research article scar marker for identification and...

Research ArticleSCAR Marker for Identification and Discrimination ofCommiphora wightii and C myrrha

Pramod Kumar Sairkar1 Anjana Sharma2 and N P Shukla13

1Centre of Excellence in Biotechnology M P Council of Science amp Technology Bhopal Madhya Pradesh India2Bacteriology Laboratory Department of Post Graduate Studies amp Research in Biological Science Rani Durgawati UniversityJabalpur Madhya Pradesh India3Madhya Pradesh Pollution Control Board Bhopal Madhya Pradesh India

Correspondence should be addressed to Pramod Kumar Sairkar sairkar pramod04yahoocom

Received 31 October 2015 Revised 28 January 2016 Accepted 1 February 2016

Academic Editor Sharad S Singhal

Copyright copy 2016 Pramod Kumar Sairkar et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Commercially important Commiphora species are drought-tolerant plants and they are leafless for most of the year Thereforeit is necessary to develop some molecular marker for the identification Intended for that in the present study species-specificsequence-characterized amplified regions (SCAR)markers were developed for proficient and precise identification of closely relatedspecies Commiphora wightii and C myrrha which may ensure the quality safety and efficacy of medicines made from these plantsthrough adulterousmixing of these plants Two species-specific RAPDampliconswere selected gel-purified cloned and sequencedafter screening of 20 RAPD primersThe sequence of 979 and 590 nucleotides (Genebank accession numbers K90051 and K90052)was used for development of 4 SCAR markers namely Sc1P Sc1Pm Sc2P and Sc2Pm Out of them the Sc1Pm was specific forC wightii while Sc2P discriminated both the Commiphora species These markers are first reported and will be useful for rapididentification of closely related Commiphora wightii and C myrrha species

1 Introduction

Commiphora spp of the family Burseraceae is being used asa medicinal plant since ancient times and now rated as anendangered plant species [1] They are found in the arid tosemiarid regions of the world including the deserts of IndiaPakistan Africa and Saudi Arabia while in India it is foundin Rajasthan Madhya Pradesh Gujarat Tamilnadu Orissaand Karnataka About 185 species ofCommiphorawere foundworldwide out of them C wightii (synonym C mukul) Cagallocha C stocksiana C berryi and C myrrha were foundin India [2 3] In earlier studies about the flora of India theldquoGuggulrdquo plant was known as Commiphora mukul (Hook exStocks) Engl or Balsamodendron mukul (Hook ex Stocks)Finally it was named asC wightii (Arn) by Bhandari in 1964

C wightii was well-documented medicinal plant since3000 years ago [4] having exciting biological activities likebeing anti-inflammatory antimicrobial hepatoprotective

muscle relaxing antiarthritic hypolipidemic hypocholes-terolemic antiobesity antioxidant antimalarial antimy-cobacterial antischistosomal larvicidal andmollucidal [2 35ndash19]

Cwightii contains a bitter gumknown asGuggul (Myrrh)in stems and leaves The yellowish gum oozes upon makingan incision and solidifies in the hot environment to a hardbrownish resin Guggul is medicinally important and is usedin the treatment of hypercholesterolemia and cardiovasculardiseases [9 20] it is also shown to have anticancerous activity[21] The extract of gum Guggul as gugulipid guggulipidor guglipid is reported as a folk remedy in the Unani andAyurvedic system of medicine Two trans-isomers of Gug-gulsterone namely Guggulsterones E and Z were reportedin gum Guggul as important active steroid which are usedas cholesterol-lowering agents The pharmacological proper-ties associated with gum Guggul include anti-inflammatoryantibacterial anticoagulant antirheumatic COX inhibitory

Hindawi Publishing CorporationMolecular Biology InternationalVolume 2016 Article ID 1482796 10 pageshttpdxdoiorg10115520161482796

2 Molecular Biology International

Table 1 Sequence of SCAR markers designed using 1 kb amplicon

Name of SCAR Name of fragments Sequence (51015840-31015840) Total length Temp Size (bp)

Sc1P Sc1P (F) CTGTGAGGCATTTGTATATTTAA 23 bases 60∘C 631Sc1P (R) CTTGTGGTCTTTCAGTCAATAG 22 bases 62∘C

Sc1Pm Sc1P (F) CTGTGAGGCATTTGTATATTTAA 23 bases 60∘C 910Sc1Pm (R) CTTGAGAACGAAATCTAACAAG 22 bases 60∘C

and hypolipidemic activities that are mostly due to thepresence of these steroids [22 23] In 1986 Guggul lipids weregranted approval in India for marketing as a lipid-loweringdrug [24] Several products of standardized formulations ofC wightii were already in human use as cholesterol-loweringagents [22 25]

Commiphora species have been called ldquotaxonomicallydifficultrdquo because of being drought-tolerant plants and theyare leafless for most of the year [26] There is resemblanceof gum Guggul with gum resin of other species within andoutside of the genus which make high risk of adulterationin commercial samples either deliberately to get more profitor accidentally Therefore it is important to validate the Cwightii plants and their gum Guggul in commercial samplesdue to its various pharmacological significances [27] Manytypes of markers namely morphological biochemical andDNA based molecular markers are commonly used in theidentification of species [28] Molecular markers were usedin the identification of species and individual their originand difference at the molecular level in between them [29]During the last few decades the use of molecular markersrevealing polymorphism at the DNA level has been playingan increasing part in plant biotechnology and their geneticstudies These DNA based markers are differentiated intotwo types first is non-PCR based RFLP and second is PCRbased markers (RAPD AFLP SSR SNP etc) [30] RAPD isa PCR-based technology based on enzymatic amplificationof target or random DNA segments with arbitrary primersThe main advantage of RAPDs is that they are quick andeasy to assay had no sequence data required for primerconstruction randomly distributed throughout the genomeand had a dominant nature [31] However RAPD marker isnot suitable for the species identification because of their lowreproducibility and dominant nature [32] A RAPD markercan be converted into a codominant and reproduciblemarkerthat is Sequence-Characterized Amplified Region (SCAR)which may be applicable for authentication of species

Looking upon these problems it is necessary to developsome molecular marker for the identification of C wightiiIn the present study an attempt has been made for thedevelopment of SCAR markers for C wightii

2 Materials and Methods

Total 28 accessions of two different species of Commiphorathat is C wightii (17) and C myrrha (11) were collected fromBhopal Obaidullaganj (Madhya Pradesh) Akola (Maharash-tra) Anand (Gujarat) and Jaipur (Rajasthan) and conservedat MPCST Human Herbal Health Care Garden Bhopal

21 Selection of RAPD Primers and Amplicons GenomicDNA was isolated from fresh young stem C wightii and Cmyrrha using the method of Sairkar et al (unpublished)The yield of DNA was measured using a NanoDrop UV-Spectrophotometer (ND-1000) Genomic DNA was ampli-fied by the 20 primers (Table 1) A cocktail of 40 120583L reactionvolumes was made with 20120583L 2x red dye PCR mix (Merck)1 120583L primer (10 pM) and 1 120583L template DNA (25 ng120583L)and amplification was performed on the gradient automaticthermal cycler (Eppendorf) following Sairkar et al [33] ThePCR products were separated electrophoretically on 15agarose gel at 5ndash10 voltscm of the gel and visualized by ethid-ium bromide The specific amplicon which discriminatesbetweenC wightii andCmyrrha was selected and processedfor the development of SCAR marker

