Rn

LKa

b

a

ARRAA

KCCDHNC

1

pifiwtEowwB

1tGpgudr

0h

Reproductive Toxicology 38 (2013) 25– 36

Contents lists available at SciVerse ScienceDirect

Reproductive Toxicology

jo ur nal homep age: www.elsev ier .com/ locate / reprotox

eversible effect of developmental exposure to chlorpyrifos on late-stageeurogenesis in the hippocampal dentate gyrus in mouse offspring

iyun Wanga, Takumi Ohishia, Hirotoshi Akanea, Ayako Shirakia,b, Megu Itahashia,b,unitoshi Mitsumoria, Makoto Shibutania,∗

Laboratory of Veterinary Pathology, Tokyo University of Agriculture and Technology, 3-5-8 Saiwai-cho, Fuchu-shi, Tokyo 183-8509, JapanPathogenetic Veterinary Science, United Graduate School of Veterinary Sciences, Gifu University, 1-1 Yanagido, Gifu-shi, Gifu 501-1193, Japan

r t i c l e i n f o

rticle history:eceived 27 October 2012eceived in revised form 17 January 2013ccepted 7 February 2013vailable online 18 February 2013

eywords:

a b s t r a c t

The effect of developmental exposure to chlorpyrifos (CPF) on hippocampal neurogenesis was examinedin male mice after maternal dietary exposure to CPF at 0, 4, 20, or 100 ppm from gestation day 10 topostnatal day (PND) 21. Cholinesterase activity was dose-dependently decreased in red blood cells at≥4 ppm and in the brain at 100 ppm both in dams and offspring on PND 21. Immunohistochemically,doublecortin+ cells were decreased at ≥20 ppm in the subgranular zone (SGZ) of the dentate gyrus, andNeuN+-expressing mature neurons were decreased at 100 ppm in the hilus on PND 21. There were no

hlorpyrifosholinesterase inhibitorevelopmental neurotoxicityippocampal dentate gyruseurogenesis

differences in the numbers of progenitor populations expressing Tbr2 or M1 muscarinic acetylcholinereceptors. Transcript levels of Dcx also decreased at ≥20 ppm, and those of Pcna, Casp3, Bax, Bcl2, Pax6 andTbr2 were unchanged in the dentate gyrus by real-time RT-PCR. At PND 77, hippocampal neurogenesis wasunchanged. These results suggest that developmental CPF exposure directly but transiently suppressesmaturation of late-stage granule cell lineages in the SGZ and affects interneuron populations in the hilus.

holinesterase activity

. Introduction

Chlorpyrifos (CPF) is one of the most widely used organophos-hate insecticides in the world [1]. Its toxicity is related to the

nhibition of cholinesterase (ChE) activity, disrupting cholinergicunction in the nervous system [2]. In the most recent decade,ncreased concern has been raised about health risks associated

ith subtoxic dose levels of CPF [3]. However, despite the restric-ion of some of its domestic and agricultural uses by the United Statenvironmental Protection Agency [4] in 2000, CPF still remainsne of the most widely used organophosphate insecticides in the

orld [5]. Especially in Europe, CPF is the top selling insecticide [6]ith no restrictions imposed on use sites or application rates [7].ecause of its widespread agricultural and domestic uses, the risk of

Abbreviations: ChE, cholinesterase; Chrm1, cholinergic receptor muscarinic; CPF, chlorpyrifos; DCX, doublecortin; GABA, �-aminobutyric acid; GAD67, glu-amic acid decarboxylase 67; Gapdh, glyceraldehyde 3-phosphate dehydrogenase;D, gestation day; GFAP, glial fibrillary acidic protein; Hprt, hypoxanthine-guaninehosphoribosyltransferase; NeuN, neuron-specific nuclear protein; Pax6, paired boxene 6; PCNA, proliferating cell nuclear antigen; PND, postnatal day; SGZ, subgran-lar zone; Tbr2, T box brain 2; TSH, thyroid-stimulating hormone; TUNEL, terminaleoxynucleotidyl transferase dUTP nick end labeling; T3, triiodothyronine; T4, thy-oxine.∗ Corresponding author. Tel.: +81 42 367 5874; fax: +81 42 367 5771.

E-mail address: mshibuta@cc.tuat.ac.jp (M. Shibutani).

890-6238/$ – see front matter © 2013 Elsevier Inc. All rights reserved.ttp://dx.doi.org/10.1016/j.reprotox.2013.02.004

© 2013 Elsevier Inc. All rights reserved.

unsuspected CPF exposure from environmental contamination ishigh. The estimated national average consumption of CPF throughfood in Japan is calculated as 0.72 �g/kg-day. In pregnant womenthis is 0.66 �g/kg-day and in infants of 1–6 years of age it iscalculated as 1.34 �g/kg-day [8]. Therefore, children, who arestill in the developmental stages of life, have a higher risk of CPFexposure than adults.

Studies on CPF neurotoxicity mainly focus on its impact onacetylcholine systems and related behaviors [9,10]. The mecha-nism underlying the systemic effects of organophosphates is theirreversible inhibition of ChE by active oxon metabolites [11,12].However, work over the past two decades has conclusively shownthat native compounds such as CPF are themselves developmen-tal neurotoxicants at low, nonsymptomatic exposure levels andthat, consequently, the ChE biomarker is inadequate for monitoringsafety [11,12]. Indeed, a number of studies on the ChE-unrelatedeffects underlying the developmental neurotoxicity of CPF haveindicated a combination of antimitotic and pro-apoptotic mech-anisms, leading to deficits in the numbers of neurons and/or glialcells [12,13].

Within the hippocampal formation of the mammalian brain,the dentate gyrus is a unique structure that can continue neuro-

genesis at the subgranular zone (SGZ) throughout postnatal life[14]. It forms crucial neuronal networks responsible for cognitive,emotional and memory function [15]. This postnatal neurogene-sis (so-called “adult neurogenesis”) occurs in the SGZ from type-1

2 tive To

stmi(cpraadedrpot

ceahtstt[

eltttctc

2

2

J(iw2awAvr

2

l(C

wPsftaaaftua

6 L. Wang et al. / Reproduc

tem cells and produces intermediate generations in the order ofype-2a, type-2b, and type-3 cells. Type-3 cells then undergo final

itosis to differentiate into immature granule cells, and finallynto mature granule cells [16]. In addition, �-aminobutyric acidGABA)ergic interneurons in the hilus of the dentate gyrus canontrol neurogenesis in the SGZ [17,18]. During the embryoniceriod and throughout adult life, GABAergic interneurons produceeelin, which modulates dentate granule cell progenitor migrationnd maintains normal granule cell integration in the neonatal anddult mammalian dentate gyrus [19]. Therefore, examination of theistribution of the neuronal progenitor cell populations and reelin-xpressing interneurons may be instrumental in the detection ofevelopmental neurotoxicity. However, the cholinergic system alsoegulates hippocampal adult neurogenesis, positively promotingroliferation, differentiation, integration and, potentially, survivalf newborn neurons [20]. This suggests that ChE inhibitors mayarget neurogenesis even at the adult stage.

Despite the fact that numerous studies on neuronal and glialell populations in the developing brain and the related behavioralffects of CPF have been conducted, little information is avail-ble concerning neurogenesis and its regulatory systems in theippocampal dentate gyrus. To develop a rapid screening sys-em for developmental neurotoxicants, we recently performedeveral studies on neurogenesis and its regulatory systems inhe hippocampal dentate gyrus using histopathological parame-ers including immunohistochemistry in small-scale animal studies17,21–24].

In the present study, to elucidate the effect of developmentalxposure to CPF on neurogenesis, we studied the distribution, pro-iferation and apoptosis of granule cell lineages in the SGZ andhe distribution of reelin-producing interneurons in the hilus ofhe hippocampal dentate gyrus in the offspring of mice exposedo CPF during pregnancy and lactation. We also evaluated thehanges in ChE levels in red blood cells (RBC), blood plasma, andhe forebrain, and the distribution of progenitor cells expressingholinergic receptor muscarinic 1 (Chrm1) in the SGZ.

. Materials and methods

.1. Chemicals and animals

CPF (purity: 99.8%) was kindly provided by Dow Chemical Japan Ltd. (Tokyo,apan). A total of 60 pregnant Slc:ICR mice were purchased from Japan SLC Inc.Hamamatsu, Japan) at gestation day (GD) 1 (appearance of vaginal plugs was des-gnated as GD 0). Animals were housed individually in polycarbonate cages with

ood chip bedding maintained in an air-conditioned animal room (temperature:4 ± 1 ◦C; relative humidity: 55 ± 5%) with a 12-h light/dark cycle, and allowedccess to food and tap water ad libitum. After delivery, dams were similarly housedith their litters until postnatal day (PND) 21 (with PND 0 being the day of delivery).

regular MF basal diet (Oriental Yeast Co. Ltd., Tokyo, Japan) and water were pro-ided ad libitum throughout the experimental period. All offspring consumed theegular MF basal diet and water ad libitum from PND 21 onwards.

