research article molecular characterization of

Research ArticleMolecular Characterization of Cryptosporidium spp inWild Rodents of Southwestern Iran Using 18s rRNA GeneNested-PCR-RFLP and Sequencing Techniques

Jasem Saki12 Masoud Foroutan-Rad3 and Reza Asadpouri2

1Health Research Institute Infectious and Tropical Diseases Research Center Ahvaz Jundishapur University of Medical ScienceAhvaz Iran2Department of Medical Parasitology Faculty of Medicine Ahvaz Jundishapur University of Medical Sciences Ahvaz Iran3Department of Parasitology Faculty of Medical Sciences Tarbiat Modares University Tehran Iran

Correspondence should be addressed to Masoud Foroutan-Rad masoud foroutan radyahoocom

Received 1 August 2016 Revised 5 October 2016 Accepted 26 October 2016

Academic Editor Jean-Paul J Gonzalez

Copyright copy 2016 Jasem Saki et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Background Rodents could act as reservoir for Cryptosporidium spp specially C parvum a zoonotic agent responsible for humaninfections Since there is no information about Cryptosporidium infection in rodents of Ahvaz city southwest of Iran hence thissurvey was performed to determine the prevalence andmolecular characterization ofCryptosporidium spp in this regionMaterialsand Methods One hundred rodents were trapped from different regions of Ahvaz city Intestine contents and fecal specimens ofrodents were studied using bothmicroscopy examination to identify oocyst and nested-polymerase chain reaction (PCR) techniquefor 18s rRNA gene detection Eventually restriction fragment length polymorphism (RFLP) method using SspI andVspI restrictionenzymes was carried out to genotype the species and then obtained results were sequenced Results Three out of 100 samples werediagnosed as positive and overall prevalence of Cryptosporidium spp was 3 using both modified Ziehl-Neelsen staining underlight microscope and nested-PCR (830 bp) methods Afterwards PCR-RFLP was performed on positive samples and C parvumpattern was identified Finally PCR-RFLP findings were sequenced and presence of C parvum was confirmed again ConclusionsOur study showed rodents could be potential reservoir for C parvum So an integrated program for control and combat with themshould be adopted and continued

1 Introduction

Cryptosporidium spp are ubiquitous intracellular protozoanparasites that affect wide range of vertebrates like human andlivestock [1] Oocysts are infective stage of life cycle releasedvia feces from infected hosts to environment in large amountThey are resistant to various environmental alterations andremain infective for long period in appropriate conditionlike surface of water and moist soils thus they are liable fortransmission of disease to animals and humans [2 3] Cryp-tosporidium as an opportunistic agent infects the alimentarytract of hosts and have wide spectrum of clinical symptomsin human ranging from self-limiting and asymptomatic inimmunocompetent individuals to severe and life-threateningin immunocompromised persons [2 4 5] For first time

human cryptosporidiosis was diagnosed in individuals whohad severe watery diarrhea during 1970s [6]

During past decades numerous evidences have con-firmed that small mammals such as rodents are consideredas carrier or reservoir for several infectious agents They cantransmit the pathogens directly or indirectly Also role ofrodents in transferring the helminth and protozoan infec-tions are clear [7ndash10] Surveys in different zones of Iranindicate the existence of various rodent species such as thehouse mice (Mus musculus) the black rat (Rattus rattus)the brown rat (Rattus norvegicus) and the Himalayan rat(Rattus pectoris) in country [8 10 11] Based on our previoussurvey in Ahvaz district southwest of Iran rodents could beconsidered as potential source ofToxoplasma gondii infectionfor definitive hosts [9]

Hindawi Publishing CorporationJournal of Tropical MedicineVolume 2016 Article ID 6834206 6 pageshttpdxdoiorg10115520166834206

2 Journal of Tropical Medicine

Recently several molecular studies have been conductedto determine the Cryptosporidium genotypes Small subunit-rRNA (SSU 18s rRNA) gene is being utilized for identi-fication of Cryptosporidium spp worldwide extensively Ac-cording to SSU-rRNA gene sequencing at least 20 Cryp-tosporidium species have been identified and more than six-ty Cryptosporidium genotypes have undeterminate statustill now Approximately eight Cryptosporidium speciesgeno-types includingC parvumC hominisC felisCmeleagridisC ubiquitum C viatorum C canis and C cuniculus arethe main species responsible for human infections althoughC hominis and C parvum account for over 90 of humancryptosporidiosis worldwide [1 2]

