77.

30. Briddon RW, Markham PG: Geminiviridae. In: Virus Taxonomy; Sixth

Report of the International Committee on Taxonomy of Viruses. Edited by

Murphy FA, Fauquet CM, Bishop DHL, Ghabrial SA, Jarvis AW, Martelli

GP, Mayo MA, Summers MD, 0 edn. Wien: Springer; 1995: 158-165.

31. Padidam M, Beachy RN, Fauquet CM: Tomato leaf curl geminivirus from

India has a bipartite genome and coat protein is not essential for

infectivity. The Journal of general virology 1995, 76 ( Pt 1):25-35.

32. Fauquet MC, Mayo MA: Abbreviations for plant virus names - 1999.

Archives of virology 2000, 144:1249-1273.

33. Zhang W, Olson, N. H., Baker, T. S., Faulkner, L., Agbandje-McKenna, M.,

Boulton, M. I., Davies, J. W. and McKenna, R: Structure of the Maize

streak virus geminate particle. Virology 2001, 279:471– 477.


104

104 34. Shepherd DN, Martin DP, Van Der Walt E, Dent K, Varsani A, Rybicki EP:

Maize streak virus: an old and complex 'emerging' pathogen. Molecular

plant pathology 2010, 11(1):1-12.

35. Willment JA, Martin DP, Palmer KE, Schnippenkoetter WH, Shepherd DN,

Rybicki EP: Identification of long intergenic region sequences involved in

maize streak virus replication. The Journal of general virology 2007, 88(Pt

6):1831-1841.

36. Hur J, Buckley K, Lee S, Davis K: Transcriptional activator elements for

curtovirus C1 expression reside in the 3' coding region of ORF C1.

Molecules and cells 2007, 23(1):80-87.

37. Briddon RW, Watts J, Markham PG, Stanley J: The coat protein of beet

curly top virus is essential for infectivity. Virology 1989, 172(2):628-633.

38. Soto MJ, Chen LF, Seo YS, Gilbertson RL: Identification of regions of the

Beet mild curly top virus (family Geminiviridae) capsid protein involved

in systemic infection, virion formation and leafhopper transmission.

Virology 2005, 341(2):257-270.

39. Baliji S, Lacatus G, Sunter G: The interaction between geminivirus

pathogenicity proteins and adenosine kinase leads to increased expression

of primary cytokinin-responsive genes. Virology 2010, 402(2):238-247.

40. Gutierrez C: Strategies for geminivirus DNA replication and cell cycle

interference. Physiological and Molecular Plant Pathology 2002, 60:219-

230.

41. Varsani A, Shepherd DN, Dent K, Monjane AL, Rybicki EP, Martin DP: A

highly divergent South African geminivirus species illuminates the

ancient evolutionary history of this family. Virology journal 2009, 6:36.

42. Hernandez-Zepeda C, Varsani A, Brown JK: Intergeneric recombination

between a new, spinach-infecting curtovirus and a new geminivirus

belonging to the genus Becurtovirus: first New World exemplar. Archives

of virology 2013, 158(11):2245-2254.

43. Heydarnejad J, Keyvani N, Razavinejad S, Massumi H, Varsani A: Fulfilling

Koch's postulates for beet curly top Iran virus and proposal for

consideration of new genus in the family Geminiviridae. Archives of

virology 2013, 158(2):435-443.

44. Mansoor S, Amin I, Hussain M, Zafar Y, Bull S, Briddon RW, Markham PG:

Association of a disease complex involving a begomovirus, DNA 1 and a

distinct DNA beta with leaf curl disease of okra in Pakistan. Plant Disease

2001, 85:922.

45. Navot N, Pichersky E, Zeidan M, Zamir D, Czosnek H: Tomato yellow leaf

curl virus: a whitefly-transmitted geminivirus with a single genomic

component. Virology 1991, 185(1):151-161.

46. Briddon RW, Bull SE, Bedford ID, Rishi N, S.S. S, Saunders K, J. Stanley J,

Markham PG: Pathogenic recombinant between cotton leaf curl virus and

cotton leaf curl disease DNA b : implications for the future evolution of

the virus complex. manuscript in preparation 2003.

47. Saunders K, Bedford ID, Briddon RW, Markham PG, Wong SM, Stanley J: A

unique virus complex causes Ageratum yellow vein disease. Proceedings of

the National Academy of Sciences of the United States of America 2000,

97(12):6890-6895.


105

105 48. Zhou X, Xie Y, Peng Y, Zhang Z: Malvastrum yellow vein virus, a new

Begomovirus species associated with satellite DNA molecule. Chinese

Science Bulletin 2003, 48:2205-2209.

49. Briddon RW, Brown JK, Moriones E, Stanley J, Zerbini M, Zhou X, Fauquet

CM: Recommendations for the classification and nomenclature of the

DNA-beta satellites of begomoviruses. Archives of virology 2008,

153(4):763-781.

50. Murant AF, Mayo MA: Satellites of plant viruses. Annual Review of

Phytopathology 1982, 20:49-70.

51. Tahir M, Haider MS, Briddon RW: Chili leaf curl betasatellite is associated

with a distinct recombinant begomovirus, Pepper leaf curl Lahore virus,

in Capsicum in Pakistan. Virus research 2010, 149(1):109-114.

52. Collmer CW, Howell SH: Role of satellite RNA in the expression of

symptoms caused by plant viruses. Annual review of phytopathology 1992,

30:419-442.

53. Kumari P, Singh AK, Chattopadhyay B, Chakraborty S: Molecular

characterization of a new species of Begomovirus and betasatellite

causing leaf curl disease of tomato in India. Virus research 2010.

54. Hong Y, Stanley J: Regulation of African cassava mosaic virus

complementary-sense gene expression by N-terminal sequences of the

replication-associated protein AC1. The Journal of general virology 1995,

76 ( Pt 10):2415-2422.

55. Pandey P, Choudhury NR, Mukherjee SK: A geminiviral amplicon (VA)

derived from Tomato leaf curl virus (ToLCV) can replicate in a wide

variety of plant species and also acts as a VIGS vector. Virology journal

2009, 6:152.

56. A. Levy, Czosnek H: Replacing the AC2/AC3 genes of Abutilon mosaic

virus (AbMV) with those of Bean dwarf mosaic virus enhances AbMV

accumulation, movement, and symptom severity in bean. Journal of Plant

Pathology 2006, 88(1):39-52.

57. Vanitharani R, Chellappan P, Pita JS, Fauquet CM: Differential roles of AC2

and AC4 of cassava geminiviruses in mediating synergism and

suppression of posttranscriptional gene silencing. Journal of virology 2004,

78(17):9487-9498.

58. Trinks D, Rajeswaran R, Shivaprasad PV, Akbergenov R, Oakeley EJ,

Veluthambi K, Hohn T, Pooggin MM: Suppression of RNA silencing by a

geminivirus nuclear protein, AC2, correlates with transactivation of host

genes. Journal of virology 2005, 79(4):2517-2527.

59. Wang H, Buckley KJ, Yang X, Buchmann RC, Bisaro DM: Adenosine kinase

inhibition and suppression of RNA silencing by geminivirus AL2 and L2

proteins. Journal of virology 2005, 79(12):7410-7418.

60. Sung YK, Coutts RH: Potato yellow mosaic geminivirus AC2 protein is a

sequence non-specific DNA binding protein. FEBS letters 1996, 383(1-

2):51-54.

61. Rajeswaran R, Sunitha S, Shivaprasad PV, Pooggin MM, Hohn T, Veluthambi

K: The mungbean yellow mosaic begomovirus transcriptional activator

protein transactivates the viral promoter-driven transgene and causes

toxicity in transgenic tobacco plants. Mol Plant Microbe Interact 2007,

20(12):1545-1554.


106

106 62. Zakri AM, Ziegler A, Torrance L, Fischer R, Commandeur U: Generation

and characterization of a scFv against recombinant coat protein of the

geminivirus tomato leaf curl New Delhi virus. Archives of virology 2010,

155(3):335-342.

63. Chowda-Reddy RV, Achenjang F, Felton C, Etarock MT, Anangfac MT,

Nugent P, Fondong VN: Role of a geminivirus AV2 protein putative

protein kinase C motif on subcellular localization and pathogenicity. Virus

research 2008, 135(1):115-124.

64. Mubin M, Mansoor S, Hussain M, Zafar Y: Silencing of the AV2 gene by

antisense RNA protects transgenic plants against a bipartite begomovirus.

Virology journal 2007, 4:10.

65. Sanjaya, V. V. Satyavathi1, V. Prasad

1, N. Kirthi

2, S. P. Maiya

2, Savithri

2 HS,

Sita1

GL: Development of cotton transgenics with antisense AV2 gene for

resistance against cotton leaf curl virus (CLCuD) via Agrobacterium

tumefaciens. Plant Cell, Tissue and Organ Culture 2005, 81:55-63.