.2. Experimental design

All procedures of this study were conducted in compliance with the Guide-ines for Proper Conduct of Animal Experiments of the Science Council of JapanJune 1, 2006) and according to the protocol approved by the Animal Care and Useommittee of the Tokyo University of Agriculture and Technology.

Dams were randomly divided into 4 groups of 15 dams each, which were treatedith 0, 4, 20 or 100 ppm of CPF mixed into the powdered basal diet from GD 10 to

ND 21. This exposure period was chosen because the formation of hippocampustarts on GD 11 and neurogenesis in the SGZ is active during the postnatal periodrom PND 3 to PND 14 in mice [25]. At PND 4, litters of dams that delivered morehan 5 male and 5 female offspring per group were randomly culled, leaving 5 malend 5 female offspring. Remaining dams were killed by exsanguination under deepnesthesia and the remaining offspring were killed by rapid decapitation under

nesthesia. At PND 21, which is the prepubertal stage, 10 dams and 30 male and 30emale offspring per group (3 male and 3 female offspring per dam) were subjectedo necropsy as described below. The remaining male and female offspring were keptntil PND 77. At PND 77, all remaining pups were subjected to adult stage necropsys described below. The body weights and food consumption of dams and the body

xicology 38 (2013) 25– 36

weights of pups were determined every three to seven days. Mortality of pups wasexamined daily between PND 2 and PND 77.

On PND 21 and PND 77, animals were weighed and killed by exsanguinationfrom the abdominal aorta under deep anesthesia. Dams were examined for uterineimplantation sites at necropsy on PND 21. Brain, liver and kidneys were collectedat necropsy in 10 male and 10 female offspring per group. Because neurogenesisis influenced by circulating levels of steroid hormones during the estrous cycle[26], female samples taken on PND 21 and PND 77 were preserved without furtheranalysis.

2.3. Determination of cholinesterase (ChE) activity

ChE activity was measured in samples taken from dams on PND 21 (n = 6 pergroup) and male offspring on PND 21 and PND 77 (n = 6 per group for each stage).

Blood samples were collected under anesthesia from the abdominal aorta inblood collection tubes containing heparin sodium. An aliquot of blood was mixedwith distilled water containing 1% Triton X-100 (Sigma–Aldrich Japan K.K., Tokyo,Japan) and hemolyzed for analysis of ChE in total blood. For the calculation of ChEactivity in the RBC, the hematocrit was measured using a hematology analyzer(Advia 120, Siemens Medical Solutions Diagnostics, Tokyo, Japan). The remainingblood was centrifuged to obtain plasma.

The frontal lobe of the brain was removed, weighed, frozen in liquid nitrogenand stored at −80 ◦C until analysis. A brain sample was homogenized in distilledwater containing 1% Triton X-100.

The ChE activities of the blood, plasma and brain samples were analyzed usinga clinical chemistry automatic analyzer (TBA-120FR, Toshiba Medical Systems Cor-poration, Tochigi, Japan) with acetylthiocholine iodide as a substrate.

2.4. Hormone analyses

Blood samples were collected under anesthesia from the abdominal aorta of theremaining 24 male offspring per group on PND 21, and from 10 male offspring pergroup on PND 77. Serum was prepared and stored at −80 ◦C for measurement ofthyroid-stimulating hormone (TSH), triiodothyronine (T3) and thyroxine (T4) con-centrations at Mitsubishi Chemical Medience (Tokyo, Japan).

2.5. Immunohistochemistry and apoptotic cell detection

For immunohistochemical analysis, brains from male offspring killed at PND 21and PND 77 were fixed in Bouin’s solution at room temperature overnight. Sam-ples from 10 male animals from 10 dams (one male per dam) per group weresubjected to analysis at each time point. Coronal slices of 3 �m in thickness at thepositions of −2.2 mm from the bregma embedded in paraffin were prepared forimmunohistochemical staining.

Sections were incubated overnight at 4 ◦C with the antibodies listed in Table 1.To quench endogenous peroxidase, slides were incubated in 0.3% (v/v) hydrogenperoxide in absolute methanol for 30 min. Immunodetection was carried out usinga Vectastain® Elite ABC kit (Vector Laboratories Inc., Burlingame, CA, USA) with3,3′-diaminobenzidine (DAB)/hydrogen peroxide (H2O2) as the chromogen, as pre-viously described [24]. The sections were then counterstained with hematoxylinand coverslipped for microscopic examination.

For evaluation of apoptosis in the SGZ of the dentate gyrus, terminal deoxynu-cleotidyl transferase dUTP nick and labeling (TUNEL) assay was applied to brainsections from the same 10 male offspring per group that were killed on PND 21.Deparaffinized sections were treated with 20 �g/mL proteinase K in phosphatebuffered saline (PBS; pH 7.4) for 15 min at room temperature, and then incubated in3.0% hydrogen peroxide in PBS for 5 min. Detection of apoptotic bodies was carriedout using the Apop Tag® in situ apoptosis detection kit S7100 (Millipore Corporation,Billerica, MA, USA) according to the instructions provided by the manufacturer withDAB/H2O2 as the chromogen.

2.6. Morphometry of immunolocalized and apoptotic cells

Reelin+-immunoreactive interneurons and neuron-specific nuclear protein(NeuN)+ neurons, indicating postmitotic interneurons and glial fibrillary acidic pro-tein (GFAP)-expressing astrocytes distributed in the hilus of the dentate gyrus,were bilaterally counted and normalized for the number per unit area of the hilararea (polymorphic layer) as previously described [17]. Large cornu ammonis 3 neu-rons distributed in this area were easily distinguished from hilar interneurons andexcluded from counting as previously described [17]. Apoptotic bodies as detectedby TUNEL assay, proliferating cells as detected by nuclear immunoreactivity of pro-liferating cell nuclear antigen (PCNA), and paired box gene 6 (Pax6)+, T box brain 2protein (Tbr2) +, and doublecortin (DCX) + cells indicating granule cell lineage werebilaterally counted in the SGZ of the dentate gyrus and normalized to the length ofthe granule cell layer measured as previously described [17]. To examine the effects

of cholinergic stimulation on the neuronal progenitors in the SGZ, Chrm1+ progen-itor cells were bilaterally counted in the SGZ and normalized for the length of thegranule cell layer [20]. For quantitative measurements of each immunoreactive cel-lular component, digital photomicrographs at 200- or 400-fold magnification weretaken using a BX51 microscope (Olympus Optical Co., Ltd., Tokyo, Japan) attached

L. Wang et al. / Reproductive Toxicology 38 (2013) 25– 36 27

Table 1Antibodies used in the study.

Antigen Abbreviatedname

Host species Clonality Clone number Dilution Antigen retrievala Manufacturer (city,state, country)

Reelin – Mouse Monoclonal IgG1 G10 1:1000 None Novus Biological, Inc.(Littleton, CO, USA)

Neuron-specific nuclear protein NeuN Mouse Monoclonal IgG1 A60 1:100 None Millipore Corporation(Temecula, CA, USA)

Paired box gene 6 Pax6 Mouse Monoclonal IgG1 AD2.38 1:500 None Abcam (Cambridge,UK)

T box brain protein 2 Tbr2 Rabbit Polyclonal IgG n.a. 1:500 Autoclaving in antigenretrieval solution

Abcam

Doublecortin DCX Rabbit Polyclonal IgG n.a. 1:1000 None AbcamGlial fibrillary acidic protein GFAP Mouse Monoclonal IgG1 GA5 1:200 None Millipore CorporationProliferating cell nuclear antigen PCNA Mouse Monoclonal IgG2a PC10 1:200 None Dako (Glostrup,

Denmark)Cholinergic receptor, muscarinic 1 Chrm1 Rabbit Polyclonal IgG n.a. 1:200 Autoclaving in antigen

retrieval solutionLifeSpan BioSciences,Inc. (Seattle, WA, USA)

Aas 10

ts(

2

kbtdL5tGcBawcTtamTtchgC

2

sls

TP

AgT

bbreviation: n.a., not available.a Retrieval conditions were autoclaving for 10 min at 121 ◦C. The solution used w

o a DP70 Digital Camera System (Olympus Optical Co., Ltd.), and quantitative mea-urements were performed using the WinROOF image analysis software packageversion 5.7, Mitani Corp., Fukui, Japan).