22 Cloning of Selected RAPD Amplicon The selected ampli-cons were eluted using Medox-Easy Spin Column CleanupMinipreps kit and ligated with the TA cloning vector(pGEM5Z Promega)The ligated TA vector was transformedinto competent cells of E coli (DH5120572) which was preparedusing single step ultracompetent cell preparation kit (Medox)The first selection of recombinant clones was based ondeveloped blue andwhite colonies on LB (Luria Burtani) agarplates containing 05mgmL ampicillin 24120583gmL IPTG and30 120583gmL X-gal The plasmid of white and blue colonies wasisolated throughMedox-Easy ultrapure spin column plasmidDNAminipreps kitThree selection steps that is clone retar-dation restriction digestion and amplification of plasmidwere adopted to identify positive insert within the plasmid Inretardation step plasmids were separated electrophoreticallyto observe the presence of insert within plasmid whilein restriction digestion plasmids were digested with PvuIIenzyme for insert release In the final step the plasmids wereamplified through the PCR reaction using 50120583L that consistof 25 120583L 2x red dye PCR mix (Merck) 1120583L each of forwardand reverseM-13 primers (10 pM each) 1120583L of plasmid DNA(25 ng120583L)with a PCRprofile of 94∘C for 12minutes 30 cyclesof 30 seconds at 94∘C 30 seconds at 55∘C and 45 secondsat 72∘C and final extension on 72∘C at 10 minutes using thegradient automatic thermal cycler (Eppendorf)

23 Designing and Screening of SCAR Marker Plasmid hav-ing desired amplicon was sequenced by Aristogene Pvt LtdBangalore India using M13 reverse and forward sequencingprimers and consensus sequence of ampliconswas developedThe homology search of consensus sequences was performedby the NCBI BLAST tool The primer pairs were designedfor these sequences by using PRIMER 3 software [34] and

Molecular Biology International 3

M 1 2

(a)

M 1 2

(b)

Figure 1 Selection and elution of desired amplicon (a) PCR product of sample Commiphora wightii on low melting agarose gel Lanes 1 and2 amplified by primers OPD-02 and OPD-08 (b) Eluted desired amplicon run on agarose gel Lanes 1 and 2 fragment sizes 1 kb and 06 kbrespectively

used as a candidate for SCAR primer Four accessions ofeach species of C wightii and C myrrha were amplifiedthrough these primer pairs (synthesized by Aristogene) witha cocktail of 40 120583L containing 20120583L of 2x red dye PCRmix (Merck) 1 120583L of each of the SCAR primer pair (10 pMeach) and 1 120583L of template DNA (25 ng120583L) Amplificationwas performed on the gradient automatic thermal cycler(Eppendorf) with PCR conditions 94∘C for 5 minutes 30cycles of 30 seconds at 94∘C 30 seconds at 58∘C and 1 minuteat 72∘C and final extension on 72∘C at 10minutes Among theall designed primer pairs suitable primer pair was selectedwhich discriminate the both species of Commiphora andfurther screened in all the accessions for validation of SCARmarker

3 Result

31 Identification of RAPD Primer and Amplicon Out of20 RAPD primers 1 kb amplicon of OPD-02 and 06 kbamplicon of OPD-08 discriminate both Commiphora speciesas it was present only in C wightii accessions (Figure 1(a))Due to specificity of these amplicons they were clonedsequenced and used for SCAR marker development Thesebands were elected from agarose gels and gel electrophoresisrevealed that they were appropriate for cloning (Figure 1(b))

32 Cloning and Selection of Positive Clone White colony ofcompetent cells (E coli) having T vector with 1 kb and 06 kbinsert was undertaken for plasmid isolation and three selec-tion criteria were performed for the conformation of positiveclone The screening for retardation checking reveals that17 positive plasmids for 1 kb insert and 5 positive plasmidsfor 06 kb may have proper insert (Figure 2) These positive

B 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

Figure 2 Retardation checking by plasmid run on agarose gelLanes 1 to 21 positive cloned plasmids 1 to 21 B negative clonedplasmid isolated from blue colony

plasmids were digested with the restriction endonuclease(PvuII) for insert release A total of 6 positive plasmids of1 kb insert and 4 positive plasmids of 06 kb insert releasetheir respective insert fragment (Figure 3) In the third stageof selection 4 positive plasmids for 1 kb insert 3 positiveplasmids for 06 kb insert were finalized for sequencing afteramplify with M-13 primer (Figure 4)

33 Sequencing and In Silico Application The clones weresequenced and 979 bp and 590 bp consensus sequences wereformed for 1 kb insert 06 kb insert respectively (Figures 5and 6) The BLAST search was performed for the obtainedsequences and no significant homologous sequence wasfound in the NCBI database This DNA sequences weredeposited in the NCBI gene bank database with accessionnumbers K90051 and K90052 Two candidate SCAR primerpairs for each DNA sequences were designed that is primersSc1P and Sc1Pm from 979 bp sequences and primer Sc2P andSc1Pm from 590 bp sequences (Tables 1 and 2)These primerswere deposited in the NCBI Prob database with accessionnumber Pr031905450 to Pr031905453


Table 2 Sequence of SCAR markers designed from 06 kb amplicon


Sc2P Sc2P (F) GTACCCAATGTAGTAATATTCC 22 bases 60∘C 491Sc2P (R) TAGTTAGTTTGATGACCATCACA 23 bases 62∘C

Sc2Pm Sc2P (F) GTACCCAATGTAGTAATATTCC 22 bases 60∘C 570Sc2Pm (R) GTGTGCCCCATTCAACCAAT 20 bases 60∘C

M 1 32 4 5

Figure 3 Insert release digested plasmids by restriction endonucle-ase PvuII run on agarose gel plasmid of Lanes 1 2 4 and 5 realised1 kb fragment after digestion

M1 2 3 4 5 6 7 8 9

Figure 4 Amplification of plasmid by vector primers (M-13) Lane1 2 3 and 9 produced 1 kb fragment while lanes 4 5 and 6 produced06 kb fragment

34 Development of SCAR Marker The candidate SCARprimer pairs were screenedwith three accessions of each ofCwightii and C myrrha which revealed that the primer Sc1Pmis highly specific forC wightii and amplified 910 bp ampliconwhile primer Sc1P had a similar banding pattern in all thesamples Primer Sc2P discriminated both the Commiphoraspecies as it gave 491 bp amplicon for C wightii and 1200 bpfor C myrrha while primer Sc2Pm gives 491 and 570 bpamplicon forCwightii andCmyrrha respectively (Figure 7)

Based on the above results primers Sc1Pm and Sc2Pwere authenticated through amplification of eight accessionof each species that is C wightii and C myrrha (Figure 8)The similar results were observed during this screening asthey were discriminated both the species of Commiphora

4 Discussion

Identification of plants at the species level traditionally is afeverish job and needs special care during identificationThis