66. Levy A, Czosnek H: The DNA-B of the non-phloem-limited bean dwarf

mosaic virus (BDMV) is able to move the phloem-limited Abutilon mosaic

virus (AbMV) out of the phloem, but DNA-B of AbMV is unable to

confine BDMV to the phloem. Plant molecular biology 2004, 53:789-803.

67. Haley A, Richardson K, Zhan X, Morris B: Mutagenesis of the BC1 and

BV1 gene of African cassava mosaic virus identifies conserved amino

acids that are essential for spread. Journal of General Virology 1995,

76:1291-1298.

68. Frischmuth S, Wege C, Hulser D, Jeske H: The movement protein BC1

promotes redirection of the nuclear shuttle protein BV1 of Abutilon

mosaic geminivirus to the plasma membrane in fission yeast. Protoplasma

2007, 230(1-2):117-123.

69. Cheng X, Wang X, Wu J, Briddon RW, Zhou X: betaC1 encoded by tomato

yellow leaf curl China betasatellite forms multimeric complexes in vitro

and in vivo. Virology 2011, 409(2):156-162.

70. Dry IB, Krake LR, Rigden JE, Rezaian MA: A novel subviral agent

associated with a geminivirus: the first report of a DNA satellite.


America 1997, 94(13):7088-7093.

71. Briddon RW, Markham PG: Complementation of bipartite begomovirus

movement functions by topocuviruses and curtoviruses. Archives of

virology 2001, 146(9):1811-1819.

72. Zhao X, Coats I, Fu P, Gordon-Kamm B, Lyznik LA: T-DNA recombination

and replication in maize cells. Plant Journal 2003, 33:149-159.

73. Saunders K, Norman A, Gucciardo S, Stanley J: The DNA beta satellite

component associated with ageratum yellow vein disease encodes an

essential pathogenicity protein (betaC1). Virology 2004, 324(1):37-47.

74. Zhou X, Xie Y, Tao X, Zhang Z, Li Z, Fauquet CM: Characterization of

DNAbeta associated with begomoviruses in China and evidence for co-

evolution with their cognate viral DNA-A. The Journal of general virology

2003, 84(Pt 1):237-247.

75. Cui X-F, Li Y-Q, Hu D-W, Zhou X-P: Expression of a begomoviral DNA b

gene in transgenic Nicotiana plants induced abnormal cell division.

Journal of Zhejiang University SCIENCE 2005, 6B(2):83-86.


107

107 76. Fiallo-Olive E, Hamed A, Navas-Castillo J, Moriones E: Cotton leaf curl

Gezira alphasatellite associated with tomato leaf curl Sudan virus

approaches the expected upper size limit in the evolution of

alphasatellites. Virus research 2013.

77. Huang C, Xie Y, Zhao L, Ren H, Li Z: A naturally occurring defective DNA

satellite associated with a monopartite begomovirus: evidence for

recombination between alphasatellite and betasatellite. Viruses 2013,

5(9):2116-2128.

78. Srivastava A, Raj SK, Kumar S, Snehi SK, Kulshreshtha A, Hallan V, Pande

SS: Molecular identification of Ageratum enation virus, betasatellite and

alphasatellite molecules isolated from yellow vein diseased Amaranthus

cruentus in India. Virus genes 2013.

79. J X, Xie Y: Nanovirus-like DNA component associated with the

malvastrum yellow mosaic virus. Acta virologica 2008, 52(1):63-66.

80. Vega-Arreguin JC, Timchenko T, Gronenborn B, Ramirez BC: A functional

histidine-tagged replication initiator protein: implications for the study of

single-stranded DNA virus replication in planta. Journal of virology 2005,

79:8422-8430.

81. Briddon RW, Bull SE, Amin I, Mansoor S, Bedford ID, Rishi N, Siwatch SS,

Zafar MY, Abdel-Salam AM, Markham PG: Diversity of DNA 1; a satellite-

like molecule associated with monopartite begomovirus-DNA b

complexes. Virology 2004, 324:462-474.

82. Wu P-J, Zhou X-P: Interaction between a nanovirus-like component and

the Tobacco curly shoot virus/satellite complex. Acta biochimica et

biophysica Sinica 2005, 37:25-31.

83. Leke WN, Sattar MN, Ngane EB, Ngeve JM, Kvarnheden A, Brown JK:

Molecular characterization of begomoviruses and DNA satellites

associated with okra leaf curl disease in Cameroon. Virus research 2013,

174(1-2):116-125.

84. Saunders K, Lucy A, Stanley J: DNA forms of the geminivirus African

cassava mosaic virus consistent with a rolling circle mechanism of

replication. Nucleic Acids Res 1991, 19:2325-2330.

85. Stenger DC, Revington GN, Stevenson MC, Bisaro DM: Replicational

release of geminivirus genomes from tandemly repeated copies: Evidence

for rolling-circle replication of a plant viral DNA. Proceedings of the

National Academy of Sciences USA 1991, 88:8029-8033.

86. Londono A, Riego-Ruiz L, Arguello-Astorga GR: DNA-binding specificity

determinants of replication proteins encoded by eukaryotic ssDNA

viruses are adjacent to widely separated RCR conserved motifs. Archives

of virology 2010, 155(7):1033-1046.

87. Erdmann JB, Shepherd DN, Martin DP, Varsani A, Rybicki EP, Jeske H:

Replicative intermediates of maize streak virus found during leaf

development. The Journal of general virology 2010, 91(Pt 4):1077-1081.

88. Krupovic M, Ravantti JJ, Bamford DH: Geminiviruses: a tale of a plasmid

becoming a virus. BMC evolutionary biology 2009, 9:112.

89. Bisaro D: Geminivirus DNA replication. In: DNA replication in eukaryotic

cells. Cold Spring Harbor Laboratory \press; 1996: 833-854.

90. Rojas MR, Hagen C, Lucas WJ, Gilbertson RL: Exploiting chinks in the

plant's armor: evolution and emergence of geminiviruses. Annual review of

phytopathology 2005, 43:361-394.


108

108 91. Vega-Rocha S, Gronenborn B, Gronenborn AM, Campos-Olivas R: Solution

structure of the endonuclease domain from the master replication

initiator protein of the nanovirus faba bean necrotic yellows virus and

comparison with the corresponding geminivirus and circovirus

structures. Biochemistry 2007, 46(21):6201-6212.

92. Campos-Olivas R, Louis JM, Cleroy D, Gronenborn B, Gronenborn AM: The

structure of a replication initiator unites diverse aspects of nucleic acid

metabolism. Proceedings of the National Academy of Sciences USA 2002,

99:10310–10315.

93. Selth LA, Randles JW, Rezaian MA: Agrobacterium tumefaciens supports

DNA replication of diverse geminivirus types. FEBS letters 2002, 516(1-

3):179-182.

94. Padidam M, Beachy RN, Fauquet CM: Classification and identification of

geminiviruses using sequence comparisons. The Journal of general virology

1995, 76 ( Pt 2):249-263.

95. Bigarré L, Chazly M, Salah M, Ibrahim M, Padidam M, Nicole M,

Peterschmitt M, Fauquet C, Thoiuvenel JC: Characterization of a new

begomovirus from Egypt infecting hollyhock (Althea Rosea). European

Journal of Plant Pathology 2001, 107:701-711.

96. Chatterji A, Padidam M, Beachy RN, Fauquet CM: Identification of

replication specificity determinants in two strains of tomato leaf curl virus

from New Delhi. Journal of virology 1999, 73(7):5481-5489.

97. Roux S, Enault F, Bronner G, Vaulot D, Forterre P, Krupovic M: Chimeric

viruses blur the borders between the major groups of eukaryotic single-

stranded DNA viruses. Nature communications 2013, 4:2700.

98. Khan AJ, Akhtar S, Singh AK, Al-Shehi AA, Al-Matrushi AM, Ammara U,

Briddon RW: Recent evolution of a novel begomovirus causing tomato leaf

curl disease in the Al-Batinah region of Oman. Archives of virology 2013.

99. Kraberger S, Harkins GW, Kumari SG, Thomas JE, Schwinghamer MW,

Sharman M, Collings DA, Briddon RW, Martin DP, Varsani A: Evidence

that dicot-infecting mastreviruses are particularly prone to inter-species

recombination and have likely been circulating in Australia for longer

than in Africa and the Middle East. Virology 2013, 444(1-2):282-291.

100. Harimalala M, De Bruyn A, Hoareau M, Andrianjaka A, Ranomenjanahary S,

Reynaud B, Lefeuvre P, Lett JM: Molecular characterization of a new

alphasatellite associated with a cassava mosaic geminivirus in

Madagascar. Archives of virology 2013, 158(8):1829-1832.

101. Harrison BD, Robinson DJ: Natural, genomic and antigenic variation in

whitefly-transmitted geminiviruses (Begomoviruses). Annual review of

phytopathology 1999, 37:369-398.

102. Briddon RW, Lunness P, Bedford ID, Chamberlin LCL, Mesfin T, Markham

PG: A streak disease of pearl millet caused by a leafhopper-transmitted

geminivirus. European Journal of Plant Pathology 1996, 102:397-400.