.7. Real-time RT-PCR

For mRNA expression analysis in the dentate gyrus, brains from male offspringilled at PND 21 were fixed in methacarn solution at 4 ◦C for 8 h, then dehydratedy ice-cold absolute ethanol overnight at 4 ◦C [24]. A coronal brain slice at the posi-ion between −2.2 and −2.8 mm from bregma was prepared, and portions of theentate gyrus were collected using a biopsy punch (Ф1.0 mm, Kai Industries Co.,td., Seki, Japan) and stored in ethanol at −80 ◦C until extraction. Samples from

male offspring from 5 dams (one offspring per dam) per group were subjectedo analysis. Total RNA was extracted with the RNeasy Mini Kit (Qiagen, Hilden,ermany) according to the manufacturer’s instructions. Real-time RT-PCR quantifi-ation of mRNA levels for genes targeting cell proliferation (Pcna), apoptosis (Casp3,ax and Bcl2), progenitor cell population of neuronal lineage (Pax6, Tbr2 and Dcx),nd cholinergic receptor, muscarinic 1 (Chrm1) was performed. First strand cDNAas synthesized from 2 �g of total RNA in the presence of dithiothreitol, deoxynu-

leotide triphosphates, random primers, RNaseOUT and SuperScriptTMIII Reverseranscriptase (Invitrogen Corp., Carlsbad, CA, USA) in a 20 �L total reaction mix-ure. Real-time PCR was performed using the Power SYBR® Green PCR Master Mixnd the Applied Biosystems StepOnePlusTM Real-Time PCR System according to theanufacturer’s protocol. The PCR primers for amplification of target gene shown in

able 2 were designed using Primer Express software (Version 3.0; Applied Biosys-ems Japan Ltd., Tokyo, Japan). The relative differences in gene expression werealculated using threshold cycle (CT) values that were first normalized to those ofousekeeping genes, hypoxanthine-guanine phosphoribosyltransferase (Hprt) andlyceraldehyde 3-phosphate dehydrogenase (Gapdh), and then relative to a controlT value by the 2−��C

T method [27].

.8. Statistical analysis

Numerical data are presented as mean ± SD. Maternal body weights, food con-umption, body and organ weights at necropsy, ChE activity and plasma hormoneevels were analyzed using the individual animal as the experimental unit. Off-pring body weights during the experiment, body and organ weights at necropsy,

able 2rimer sequence for real-time RT-PCR analysis.

Gene Accession No. Forward pri

Casp3 NM 009810 GCTGGACTGBax NM 010921 CGGCGAATTBcl2 NM 009741 CATGTGTGTPcna NM 011045 GCCTGTTCAPax6 NM 013627 TCCCCAGTCTbr2 NM 010136 CTCCCCCCTCDcx NM 001110222 AGCCCAGGCChrm1 NM 001112697 CAGTCCCAAHprt NM 013556 TTGTATACCGapdh NM 008084 TGTCAAGCT

bbreviations: Bax, BCL2-associated X protein; Bcl2, B cell leukemia/lymphoma 2; Casp3lyceraldehyde-3-phosphate dehydrogenase; Hprt, hypoxanthine guanine phosphoribo-box brain protein 2.

mM citrate buffer (pH 6.0).

immunohistochemical analyses, TUNEL-assays, ChE activity, serum hormone lev-els and mRNA levels by real-time RT-PCR were analyzed using the litter as theexperimental unit. For comparison of the numerical data between the control andtreatment groups, Bartlett’s test for equal variance was used to determine whetherthe variance was homogenous between the groups. If the variance was homogenous,numerical data was assessed using Dunnett’s test to compare between the controland each treated groups. If a significant difference in variance was observed, Steel’stest [28] was used instead.

All analyses were performed using the Excel Statistics 2008 software package(Social Survey Research Information Co. Ltd., Tokyo, Japan).

3. Results

All comparisons were made between the 0 ppm group and eachtreatment group.

3.1. Maternal parameters

During the gestation and lactation periods, CPF exposure did notaffect body weight, except for a transient decrease in the 100 ppmgroup on PND 4 (Table 3). There were no statistically significantdifferences in food consumption during the gestation period. Dur-ing the lactation period, there was a significant decrease in foodconsumption on PND 19 in all treatment groups (Table 3). Meandaily intakes of CPF by dams during the gestation period were0.6 ± 0.1, 3.2 ± 1.1, and 16.5 ± 7.0 mg/kg body weight-day at 4, 20and 100 ppm, respectively. During the lactation period daily CPF

intakes were 1.7 ± 0.4, 8.3 ± 2.0, 38.6 ± 8.0 mg/kg body weight-dayat 4, 20 and 100 ppm, respectively.

CPF treatment did not affect the length of gestation, number ofimplantation sites in the uterus or number of live births (Table 4).

mer (5′ → 3′) Reverse primer (5′ → 3′)

TGGCATTGAGA GGTATCTTCTGGCAAGCCATCTGGAGATGAACT GTCCACGTCAGCAATCATCCTGGAGAGCGTCAA GATGCCGGTTCAGGTACTCAGTCCTAACGTTTGC GGAGACAGTGGAGTGGCTTTTGAGACCTCCTCATA TCATAACTCCGCCCATTCACTCATCAAGTCT TCTCTTGCAAGCGCTGTTGTACCAATGC TTTGCGTCTTGGTCGTTACCTCATCACCGTCTT TCCCGATGAATGCCACTTGTAATCATTATGCCGAGG CAGAGGGCCACAATGTGATGCATTTCCTGGTATGA TCTTACTCCTTGGAGGCCATGTA

, caspase 3; Chrm1, cholinergic receptor, muscarinic 1; Dcx, doublecortin; Gapdh,syl transferase; Pcna, proliferating cell nuclear antigen; Pax6, paired box 6; Tbr2,

28 L. Wang et al. / Reproductive Toxicology 38 (2013) 25– 36

Table 3Body weights and food consumption in dams exposed to CPF from mid-gestation to the end of lactation.

CPF in diet (ppm)

0 4 20 100

No. of dam examined 10 10 10 10Body weight (g)GD 2 31.2 ± 2.7a 30.9 ± 1.7 29.7 ± 1.8 30.0 ± 2.4GD 5 35.1 ± 3.3 36.0 ± 2.0 35.6 ± 3.1 35.2 ± 2.5GD 10 41.2 ± 4.0 41.4 ± 2.3 41.0 ± 3.8 40.6 ± 2.8GD 15 64.2 ± 7.6 64.8 ± 4.7 67.3 ± 6.2 65.3 ± 5.0PND 1 45.9 ± 4.8 45.3 ± 1.8 46.1 ± 4.1 45.3 ± 2.4PND 4 48.7 ± 5.0 47.5 ± 2.3 47.3 ± 3.3 44.5 ± 2.9*

PND 8 46.5 ± 5.9 44.8 ± 2.6 45.6 ± 7.3 44.1 ± 3.5PND 12 45.0 ± 4.1 44.0 ± 1.2 46.0 ± 5.8 42.7 ± 2.4PND 16 42.2 ± 4.1 40.5 ± 1.9 41.6 ± 5.0 39.6 ± 4.0PND 19 41.3 ± 3.4 39.8 ± 1.4 41.4 ± 5.8 39.0 ± 2.5PND 21 41.2 ± 3.8 40.7 ± 1.4 42.2 ± 5.2 39.7 ± 2.0

Food consumption (g/animal/day)GD 5 5.9 ± 1.1 6.5 ± 0.7 6.5 ± 1.0 7.6 ± 2.1GD 10 9.2 ± 3.1 7.3 ± 0.4 7.7 ± 1.8 7.8 ± 1.4GD 15 6.6 ± 0.7 6.5 ± 1.6 7.1 ± 0.5 6.8 ± 0.5PND 1 9.8 ± 1.5 9.7 ± 1.2 9.9 ± 0.7 10.2 ± 1.8PND 4 17.1 ± 1.8 17.8 ± 2.6 17.0 ± 1.6 17.5 ± 2.8PND 8 17.0 ± 1.4 16.4 ± 1.4 16.1 ± 1.8 17.2 ± 0.9PND 12 14.5 ± 1.7 15.1 ± 1.1 14.9 ± 2.5 15.1 ± 2.1PND 16 15.7 ± 1.1 15.7 ± 1.4 15.9 ± 1.4 16.1 ± 1.5PND 19 22.4 ± 0.9 20.5 ± 1.1* 19.8 ± 1.6* 20.8 ± 1.7*

PND 21 25.4 ± 0.9 24.5 ± 1.1 24.8 ± 1.6 24.8 ± 1.7

A

2ir

3

gPPCP

wd

TR

A

bbreviations: CPF, chlorpyrifos; GD, gestation day; PND, postnatal day.a Mean ± SD.* P < 0.05 compared with the 0 ppm group by Dunnett’s test or Steel’s test.

There were no differences in body weight at necropsy on PND1 among the groups. With regard to organ weights, significant

ncreases were observed in relative liver weights at 4 ppm and theelative kidney weights at 100 ppm (Table 4).

.2. Body and organ weights of offspring

Body weights of male pups were significantly lower in the 4 ppmroup between PND 49 and PND 70, in the 20 ppm group betweenND 21 and PND 70 and in the 100 ppm group between PND 28 andND 70 (Table 5). These changes were no longer present on PND 77.PF exposure did not affect body weights in female pups between

ND 1 and PND 77 (Table 5).