CGTTTCCTTCTTATTAGGGGCGAATTGGGCCCGACGTCGCATGCTCCCGGCCG

CCATGGTTGGACCCAACCCGACCCCTGTGAGGCATTTGTATATTTAAAATAA

ACAACTGTTAAGTAGTTAAGTTAACTAACATTCAACGAAATTAAACCAAAA

CATAGACAAAGTATGATTAGGAGCAATCAGAGAATAAAGAGAGAAAAAGA

AAATAGTACGGAGTAAGGAAGTGTAAATATATATTGTGATTAAATAGTTACT

TTTCTTCGTACATATGATTCATCTCCAGACGTGATTTCATTTGGAATGTATCTA

ATTCGATCTTAATTAAAATTCCATCACTTGCAATGCAGCCGCCGTTAATATAA

TTAACAATATTCGATCCTAGCATGATCGGCATCCTACAGTAAATTAATACAT

AAAAATAGGGTGAAATAGCGACCACTTGGAAATTAATAGTGACGTAATCAT

ACTTTTTTCTTAGACGGGTTAAATTAATATATTAGGTAAGTTATGGTGGTACA

AGAAAATTTTATAAAGATAAAATATTTATAACTAAGGGGACATAATAAATTT

TACTCCTCAAAATGTATCTTTTATACAAAAATAAATATTAAAAATATGGTTA

ATGAACTAATCATAATAAAAGTTAGTCACATCTCTACACCAAGAATATCAAA

TTCATATAAAATGCCTATTGACTGAAAGACCACAAGGTATAATCCTATATTA

AATCTTCTAATATTTAGAATAATAGGTTACCATAAGTTCATATCTAATACATA

AACACACAAATAGAGTTATACAATACTAATAATTTAACATCAATATAATAAT

ATTTGTTTCAACAACATAATTTCATCATCAATTGATAGAAACCATAAGAAAA

TGTGGCTTAAATTAATTTTGATGTCCTAGTAATGGGTATACTAGAATACACAA

ATATGAGAATAAATAAAGGTGTGTGATCTTGTTAGATTTCGTTCTCAAGGGG

GCCGGCAGCCACTTCTTTTTTCAAATGTTCGCAACAATTGGTTGGGTCCATCC

ATGGCCGCGGGATATCACTAGTGCGGCCGCCTGCAGGTCGACCATATGGGA

GAGCTCCCAACGCGTTGGATGCATAGCTTGAGTATTCTATAGTTCACCTAAAT

TGCCTAATCCC

Figure 5 Consensus sequence (979 bp) of 1 kb fragment (GenebankIDK90051) Red highlights vector sequenceGreen highlight SCARprimer region Blue highlight second reverse SCAR primer Pinkhighlight RAPD primer region

GGCATTCCTTCTATAGGGCGATTGGGCCCGACGTCGCATGCTCCCGGCCGCC

ATGGTTGTGTGCCCCAATGCCAACTTTCTAGAATTTTGGTACCCAATGTAGTA

ATATTCCACCCCTGGTGTGGACGATATTTTGATAAACTCCCATGTCATTTTAA

TTTGTTAATTGGATTTTATTATGATTATTTTTATGCTACTATTAATTTTATTGAT

GGTAATTAAGGATTAAAAGATAAATTTGTCTATTTCAATAGTGATTGATAAA

GTTGATAATTAGGTTGTTTTGTTTAAAGGGATAAAAGTATATGATTAAGGATT

TAAATATAGATAAGGACATGTACCTCATAGCTAATTTTGATAGTCATAAATTT

TCATAGTCACCGGAGTGTTTGGATGGTGAAAGAAATTCCTTACTTCCTCTATT

AAGAGTTAATGGTTTCTTTTGAGTTAGTAGATGAACTTATTAGTGTTTATTGC

ATGGGACCAAAACTTAAAATTTGACAAGATAAAAAGCATAAGCATGTATGT

CTAGAATTGGAGACGTCATCAAAAACTAAATGTGATGGTCATCAAACTAACT

ACTATCTCCCTCCATATGTGATGAATGGGATAAAGAAAAAGATTTTAAATTG

GTTGAATGGGGCACACATCCATGGCCGCGGGATATCACTAGTGCGGCCGCCT

GCAGGTCGACCATATGGGAGAGCTCCCAACGCGTTGGGATGCATAGCTTGA

GTATTCTATAGTGTCACCCTAAATAGCTTGACGTAATCATGGTCATAGCTGTT

TCCTGTGTGAAATGTTATCCGCTCACAATTCCACACACATACGAGCCGGGAT

GCATAAAGTGTAAAGCCTGTGGTGCCCTAATGAGTGAGCTAACTCACAATTA

ATTGCGTGGCGCTCACTGACCGGCTTTCCAGTCGGGAATCCTGTCGTGCCAG

CCTGCATTTATGAATCGGCCAACGCGCGGGGGAAAGGCGTTTGCGTATTGGG

CGCCTTACCGCTTCCTCCGTCCACATGAC

Figure 6 Consensus sequence (590 bp) of 06 kb fragment(Genebank ID K90052) Red highlights vector sequence Greenhighlight SCAR primer region Blue highlight second reverseSCAR primer Pink highlight RAPD primer region


M 4 5 61 2 3

(a)M 5 7 8 641 2 3

(b)

M 5 7 8641 2 3

(c)

Figure 7 Screening of SCAR primers (a) Lanes 1 to 2 C myrrhaand Lanes 3 to 4 C wightii amplified by primers Sc1P Lanes 5 to6 C myrrha and C wightii amplified by primers Sc2P (b) Lanes1 to 2 C myrrha and Lanes 3 to 4 C wightii amplified by primersSc1P Lanes 5 to 6 C myrrha and Lanes 7 to 8 C wightii amplifiedby primers Sc2P (c) Lanes 1 to 4 C myrrha amplified by primersSc1P Sc1Pm Sc2P and Sc2Pm Lanes 5 to 8 C wightii amplified byprimers Sc1P Sc1Pm Sc2P and Sc2Pm

work usually needs to be a specially trained expert after thatmany human errors were observed To overcome this prob-lem in the early 1990s many specific molecular identificationtechnologies were popular which are more reliable [35 36]Nowadays molecular taxonomists are engaged in preparationof the nucleotide sequence of a shortDNA fragment for all liv-ing species on earth which is called DNA barcodes [37ndash39]

Molecular markers allow the detection of specific DNAsequence differences between tests of individuals of anorganism [40] DNA markers are unlimited in number andare not affected by environmental factors and developmentalstages of the plant [41] The discovery of PCR technologychanged the entire molecular biology and a single randomoligonucleotide primer (10-bp long) was discovered in 1990as a universal marker technology called RAPDs [42] Themain advantages of RAPD markers are the following theyare universal and cost-effective and for application of these

markers they did not need any genetic information of thetarget organism and they canmap almost completed genomicDNA of the target organism [43] However each methodanalyses different aspects of DNA sequence variation anddifferent regions of the genome RAPD and AFLP markersappear to frequently target repetitive regions of the genome

The presence of polysaccharides polyphenols and othersecondary metabolites in the leaves of Commiphora speciescreates complications in the DNA process Haque et al 2008[44] and Samantaray et al [45] used various methods anddescribed the process for DNA isolationTheir isolated DNAshowed good PCR amplification therefore it can furtherbe used in molecular downstream applications Molecularvariations among accessions collected from different local-ities of Rajasthan and Gujarat were described by Sutharet al [46] Intraspecific variation in Commiphora wightiipopulations was described by Haque et al [47] using Inter-nal Transcribed Spacer (ITS1-58S-ITS2) Sequences whileHarish et al [48] studied genetic variations on accessionscollected from Indian Thar Desert using RAPD and ISSRmarkers Molecular variations among different biotypes ofCommiphora wightii were done by Vyas and Joshi in 2015[49] using RAPD markers Genetic variability among the Cwightii germplasm collected from Rajasthan and Haryanawas studied by Kulhari et al [50] Samantaray et al [51]used sixty different random decamer primers and identifiedthree primerswhich produced specific fragment in the femaleplant of C wightii but failed to do so from the male plantDNAs Their finding was helpful for the breeding practiceof C wightii and our SCAR markers may be useful foridentification of C wightii at species level