103. Preib W, Jeske H: Multitasking in replication is common among

geminiviruses. Journal of virology 2003, 77:2972–2980.

104. Morilla G, Krenz B, Jeske H, Bejarano ER, C. W: Tete a tete of Tomato

yellow leaf curl virus and Tomato yellow leaf curl sardinia virus in single

nuclei. Journal of virology 2004, 78:10715-10723.

105. Hull R: Matthew's Plant Virology, 4 edn. San Diego: Academic Press; 2002.


109

109 106. Eybishtz A, Peretz Y, Sade D, Gorovits R, Czosnek H: Tomato yellow leaf

curl virus infection of a resistant tomato line with a silenced sucrose

transporter gene LeHT1 results in inhibition of growth, enhanced virus

spread, and necrosis. Planta 2010, 231(3):537-548.

107. Sanford JC, Johnson SA: The concept of parasite-derived resistance:

deriving resistance genes from the parasites own genome. Journal of

theoretical biology 1985, 115:395-405.

108. Hong J, Stanley J: Virus resistance in Nicotiana benthamiana conferred by

African cassava mosaic virus replication-associated protein (AC1)

transgene. Molecular Plant-Microbe Interactions 1996, 4:219-225.

109. Brunetti A, Tavazza R, Noris E, Lucioli A, Accotto GP, Tavazza M:

Transgenically expressed T-Rep of tomato yellow leaf curl Sardinia virus

acts as a trans-dominant-negative mutant, inhibiting viral transcrition

and replication. Journal of virology 2001, 75:10573-10581.

110. Noris E, Accotto GP, Tavazza R, Brunetti A, Crespi S, Tavazza M:

Resistance to tomato yellow leaf curl geminivirus in Nicotiana

benthamiana plants transformed with a truncated viral C1 gene. Virology

1996, 224(1):130-138.

111. Lucioli A, Noris E, Brunetti A, Tavazza R, Ruzza V, Castillo AG, Bejarano

ER, Accotto GP, Tavazza M: Tomato yellow leaf curl Sardinia virus rep-

derived resistance to homologous and heterologous geminiviruses occurs

by different mechanisms and is overcome if virus-mediated transgene

silencing is activated. Journal of virology 2003, 77(12):6785-6798.

112. von Arnim A, Stanley J: Inhibition of African cassava mosaic virus

systemic infection by a movement protein from the related geminivirus

tomato golden mosaic virus. Virology 1992, 187:555-564.

113. Duan Y-P, Powell CA, Webb SE, Purcifull DE, Hiebert E: Geminivirus

resistance in transgenic tobacco expressing mutated BC1 protein.

Molecula Plant-Microbe Interactions 1997, 10:617-623.

114. Tavladoraki P, Benvenuto E, Trinca S, De Martinis D, Cattaneo A, Galeffi P:

Transgenic plants expressing a functional single-chain Fv antibody are

specifically protected from virus attack. Nature 1993, 366(6454):469-472.

115. Patil BL, Dasgupta I: Defective Interfering DNAs of Plant Viruses. Critical

Reviews in Plant Sciences 2006, 25:47–64.

116. Winterhagen P, Dubois C, Sinn M, Wetzel T, Reustle GM: Gene silencing

and virus resistance based on defective interfering constructs in

transgenic Nicotiana benthamiana is not linked to accumulation of

siRNA. Plant Physiol Biochem 2009, 47(8):739-742.

117. Asad S, Haris WA, Bashir A, Zafar Y, Malik KA, Malik NN, Lichtenstein CP:

Transgenic tobacco expressing geminiviral RNAs are resistant to the

serious viral pathogen causing cotton leaf curl disease. Archives of virology

2003, 148(12):2341-2352.

118. Lindbo JA, Dougherty WG: Pathogen-derived resistance to a potyvirus:

immune and resistant phenotypes in transgenic tobacco expressing

altered forms of a potyvirus coat protein nucleotide sequence. Mol Plant

Microbe Interact 1992, 5(2):144-153.

119. Fusaro AF, Matthew L, Smith NA, Curtin SJ, Dedic-Hagan J, Ellacott GA,

Watson JM, Wang MB, Brosnan C, Carroll BJ et al: RNA interference-

inducing hairpin RNAs in plants act through the viral defence pathway.

EMBO reports 2006, 7(11):1168-1175.


110

110 120. Vallier A, Vincent-Monegat C, Laurencon A, Heddi A: RNAi in the cereal

weevil Sitophilus spp: systemic gene knockdown in the bacteriome tissue.

BMC biotechnology 2009, 9:44.

121. Shelly Praveen SVR, Anil K. Mishra, Vikas Koundal, Peter Palukaitis:

Silencing potential of viral derived RNAi constructs in Tomato leaf curl

virus-AC4 gene suppression in tomato Transgenic research 2010, 19:45-55.

122. Weiwei M, Zhenhua X, Feng L, Hang N, Yuyang J: A significant increase of

RNAi efficiency in human cells by the CMV enhancer with a tRNAlys

promoter. Journal of biomedicine & biotechnology 2009, 2009:514287.

123. von Eije KJ, Berkhout B: RNA-interference-based gene therapy

approaches to HIV type-1 treatment: tackling the hurdles from bench to

bedside. Antivir Chem Chemother 2009, 19(6):221-233.

124. Zheng YQ, Liu JX, Li XZ, Xu L, Xu YG: RNA interference-mediated

downregulation of Beclin1 attenuates cerebral ischemic injury in rats.

Acta pharmacologica Sinica 2009, 30(7):919-927.

125. Xie Z, Allen E, Wilken A, Carrington JC: DICER-LIKE 4 functions in

trans-acting small interfering RNA biogenesis and vegetative phase

change in Arabidopsis thaliana. Proceedings of the National Academy of

Sciences, USA 2005, 102(36):12984-12989.

126. Mallory AC, Vaucheret H: ARGONAUTE 1 homeostasis invokes the

coordinate action of the microRNA and siRNA pathways. EMBO reports

2009, 10(5):521-526.

127. Meng C, Chen J, Ding SW, Peng J, Wong SM: Hibiscus chlorotic ringspot

virus coat protein inhibits trans-acting small interfering RNA biogenesis

in Arabidopsis. The Journal of general virology 2008, 89(Pt 9):2349-2358.

128. Glick E, Zrachya A, Levy Y, Mett A, Gidoni D, Belausov E, Citovsky V,

Gafni Y: Interaction with host SGS3 is required for suppression of RNA

silencing by tomato yellow leaf curl virus V2 protein. Proceedings of the

National Academy of Sciences of the United States of America 2008,

105(1):157-161.

129. Fukunaga R, Doudna JA: dsRNA with 5' overhangs contributes to

endogenous and antiviral RNA silencing pathways in plants. The EMBO

journal 2009, 28(5):545-555.

130. Boutet S, Vazquez F, Liu J, Beclin C, Fagard M, Gratias A, Morel JB, Crete P,

Chen X, Vaucheret H: Arabidopsis HEN1: a genetic link between

endogenous miRNA controlling development and siRNA controlling

transgene silencing and virus resistance. Curr Biol 2003, 13(10):843-848.

131. Yanez M, Caceres S, Orellana S, Bastias A, Verdugo I, Ruiz-Lara S, Casaretto

JA: An abiotic stress-responsive bZIP transcription factor from wild and

cultivated tomatoes regulates stress-related genes. Plant Cell Rep 2009,

28(10):1497-1507.

132. Allen E, Howell MD: miRNAs in the biogenesis of trans-acting siRNAs in

higher plants. Seminars in cell & developmental biology 2010.

133. Vazquez F, Gasciolli V, Crete P, Vaucheret H: The nuclear dsRNA binding

protein HYL1 is required for microRNA accumulation and plant

development, but not posttranscriptional transgene silencing. Curr Biol

2004, 14(4):346-351.

134. Ying SY, Lin SL: Intron-mediated RNA interference and microRNA

biogenesis. Methods in molecular biology (Clifton, NJ 2009, 487:387-413.


111

111 135. Valdes-Lopez O, Yang SS, Aparicio-Fabre R, Graham PH, Reyes JL, Vance

CP, Hernandez G: MicroRNA expression profile in common bean

(Phaseolus vulgaris) under nutrient deficiency stresses and manganese

toxicity. The New phytologist 2010, 187(3):805-818.

136. Ruiz-Ferrer V, Voinnet O: Roles of plant small RNAs in biotic stress

responses. Annual review of plant biology 2009, 60:485-510.

137. Franco-Zorrilla JM, Del Toro FJ, Godoy M, Perez-Perez J, Lopez-Vidriero I,

Oliveros JC, Garcia-Casado G, Llave C, Solano R: Genome-wide

identification of small RNA targets based on target enrichment and

microarray hybridizations. Plant J 2009, 59(5):840-850.

138. Lewis RS: Transfer of resistance to potato virus Y (PVY) from Nicotiana

africana to Nicotiana tabacum: possible influence of tissue culture on the

rate of introgression. Theoretical and Applied Genetics 2005, 110(4):678.