On necropsy at PND 21, a dose-unrelated decrease in bodyeight was observed in male pups of the 20 ppm group, while noifferences in body weight were observed in female pups at any

able 4eproductive parameters and body and organ weights at PND 21 in dams exposed to CPF

CPF in diet (ppm)

0 4

No. of dams examined 10 10No. of implantation sites 14.70 ± 2.21a 14Length of gestation (day) 20.30 ± 0.42 20No. of live offspring 12.80 ± 2.04 12

Necropsy at PND 21Body weight 41.20 ± 3.80 40Brain (g) 0.49 ± 0.02 0(g/100 g BW) 1.20 ± 0.10 1Liver (g) 2.66 ± 0.50 2(g/100 g BW) 6.42 ± 0.84 7Kidneys (g) 0.50 ± 0.05 0(g/100 g BW) 1.20 ± 0.09 1

bbreviations: BW, body weight; CPF, chlorpyrifos; PND, postnatal day.a Mean ± SD.* P < 0.05 compared with the 0 ppm group by Dunnett’s test or Steel’s test.

** P < 0.01 compared with the 0 ppm group by Dunnett’s test or Steel’s test.

dose. Significant increases in relative brain and liver weights andin absolute and relative kidney weights were observed in male pupsof the 20 ppm group (Table 6). In female pups, there were no sig-nificant differences in organ weights among CPF exposure groups(Table 6).

On PND 77, there were no statistically significant differencesin body, brain, liver or kidney weights in any treatment group(Table 6).

3.3. Serum concentrations of thyroid-related hormones in maleoffspring

On PND 21, dose-unrelated decreases were observed in serum

concentrations of T3 and T4 in the 4 ppm group (Table 7). On PND77, a significant increase was observed in serum T4 concentrationin the 100 ppm group. CPF exposure did not affect serum TSH con-centrations on either PND 21 or PND 77 (Table 7).

from mid-gestation to the end of lactation.

20 100

10 10.70 ± 1.83 15.10 ± 1.66 14.00 ± 2.40.30 ± 0.42 20.20 ± 0.48 20.30 ± 0.42.70 ± 1.49 14.00 ± 1.94 13.00 ± 2.26

.72 ± 1.40 42.20 ± 5.21 39.67 ± 2.04

.48 ± 0.02 0.49 ± 0.01 0.50 ± 0.02

.19 ± 0.07 1.16 ± 0.11 1.26 ± 0.07

.99 ± 0.41 3.01 ± 0.35 2.73 ± 0.44

.32 ± 0.86* 7.22 ± 1.10 6.87 ± 0.96

.52 ± 0.03 0.51 ± 0.03 0.53 ± 0.06

.29 ± 0.06 1.21 ± 0.10 1.33 ± 0.14**

L. Wang et al. / Reproductive Toxicology 38 (2013) 25– 36 29

Table 5Body weight changes in offspring exposed maternally to CPF in the diet from mid-gestation to the end of lactation.

CPF in diet (ppm)

0 4 20 100

Body weight (g)Males

No. of offspring examineda 50 50 50 50PND 1 2.4 ± 0.2c 2.5 ± 0.3 2.5 ± 0.2 2.5 ± 0.3PND 4 4.0 ± 0.4 4.0 ± 0.5 4.1 ± 0.3 4.1 ± 0.6PND 8 6.3 ± 1.4 5.9 ± 1.0 5.9 ± 1.2 6.0 ± 0.9PND 12 7.8 ± 0.6 7.6 ± 0.8 7.6 ± 0.5 7.5 ± 0.5PND 16 9.4 ± 0.8 9.1 ± 0.9 8.9 ± 0.5 8.9 ± 0.4PND 19 11.5 ± 0.6 10.8 ± 0.9 10.8 ± 0.8 10.9 ± 0.9PND 21 11.3 ± 0.7 11.1 ± 0.9 10.2 ± 1.0* 11.3 ± 1.1

No. of offspring examinedb 20 20 20 20PND 28 20.8 ± 1.2 20.6 ± 5.0 16.1 ± 0.3* 16.4 ± 0.4*

PND 35 26.0 ± 0.4 25.8 ± 0.8 25.2 ± 0.3* 25.2 ± 0.3*

PND 42 32.5 ± 2.6 31.8 ± 0.9 31.0 ± 1.0* 31.2 ± 1.3*

PND 49 40.2 ± 2.8 35.4 ± 1.1* 35.0 ± 1.4* 35.6 ± 0.9*

PND 56 43.2 ± 2.8 39.4 ± 1.8* 39.4 ± 1.3* 39.2 ± 0.6*

PND 63 44.6 ± 3.3 41.1 ± 1.4* 41.1 ± 1.3* 41.0 ± 0.6*

PND 70 46.7 ± 4.8 42.4 ± 0.9* 42.3 ± 1.8* 42.3 ± 0.5*

PND 77 45.8 ± 2.0 44.5 ± 1.7 45.7 ± 3.3 44.3 ± 3.3Females

No. of offspring examineda 50 50 50 50PND 1 2.4 ± 0.2 2.4 ± 0.3 2.5 ± 0.2 2.4 ± 0.3PND 4 4.0 ± 0.4 4.1 ± 0.5 4.0 ± 0.3 4.1 ± 0.6PND 8 7.2 ± 0.9 7.5 ± 1.6 7.5 ± 1.3 7.2 ± 1.3PND 12 7.8 ± 0.9 8.1 ± 0.7 7.3 ± 2.3 7.9 ± 0.5PND 16 9.0 ± 0.5 9.0 ± 0.7 8.9 ± 0.5 9.0 ± 0.5PND 19 11.3 ± 0.7 10.9 ± 0.7 10.7 ± 1.0 11.1 ± 0.9PND 21 12.1 ± 0.9 10.8 ± 1.8 11.1 ± 1.5 12.0 ± 1.1

No. of offspring examinedb 20 20 20 20PND 28 15.2 ± 5.1 15.9 ± 2.8 15.5 ± 0.5 16.0 ± 0.8PND 35 24.8 ± 1.1 23.4 ± 1.3 24.1 ± 2.2 24.6 ± 1.0PND 42 28.8 ± 0.7 27.5 ± 2.0 29.3 ± 2.7 27.6 ± 1.4PND 49 32.0 ± 0.5 32.5 ± 5.1 31.1 ± 2.6 31.2 ± 0.6PND 56 33.5 ± 0.6 31.3 ± 1.8 32.3 ± 2.6 32.6 ± 0.8PND 63 34.5 ± 0.7 32.2 ± 1.3 32.5 ± 3.0 33.8 ± 1.3PND 70 36.4 ± 1.5 33.1 ± 2.1 34.0 ± 2.7 35.1 ± 1.3PND 77 37.3 ± 5.5 35.6 ± 3.8 32.7 ± 2.4 34.6 ± 2.4

Abbreviations: CPF, chlorpyrifos; PND, postnatal day.a The same 5 male and 5 female offspring per dam (n = 10/group) were used for body weight measurements between PND 1 and PND 21.

ody w

3

oa(

wpAfocR

3o

SwSSo2

b The same 2 male and 2 female offspring per dam (n = 10/group) were used for bc Mean ± SD.* P < 0.05 compared with the 0 ppm group by Dunnett’s test or Steel’s test.

.4. ChE activity in dams and male offspring

In dams on PND 21, significant dose-dependent decreases werebserved in ChE activity in RBC and plasma at ≥4 ppm, while ChEctivity in the brain (forebrain) was only decreased at 100 ppmTable 8).

In male offspring on PND 21, a significant dose-related decreaseas observed in ChE activity in RBC at ≥4 ppm, while ChE activity inlasma was decreased at ≥4 ppm without clear dose-dependence.

significant decrease was also observed in ChE activity in theorebrain at 100 ppm. On PND 77, a significant decrease wasbserved in plasma ChE activity in all CPF-exposed groups withoutlear dose-dependence. CPF exposure did not affect ChE activity inBC or the brain at PND 77 (Table 8).

.5. Proliferating and apoptotic cell indices in the SGZ in maleffspring

Both PCNA+ proliferating cells and TUNEL+ apoptotic cells in theGZ were sparsely observed in the SGZ on PND 21 (Fig. 1). There

+

ere no significant differences in the number of PCNA cells in theGZ among all dosed groups on both PND 21 and PND 77 (Fig. 1A).imilarly, no significant differences were observed in the numberf TUNEL+ cells in the SGZ among the CPF-exposed groups on PND1 (Fig. 1B).

eight measurements between PND 28 and PND 77.

3.6. Neuronal progenitors and Chrm1 distribution in the SGZ inmale offspring

With regard to neuronal stem and progenitor cell markers, Pax6and Tbr2 expressions were observed in the nuclei of a small popu-lation of cells located within the SGZ (Fig. 2A–D). DCX expressionwas observed in the cytoplasm of a large population of cells locatedwithin the SGZ (Fig. 2E and F). Chrm1+ cells were sparse in the SGZ(Fig. 2G).

On PND 21, CPF exposure did not affect the number of Pax6+ orTbr2+ cells (Fig. 2A and C), while a significant decrease was foundin the number of DCX+ cells at ≥20 ppm (Fig. 2E). There was no sig-nificant difference in the number of Chrm1+ cells in the SGZ amongCPF-exposed groups on PND 21 (Fig. 2G). On PND 77, the numbersof progenitor cells immunoreactive for the neuronal stage-definingmarkers examined here were reduced compared with PND 21;however, no significant changes were observed in the numbers ofPax6+, Tbr2+, and DCX+ cells among CPF-exposed groups (Fig. 2B,D and F).