The developed SCAR markers by us were used foridentification of C wightii and discrimination among Cwightii and C myrrha SCAR markers maybe are developedusing sequence of RAPD fragments which are characterizedbymany advantages including their specificity low cost easefast use reproducibility abundance and being polymorphicin nature targeting specific regions of the genomes [52ndash54] employed with success in plant and animal speciesidentification [30 55ndash58]

In this study RAPD amplicons were selected for cloningsequencing andfinal development of SCARmarkers Specificcharacters of RAPD markers entice researchers and usuallySCAR markers have been developed from RAPD amplicons[58ndash61] Amplicon of other fingerprintingmethods likeAFLP[62ndash64] and ISSR (Inter Simple Sequence Repeat) [52] wasalso used to develop SCAR markers

Developed Sc1Pmmarker in this study produced a 910 bpamplicon with C wightii while in other samples no amplifi-cation was observed These results revealed that this SCARmarker might be used in identification and authenticationof C wightii Many reports are available in which SCARmarkers have been used for authentication of medicinal plantspecies like Panax ginseng [65] bent-grass [66] Bamboo[67] Piper longum [68] Artemisia princeps and A argyi[69]Phyllanthus emblica [70] strawberry [71] Jatropha curcas[72 73] Ganoderma lucidum [74] Pueraria tuberosa [75]Dendrobium candidum [76] Sinapis arvensis [77] Cornusofficinalis [78] and Scrophularia ningpoensis [79] Three


M 5 7 8641 2 3

(a)

M 5 7 8641 2 3

(b)

L 5 7641 2 3 8 9 10 11 12 13 14 15 16 17 18

(c)

Figure 8 Screening of SCAR primers (a) Lanes 1 to 8 accessions of C wightii amplified by primers Sc1Pm (b) Lanes 1 to 8 accessions of Cmyrrha amplified by primers Sc1Pm (c) Lanes 1 to 8 accessions of C wightii and Lanes 9 to 16 accessions of C myrrha amplified by primersSc2P M = low range ruler (3000 2500 2000 1500 1000 600 300 200 and 100 bp) L = 100 bp ladder (1000 900 800 700 600 500 400300 200 and 100 bp)

SCAR markers of Phyllanthus species were developed fromthree specific RAPD sequences that can identify and differ-entiate the morphologically similar Phyllanthus species [80]

SCAR markers have been also developed for breedingprograms of crops like Rice [81] Citrus tristeza [82] Bras-sica napus L [83] Grapevine [84] Wheat [85] Buckwheat[86] Grape [87] Barley [88] Atractylodes japonica and Amacrocephala [89]Diplocarpon rosae [90] Puccinia coronata[91] Puccinia striiformis [92] Thinopyrum elongatum [93]Liriope and Ophiopogon [94] Medicago sativa [95] Triticumturgidum [96] andMiscanthus sacchariflorus [97]

Our marker Sc2P produced a prominent amplicon of491 bp in theCwightii and 12 kb in theCmyrrhawhile otherplant samples did not show amplificationThe result revealedthat this SCAR primer might be used for the discriminationamongC wightii andC myrrha Only few reports are presentwith a single primer discrimination among two closely relatedspecies

Conflict of Interests

The authors declare that there is no conflict of interests

Authorsrsquo Contribution

Dr P K Sairkar performed wet and dry laboratory workunder the supervision of Dr N P Shukla and ProfessorAnjana Sharma ProfessorA Sharmawas cosupervisor of thiswork and allmicrobiology relatedworkwas performed underher supervision while Dr N P Shukla was supervisor of thiswork and probes were developed under his supervision

Acknowledgments

The authors wish to thank Professor P K Verma DirectorGeneral MPCST and Dr R K Singh Resource ScientistandGroupHeadAdvanceResearch Instrumentation FacilityMPCST for providing laboratory facilities

References

[1] IUCN ldquoIUCN Red List of ThreatenedSpeciesrdquo Version 201222012 httpwwwiucnredlistorg

[2] K R Kirtikar and B D Basu Indian Medicinal Plants vol 1Bishen Singh Mahendra Pal Singh Dehra Dun India 1935


[3] D Hocking Trees for Drylands Oxford and IBH PublishingNew Delhi India 1993

[4] A Joshi Ayurvedic Patrikaritaka Has (History of AyurvedicPublications) Mimeo Mohan Ayurvedic Pharmacy JodhpurIndia 1980

[5] G N Chaturvedi and R H Singh ldquoExperimental studies onanti-arthritic effect of certain indigenous drugsrdquo Indian Journalof Medical Research vol 53 no 1 pp 71ndash80 1965

[6] G V Satyavati C Dwarkanath and S N Ttripathi ldquoExper-imental studies on the hypocholesterolemic effect of Com-miphora mukul Engl (Guggul)rdquo Indian Journal of MedicalResearch vol 57 no 10 pp 1950ndash1962 1969

[7] S Kumar and V Shankar ldquoMedicinal plants of Indian desertCommiphora wightii (Arnott) Bhandrdquo Journal of Arid Environ-ments vol 5 pp 1ndash11 1982

[8] G V Satyavati ldquoUse of plant drugs in Indian traditional systemsof medicine and their relevance to primary health carerdquo inEconomic and Medicinal Plant Research H Wagner and NR Farnsworth Eds pp 39ndash56 Academic Press London UK1990

[9] R B Singh M A Niaz and S Ghosh ldquoHypolipidemic andantioxidant effects of Commiphora mukul as an adjunct todietary therapy in patients with hypercholesterolemiardquo Cardio-vascular Drugs and Therapy vol 8 no 4 pp 659ndash664 1994

[10] A D Bhatt D G Dalal S J Shah et al ldquoConceptual andmethodologic challenges of assessing the short-term efficacy ofGuggulu in obesity data emergent from a naturalistic clinicaltrialrdquo Journal of Postgraduate Medicine vol 41 no 1 pp 5ndash71995

[11] A F AllamMH El-Sayed and S S Kahlil ldquoLaboratory assess-ment of molluscidal activity of Commiphora molmol (myrrha)on Biomphalaria alexandrina Bulinus truncates and Lymneacailliaudirdquo Journal of the Egyptian Society of Parasitology vol31 pp 683ndash690 2001

[12] E S H El Ashry N Rashed O M Salama and A SalehldquoComponents therapeutic value anduses ofmyrrhrdquoPharmazievol 58 no 3 pp 163ndash168 2003

[13] A M A Massoud F H El Ebiary and N F Abd-El-SalamldquoEffect of myrrh extract on the liver of normal and bilharziallyinfectedmicemdashan ultrastructural studyrdquo Journal of the EgyptianSociety of Parasitology vol 34 no 1 pp 1ndash21 2004

[14] X Wang J Greilberger G Ledinski G Kager B Paigen andG Jurgens ldquoThe hypolipidemic natural product Commiphoramukul and its component guggulsterone inhibit oxidative mod-ification of LDLrdquo Atherosclerosis vol 172 no 2 pp 239ndash2462004