139. Mallory AC, Bartel DP, Bartel B: MicroRNA-directed regulation of

Arabidopsis AUXIN RESPONSE FACTOR17 is essential for proper

development and modulates expression of early auxin response genes. The

Plant cell 2005, 17(5):1360-1375.

140. Liu PP, Montgomery TA, Fahlgren N, Kasschau KD, Nonogaki H, Carrington

JC: Repression of AUXIN RESPONSE FACTOR10 by microRNA160 is

critical for seed germination and post-germination stages. Plant J 2007,

52(1):133-146.

141. Haas G, Azevedo J, Moissiard G, Geldreich A, Himber C, Bureau M,

Fukuhara T, Keller M, Voinnet O: Nuclear import of CaMV P6 is required

for infection and suppression of the RNA silencing factor DRB4. The

EMBO journal 2008, 27(15):2102-2112.

142. Tenllado F, Llave C, Diaz-Ruiz JR: RNA interference as a new

biotechnological tool for the control of virus diseases in plants. Virus

research 2004, 102(1):85-96.

143. Lindbo JA, Silva-Rosales L, Proebsting WM, Dougherty WG: lnduction of a

highly specific antiviral state in transgenic plants: implications for

regulation of gene expression and virus resistance. The Plant cell 1993,

5:1749-1759.

144. Zhang C, Yang C, Whitham SA, Hill JH: Development and use of an

efficient DNA-based viral gene silencing vector for soybean. Mol Plant

Microbe Interact 2009, 22(2):123-131.

145. Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding

PS, Singh SP, Abbott D, Stoutjesdijk PA et al: Construct design for

efficient, effective and high-throughput gene silencing in plants. Plant J

2001, 27(6):581-590.

146. Wesley SV HC, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS,

Singh, SP AD, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG and

Waterhouse PM: Construct design for efficient, effective and high-

throughput gene silencing in plants. Plant J 2001, 27:581-590.

147. Ince AG, Karaca M, Onus AN: Genetic relationships within and between

Capsicum species. Biochemical genetics 2009, 48(1-2):83-95.

148. Mueller-Seitz E, Hiepler C, Petz M: Chili pepper fruits: content and

pattern of capsaicinoids in single fruits of different ages. Journal of

agricultural and food chemistry 2008, 56(24):12114-12121.

149. Kochieva EZ, Ryzhova NN: Analysis of resistance gene family diversity in

pepper (Capsicum annuum). Dokl Biochem Biophys 2009, 425:73-75.


112

112 150. Thapa B, Skalko-Basnet N, Takano A, Masuda K, Basnet P: High-

performance liquid chromatography analysis of capsaicin content in 16

Capsicum fruits from Nepal. J Med Food 2009, 12(4):908-913.

151. Janick J: Horticultural Science Freeman, W H, and Company, USA

1986:656 p.

152. Pellicer F, Picazo O, Leon-Olea M: Effect of red peppers (Capsicum

frutescens) intake during gestation on thermonociceptive response of rat

offspring. Behavioural brain research 2001, 119(2):179-183.

153. de Abreu IS, Carvalho CR, Clarindo WR: Chromosomal DNA content of

sweet pepper determined by association of cytogenetic and cytometric

tools. Plant Cell Rep 2008, 27(7):1227-1233.

154. Lee SM, Kim SY, Lee J, Yu KW, Chang I, Suh HJ: Nonpungent Capsicum

fermentation by Bacillus subtilis and the addition of Rapidase. Applied

microbiology and biotechnology 2008, 81(2):257-262.

155. Atrooz OM: The antioxidant activity and polyphenolic contents of

different plant seeds extracts. Pakistan journal of biological sciences: PJBS

2009, 12(15):1063-1068.

156. Alan O, Eser B: Pepper seed yield and quality in relation to fruit position

on the mother plant. Pakistan journal of biological sciences: PJBS 2007,

10(23):4251-4255.

157. Anonymous: Agricultural statistics of Pakistan. Government of Pakistan,

Ministry of Food, Agriculture and Livestock, Economic Wing, Islamabad

2003-04.

158. Hussain M, Mansoor S, Iram S, Zafar Y, Briddon RW: First report of

Tomato leaf curl New Delhi virus affecting chilli pepper in Pakistan. New

Disease Reports 2004, [http://www.bspp.org.uk/ndr/] Volume 9.

159. Shih SL, Tsai JH, Green SK, Khalid S, Ahmad I, Rezaian MA, Smith J:

Molecular characterisation of tomato and chili leaf curl begomoviruses

from Pakistan. Plant Disease 2003, 87:200.

160. A. Akhter, J. Qazi, M. Saeed, Mansoor S: A severe leaf curl disease on

chilies in Pakistan is associated with multiple begomovirus bomponents

plant disease 2009, 93(9):962.

161. Mazhar Hussain SI, Shahid Mansoor and Rob W. Briddon: A single species of

betasatellite is prevalent in chilli across north central Pakistan and shows

phylogeographic segregation. J Phytopathol 2009, 157:576-579.

162. Briddon RW, Bull SE, Amin I, Idris AM, Mansoor S, Bedford ID, Dhawan P,

Rishi N, Siwatch SS, Abdel-Salam AM et al: Diversity of DNA b: a satellite

molecule associated with some monopartite begomoviruses. Virology 2003,

312:106-121.

163. Kothari SL, Joshi A, Kachhwaha S, Ochoa-Alejo N: Chilli peppers--a review

on tissue culture and transgenesis. Biotechnology advances 2010, 28(1):35-

48.

164. Li D, Zhao K, Xie B, Zhang B, Luo K: Establishment of a highly efficient

transformation system for pepper (Capsicum annuum L.). Plant Cell Rep

2003, 21(8):785-788.

165. Padmanabhan P, Sahi SV: Genetic transformation and regeneration of

Sesbania drummondii using cotyledonary nodes. Plant Cell Rep 2009,

28(1):31-40.

http://www.bspp.org.uk/ndr/


113

113 166. Gunay AC, Rao PS: In vitro plant regeneration from hypocotyls and

cotyledon explants of red pepper (Capsicum). Plant Science Letters 1978,

11:365-372.

167. Valadez-Bustos MG A-SG, Carrillo-Castañeda G, Aguilar-Rincon VH,,

Espitia-Rangel E M-HS, Robledo-Paz A: In vitro propagation and

agronomic performance of regenerated chilli pepper (Capsicum spp.)

plants from commercially important genotypes. In Vitro Cell Dev Biol-

Plant 2009, 45:650-658.

168. Mihálka V, E. B: Genetic transformation and shoot regeneration

procedure for pepper (Capsicum annuum L.). . Acta Agron Hung 2006,

54:147-149.

169. Kim YS, Kuk YI, Kim KM: Inheritance and expression of transgenes

through anther culture of transgenic hot pepper. Zeitschrift fur

Naturforschung 2007, 62(9-10):743-746.

170. Doyle JJ, Doyle JL: Isolation of plant DNA from fresh tissue. Focus 1990,

12:13-15.

171. Sambrook J, Frisch EF, Maniatis T: Molecular Cloning: A Laboratory

Manual. New York: Cold Spring Harbor Laboratory Press; 1989.

172. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG: The

Clustal_X windows interface; flexible strategies for multiple sequence

alignment aided by quality analysis tools. Nucleic acids research 1997,

25:4876-4882.

173. Page RDM: TREEVIEW: An application to display phylogenetic trees on

personal computers. Computer Applications in the Biosciences 1996, 12:357-

358.

174. Hart SM, Basu C: Optimization of a Digoxigenin-Based Immunoassay

System for Gene Detection in Arabidopsis thaliana. J Biomol Tech 2009,

20(2):96–100.

175. Jones DR: Plant viruses transmitted by whiteflies. European Journal of

Plant Pathology 2003, 109:195-219.

176. Stanley J, Bisaro DM, Briddon RW, Brown JK, Fauquet CM, Harrison BD,

Rybicki EP, Stenger DC: Geminiviridae. In: Virus Taxonomy, VIIIth Report

of the ICTV. Edited by Fauquet CM, Mayo MA, Maniloff J, Desselberger U,

Ball LA. London: Elsevier/Academic Press; 2005: 301-326.

177. Morales FJ, Anderson PK: The emergence and dissemination of whitefly-

transmitted geminiviruses in Latin America. Archives of virology 2001,

146(3):415-441.

178. Varma A, Malathi VG: Emerging geminivirus problems: A serious threat

to crop production. Annals of Applied Biology 2003, 142(2):145-164.

179. Briddon RW, Bull SE, Amin I, Idris AM, Mansoor S, Bedford ID, Dhawan P,

Rishi N, Siwatch SS, Abdel-Salam AM et al: Diversity of DNA beta, a

satellite molecule associated with some monopartite begomoviruses.

Virology 2003, 312(1):106-121.

180. Shih SL, Tsai WS, Green SK: Molecular Characterization of Tomato and

Chili Leaf Curl Begomoviruses from Pakistan. Plant Disease 2003, 87:200.

181. D.M.J.B. Senanayake BM, S. Lodha and A. Varma: First report of Chilli

leaf curl virus affecting chilli in India. New Disease Reports 2006, 13:27.