3.7. Distribution of neurons and astrocytes in the dentate hilus of

male offspring

Reelin+ cells, indicative of GABAergic interneurons, weresparsely distributed in the hilus of the dentate gyrus, as previously

30 L. Wang et al. / Reproductive Toxicology 38 (2013) 25– 36

Table 6Body and organ weights at prepubertal and adult necropsies of offspring exposed maternally to CPF in the diet from mid-gestation to the end of lactation.

CPF in diet (ppm)

0 4 20 100

PND 21No. of male offspring examined 10 10 10 10

Body weight 11.29 ± 0.67a 11.08 ± 0.88 10.21 ± 1.02* 11.34 ± 1.12Brain (g) 0.43 ± 0.01 0.40 ± 0.01 0.43 ± 0.04 0.44 ± 0.02

(g/100 g BW) 3.77 ± 0.27 3.70 ± 0.19 4.55 ± 0.32** 3.79 ± 0.44Liver (g) 0.45 ± 0.04 0.45 ± 0.06 0.48 ± 0.09 0.45 ± 0.05

(g/100 g BW) 3.98 ± 0.25 4.01 ± 0.27 4.63 ± 0.54** 3.96 ± 0.12Kidneys (g) 0.17 ± 0.01 0.17 ± 0.02 0.21 ± 0.06* 0.18 ± 0.02

(g/100 g BW) 1.53 ± 0.09 1.55 ± 0.11 2.06 ± 0.47** 1.54 ± 0.10No. of female offspring examined 10 10 10 10

Body weight 12.07 ± 0.85 10.80 ± 1.77 11.07 ± 1.52 11.96 ± 1.12Brain (g) 0.42 ± 0.01 0.40 ± 0.02 0.43 ± 0.05 0.43 ± 0.01

(g/100 g BW) 3.54 ± 0.27 3.70 ± 0.20 3.90 ± 0.37 3.66 ± 0.27Liver (g) 0.49 ± 0.05 0.44 ± 0.04 0.46 ± 0.07 0.49 ± 0.07

(g/100 g BW) 4.08 ± 0.21 4.06 ± 0.20 4.16 ± 0.20 4.13 ± 0.34Kidneys (g) 0.19 ± 0.02 0.16 ± 0.01 0.17 ± 0.04 0.19 ± 0.02

(g/100 g BW) 1.53 ± 0.11 1.52 ± 0.11 1.54 ± 0.31 1.57 ± 0.10PND 77No. of male offspring examined 10 10 10 10

Body weight 45.77 ± 2.02 44.50 ± 1.74 45.68 ± 3.30 44.27 ± 3.27Brain (g) 0.49 ± 0.02 0.48 ± 0.02 0.49 ± 0.02 0.47 ± 0.02

(g/100 g BW) 1.06 ± 0.06 1.08 ± 0.08 1.07 ± 0.07 1.07 ± 0.11Liver (g) 2.15 ± 0.26 2.03 ± 0.19 2.08 ± 0.21 2.06 ± 0.16

(g/100 g BW) 4.69 ± 0.46 4.56 ± 0.33 4.54 ± 0.22 4.66 ± 0.26Kidneys (g) 0.62 ± 0.05 0.61 ± 0.07 0.66 ± 0.04 0.57 ± 0.04

(g/100 g BW) 1.34 ± 0.10 1.36 ± 0.16 1.44 ± 0.09 1.30 ± 0.12No. of female offspring examined 10 10 10 10

Body weight 37.25 ± 5.54 35.62 ± 3.77 35.71 ± 2.38 34.63 ± 2.38Brain (g) 0.51 ± 0.02 0.49 ± 0.03 0.50 ± 0.02 0.49 ± 0.02

(g/100 g BW) 1.40 ± 0.19 1.40 ± 0.19 1.40 ± 0.16 1.41 ± 0.10Liver (g) 1.68 ± 0.32 1.62 ± 0.27 1.63 ± 0.16 1.60 ± 0.15

(g/100 g BW) 4.48 ± 0.46 4.52 ± 0.33 4.54 ± 0.22 4.60 ± 0.26Kidneys (g) 0.42 ± 0.06 0.39 ± 0.03 0.39 ± 0.02 0.41 ± 0.06

(g/100 g BW) 1.12 ± 0.10 1.11 ± 0.09 1.09 ± 0.10 1.17 ± 0.18

Abbreviations: BW, body weight; CPF, chlorpyrifos; PND, postnatal day.

rmd(d

iada

TS

A

a Mean ± SD.* P < 0.05 compared with the 0 ppm group by Dunnett’s test or Steel’s test.

** P < 0.01 compared with the 0 ppm group by Dunnett’s test or Steel’s test.

eported in rats [17,29] (Fig. 3A and B). NeuN, a postmitotic neuronarker, was expressed in the nuclei of neurons located within the

entate hilus, as well as in granule cells of the granule cell layerFig. 3C and D). GFAP+-expressing astrocytes were predominantlyistributed within the hilus (Fig. 3E and F).

On PND 21, there were no statistically significant differences

n the numbers of reelin+ cells and GFAP+ astrocytes in the hilusmong CPF-exposed groups (Fig. 3A, E). However, a significantecrease in the number of NeuN+ cells was observed in the hilust 100 ppm (Fig. 3C). On PND 77, there were no changes in the

able 7erum thyroid-related hormone levels of offspring exposed maternally to CPF in the diet

CPF in diet (ppm)

0 4

PND 21No. of male offspring examined 24 (10)a 24

T3 (ng/dl) 35.60 ± 4.83b 29T4 (�g/dl) 3.30 ± 0.33 2TSH (ng/mL) 0.028 ± 0.013 0

PND 77No. of male offspring examined 10 10

T3 (ng/dl) 64.00 ± 4.90 61T4 (�g/dl) 5.26 ± 0.70 5TSH (ng/mL) 0.022 ± 0.011 0

bbreviations: CPF, chlorpyrifos; PND, postnatal day; T3: triiodothyronine; T4: thyroxine;a Number in parenthesis represents the pooled samples: 2–3 samples.b Mean ± SD.* P < 0.05 compared with the 0 ppm group by Dunnett’s test or Steel’s test.

** P < 0.01 compared with the 0 ppm group by Dunnett’s test or Steel’s test.

distributions of reelin+ cells and NeuN+ cells after CPF exposure(Fig. 3B and D). The number of GFAP+ cells was significantlydecreased at 20 ppm (Fig. 3F).

3.8. Transcript expression in the dentate gyrus of male offspring

at PND 21

There were no changes in the transcript expression levelsof Pcna, Casp3, Bax, Bcl2, Pax6, Tbr2, and Chrm1 following CPF

from mid-gestation to the end of lactation.

20 100

(10) 24 (10) 24 (10).80 ± 3.11* 33.40 ± 2.51 33.40 ± 3.51.46 ± 0.55** 2.88 ± 0.22 2.90 ± 0.26.020 ± 0.013 0.026 ± 0.005 0.026 ± 0.009

10 10.80 ± 4.02 62.60 ± 5.27 65.80 ± 3.03.74 ± 0.48 5.22 ± 0.38 6.62 ± 0.67**

.038 ± 0.013 0.030 ± 0.021 0.038 ± 0.008

TSH: thyroid-stimulating hormone.

L. Wang et al. / Reproductive Toxicology 38 (2013) 25– 36 31

Table 8ChE levels in RBC, plasma and brain (forebrain) of dams and offspring after maternal exposure to CPF in the diet from mid-gestation to the end of lactation.

CPF in diet (ppm)

0 4 20 100

PND 21No. of dam examined 6 6 6 6

RBC (IU/l) 4325 ± 173a 3081 ± 577** 2734 ± 304** 1826 ± 307**

Plasma (IU/l) 8287 ± 1026 4461 ± 1395** 4167 ± 535** 2266 ± 711**

Brain (IU/g) 20.7 ± 1.3 19.1 ± 1.8 20.1 ± 1.7 7.4 ± 0.9**

No. of male offspring examined 6 6 6 6RBC (IU/l) 3398 ± 277 2428 ± 777** 2239 ± 189** 1377 ± 222**

Plasma (IU/l) 4196 ± 295 2503 ± 678** 2686 ± 309** 939 ± 240**

Brain (IU/g) 16.0 ± 1.1 15.5 ± 0.9 16.0 ± 0.8 11.0 ± 1.9**

PND 77No. of male offspring examined 6 6 6 6

RBC (IU/l) 2779 ± 741 3034 ± 509 2689 ± 391 2852 ± 248Plasma (IU/l) 5091 ± 1614 3590 ± 740* 3719 ± 476* 3719 ± 476*

Brain (IU/g) 22.9 ± 1.2 20.0 ± 5.9 23.3 ± 1.6 22.4 ± 1.8

Abbreviations: ChE, cholinesterase; CPF, chlorpyrifos; PND, postnatal day; RBC, red blood cells.a Mean ± SD.* P < 0.05 compared with the 0 ppm group by Dunnett’s test or Steel’s test.