[15] F A Abbas S M Al-Massarany S Khan T A Al-Howiriny JS Mossa and E A Abourashed ldquoPhytochemical and biologicalstudies on Saudi Commiphora opobalsamum Lrdquo Natural Prod-uct Research vol 21 no 5 pp 383ndash391 2007

[16] T Shen W Wan H Yuan et al ldquoSecondary metabolites fromCommiphora opobalsamum and their antiproliferative effect onhuman prostate cancer cellsrdquo Phytochemistry vol 68 no 9 pp1331ndash1337 2007

[17] A Sharma V K Patel S Rawat P Ramteke and R VermaldquoIdentification of the antibacterial component of some indianmedicinal plants against Klebsiella pneumoniaerdquo InternationalJournal of Pharmacy and Pharmaceutical Sciences vol 2 no 3pp 123ndash127 2010

[18] C Goyal M Ahuja and S K Sharma ldquoPreparation and evalu-ation of anti-inflammatory activity of gugulipid-loaded pronio-somal gelrdquo Acta Poloniae PharmaceuticamdashDrug Research vol68 no 1 pp 147ndash150 2011

[19] T Al-Howiriny M Al-Sohaibani M Al-Said M Al-Yahya KEl-Tahir and S Rafatullah ldquoEffect of Commiphora opobalsa-mum (L) Engl (Balessan) on experimental gastric ulcers andsecretion in ratsrdquo Journal of Ethnopharmacology vol 98 no 3pp 287ndash294 2005

[20] R Deng D Yang A Radke J Yang and B Yan ldquoThehypolipidemic agent guggulsterone regulates the expression ofhuman bile salt export pump dominance of transactivationover farsenoid X receptor-mediated antagonismrdquo Journal ofPharmacology andExperimentalTherapeutics vol 320 no 3 pp1153ndash1162 2007

[21] D Xiao and S V Singh ldquoz-Guggulsterone a constituent ofAyurvedic medicinal plant Commiphora mukul inhibits angio-genesis in vitro and in vivordquoMolecular CancerTherapeutics vol7 no 1 pp 171ndash180 2008

[22] N Zhu M M Rafi R S DiPaola et al ldquoBioactive constituentsfrom gum guggul (Commiphora wightii)rdquo Phytochemistry vol56 no 7 pp 723ndash727 2001

[23] M R Meselhy ldquoInhibition of LPS-induced NO production bythe oleogum resin of Commiphora wightii and its constituentsrdquoPhytochemistry vol 62 no 2 pp 213ndash218 2003

[24] Indian Pharmacopeia 2007 Indian Pharmacopoeia (IP) Gov-ernment of India Ministry of Health and Family Welfare 2007

[25] P O Szapary M L Wolfe L T Bloedon et al ldquoGuggulipidfor the treatment of hypercholesterolemia a randomized con-trolled trialrdquo Journal of the American Medical Association vol290 no 6 pp 765ndash772 2003

[26] F N Gachathi ldquoRecent advances on classification and statusof the main gum-resin producing species in the family Burs-eraceaerdquo in Proceedings of the Regional Conference for Africaon Conservation Management and Utilization of Plant GumsResins and Essential Oils Nairobi Kenya October 1997

[27] H A Ahmed E T MacLeod G Hide S C Welburn andK Picozzi ldquoThe best practice for preparation of samplesfrom FTAcards for diagnosis of blood borne infections usingAfrican trypanosomes as amodel systemrdquoParasites andVectorsvol 4 article 68 2011

[28] D Tautz P Arctander A Minelli R H Thomas and A PVogler ldquoA plea for DNA taxonomyrdquo Trends in Ecology andEvolution vol 18 no 2 pp 70ndash74 2003

[29] N Techen S L Crockett I A Khan and B E ShefflerldquoAuthentication of medicinal plants using molecular biologytechniques to compliment conventional methodsrdquo CurrentMedicinal Chemistry vol 11 no 11 pp 1391ndash1401 2004

[30] P KumarVKGupta AKMisraD RModi andBK PandeyldquoPotential of molecular markers in plant biotechnologyrdquo PlantOmics Journal vol 2 no 4 pp 141ndash162 2009

[31] J G KWilliams M K Hanafey J A Rafalski and S V TingeyldquoGenetic analysis using random amplified polymorphic DNAmarkersrdquo in Methods in Enzymology vol 218 pp 704ndash740Academic Press New York NY USA 1993

[32] S H Ganiea P Upadhyaya S Dasa and M P SharmabldquoAuthentication of medicinal plants by DNA markersrdquo PlantGene vol 4 pp 83ndash99 2015

[33] P Sairkar N Vijay N Silawat et al ldquoInter-species associa-tion of Ocimum genus as revealed through random amplifiedpolymorphic DNA fingerprintingrdquo Science Secure Journal ofBiotechnology vol 1 no 1 pp 1ndash8 2012


[34] S Rozen and H Skaletsky ldquoPrimer3 on the WWW for generalusers and for biologist programmersrdquo Methods in MolecularBiology vol 132 pp 365ndash386 2000

[35] K-S Cheung H-S Kwan P P-H But and P-C ShawldquoPharmacognostical identification of American and Orientalginseng roots by genomic fingerprinting using ArbitrarilyPrimed Polymerase Chain Reaction (AP-PCR)rdquo Journal ofEthnopharmacology vol 42 no 1 pp 67ndash69 1994

[36] H Mizukami K Ohbayashi Y Kitamutra and T Ike-naga ldquoRestriction fragment length polymorphisms (RFLPs) ofmedicinal plants and crude drugs I RFLP probes allow clearidentification ofDuboisia interspecific hybrid genotypes in bothfresh and dried tissuesrdquo Biological and Pharmaceutical Bulletinvol 16 no 4 pp 388ndash390 1993

[37] P D N Hebert A Cywinska S L Ball and J R deWaardldquoBiological identification through DNA barcodesrdquo Proceedingsof the Royal Society of London Series B Biological Sciences vol270 pp 313ndash321 2003

[38] V Savolainen R S Cowan A P Vogler G K Roderickand R Lane ldquoTowards writing the encyclopaedia of life anintroduction to DNA barcodingrdquo Philosophical Transactions ofthe Royal Society B Biological Sciences vol 360 no 1462 pp1805ndash1811 2005

[39] S RatnasinghamandPDNHebert ldquoBOLD the barcode of lifedata system (httpwwwbarcodinglifeorg)rdquoMolecular EcologyNotes vol 7 no 3 pp 355ndash364 2007

[40] P Langridge and K Chalmers ldquoThe principle identificationand application of molecular markersrdquo in Molecular MarkerSystems in Plant Breeding and Crop Improvement H Lorz andG Wenzel Eds vol 49 of Biotechnology in Agriculture andForestry pp 129ndash149 Springer Berlin Germany 2004

[41] PWinter andGKahl ldquoMolecularmarker technologies for plantimprovementrdquo World Journal of Microbiology amp Biotechnologyvol 11 no 4 pp 438ndash448 1995

[42] J G KWilliams A R Kubelik K J Livak J A Rafalski and SV Tingey ldquoDNApolymorphisms amplified by arbitrary primersare useful as geneticmarkersrdquoNucleic Acids Research vol 18 no22 pp 6531ndash6535 1990