182. Khan MS, Raj SK, Singh R: First report of Tomato leaf curl New Delhi

virus infecting chilli in India. Plant Pathology 2006, 55:289.


114

114 183. Bull SE, Briddon RW, Markham PG: Universal primers for the PCR-

mediated amplification of DNA 1: a satellite-like molecule associated with

begomovirus-DNA beta complexes. Molecular biotechnology 2003,

23(1):83-86.

184. Briddon RW, Bull SE, Mansoor S, Amin I, Markham PG: Universal primers

for the PCR-mediated amplification of DNA beta: a molecule associated

with some monopartite begomoviruses. Molecular biotechnology 2002,

20(3):315-318.

185. Shahid MS, Mansoor S, Briddon RW: Complete nucleotide sequences of

cotton leaf curl Rajasthan virus and its associated DNA beta molecule

infecting tomato. Archives of virology 2007, 152(11):2131-2134.

186. Hellens RP, Edwards EA, Leyland NR, Bean S, Mullineaux PM: pGreen: a

versatile and flexible binary Ti vector for Agrobacterium-mediated plant

transformation. Plant molecular biology 2000, 42(6):819-832.

187. Briddon RW, Mansoor S, Bedford ID, Pinner MS, Saunders K, Stanley J,

Zafar Y, Malik KA, Markham PG: Identification of dna components

required for induction of cotton leaf curl disease. Virology 2001,

285(2):234-243.

188. Fauquet CM, Briddon RW, Brown JK, Moriones E, Stanley J, Zerbini M,

Zhou X: Geminivirus strain demarcation and nomenclature. Archives of

virology 2008, 153(4):783-821.

189. Heyraud F, Matzeit V, Kammann M, Schafer S, Schell J, Gronenborn B:

Identification of the initiation sequence for viral-strand DNA synthesis of

wheat dwarf virus. EMBO Journal 1993, 12:4445-4452.

190. Argüello-Astorga G, Herrera-Estrella L, Rivera-Bustamante R: Experimental

and theoretical definition of geminivirus origin of replication. Plant

molecular biology 1994, 26:553-556.

191. Saunders K, Briddon RW, Stanley J: Replication promiscuity of DNA-beta

satellites associated with monopartite begomoviruses; deletion

mutagenesis of the Ageratum yellow vein virus DNA-beta satellite

localizes sequences involved in replication. The Journal of general virology

2008, 89(Pt 12):3165-3172.

192. Chakraborty S, Vanitharani R, Chattopadhyay B, Fauquet CM: Supervirulent

pseudorecombination and asymmetric synergism between genomic

components of two distinct species of begomovirus associated with severe

tomato leaf curl disease in India. The Journal of general virology 2008,

89(Pt 3):818-828.

193. Briddon RW, Patil BL, Bagewadi B, Nawaz-ul-Rehman MS, Fauquet CM:

Distinct evolutionary histories of the DNA-A and DNA-B components of

bipartite begomoviruses. BMC evolutionary biology 2010, 10:97.

194. Shafiq M, Asad S, Zafar Y, Briddon RW, Mansoor S: Pepper leaf curl

Lahore virus requires the DNA B component of Tomato leaf curl New

Delhi virus to cause leaf curl symptoms. Virology journal 2010, 7:367.

195. Mansoor S, Zafar Y, Briddon RW: Geminivirus disease complexes: the

threat is spreading. Trends in plant science 2006, 11(5):209-212.

196. Yadav RK, Chattopadhyay D: Enhanced viral intergenic region-specific

short interfering RNA accumulation and DNA methylation correlates

with resistance against a geminivirus. Mol Plant Microbe Interact 2011,

24(10):1189-1197.


115

115 197. Napoli C LC, Jorgensen R: Introduction of a chalcone synthase gene into

Petunia results in reversible co-suppression of homologous genes in trans.

. The Plant cell 1990, 2:279-289.

198. Nahid N, Amin I, Briddon RW, Mansoor S: RNA interference-based

resistance against a legume mastrevirus. Virology journal 2011, 8:499.

199. Bonfim K, Faria JC, Nogueira EO, Mendes EA, Aragao FJ: RNAi-mediated

resistance to Bean golden mosaic virus in genetically engineered common

bean (Phaseolus vulgaris). Mol Plant Microbe Interact 2007, 20(6):717-726.

200. Pooggin M, Shivaprasad PV, Veluthambi K, Hohn T: RNAi targeting of

DNA virus in plants. Nature biotechnology 2003, 21:131-132.

201. Mubin M, Hussain M, Briddon RW, Mansoor S: Selection of target

sequences as well as sequence identity determine the outcome of RNAi

approach for resistance against cotton leaf curl geminivirus complex.

Virology journal 2011, 8:122.

202. Muhammad Tehseen, Muhammad Imran, Mazhar Hussain, Shazia Irum,

Shahid Ali, Shahid Mansoor, Zafar Y: Development of male sterility by

silencing Bcp1 gene of Arabidopsis through RNA interference. African

Journal of Biotechnology 2010, 9(19):2736-2741.

203. Voinnet O, Rivas S, Mestre P, Baulcombe D: An enhanced transient

expression system in plants based on suppression of gene silencing by the

p19 protein of tomato bushy stunt virus. Plant Journal 2003, 33:949–956.

204. Hanson SF, Maxwell DP: trans-Dominant Inhibition of Geminiviral DNA

Replication by Bean Golden Mosaic Geminivirus rep Gene Mutants.

Phytopathology 1999, 89(6):480-486.

205. Lapidot M, Friedmann M: Breeding for resistance to whitefly-transmitted

geminiviruses. Annals of Applied Biology 2002, 140:109-127.

206. Rodriguez-Negrete EA, Carrillo-Tripp J, Rivera-Bustamante RF: RNA

silencing against geminivirus: complementary action of

posttranscriptional gene silencing and transcriptional gene silencing in

host recovery. Journal of virology 2009, 83(3):1332-1340.

207. Raja P, Wolf JN, Bisaro DM: RNA silencing directed against

geminiviruses: post-transcriptional and epigenetic components.

Biochimica et biophysica acta 2010, 1799(3-4):337-351.

208. Ramesh SV, Mishra AK, Praveen S: Hairpin RNA-mediated strategies for

silencing of tomato leaf curl virus AC1 and AC4 genes for effective

resistance in plants. Oligonucleotides 2007, 17(2):251-257.

209. Watson JM, Fusaro AF, Wang M, Waterhouse PM: RNA silencing platforms

in plants. FEBS letters 2005, in press.

210. Vanderschuren H, Akbergenov R, Pooggin MM, Hohn T, Gruissem W, Zhang

P: Transgenic cassava resistance to African cassava mosaic virus is

enhanced by viral DNA-A bidirectional promoter-derived siRNAs. Plant

molecular biology 2007, 64(5):549-557.

211. Zrachya A, Glick E, Levy Y, Arazi T, Citovsky V, Gafni Y: Suppressor of

RNA silencing encoded by Tomato yellow leaf curl virus-Israel. Virology

2007, 358(1):159-165.

212. Noris E, Lucioli A, Tavazza R, Caciagli P, Accotto GP, Tavazza M: Tomato

yellow leaf curl Sardinia virus can overcome transgene-mediated RNA

silencing of two essential viral genes. The Journal of general virology 2004,

85(Pt 6):1745-1749.


116

116 213. Ribeiro F, Neto MM, Rocha MM, Fonseca IT: Voltammetric studies on the

electrochemical determination of methylmercury in chloride medium at

carbon microelectrodes. Analytica chimica acta 2006, 579(2):227-234.

214. Arif M, Azhar U, Arshad M, Zafar Y, Mansoor S, Asad S: Engineering

broad-spectrum resistance against RNA viruses in potato. Transgenic

research 2011:1-9.

215. Aragao FJ, Faria JC: First transgenic geminivirus-resistant plant in the

field. Nature biotechnology 2009, 27(12):1086-1088; author reply 1088-1089.

216. Chellappan P, Vanitharani R, Pita J, Fauquet CM: Short interfering RNA

accumulation correlates with host recovery in DNA virus-infected hosts,

and gene silencing targets specific viral sequences. Journal of virology

2004, 78(14):7465-7477.

217. Jin M, Li C, Shi Y, Ryabov E, Huang J, Wu Z, Fan Z, Hong Y: A single

amino acid change in a geminiviral Rep protein differentiates between

triggering a plant defence response and initiating viral DNA replication.

The Journal of general virology 2008, 89(Pt 10):2636-2641.

218. Desbiez C, David C, Mettouchi A, Laufs J, Gronenborn B: Rep protein of

tomato yellow leaf curl geminivirus has an ATPase activity required for

viral replication. Proceedings of the National Academy of Sciences USA

1995, 92:5640-5644.

219. Sangaré A, Deng D, Fauquet CM, Beachy RN: Resistance to African cassava

mosaic virus conferred by a mutant of the putative NTP-binding domain

of the Rep Gene (AC1) in Nicotiana benthamiana. Molecular Breeding

1999, 5:95-102.