** P < 0.01 compared with the 0 ppm group by Dunnett’s test or Steel’s test.

Fig. 1. Distribution of proliferating cells and apoptotic cells in the SGZ of the hippocampal dentate gyrus in male offspring exposed maternally to CPF from GD 10 to PND 21.( tic celg lls/une

ed

4

Cow12aooi2e

A) PCNA+ proliferating progenitor cells at PND 21 and PND 77. (B) TUNEL+ apoptoroup (right) at PND 21 magnification 400×. Graphs show the number of positive cexpressed as the mean + SD.

xposure on PND 21. With regard to Dcx, transcript levelsecreased at ≥20 ppm at this time point (Table 9).

. Discussion

Inhibition of ChE is considered to be the most sensitive effect ofPF in all animal species evaluated, including humans, regardlessf the route or duration of exposure [30]. In the present study,e performed CPF exposure through the maternal diet at up to

00 ppm (16.5–38.6 mg/kg body weight-day) from GD 10 to PND1 using mice. As expected, RBC ChE activity was decreased in

dose-dependent manner both in dams and in male offspringn PND 21 at doses ≥4 ppm. While a clear dose effect was not

bserved in male offspring, significant decreases were also foundn plasma ChE activity both in dams and in male offspring on PND1. This effect was sustained to PND 77 in the male offspring. How-ver, inhibition of plasma ChE activity is considered to be of low

ls at PND 21. Representative images from the 0 ppm group (left) and the 100 ppmit length (mm) of the SGZ of bilateral hemispheres at PND 21 or PND 77. Values are

toxicological significance [8]. Forebrain ChE activity was alsodecreased in dams and male offspring at 100 ppm only on PND21. Therefore, with regard to the inhibition of ChE activity, thetoxicologically critical dose level was determined to be 4 ppmfor dams and offspring (0.6–1.7 mg/kg body weight-day). In astudy of CPF exposure by oral gavage during GD 6–PND 10 todams resulted in ChE inhibition in the brain, heart, plasma andRBC only at high dose (5 mg/kg-day) in offspring [31]. In spiteof exposure via milk, the ChE levels of all tissues of high-dosagepups rapidly returned to near control levels by PND 5, and theseinhibitions all disappeared at PND 22 on weaning. With regard tothe effect of subcutaneous injections of CPF, doses of 6.25, 12.5, or25 mg/kg-day from GD12 to GD 19 to dams resulted in inhibition of

brain ChE in offspring; however, the inhibition rapidly diminishedat PND 3 [32]. While the reason for the gap on the reversibility ofChE inhibition between our study and other studies is not clear, ourstudy employed continuous exposure regimen of CPF with longer

32 L. Wang et al. / Reproductive Toxicology 38 (2013) 25– 36

Fig. 2. Distribution of immunoreactive cells for Pax6, Tbr2, DCX and Chrm1 in the SGZ of the hippocampal dentate gyrus at PND 21 and PND 77 in male offspring exposedmaternally to CPF from GD 10 to PND 21. (A) Pax6+ cells at PND 21. (B) Pax6+ cells at PND 77. (C) Tbr2+ cells at PND 21. (D) Tbr2+ cells at PND 77. (E) DCX+ cells at PND 21.(F) DCX+ cells at PND 77. (G) Chrm1+ cells at PND 21. Representative images from the 0 ppm group (left) and the 100 ppm group (right) at PND 21 or PND 77 are shown forall molecules. magnification 400×. Graphs show the numbers of immunoreactive cells for Pax6, Tbr2, DCX or Chrm1/unit length (mm) of the SGZ of bilateral hemispheres atPND 21 or PND 77. Values are expressed as the mean + SD. *P < 0.05 compared with the 0 ppm group by Dunnett’s or Steel’s test.

L. Wang et al. / Reproductive Toxicology 38 (2013) 25– 36 33

Fig. 3. Distribution of immunoreactive cells for reelin, NeuN and GFAP in the hilus of the hippocampal dentate gyrus at PND 21 and PND 77 in male offspring exposedmaternally to CPF from GD 10 to PND 21. (A) Reelin+ cells at PND 21. (B) Reelin+ cells at PND 77. (C) NeuN+ cells at PND 21. (D) NeuN+ cells at PND 77. (E) GFAP+ cells at PND21. (F) GFAP+ cells at PND 77. Representative images from the 0 ppm group (left) and the 100 ppm group (right) at PND 21 and PND 77 are shown for all molecules. (A), (B),(E) and (F) magnification 400×. (C) and (D) Magnification 200×. Graphs show the number of immunoreactive cells for reelin, NeuN or GFAP/unit area (mm2) of the hilus ofbilateral hemispheres at PND 21 and PND 77. Values are expressed as the mean + SD. *P < 0.05 compared with the 0 ppm group by Dunnett’s or Steel’s test.

34 L. Wang et al. / Reproductive Toxicology 38 (2013) 25– 36

Table 9Real-time RT-PCR data in the hippocampal dentate gyrus on PND 21.

Relative transcript level normalized to Hprt Relative transcript level normalized to Gapdh

CPF in diet (ppm) CPF in diet (ppm)

0 4 20 100 0 4 20 100

Casp3 1.02 ± 0.23a 1.03 ± 0.45 1.05 ± 0.33 1.02 ± 0.43 1.03 ± 0.35 1.09 ± 0.37 1.06 ± 0.35 1.09 ± 0.27Bax 1.01 ± 0.14 1.08 ± 0.47 1.06 ± 0.24 1.05 ± 0.34 1.08 ± 0.29 1.04 ± 0.39 1.06 ± 0.19 1.04 ± 0.25Bcl2 1.00 ± 0.05 1.03 ± 0.42 1.05 ± 0.15 1.05 ± 0.25 1.03 ± 0.09 1.08 ± 0.10 0.93 ± 0.19 1.08 ± 0.12Pcna 1.00 ± 0.04 1.03 ± 0.48 1.05 ± 0.14 1.06 ± 0.12 1.13 ± 0.06 1.16 ± 0.25 1.12 ± 0.10 1.11 ± 0.05Pax6 1.05 ± 0.40 1.03 ± 0.26 1.05 ± 0.20 1.08 ± 0.10 1.03 ± 0.40 1.06 ± 0.54 1.03 ± 0.20 1.02 ± 0.14Tbr2 1.01 ± 0.14 1.02 ± 0.20 1.06 ± 0.20 1.05 ± 0.12 1.03 ± 0.40 1.06 ± 0.24 1.08 ± 0.42 1.04 ± 0.14Dcx 1.06 ± 0.11 1.02 ± 0.21 0.78 ± 0.10* 0.82 ± 0.07* 1.02 ± 0.10 1.00 ± 0.26 0.86 ± 0.08* 0.89 ± 0.06*

Chrm1 1.00 ± 0.06 1.06 ± 0.06 0.98 ± 0.12 1.05 ± 0.06 1.12 ± 0.04 1.09 ± 0.03 1.07 ± 0.04 1.09 ± 0.06

Abbreviations: Bax, BCL2-associated X protein; Bcl2, B cell leukemia/lymphoma 2; Casp3, caspase 3; Chrm1, cholinergic receptor, muscarinic 1; Dcx, doublecortin; Gapdh,glyceraldehyde-3-phosphate dehydrogenase; Hprt, hypoxanthine guanine phosphoribosyl transferase; Pcna, proliferating cell nuclear antigen; Pax6, paired box 6; Tbr2,T

T-PCR

eeo

11ldtllobcnanwmftmcmaa

prsttdiwtarSeOenhami

-box brain protein 2.a Mean ± SD (n = 5) relative to the expression levels in 0 ppm group. Real-time R* P < 0.05 compared with the 0 ppm group by Dunnett’s test or Steel’s test.

xposure period than other studies. It is reported that dietary CPFxposure for 6 months to rats resulted in sustained urine excretionf metabolites as measured at 4 months later [8].

Ambali et al. [5] found that repeated oral administration of5.9 mg/kg CPF by gavage in pregnant mice from GD 6 to GD5 prolonged the gestation period, increased post-implantation

osses and reduced survival of pups. However, in the present study,evelopmental exposure to CPF through the maternal diet at upo 100 ppm (16.5–38.6 mg/kg body weight-day) did not affect theength of gestation, number of implantation sites in the uterus orive births. We did not find any dose-related changes in body weightr food consumption in the dams except for a transient decrease inody weight at 100 ppm on PND 4 and a transient decrease in foodonsumption at all doses on PND 19. Male offspring showed onlyon-dose-related decreases in body weight at 20 ppm on weaningnd at ≥4 ppm at sexual maturity. With regard to organ weights,on-dose-related changes in absolute kidney weight and relativeeights of the brain, liver and kidneys were observed at 20 ppm inale pups on PND 21. Because of the lack of effects on reproductive

unction and sporadic changes in body weight and food consump-ion of dams, we suggest that there were no relevant toxicological

aternal effects of CPF exposure, except on ChE activity, as dis-ussed above. However, the observed changes in body weight inale pups suggest some effects of CPF exposure on the offspring,

lthough there was no clear dose relation and any effects had dis-ppeared on PND 77.