[43] S V Tingey and J P del Tufo ldquoGenetic analysis with randomamplified polymorphic DNA markersrdquo Plant Physiology vol101 no 2 pp 349ndash352 1993

[44] I Haque R Bandopadhyay and K Mukhopadhyay ldquoAn opti-mised protocol for fast genomic DNA isolation from high sec-ondary metabolites and gum containing plantsrdquo Asian Journalof Plant Sciences vol 7 no 3 pp 304ndash308 2008

[45] S Samantaray K P Hidayath and S Maiti ldquoAn isolationprotocol of genomic DNA from Commiphora wightii (Arnott)Bhandari an endangered medicinal plantrdquo International Jour-nal of Integrative Biology vol 6 no 3 pp 127ndash131 2009

[46] S Suthar S Thul A K Kukreja and K G Ramawat ldquoRAPDmarkers reveal polymorphism in Commiphora wightii anendangered medicinal treerdquo Journal of Cell and Tissue Researchvol 8 no 2 pp 1477ndash1480 2008

[47] I Haque R Bandopadhyay and K Mukhopadhyay ldquoIntraspe-cific variation in Commiphora wightii populations based oninternal transcribed spacer (ITS1-58S-ITS2) sequences ofrDNArdquo Diversity vol 1 no 2 pp 89ndash101 2009

[48] Harish A K Gupta M Phulwaria M K Rai and N SShekhawat ldquoConservation genetics of endangered medicinalplantCommiphorawightii in IndianTharDesertrdquoGene vol 535no 2 pp 266ndash272 2014

[49] P Vyas andR Joshi ldquoAssessment ofmolecular variations amongdifferent biotypes of Commiphora wightii (Arnott) Bhandariusing RAPD markersrdquo International Journal of Innovative Sci-ence Engineering amp Technology vol 2 no 6 pp 328ndash338 2015

[50] A Kulhari R Singh A Chaudhury A K Dhawan and RK Kalia ldquoAssessment of genetic variability through ISSR andRAPD markers in Commiphora wightii (Arn) Bhandarirdquo ActaPhysiologiae Plantarum vol 37 article 113 2015

[51] S Samantaray K A Geetha K P Hidayath and S MaitildquoIdentification of RAPD markers linked to sex determinationin guggal [Commiphora wightii (Arnott)] Bhandarirdquo PlantBiotechnology Reports vol 4 no 1 pp 95ndash99 2010

[52] E Zietkiewicz A Rafalski and D Labuda ldquoGenome finger-printing by simple sequence repeat (SSR)-anchored polymerasechain reaction amplificationrdquo Genomics vol 20 no 2 pp 176ndash183 1994

[53] B Bornet and M Branchard ldquoNonanchored Inter SimpleSequence Repeat (ISSR) markers reproducible and specifictools for genome fingerprintingrdquo Plant Molecular BiologyReporter vol 19 no 3 pp 209ndash215 2001

[54] B Bornet C Muller F Paulus and M Branchard ldquoHighlyinformative nature of Inter Simple Sequence Repeat (ISSR)sequences amplified using tri- and tetra-nucleotide primersfrom DNA of cauliflower (Brassica oleracea var botrytis L)rdquoGenome vol 45 no 5 pp 890ndash896 2002

[55] J-G Parent and D Page ldquoIdentification of raspberry cultivarsby sequence characterized amplified region DNA analysisrdquoHortScience vol 33 no 1 pp 140ndash142 1998

[56] L Mariniello M G Sommella A Sorrentino M Forlani andR Porta ldquoIdentification ofPrunus armeniaca cultivars byRAPDand SCAR markersrdquo Biotechnology Letters vol 24 no 10 pp749ndash755 2002

[57] F C F Yau K L Wong P C Shaw P P H But and JWang ldquoAuthentication of snakes used in Chinese medicine bysequence characterized amplified region (SCAR)rdquo Biodiversityand Conservation vol 11 no 9 pp 1653ndash1662 2002

[58] R Bautista R Crespillo F M Canovas and M G ClarosldquoIdentification of olive-tree cultivars with SCAR markersrdquoEuphytica vol 129 no 1 pp 33ndash41 2003

[59] A S Parasnis V S Gupta S A Tamhankar and P K RanjekarldquoA highly reliable sex diagnostic PCR assay for mass screeningof papaya seedlingsrdquo Molecular Breeding vol 6 no 3 pp 337ndash344 2000

[60] O V Koveza Z G Kokaeva S A Gostimsky T V Petrova andE SOsipova ldquoCreation of a SCARmarker in peaPisum sativumL using RAPD analysisrdquo Russian Journal of Genetics vol 37 no4 pp 464ndash466 2001

[61] M S Arnedo-Andres R Gil-Ortega M Luis-Arteaga and J IHormaza ldquoDevelopment of RAPD and SCAR markers linkedto the Pvr4 locus for resistance to PVY in pepper (Capsicumannuum L)rdquoTheoretical and Applied Genetics vol 105 no 6-7pp 1067ndash1074 2002

[62] M S Negi M Devic M Delseny and M LakshmikumaranldquoIdentification of AFLP fragments linked to seed coat colourin Brassica juncea and conversion to a SCAR marker for rapidselectionrdquoTheoretical and Applied Genetics vol 101 no 1-2 pp146ndash152 2000

[63] M Xu and S S Korban ldquoAFLP-derived SCARs facilitate con-struction of a 11 Mb sequence-ready map of a region that spansthe Vf locus in the apple genomerdquo Plant Molecular Biology vol50 no 4-5 pp 803ndash818 2002


[64] H Schmidt M Ehrmann R F Vogel M H Taniwaki andL Niessen ldquoMolecular typing of Aspergillus ochraceus andconstruction of species specific SCAR-primers based on AFLPrdquoSystematic and Applied Microbiology vol 26 no 1 pp 138ndash1462003

[65] J Wang W-Y Ha F-N Ngan P P-H But and P-CShaw ldquoApplication of sequence characterized amplified region(SCAR) analysis to authenticate Panax species and their adul-terantsrdquo Planta Medica vol 67 no 8 pp 781ndash783 2001

[66] E A Scheef M D Casler and G Jung ldquoDevelopment ofspecies-specific SCAR markers in bentgrassrdquo Crop Science vol43 no 1 pp 345ndash349 2003

[67] M Das S Bhattacharya and A Pal ldquoGeneration and character-ization of SCARs by cloning and sequencing of RAPDproductsa strategy for species-specific marker development in bamboordquoAnnals of Botany vol 95 no 5 pp 835ndash841 2005

[68] PManoj N S Banerjee and P Ravichandran ldquoDevelopment ofsex-associated SCARmarkers in Piper longum Lrdquo Plant GeneticResources Newsletter vol 141 pp 44ndash50 2005

[69] M Y Lee E J Doh C H Park et al ldquoDevelopment of SCARmarker for discrimination of Artemisia princeps and A argyifrom other Artemisia herbsrdquo Biological and PharmaceuticalBulletin vol 29 no 4 pp 629ndash633 2006

[70] W Dnyaneshwar C Preeti J Kalpana and P Bhushan ldquoDevel-opment and application of RAPD-SCAR marker for identifica-tion ofPhyllanthus emblicaLinnrdquoBiological and PharmaceuticalBulletin vol 29 no 11 pp 2313ndash2316 2006