220. Pant V, Gupta D, Choudhury NR, Malathi VG, Varma A, Mukherjee SK:

Molecular characterization of the Rep protein of the blackgram isolate of

Indian mungbean yellow mosic virus. Journal of General Virology 2001,

82:2559-2567.

221. Choudhury NR, Malik PS, Singh DK, Islam MN, Kaliappan K, Mukherjee

SK: The oligomeric Rep protein of Mungbean yellow mosaic India virus

(MYMIV) is a likely replicative helicase. Nucleic acids research 2006,

34(21):6362-6377.

222. Settlage SB, See RG, Hanley-Bowdoin L: Geminivirus C3 protein:

replication enhancement and protein interactions. Journal of virology

2005, 79(15):9885-9895.

223. Vanitharani R, Chellappan P, Fauquet CM: Short interfering RNA-mediated

interference of gene expression and viral DNA accumulation in cultured

plant cells. Proceedings of the National Academy of Sciences USA 2003,

100:9632-9636.

224. Bonfim K, Faria JC, Nogueira EOPL, Mendes ÃrA, AragÃ£o FJL: RNAi-

Mediated Resistance to Bean golden mosaic virus in Genetically

Engineered Common Bean (Phaseolus vulgaris). Molecular Plant-Microbe

Interactions 2007, 20(6):717-726.

225. Vidavsky F, Czosnek H: Tomato Breeding Lines Resistant and Tolerant to

Tomato Yellow Leaf Curl Virus Issued from Lycopersicon hirsutum.

Phytopathology 1998, 88(9):910-914.

226. Mansoor S, Khan SH, Hussain M, Mushtaq N, Zafar Y, Malik KA: Evidence

that watermelon leaf curl disease in Pakistan is associated with Tomato

leaf curl virus-India, a bipartite begomovirus. Plant Disease 2000, 84:102.


117

117 227. Chellappan P, Masona MV, Vanitharani R, Taylor NJ, Fauquet CM: Broad

spectrum resistance to ssDNA viruses associated with transgene-induced

gene silencing in cassava. Plant molecular biology 2004, 56(4):601-611.

228. Pringle CR: Virus taxonomy at the XIth International Congress of

Virology, Sydney, Australia 1999. Archives of virology 1999, 144(10):2065-

2070.

229. Froissart R, Uzest M, Ruiz-Ferrer V, Drucker M, Hebrard E, Hohn T, Blanc S:

Splicing of Cauliflower mosaic virus 35S RNA serves to downregulate a

toxic gene product. The Journal of general virology 2004, 85(Pt 9):2719-

2726.

230. Bureau M, Leh V, Haas M, Geldreich A, Ryabova L, Yot P, Keller M: P6

protein of Cauliflower mosaic virus, a translation reinitiator, interacts

with ribosomal protein L13 from Arabidopsis thaliana. The Journal of

general virology 2004, 85(Pt 12):3765-3775.

231. Palanichelvam K, Cole AB, Shababi M, Schoelz JE: Agroinfiltration of

Cauliflower mosaic virus gene VI elicits hypersensitive response in

Nicotiana species. Mol Plant Microbe Interact 2000, 13(11):1275-1279.

232. Palanichelvam K, Schoelz JE: A comparative analysis of the avirulence and

translational transactivator functions of gene VI of Cauliflower mosaic

virus. Virology 2002, 293(2):225-233.

233. Harries PA, Palanichelvam K, Yu W, Schoelz JE, Nelson RS: The

cauliflower mosaic virus protein P6 forms motile inclusions that traffic

along actin microfilaments and stabilize microtubules. Plant physiology

2009, 149(2):1005-1016.

234. Covey SN, Hull R: Transcription of cauliflower mosaic virus DNA.

Detection of transcripts, properties and location of the gene encoding the

virus inclusion body protein. Virology 1981, 111:463-474.

235. Covey SN, Lomonossoff GP, Hull R: Characterisation of cauliflower

mosaic virus DNA sequences which encode major polyadenylated

transcripts. Nucleic acids research 1981, 9:6735-6747.

236. Cecchini E, Gong Z, Geri C, Covey SN, Milner JJ: Transgenic Arabidopsis

lines expressing gene VI from cauliflower mosaic virus variants exhibit a

range of symptom-like phenotypes and accumulate inclusion bodies.

Molecular Plant-Microbe Interactions 1997, 10:1094-1101.

237. Geri C, Love AJ, Cecchini E, Barrett SJ, Laird J, Covey SN, Milner JJ:

Arabidopsis mutants that suppress the phenotype induced by transgene-

mediated expression of cauliflower mosaic virus (CaMV) gene VI are less

susceptible to CaMV-infection and show reduced ethylene sensitivity.

Plant molecular biology 2004, 56(1):111-124.

238. Pennazio S, Roggero P: Plant hormones and plant virus diseases. The

auxins. The new microbiologica 1996, 19(4):369-378.

239. Cheng Y, Dai X, Zhao Y: Auxin synthesized by the YUCCA flavin

monooxygenases is essential for embryogenesis and leaf formation in

Arabidopsis. The Plant cell 2007, 19(8):2430-2439.

240. Kulka RG: Hormonal control of root development on epiphyllous plantlets

of Bryophyllum (Kalanchoe) marnierianum: role of auxin and ethylene.

Journal of experimental botany 2008, 59(9):2361-2370.

241. Lomax TL, Muday, G. K., and Rubery, P. H.: Auxin transport. In Plant

Hormones and Their Role in Plant Growth Development, . 2nd ed, P J

Davies, ed, Kluwer, Dordrecht, Netherlands,pp 509–530 1995.


118

118 242. Gil P, Dewey E, Friml J, Zhao Y, Snowden KC, Putterill J, Palme K, Estelle

M, Chory J: BIG: a calossin-like protein required for polar auxin

transport in Arabidopsis. Genes & development 2001, 15(15):1985-1997.

243. Kaneyasu T, Kobayashi A, Nakayama M, Fujii N, Takahashi H, Miyazawa Y:

Auxin response, but not its polar transport, plays a role in hydrotropism

of Arabidopsis roots. Journal of experimental botany 2007, 58(5):1143-1150.

244. Strader LC, Bartel B: A new path to auxin. Nature chemical biology 2008,

4(6):337-339.

245. Desgagne-Penix I, Eakanunkul S, Coles JP, Phillips AL, Hedden P, Sponsel

VM: The auxin transport inhibitor response 3 (tir3) allele of BIG and

auxin transport inhibitors affect the gibberellin status of Arabidopsis.

Plant J 2005, 41(2):231-242.

246. Taylor GA, Moore JN, Drinkwater WO: Influence of 2,3,5-triiodobenzoic

acid, indole-3-acetic acid & method of sample collection on translocation

of foliar applied radiocalcium. Plant physiology 1961, 36(3):360-363.

247. Dhonukshe P, Grigoriev I, Fischer R, Tominaga M, Robinson DG, Hasek J,

Paciorek T, Petrasek J, Seifertova D, Tejos R et al: Auxin transport

inhibitors impair vesicle motility and actin cytoskeleton dynamics in

diverse eukaryotes. Proceedings of the National Academy of Sciences of the

United States of America 2008, 105(11):4489-4494.

248. Pennazio S, Roggero P: Plant hormones and plant virus diseases. The

auxins. New Microbiol 1996, 19(4):369-378.

249. Kazan K, Manners MJ: Linking development to defense: auxin in plant-

pathogen interactions. Trends Plant Sci 2009, 14(7):373-382.

250. Smith LA: Interactions between Cauliflower mosaic virus and auxin

signalling. PhD Thesis, University of Glasgow, UK. 2007.

251. DeLong A, Mockaitis K, Christensen S: Protein phosphorylation in the

delivery of and response to auxin signals. Plant molecular biology 2002,

49(3-4):285-303.

252. Love AJ, Laird J, Holt J, Hamilton AJ, Sadanandom A, Milner JJ:

Cauliflower mosaic virus protein P6 is a suppressor of RNA silencing. The

Journal of general virology 2007, 88(Pt 12):3439-3444.

253. Cecchini E, Gong Z, Geri C, Covey SN, Milner JJ: Transgenic Arabidopsis

lines expressing gene VI from cauliflower mosaic virus variants exhibit a

range of symptom-like phenotypes and accumulate inclusion bodies. Mol

Plant Microbe Interact 1997, 10(9):1094-1101.

254. Pall GS, Codony-Servat C, Byrne J, Ritchie L, Hamilton A: Carbodiimide-

mediated cross-linking of RNA to nylon membranes improves the

detection of siRNA, miRNA and piRNA by northern blot. Nucleic acids

research 2007, 35(8):e60.

255. Wu MF, Tian Q, Reed JW: Arabidopsis microRNA167 controls patterns of

ARF6 and ARF8 expression, and regulates both female and male

reproduction. Development (Cambridge, England) 2006, 133(21):4211-4218.

256. Whitham SA, Yang C, Goodin MM: Global impact: elucidating plant

responses to viral infection. Mol Plant Microbe Interact 2006, 19(11):1207-

1215.