Increasing evidences suggest that effects of CPF extend fromrenatal to postnatal exposure. The wide window of vulnerabilityeflects a shift in the targets for CPF: initially, neurons, and sub-equently, astrocytes, which develop much later [13]. The findinghat CPF targets astrocytes as well as neurons provides a par-ial explanation for the exceptionally long period in which brainevelopment is sensitive to this agent in rats. Of note, astrocytes

n males were preferentially targeted during postnatal exposureshile those in females experienced delayed effects following gesta-

ional exposure, commensurate with behavioral outcomes [13]. It islso reported that changes in GFAP expression differ between brainegions depending on the time frame of CPF exposure in rats [33].ubcutaneous CPF injections during PND 11–14 increased GFAPxpression in multiple brain regions of male rats on PND 30 [33].n the other hand, CPF injections during PND 1–4 increased GFAPxpression only in the cerebellum of male rats. However, we didot observe any dose-related increases of GFAP+ astrocytes in the

ilar region of the dentate gyrus of male mice by CPF-exposuret both PND 21 and PND 77. Species difference between rats andice or difference in the treatment regimen, i.e., subcutaneous

njections versus dietary administration, may be responsible for

analysis of Hprt and Gapdh was performed for the analysis of each target gene.

the discrepancy between the previous rat study and our mousestudy.

In the present study, we found that maternal exposure toCPF induced reversible reduction of DCX+ cells, which representtype-2b and type-3 progenitors and postmitotic immature granulecell populations [34], in the SGZ of male offspring at ≥20 ppm onPND 21. Because Tbr2+ cells, representing type-2 progenitor cells[16], were not affected by CPF exposure, the decreased populationof DCX+ cells most likely represents a decrease in type-3 progen-itors and/or postmitotic immature granule cells. Therefore, wesuggest that developmental exposure to CPF transiently suppressesmaturation of late-stage granule cell lineages in mice, which issimilar to our previous results regarding developmental exposureto acrylamide in rats [23]. With regard to the possible hypothy-roid effect on neurogenesis [14], we only found dose-unrelateddecreases in serum concentrations of T3 and T4 at 4 ppm on PND 21,which indicates that there was no toxicologically relevant effect. DeAngelis et al. [35] reported a non-dose-related decrease in serum T4in adult offspring after prenatal and/or postnatal exposure to CPF.

The cholinergic system may act on dentate gyrus neurogen-esis directly and/or indirectly. An indirect effect of cholinergicinput on neurogenesis has been proposed based on the observa-tion that lesions in the basal forebrain cholinergic system reducedthe expression of brain-derived neurotrophic factor [36], whichpromotes neurogenesis [36,37]. A direct effect of the cholinergicsystem has been reported by Kaneko et al. [38], who suggestedthat neuronal progenitor cells, expressing various acetylcholinereceptor subtypes in the adult mouse dentate gyrus, are in con-tact with cholinergic fibers, and are increased by treatment withChE inhibitors. As Chrm1 is localized on newborn progenitor cellsin the dentate gyrus [38], and a functional relationship with pro-genitor cell survival has been postulated in rats [39], we examinedthe Chrm1 distribution in the SGZ. However, we did not observeany differences in the numbers of Chrm1+ cells in the SGZ afterCPF exposure on PND 21. Thus, the decrease in DCX+ cells in theSGZ was unlikely to be related to cholinergic stimulation causedby inhibition of ChE activity. Conversely, it has been reported thatneonatal rats treated with CPF had decreased DNA synthesis [40]and changed expression levels of genes related to cell cycle andapoptosis in the brain [41]. It was concluded that these changeswere unrelated to the activation of cholinergic stimulation becauseeffects were observed in the absence of inhibition of ChE activity[41]. Instead, a direct effect of CPF was hypothesized. Therefore, the

decrease in DCX+ cells found in the present study may be causedby a direct effect of CPF. Target mechanisms may be DNA synthesisand cell cycle in the brain [41]. While the dose response was non-monotonic and unrelated to that of ChE inhibition, prenatal CPF

tive To

eb

toeWbd[iDwatacoeodTs

5

ClinhHtogsSabwa(lmabilf

C

e

A

Rttt

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

L. Wang et al. / Reproduc

xposure resulted in fluctuations in cell cycle genes in the wholerain tissue of mice at GD 18 [42].

In addition, we found reversible reduction of NeuN + postmi-otic neurons in the dentate hilus of male offspring at 100 ppmn PND 21. In the rodent dentate hilus, there are approximatelyqual numbers of GABAergic interneurons and other neurons [43].e previously found parallel increases in glutamic acid decar-

oxylase 67 (GAD67)+ interneurons and NeuN+ neurons in theentate hilus in rat offspring after maternal exposure to acrylamide23,29]. In a model for hypothyroidism [17], we found an increasen GAD67+ interneurons only at the adult stage, and calbindin--28K+ interneurons were increased at the end of exposure oneaning. We also found a decrease in parvalbumin+ interneurons

nd an increase in calretinin+ interneurons in the dentate hilus inhe hypothyroidism model [44]. These results suggest that therere heterogeneous populations of interneurons showing differentellular potency depending on the type and magnitude of the insultn neurogenesis. Therefore, we suggest that the developmental CPFxposure in the present study transiently decreased the numberf GABAergic postmitotic interneurons, probably in relation withelayed maturation of granule cell lineages at the end of exposure.he non-dose-related decrease in GFAP+ cells at 20 ppm on PND 77uggests no toxicological relevance.

. Conclusions

In conclusion, our results indicate that maternal exposure toPF reversibly decreased the numbers of late-stage granule cell

ineages, most likely proliferative type-3 progenitor cells and/ormmature granule cells, at ≥20 ppm in the SGZ, and postmitoticeurons, most likely GABAergic interneurons, at 100 ppm in theilus of the hippocampal dentate gyrus in male offspring in mice.owever, CPF did not change the numbers of Chrm1+ cells in

he SGZ at any dose, which suggests that there was no effectf cholinergic stimulation on neurogenesis. These results sug-est that developmental exposure to CPF directly but transientlyuppressed maturation of late-stage granule cell lineages in theGZ and also affected interneuron populations in the hilus. Welso showed dose-dependent inhibition of ChE activity in RBCoth in dams and male offspring at ≥4 ppm (0.6–1.7 mg/kg bodyeight-day) at the end of exposure. Therefore, the lowest-observed

dverse-effect level (LOAEL) of CPF was determined to be 4 ppm0.6–1.7 mg/kg body weight-day) both for dams and offspring. Thisevel is 800–2400 times and 900–2600 times greater than the esti-

ated consumption of CPF through food in the average populationnd pregnant women in Japan. Obtained results suggest that inhi-ition of ChE activity is a sensitive endpoint that may remain valid

n assigning toxicity thresholds for CPF, but the mechanisms under-ying developmental neurotoxicity are more complex and separaterom ChE inhibition.

onflict of interest statement

The authors disclose that there are no competing financial inter-sts that could inappropriately influence the outcome of this study.

cknowledgments

This work was supported by Health and Labour Sciencesesearch Grants (Research on Risk of Chemical Substances) fromhe Ministry of Health, Labour and Welfare of Japan. The authorshank Mrs. Shigeko Suzuki for her technical assistance in preparinghe histological specimens.

[

[

[

xicology 38 (2013) 25– 36 35

References

[1] Eaton DL, Daroff RB, Autrup H, Bridges J, Buffler P, Costa LG, et al. Reviewof the toxicology of chlorpyrifos with an emphasis on human exposure andneurodevelopment. Critical Reviews in Toxicology 2008;38(Suppl. 2):1–125.

[2] Lassiter TL, Brimijoin S. Rats gain excess weight after developmental exposureto the organophosphorothionate pesticide, chlorpyrifos. Neurotoxicology andTeratology 2008;30:125–30.

[3] Venerosi A, Ricceri L, Scattoni ML, Calamandrei G. Prenatal chlorpyrifos expo-sure alters motor behavior and ultrasonic vocalization in CD-1 mouse pups.Environmental Health 2009;30:8–12.

[4] U.S. Environmental Protection Agency (US EPA). Human health risk assess-ment: Chlorpyrifos (Phase 4). Health Effects Division (7509C), Office ofPesticide Program; June 2000. Available at http://www.epa.gov/scipoly/sap/meetings/2008/september/hed ra.pdfc

[5] Ambali SF, Abbas SO, Shittu M, Dzenda T, Kawu MU, Salami SO, et al. Effectsof gestational exposure to chlorpyrifos on implantation and neonatal mice.Journal of Cell and Animal Biology 2009;3:50–7.