[71] R Rugienius T Siksnianas V Stanys D Gelvonauskiene andV Bendokas ldquoUse of RAPD and SCAR markers for identifi-cation of strawberry genotypes carrying red stele (Phytophtorafragariae) resistance gene Rpf1rdquo Agronomy Research vol 4 pp335ndash339 2006

[72] S D Basha and M Sujatha ldquoInter and intra-populationvariability of Jatropha curcas (L) characterized by RAPD andISSR markers and development of population-specific SCARmarkersrdquo Euphytica vol 156 no 3 pp 375ndash386 2007

[73] S D Basha G Francis H P S Makkar K Becker and MSujatha ldquoA comparative study of biochemical traits and molec-ular markers for assessment of genetic relationships betweenJatropha curcas L germplasm from different countriesrdquo PlantScience vol 176 no 6 pp 812ndash823 2009

[74] H Su L Wang Y Ge E Feng J Sun and L Liu ldquoDevel-opment of strain-specific SCAR markers for authenticationof Ganoderma lucidumrdquo World Journal of Microbiology andBiotechnology vol 24 no 7 pp 1223ndash1226 2008

[75] K M Devaiah and P Venkatasubramanian ldquoDevelopment ofSCAR marker for authentication of Pueraria tuberosa (Roxbex Willd) DCrdquo Current Science vol 94 no 10 pp 1306ndash13092008

[76] B Jin F-S Jiang J Yu Z-S Ding S-H Chen and G-YLv ldquoStudy on sequence characterized amplified region (SCAR)markers in Dendrobium candidumrdquo Zhong Yao Cai vol 33 no3 pp 343ndash346 2010

[77] A A Pankin and E E Khavkin ldquoGenome-specific scarmarkershelp solve taxonomy issues a case study with Sinapis arvensis(Brassiceae Brassicaceae)rdquo American Journal of Botany vol 98no 3 pp e54ndashe57 2011

[78] S Chen X Lu and L Wang ldquoStudy on sequence characterizedamplified region (SCAR) markers of Cornus officinalisrdquo Zhong-guo Zhong Yao Za Zhi vol 36 no 9 pp 1145ndash1149 2011

[79] C Chen L-N Duan X-L Zhou B-L Chen and C-XFu ldquoMolecular authentication of geo-authentic Scrophularia

ningpoensisrdquo Journal of Zhejiang University Science B vol 12no 5 pp 393ndash398 2011

[80] PTheerakulpisut N Kanawapee DMaensiri S Bunnag and PChantaranothai ldquoDevelopment of species-specific SCARmark-ers for identification of three medicinal species of PhyllanthusrdquoJournal of Systematics and Evolution vol 46 no 4 pp 614ndash6212008

[81] N I Naqvi and B B Chattoo ldquoDevelopment of a sequencecharacterized amplified region (SCAR) based indirect selectionmethod for a dominant blast-resistance gene in ricerdquo Genomevol 39 no 1 pp 26ndash30 1996

[82] Z Deng S Huang S Xiao and F G Gmitter Jr ldquoDevelopmentand characterization of SCAR markers linked to the Citrustristeza virus resistance gene from Poncirus trifoliatardquo Genomevol 40 no 5 pp 697ndash704 1997

[83] P Barret R Delourme N Foisset and M Renard ldquoDevel-opment of a SCAR (sequence characterised amplified region)marker for molecular tagging of the dwarf BREIZH (Bzh) genein Brassica napus Lrdquo Theoretical and Applied Genetics vol 97no 5 pp 828ndash833 1998

[84] F Lahogue P This and A Bouquet ldquoIdentification of acodominant SCAR marker linked to the seedlessness characterin grapevinerdquoTheoretical and Applied Genetics vol 97 no 5-6pp 950ndash959 1998

[85] P Hernandez A Martın and G Dorado ldquoDevelopment ofSCARs by direct sequencing of RAPD products a practical toolfor the introgression and marker-assisted selection of wheatrdquoMolecular Breeding vol 5 no 3 pp 245ndash253 1999

[86] J Aii M Nagano S H Woo C Campbell and T AdachildquoDevelopment of the SCAR markers linked to the Sh gene inbuckwheatrdquo Fagopyrum vol 16 pp 19ndash22 1999

[87] A-F Adam-Blondon F Lahogue-Esnault A Bouquet J MBoursiquot and P This ldquoUsefulness of two SCAR markers formarker-assisted selection of seedless grapevine cultivarsrdquo Vitisvol 40 no 3 pp 147ndash155 2001

[88] G S Ardiel T S Grewal P Deberdt B G Rossnagel and G JScoles ldquoInheritance of resistance to covered smut in barley anddevelopment of a tightly linked SCAR markerrdquoTheoretical andApplied Genetics vol 104 no 2 pp 457ndash464 2002

[89] M K Huh and K H Bang ldquoIdentification of Atractylodesjaponica and A macrocephala by RAPD analysis and SCARmarkersrdquo Silvae Genetica vol 55 no 3 pp 101ndash105 2006

[90] V M Whitaker J M Bradeen T Debener A Biber and S CHokanson ldquoRdr3 a novel locus conferring black spot diseaseresistance in tetraploid rose genetic analysis LRRprofiling andSCAR marker developmentrdquo Theoretical and Applied Geneticsvol 120 no 3 pp 573ndash585 2010

[91] C A McCartney R G Stonehouse B G Rossnagel et alldquoMapping of the oat crown rust resistance genePc91rdquoTheoreticaland Applied Genetics vol 122 no 2 pp 317ndash325 2011

[92] L Hu G Li H Zhan C Liu and Z Yang ldquoNew St-chromosome-specific molecular markers for identifyingwheatmdashThinopyrum intermedium derivative linesrdquo Journal ofGenetics vol 91 no 2 pp e69ndashe74 2011

[93] G H Xu W Y Su Y J Shu W W Cong L Wu and C HGuo ldquoRAPD and ISSR-assisted identification and developmentof three new SCARmarkers specific for theThinopyrum elonga-tum E (Poaceae) genomerdquoGenetics andMolecular Research vol11 no 2 pp 1741ndash1751 2012

[94] G Li and Y-J Park ldquoSCAR markers for discriminating speciesof two genera of medicinal plants Liriope and Ophiopogonrdquo


Genetics and Molecular Research vol 11 no 3 pp 2987ndash29962012

[95] Y Wang B Bi Q H Yuan X L Li and J M Gao ldquoAssociationofAFLP and SCARmarkerswith common leafspot resistance inautotetraploid alfalfa (Medicago sativa)rdquoGenetics andMolecularResearch vol 11 no 1 pp 606ndash616 2012

[96] Z Liu J Zhu Y Cui et al ldquoIdentification and comparativemap-ping of a powdery mildew resistance gene derived from wildemmer (Triticum turgidum var dicoccoides) on chromosome2BSrdquoTheoretical and Applied Genetics vol 124 no 6 pp 1041ndash1049 2012

[97] J K Kim G H An S-H Ahn et al ldquoDevelopment ofSCAR marker for simultaneous identification of Miscanthussacchariflorus M sinensis and M x giganteusrdquo Bioprocess andBiosystems Engineering vol 35 no 1-2 pp 55ndash59 2012