257. Padmanabhan MS, Goregaoker SP, Golem S, Shiferaw H, Culver JN:

Interaction of the tobacco mosaic virus replicase protein with the

Aux/IAA protein PAP1/IAA26 is associated with disease development.

Journal of virology 2005, 79(4):2549-2558.


119

119 258. Padmanabhan MS, Kramer SR, Wang X, Culver JN: Tobacco mosaic virus

replicase-auxin/indole acetic acid protein interactions: reprogramming

the auxin response pathway to enhance virus infection. Journal of virology

2008, 82(5):2477-2485.

259. Baughman GA, Jacobs JD, Howell SH: Cauliflower mosaic virus gene VI

produces a symptomatic phenotype in transgenic tobacco plants.


America 1988, 85(3):733-737.

260. Kanyuka K, Praekelt U, Franklin KA, Billingham OE, Hooley R, Whitelam

GC, Halliday KJ: Mutations in the huge Arabidopsis gene BIG affect a

range of hormone and light responses. Plant J 2003, 35(1):57-70.

261. Amin I, Patil BL, Briddon RW, Mansoor S, Fauquet CM: Comparison of

phenotypes produced in response to transient expression of genes encoded

by four distinct begomoviruses in Nicotiana benthamiana and their

correlation with the levels of developmental miRNAs. Virology journal

2011, 8:238.

262. Mallory AC, Reinhart BJ, Bartel D, Vance VB, Bowman LH: A viral

suppressor of RNA silencing differentially regulates the accumulation of

short interfering RNAs and micro-RNAs in tobacco. Proceedings of the

National Academy of Sciences USA 2002, 99:15228–15233.

263. Chapman EJ, Prokhnevsky AI, Gopinath K, Dolja VV, Carrington JC: Viral

RNA silencing suppressors inhibit the microRNA pathway at an

intermediate step. Genes Dev 2004, 18(10):1179-1186.

264. Ulmasov T, Hagen G, Guilfoyle TJ: Activation and repression of

transcription by auxin-response factors. Proceedings of the National

Academy of Sciences of the United States of America 1999, 96(10):5844-5849.

265. Guilfoyle TJ, Hagen G: Auxin response factors. Current opinion in plant

biology 2007, 10(5):453-460.

266. Khan S, Stone JM: Arabidopsis thaliana GH3.9 influences primary root

growth. Planta 2007, 226(1):21-34.

267. Tiwari SB, Hagen G, Guilfoyle TJ: Aux/IAA proteins contain a potent

transcriptional repression domain. The Plant cell 2004, 16(2):533-543.

268. Li H, Cheng Y, Murphy A, Hagen G, Guilfoyle TJ: Constitutive repression

and activation of auxin signaling in Arabidopsis. Plant physiology 2009,

149(3):1277-1288.

269. Tiwari SB, Hagen G, Guilfoyle T: The roles of auxin response factor

domains in auxin-responsive transcription. The Plant cell 2003, 15(2):533-

543.

270. Gutierrez L, Bussell JD, Pacurar DI, Schwambach J, Pacurar M, Bellini C:

Phenotypic plasticity of adventitious rooting in Arabidopsis is controlled

by complex regulation of AUXIN RESPONSE FACTOR transcripts and

microRNA abundance. The Plant cell 2009, 21(10):3119-3132.

271. Kasschau KD, Xie Z, Allen E, Llave C, Chapman EJ, Krizan KA, Carrington

JC: P1/HC-Pro, a viral suppressor of RNA silencing, interferes with

Arabidopsis development and miRNA unction. Developmental cell 2003,

4:205-217.

272. Vaucheret H, Vazquez F, Crete P, Bartel DP: The action of ARGONAUTE1

in the miRNA pathway and its regulation by the miRNA pathway are

crucial for plant development. Genes & development 2004, 18(10):1187-

1197.


120

120 273. Vazquez F, Gasciolli V, Crete P, Vaucheret H: The nuclear dsRNA binding

protein HYL1 is required for microRNA accumulation and plant

development, but not posttranscriptional transgene silencing. Curren

Biology 2004, 14:346-351

274. Diaz I MR, Power JB.: Plant regeneration from protoplasts of Capsicum

annuum. Plant Cell Rep 1988, 7:210-212.

275. Jeong WY, Jin JS, Cho YA, Lee JH, Park S, Jeong SW, Kim YH, Lim CS,

Abd El-Aty AM, Kim GS et al: Determination of polyphenols in three

Capsicum annuum L. (bell pepper) varieties using high-performance

liquid chromatography-tandem mass spectrometry: their contribution to

overall antioxidant and anticancer activity. Journal of separation science

2011, 34(21):2967-2974.

276. Hussain Shah. TY, Muhammad Fahim., Shahid Hameed., M.I. Haque.,:

Transmission and host range studies of Pakistani isolate of chilli veinal

mottle virus. Pak J Bot 2008, 40(6):2669-2681.

277. Wu HW, Yu TA, Raja JA, Wang HC, Yeh SD: Generation of transgenic

oriental melon resistant to Zucchini yellow mosaic virus by an improved

cotyledon-cutting method. Plant Cell Rep 2009, 28(7):1053-1064.

278. Yadav RK, Shukla RK, Chattopadhyay D: Soybean cultivar resistant to

Mungbean Yellow Mosaic India Virus infection induces viral RNA

degradation earlier than the susceptible cultivar. Virus research 2009,

144(1-2):89-95.

279. Ban H, Chai X, Lin Y, Zhou Y, Peng D, Zou Y, Yu Z, Sun M: Transgenic

Amorphophallus konjac expressing synthesized acyl-homoserine

lactonase (aiiA) gene exhibit enhanced resistance to soft rot disease. Plant

Cell Rep 2009, 28(12):1847-1855.

280. Nakagawa T, Suzuki T, Murata S, Nakamura S, Hino T, Maeo K, Tabata R,

Kawai T, Tanaka K, Niwa Y et al: Improved Gateway binary vectors: high-

performance vectors for creation of fusion constructs in transgenic

analysis of plants. Bioscience, biotechnology, and biochemistry 2007,

71(8):2095-2100.

281. Gaj MD: Factors Influencing Somatic Embryogenesis Induction and Plant

Regeneration with Particular Reference to Arabidopsis thaliana (L.)

Heynh. Plant Growth Regulation 2004, 43(1):27-47.

282. Gururaj HB, Giridhar P, Sharma A, Prasad BC, Ravishankar GA: In vitro

clonal propagation of bird eye chilli (Capsicum frutescens Mill.). Indian

journal of experimental biology 2004, 42(11):1136-1140.

283. Ashrafuzzaman M, Hossain MM, Razi IM, Shahidul Haque M, Shahidullah

SM, Shahin-uz-zaman: Regeneration potential of seedling explants of chilli

(Capsicum annuum). African J Biotechnol 2009, 18:591-596.

284. Lee YH, Kim HS, Kim JY, Jung M, Park YS, Lee JS, Choi SH, Her NH, Lee

JH, Hyung NI et al: A new selection method for pepper transformation:

callus-mediated shoot formation. Plant Cell Rep 2004, 23(1-2):50-58.

285. Hasnat R AN, Hafiz IA, Ahmad T, Chudhary Z: Effect of different bacterial

dilutions on transformation efficiency of hot chilli (Capsicum frutescens

L.) varieties. Pak J Bot 2008, 40:2655-2662.

286. Christopher T, Rajam MV: Effect of genotype, explants and medium on in

vitro regeneration of red pepper. Plant Cell Tiss Org Cult, 1996, 46:245-

250.


121

121 287. Szasz A, Nervo G, Fari M: Screening for in vitro shoot-forming capacity of

seedling explants in bell pepper. (Capsicum annuum L.) genotypes and

efficient regeneration using thidiazuron. . Plant Cell Rep 1995, 14:666-669.

288. Ezura H, Nishimiya S. Kasumi M: Efficient regeneration of plants

independent of exogenous growth regulators in bell pepper (Capsicum

annuum L.). Plant Cell Rep 1993, 12:676-680.

289. Zhu YX, Ou-Yang W, Zhang YF, Chen ZL: Transgenic sweet pepper plants

from Agrobacterium-mediated transformation. Plant Cell Rep 1996, 16:71-

75.

290. Kim SJ, Lee SJ, Kim BD, Paek KH: Satellite-RNA mediated resistance to

cucumber mosaic virus in transgenic plants of hot pepper (Capsicum

annuum cv. Golden Tower). Plant Cell Rep 1997, 16:825-830.

291. Haberlandt G: Culturversuche mit isolierten Pflanzenzellen. Sitz-Ber Math-

Nat Kl Kais Akad Wiss Wien 1902, 111:69-92.

292. Steward FC M, Mears JS,: Growth and organized development of cultured

cells. II.

Organization in cultures grown fromfreely suspended cells. American journal of

botany 1958, 45:705-708.