[6] Muthmann R, Nadin P. The use of plant protection products in the EuropeanUnion, Data 1992–2003. 2007 ed. European Communities; 2007. Available athttp://epp.eurostat.ec.europa.eu/cache/ITY OFFPUB/KS-76-06-669/EN/KS-76-06-669-E N.PDF

[7] Bjorling-Poulsen M, Raun Andersen H, Grandjean P. Potential developmentalneurotoxicity of pesticides used in Europe. Environmental Health 2008;7:50.

[8] Pesticides expert committee, Food Safety Commission, Cabinet Office, Govern-ment of Japan. Evaluation report: Chlorpyrifos (the 3rd ed.). May 2011.

[9] Slotkin TA, Seidler FJ. The alterations in CNS serotonergic mechanisms causedby neonatal chlorpyrifos exposure are permanent. Developmental BrainResearch 2005;158:115–9.

10] Jett DA, Navoa RV, Beckles RA, Mclemore GL. Cognitive function and choliner-gic neurochemistry in weanling rats exposed to chlorpyrifos. Toxicology andApplied Pharmacology 2001;174:89–98.

11] Colborn T. A case for revisiting the safety of pesticides: a closer look at neu-rodevelopment. Environmental Health Perspectives 2006;114:10–7.

12] Mauro RE, Zhang L. Unique insights into the actions of CNS agents: lessons fromstudies of chlorpyrifos and other common pesticides. Central Nervous SystemAgents in Medicinal Chemistry 2007;7:183–99.

13] Garcia SJ, Seidler FJ, Slotkin TA. Developmental neurotoxicity of chlorpyrifos:targeting glial cells. Environmental Toxicology Pharmacology 2005;19:455–61.

14] Zhang L, Blomgren K, Kuhn HG, Cooper-Kuhn CM. Effects of postnatal thyroidhormone deficiency on neurogenesis in the juvenile and adult rat. Neurobiologyof Disease 2009;34:366–74.

15] Montaron MF, Koehl M, Lemaire V, Drapeau E, Abrous DN, Le Moal M. Environ-mentally induced long-term structural changes: cues for functional orientationand vulnerabilities. Neurotoxicity Research 2004;6:571–80.

16] Hodge RD, Kowalczyk TD, Wolf SA, Encinas JM, Rippey C, Enikolopov G, et al.Intermediate progenitors in adult hippocampal neurogenesis: Tbr2 expressionand coordinate regulation of neuronal output. The Journal of Neuroscience2008;28:3707–17.

17] Saegusa Y, Woo GH, Fujimoto H, Kemmochi S, Shimamoto K, Hirose M, et al.Sustained production of Reelin-expressing interneurons in the hippocampaldentate hilus after developmental exposure to anti-thyroid agents in rats.Reproductive Toxicology 2010;29:407–14.

18] Lussier AL, Caruncho HJ, Kalynchuk LE. Repeated exposure to corticosterone,but not restraint, decreases the number of reelin-positive cells in the adult rathippocampus. Neuroscience Letters 2009;460:170–4.

19] Gong C, Wang TW, Huang HS, Parent JM. Reelin regulates neuronal progenitormigration in intact and epileptic hippocampus. The Journal of Neuroscience2007;27:1803–11.

20] Bruel-Jungerman E, Lucassen PJ, Francis F. Cholinergic influences on cor-tical development and adult neurogenesis. Behavioural Brain Research2011;221:379–88.

21] Ohishi T, Wang L, Ogawa B, Fujisawa K, Taniai E, Hayashi H, et al. No effect ofsustained systemic growth retardation on the distribution of Reelin-expressinginterneurons in the neuron-producing hippocampal dentate gyrus in rats.Reproductive Toxicology 2010;30:591–9.

22] Ohishi T, Wang L, Akane H, Shiraki A, Goto K, Ikarashi Y, et al. Reversible aber-ration of neurogenesis affecting late-stage differentiation in the hippocampaldentate gyrus of rat offspring after maternal exposure to manganese chloride.Reproductive Toxicology 2012;34:408–19.

23] Ogawa B, Wang L, Ohishi T, Taniai E, Akane H, Suzuki K, et al. Reversible aber-ration of neurogenesis targeting late-stage progenitor cells in the hippocampaldentate gyrus of rat offspring after maternal exposure to acrylamide. Archivesof Toxicology 2012;86:779–90.

24] Wang L, Ohishi T, Shiraki A, Morita R, Akane H, Ikarashi Y, et al. Devel-opmental exposure to manganese chloride induces sustained aberration ofneurogenesis in the hippocampal dentate gyrus of mice. Toxicological Sciences2012;127:508–21.

25] Reznikov KY. Cell proliferation and cytogenesis in the mouse hippocampus.Advances in Anatomy, Embryology, and Cell Biology 1991;122:1–74.

26] Pawluski JL, Brummelte S, Barha CK, Crozier TM, Galea LA. Effects of steroid hor-

mones on neurogenesis in the hippocampus of the adult female rodent duringthe estrous cycle, pregnancy, lactation and aging. Frontiers in Neuroendocri-nology 2009;30:343–57.

27] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−��CT method. Methods 2001;25:402–8.

3 tive To

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

6 L. Wang et al. / Reproduc

28] Steel RGD. A multiple comparison rank sum test: Treatments versus control.Biometrics 1959;15:560–72.

29] Ogawa B, Ohishi T, Wang L, Takahashi M, Taniai E, Hayashi H, et al. Disruptiveneuronal development by acrylamide in the hippocampal dentate hilus afterdevelopmental exposure in rats. Archives of Toxicology 2011;85:987–94.

30] Agency for Toxic Substances and Disease Registry (ATSDR). Toxicological Profilefor Chlorpyrifos. Atlanta, GA: U.S. Department of Health & Human Services,Public Health Service; 1997.

31] Mattsson JL, Maurissen JP, Nolan RJ, Brzak KA. Lack of differential sensitivityto cholinesterase inhibition in fetuses and neonates compared to dams treatedperinatally with chlorpyrifos. Toxicological Sciences 2000;53:438–46.

32] Chanda SM, Pope CN. Neurochemical and neurobehavioral effects of repeatedgestational exposure to chlorpyrifos in maternal and developing rats. Pharma-cology, Biochemistry, and Behavior 1996;53:771–6.

33] Garcia SJ, Seidler FJ, Qiao D, Slotkin TA. Chlorpyrifos targets developing glia:effects on glial fibrillary acidic protein. Brain Research Developmental BrainResearch 2002;133:151–61.

34] Kempermann G, Jessberger S, Steiner B, Kronenberg G. Milestones of neu-ronal development in the adult hippocampus. Trends in Neuroscience2004;27:447–52.

35] De Angelis S, Tassinari R, Maranghi F, Eusepi A, Di Virgilio A, Chiarotti F, et al.Developmental exposure to chlorpyrifos induces alterations in thyroid and thy-roid hormone levels without other toxicity signs in CD-1 mice. Toxicological

Sciences 2009;108:311–9.

36] Williams LR, Varon S, Peterson GM, Wictorin K, Fischer W, Bjorklund A, et al.Continuous infusion of nerve growth factor prevents basal forebrain neuronaldeath after fimbria fornix transection. Proceedings of the National AcademySciences of the United States of America 1986;83:9231–5.

[

xicology 38 (2013) 25– 36

37] Lee J, Duan W, Mattson MP. Evidence that brain-derived neurotrophic factoris required for basal neurogenesis and mediates, in part, the enhancement ofneurogenesis by dietary restriction in the hippocampus of adult mice. Journalof Neurochemistry 2002;82:1367–75.

38] Kaneko N, Okano H, Sawamoto K. Role of the cholinergic system in regulatingsurvival of newborn neurons in the adult mouse dentate gyrus and olfactorybulb. Genes to Cells 2006;11:1145–59.

39] Van Kampen JM, Eckman CB. Agonist-induced restoration of hippocampal neu-rogenesis and cognitive improvement in a model of cholinergic denervation.Neuropharmacology 2010;58:921–9.

40] Whitney KD, Seidler FJ, Slotkin TA. Developmental neurotoxicity ofchlorpyrifos: cellular mechanisms. Toxicology and Applied Pharmacology1995;134:53–62.

41] Slotkin TA, Seidler FJ. Developmental neurotoxicity of organophosphates tar-gets cell cycle and apoptosis, revealed by transcriptional profiles in vivo and invitro. Neurotoxicology and Teratology 2012;34:232–41.

42] Moreira EG, Yu X, Robinson JF, Griffith W, Hong SW, Beyer RP, et al.Toxicogenomic profiling in maternal and fetal rodent brains following ges-tational exposure to chlorpyrifos. Toxicology and Applied Pharmacology2010;245:310–25.

43] Houser CR. Interneurons of the dentate gyrus: an overview of 668 celltypes, terminal fields and neurochemical identity. Progress in Brain Research2007;163:217–32.

44] Shiraki A, Akane H, Ohishi T, Wang L, Morita R, Suzuki K, et al. Similar dis-tribution changes of GABAergic interneuron subpopulations in contrast tothe different impact on neurogenesis between developmental and adult-stagehypothyroidism in the hippocampal dentate gyrus in rats. Archives of Toxico-logy 2012;86:1559–69.