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


Table 1 Sequence of SCAR markers designed using 1 kb amplicon


Sc1P Sc1P (F) CTGTGAGGCATTTGTATATTTAA 23 bases 60∘C 631Sc1P (R) CTTGTGGTCTTTCAGTCAATAG 22 bases 62∘C

Sc1Pm Sc1P (F) CTGTGAGGCATTTGTATATTTAA 23 bases 60∘C 910Sc1Pm (R) CTTGAGAACGAAATCTAACAAG 22 bases 60∘C

and hypolipidemic activities that are mostly due to thepresence of these steroids [22 23] In 1986 Guggul lipids weregranted approval in India for marketing as a lipid-loweringdrug [24] Several products of standardized formulations ofC wightii were already in human use as cholesterol-loweringagents [22 25]

Commiphora species have been called ldquotaxonomicallydifficultrdquo because of being drought-tolerant plants and theyare leafless for most of the year [26] There is resemblanceof gum Guggul with gum resin of other species within andoutside of the genus which make high risk of adulterationin commercial samples either deliberately to get more profitor accidentally Therefore it is important to validate the Cwightii plants and their gum Guggul in commercial samplesdue to its various pharmacological significances [27] Manytypes of markers namely morphological biochemical andDNA based molecular markers are commonly used in theidentification of species [28] Molecular markers were usedin the identification of species and individual their originand difference at the molecular level in between them [29]During the last few decades the use of molecular markersrevealing polymorphism at the DNA level has been playingan increasing part in plant biotechnology and their geneticstudies These DNA based markers are differentiated intotwo types first is non-PCR based RFLP and second is PCRbased markers (RAPD AFLP SSR SNP etc) [30] RAPD isa PCR-based technology based on enzymatic amplificationof target or random DNA segments with arbitrary primersThe main advantage of RAPDs is that they are quick andeasy to assay had no sequence data required for primerconstruction randomly distributed throughout the genomeand had a dominant nature [31] However RAPD marker isnot suitable for the species identification because of their lowreproducibility and dominant nature [32] A RAPD markercan be converted into a codominant and reproduciblemarkerthat is Sequence-Characterized Amplified Region (SCAR)which may be applicable for authentication of species

Looking upon these problems it is necessary to developsome molecular marker for the identification of C wightiiIn the present study an attempt has been made for thedevelopment of SCAR markers for C wightii

2 Materials and Methods

Total 28 accessions of two different species of Commiphorathat is C wightii (17) and C myrrha (11) were collected fromBhopal Obaidullaganj (Madhya Pradesh) Akola (Maharash-tra) Anand (Gujarat) and Jaipur (Rajasthan) and conservedat MPCST Human Herbal Health Care Garden Bhopal

21 Selection of RAPD Primers and Amplicons GenomicDNA was isolated from fresh young stem C wightii and Cmyrrha using the method of Sairkar et al (unpublished)The yield of DNA was measured using a NanoDrop UV-Spectrophotometer (ND-1000) Genomic DNA was ampli-fied by the 20 primers (Table 1) A cocktail of 40 120583L reactionvolumes was made with 20120583L 2x red dye PCR mix (Merck)1 120583L primer (10 pM) and 1 120583L template DNA (25 ng120583L)and amplification was performed on the gradient automaticthermal cycler (Eppendorf) following Sairkar et al [33] ThePCR products were separated electrophoretically on 15agarose gel at 5ndash10 voltscm of the gel and visualized by ethid-ium bromide The specific amplicon which discriminatesbetweenC wightii andCmyrrha was selected and processedfor the development of SCAR marker

22 Cloning of Selected RAPD Amplicon The selected ampli-cons were eluted using Medox-Easy Spin Column CleanupMinipreps kit and ligated with the TA cloning vector(pGEM5Z Promega)The ligated TA vector was transformedinto competent cells of E coli (DH5120572) which was preparedusing single step ultracompetent cell preparation kit (Medox)The first selection of recombinant clones was based ondeveloped blue andwhite colonies on LB (Luria Burtani) agarplates containing 05mgmL ampicillin 24120583gmL IPTG and30 120583gmL X-gal The plasmid of white and blue colonies wasisolated throughMedox-Easy ultrapure spin column plasmidDNAminipreps kitThree selection steps that is clone retar-dation restriction digestion and amplification of plasmidwere adopted to identify positive insert within the plasmid Inretardation step plasmids were separated electrophoreticallyto observe the presence of insert within plasmid whilein restriction digestion plasmids were digested with PvuIIenzyme for insert release In the final step the plasmids wereamplified through the PCR reaction using 50120583L that consistof 25 120583L 2x red dye PCR mix (Merck) 1120583L each of forwardand reverseM-13 primers (10 pM each) 1120583L of plasmid DNA(25 ng120583L)with a PCRprofile of 94∘C for 12minutes 30 cyclesof 30 seconds at 94∘C 30 seconds at 55∘C and 45 secondsat 72∘C and final extension on 72∘C at 10 minutes using thegradient automatic thermal cycler (Eppendorf)

23 Designing and Screening of SCAR Marker Plasmid hav-ing desired amplicon was sequenced by Aristogene Pvt LtdBangalore India using M13 reverse and forward sequencingprimers and consensus sequence of ampliconswas developedThe homology search of consensus sequences was performedby the NCBI BLAST tool The primer pairs were designedfor these sequences by using PRIMER 3 software [34] and


M 1 2

(a)

M 1 2

(b)



3 Result



B 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21









M 1 32 4 5


M1 2 3 4 5 6 7 8 9




4 Discussion
























TGCCTAATCCC
























M 4 5 61 2 3

(a)M 5 7 8 641 2 3

(b)

M 5 7 8641 2 3

(c)










M 5 7 8641 2 3

(a)

M 5 7 8641 2 3

(b)

L 5 7641 2 3 8 9 10 11 12 13 14 15 16 17 18

(c)









Acknowledgments


References















































































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


M 1 2

(a)

M 1 2

(b)



3 Result



B 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21









M 1 32 4 5


M1 2 3 4 5 6 7 8 9




4 Discussion
























TGCCTAATCCC
























M 4 5 61 2 3

(a)M 5 7 8 641 2 3

(b)

M 5 7 8641 2 3

(c)










M 5 7 8641 2 3

(a)

M 5 7 8641 2 3

(b)

L 5 7641 2 3 8 9 10 11 12 13 14 15 16 17 18

(c)









Acknowledgments


References















































































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology






M 1 32 4 5


M1 2 3 4 5 6 7 8 9




4 Discussion
























TGCCTAATCCC
























M 4 5 61 2 3

(a)M 5 7 8 641 2 3

(b)

M 5 7 8641 2 3

(c)










M 5 7 8641 2 3

(a)

M 5 7 8641 2 3

(b)

L 5 7641 2 3 8 9 10 11 12 13 14 15 16 17 18

(c)









Acknowledgments


References















































































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


M 4 5 61 2 3

(a)M 5 7 8 641 2 3

(b)

M 5 7 8641 2 3

(c)










M 5 7 8641 2 3

(a)

M 5 7 8641 2 3

(b)

L 5 7641 2 3 8 9 10 11 12 13 14 15 16 17 18

(c)









Acknowledgments


References















































































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


M 5 7 8641 2 3

(a)

M 5 7 8641 2 3

(b)

L 5 7641 2 3 8 9 10 11 12 13 14 15 16 17 18

(c)









Acknowledgments


References















































































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology













































































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

research article scar marker for identification and...

Documents