293. Kim M, Jang IC, Kim JA, Park EJ, Yoon M, Lee Y: Embryogenesis and

plant regeneration of hot pepper (Capsicum annuum L.) through isolated

microspore culture. Plant Cell Rep 2008, 27(3):425-434.

294. Nowaczyk P, Kisiala A: Effect of selected factors on the effectiveness of

Capsicum annuum L. anther culture. Journal of applied genetics 2006,

47(2):113-117.

295. Kim S, Kim SR, An CS, Hong YN, Lee KW: Constitutive expression of rice

MADS box gene using seed explants in hot pepper (Capsicum annuum

L.). Molecules and cells 2001, 12(2):221-226.

296. Ochoa-Alejo N R-MR: In vitro chilli pepper biotechnology. In Vitro Cell

Dev Biol Plant 2001, 37:701-729.

297. Agrawal S, Chandra N, SL. K: Plant regeneration in tissue cultures of

pepper (Capsicum annuum L. cv. Mathania). Plant Cell Tissue Organ Cult

1989, 16:47-55.

298. Supena ED, Suharsono S, Jacobsen E, Custers JB: Successful development of

a shed-microspore culture protocol for doubled haploid production in

Indonesian hot pepper (Capsicum annuum L.). Plant Cell Rep 2006,

25(1):1-10.

299. Venkataiah P, Christopher T, Subhash K: In vitro shoot multiplication and

plant regeneration in four Capsicum species using thidiazuron. Sci Hortic-

Amsterdam 2006, 107:117-122.

300. Sripichit P, Nawata E, Shigenaga S: In vitro shoot-forming capacity of

cotyledon explants in red pepper (Capsicum annuum L. cv. Yatsufusa). .

Jap J Breed 1987, 37:133-142.

301. Venkataiah P, Christopher T, Subash K: Thiadiazuron induced high

frequency adventitious shoot formation and plant regeneration in

CapsicumannuumL. J Plant Biotechnol 2003, 5:245-250.

302. Phillips GC, Hubstenberger F: Organogenesis in pepper tissue cultures.

Plant Cell Tissue Organ Culture 1985, 4:261-269.

303. Valera-Montero LL, Ochoa-Alejo N: A novel approach for chili pepper

(Capsicum annuum L.) plant regeneration: shoot induction in rooted

hypocotyls. Plant Sci 1992, 84:215-219.


122

122 304. Ebida AIA, Hu CY: In vitro morphogenetic responses and plant

regeneration from pepper (Capsicum annuum L. cv. Early California

Wonder) seedling explant. Plant Cell Rep 1993, 13:107-110.

305. Zhang BX, Huang SW, Yang GM, Guo JZ: Two RAPD markers linked to a

major fertility restorer gene in pepper. Euphytica 2000, 113(2):155-161.

306. Lee SC, Hwang BK: Identification of the pepper SAR8.2 gene as a

molecular marker for pathogen infection, abiotic elicitors and

environmental stresses in Capsicum annuum. Planta 2003, 216(3):387-396.

307. Daskalov S, Michailov L: A new method for hybrid seed production based

on cytoplasmic male sterility combined with a lethal gene and a female

sterile pollenizer in Capsicum annuum L. TheorApplGenet 1988, 76:530.

308. Kim YS, Park JY, Kim KS, Ko MK, Cheong SJ, Oh BJ: A thaumatin-like

gene in nonclimacteric pepper fruits used as molecular marker in probing

disease resistance, ripening, and sugar accumulation. Plant molecular

biology 2002, 49(2):125-135.

309. Mirjana Mijatovic BZ, Miroslav Ivanovic AO: Diseases of pepper in Serbia

and results of breeding for resistance Folia Horticulturae 2005, 17(2):53-

60.

310. Byoung-Cheorl KIY, Hanxia L, Kari WP, Molly MJ: Ectopic expression of a

recessive resistance gene generates dominant potyvirus resistance in

plants Plant biotechnology journal 2007, 5:526-536.

311. Kochieva EZ, Ryzhova NN: Analysis of Resistance Gene Family Diversity

in Pepper (Capsicum annuum). Doklady Biochemistry and Biophysics 2009,

425:73-75.

312. Gustavo A. de la R, Joel G, Roberto V, Camilo A: Agrobacterium

tumefaciens: a natural tool for plant transformation. Electronic Journal of

Biotechnology 1998, Vol.1 No.3(3):

http://www.ejbiotechnology.info/content/vol1/issue3/full/1/. 313. Benson EE: In-vitro plant recalcitrance: an introduction. In Vitro Cell Dev

Biol Plant 2000, 36:141-148.

314. Benson EE: Do free radicals have a role in plant tissue culture

recalcitrance? In Vitro Cell Dev Biol Plant 2000, 36:163-170.

315. Bailey, E, Deighton N, Clulow SA, Goodman BA, Benson EE: Changes in

free radical profiles during the callogenesis of responsive and recalcitrant

potato genotypes. Proc R Soc Edinburgh, sect B 1994, 102:243-246.

316. Gil AE, Roberto IV, Dmitri LP, Marlene P, Guillermo S: Genetic

transformation of sugarcane by Agrobacterium tumefaciens using

antioxidant compounds Biotecnologia Aplicada 1997, 14(3):169-174.

317. Hussain M, Mansoor S, Amin I, Iram S, Zafar Y, Malik KA, Briddon RW:

First report of cotton leaf curl disease affecting chili peppers. New Disease

Reports 2003, [http://www.bspp.org.uk/ndr/] Volume 7.

318. Harrison BD: Virus variation in relation to resistance-breaking in plants.

Euphytica 2002, 124:181-192.

319. Mubin M, Akhtar S, Amin I, Briddon RW, Mansoor S: Xanthium

strumarium: a weed host of components of begomovirus-betasatellite

complexes affecting crops. Virus genes 2012, 44(1):112-119.

320. Shafiq M, Asad S, Zafar Y, Briddon RW, Mansoor S: Pepper leaf curl

Lahore virus requires the DNA B component of Tomato leaf curl New

Delhi virus to cause leaf curl symptoms. Virology journal, 7:367.

http://www.ejbiotechnology.info/content/vol1/issue3/full/1/

http://www.bspp.org.uk/ndr/


123

123 321. Mishra MD, Raychaudhri SP, Jha A: Virus causing leaf curl of chilli

(Capsicum annum L.). Indian J Microbiol 1963, 3:73-76.

322. Dhanraj KS SM: Enation in Capsicum annum L (Chilli) caused by a new

strain leaf curl virus. Indian J Hort 1968, 25:70-71.

323. Chattopadhyay B, Singh AK, Yadav T, Fauquet CM, Sarin NB, Chakraborty

S: Infectivity of the cloned components of a begomovirus: DNA beta

complex causing chilli leaf curl disease in India. Archives of virology 2008,

153(3):533-539.

324. Polston JE, McGovern RJ, Brown LG: Introduction of tomato yellow leaf

curl virus in Florida and implications for the spread of this and other

geminiviruses of tomato. Plant Disease 1999, 83:984-988.

325. Briddon RW: Cotton leaf curl disease, a multicomponent begomovirus

complex. Molecular plant pathology 2003, 4(6):427-434.

326. Legg JP, Thresh JM: Cassava mosaic virus disease in East Africa: a

dynamic disease in a changing environment. Virus research 2000, 71(1-

2):135-149.

327. Rubio M, Caranta C, Palloix A: Functional markers for selection of

potyvirus resistance alleles at the pvr2-eIF4E locus in pepper using tetra-

primer ARMS-PCR. Genome / National Research Council Canada =

Genome / Conseil national de recherches Canada 2008, 51(9):767-771.

328. Kuwabara PE, Coulson A: RNAi--prospects for a general technique for

determining gene function. Parasitology today (Personal ed 2000,

16(8):347-349.

329. Gust TC, Neubrandt L, Merz C, Asadullah K, Zugel U, von Bonin A: RNA

interference-mediated gene silencing in murine T cells: in vitro and in

vivo validation of proinflammatory target genes. Cell Commun Signal

2008, 6:3.

330. Kong LJ, Hanley-Bowdoin L: A geminivirus replication protein interacts

with a protein kinase and a motor protein that display different

expression patterns during plant development and infection. The Plant cell

2002, 14(8):1817-1832.

331. Waterhouse, Peter, Graham M, Michael WW, Ming-Bo: Virus resistance and

gene silencing in plants can be induced by simultaneous expression of

sense and antisense RNA. Proceedings of the National Academy of Sciences

USA 1998, 95:13959–13964. 332. Drugeon G, Urcuqui-Inchima S, Milner M, Kadare G, Valle RPC, Voyatzakis

A, Haenni A-L, Schirawski J: The strategies of plant virus gene expression:

models of economy. Plant Science 1999, 148(1):77.

333. Liu J, Li M, Li JM, Huang CJ, Zhou XP, Xu FC, Liu SS: Viral infection of

tobacco plants improves performance of Bemisia tabaci but more so for

an invasive than for an indigenous biotype of the whitefly. Journal of

Zhejiang University Science 2010, 11(1):30-40.

rna interference based resistance against chili leaf curl

Documents