Numerous epidemiological surveys have been performedthroughout the globe and prevalence of Cryptosporidiuminfection in rodents was highly varied from 63 in UK[12] 328 in United States of America (USA) [13] 243in Italy [14] 76 in Maryland [15] 115 in China [16]258 in Philippines [17] 82 in northern Australia [18]0 in northeast of Iran (Mashhad city) [19] and 273 innorth of Iran (Tehran city) [20] Due to lack of reports aboutCryptosporidium infection in rodents of southwest of Iran tillnow current study was aimed to determine the prevalenceand molecular characterization of Cryptosporidium spp inthis region

2 Materials and Methods

21 Study Area Ahvaz city capital of Khuzestan provincewhich is located in the southwest of Iran (31∘501015840 N and 49∘111015840 E) is ranked as the 7th largest city throughout the countryand based on the latest census its population was calculatedat 1395184 in 352128 familiesWeather temperature is highlyvariable throughout the year so that in summer temperatureexceeds 50∘C whereas in winter it falls to 5∘C Also annualaverage rainfall is approximately 230mm There is highdensity of rodents species and rat-man-domestic animalsadjacency is remarkable in Ahvaz city [9 11] Rodents areadditional reservoir for Cryptosporidium spp mostly preyedon by cats and dogs and hence could spread parasiticinfections via other animals [8]

22 Rodents Collection Ahvaz city initially divided into fivegeographical locations (north west south east and center)In each location Sherman live traps were placed outdoor atthe entrance of rodent colonies and baited with favorite pieceof foods (including cucumber pieces tomato and roastedalmonds)The Sherman live traps were installed at sunset andgathered before sunrise Overall 100 rodents were collectedfrom three different species (6M musculus 73 R norvegicusand 21 R rattus) Eventually trapped rodents were gath-ered and transferred to Department of Medical Parasitologyof Ahvaz JundishapurUniversity of Medical Sciences Thetrapped rodents were anaesthetized by putting the live trapsin a thick transparent polythene bag and then a cotton swabwas soaked in ether and placed near their nose Afterwardsthe anaesthetized rodents were dissected and fecal samplesgathered from rectum or large intestinal section Skull and

tooth structures were used for species identification TheIranian rodent key of Etemad was performed to identify therodents [21]

23 Detection of Cryptosporidium spp Oocysts Samples werecollected from intestine contents and fecal specimens ofrodents After sugar flotation (SG 1266 128 g sucrose and100 distilled water) [22] andmodified Ziehl-Neelsen stainingthe samples were examined to find the Cryptosporidium sppoocysts using opticalmicroscope undertimes1000magnificationDiagnosis of oocysts was based on morphological featureslike red spherical shapes Finally the samplesweremaintainedat 25 potassium dichromate (K

2Cr2O7) [23] and kept in

refrigerator (1-2 weeks) until DNA was extracted

24 DNA Extraction and Nested-PCR DNA extraction pro-cedure was performed using QIAamp DNA stool minikit (QIAamp DNA Stool Mini Kit USA) based on themanufacturerrsquos guideline The extracted DNA was kept inminus20∘C for next tests For nested-PCR method we used twospecific primers to detect 18s rRNA gene whose length ofproduced fragments was 1325 bp and 830 bp This dual stagestechnique was run using different primers that primary andsecondary stages primers were as following [4 20 23 24]

First Stage Primers

Forward (F1) 51015840-TTCTAGAGCTAATACATGCG-31015840

Reverse (R1) 51015840-CCCATTTCCTTCGAAACAGGA-31015840

Second Stage Primers

Forward (F2) 51015840-GGAAGGGTTGTATTTATT-AGATAAAG-31015840

Reverse (R2) 51015840-CTCATAAGGTGCTGAAGG-AGTA-31015840

Finally PCR products after loading on 15 agarose gel andelectrophoresis for 15 hours were stained with ethidiumbromide and then visualized under UV light using Gel Docdevice (Uvidoc Gel Documentation System CambridgeUK) [25]

25 Genotyping Cryptosporidium spp Using 18s rRNA PCR-RFLP and Sequencing RFLP assay was done to determinethe Cryptosporidium spp using digestion of secondary PCRproducts For this purpose SspI and VspI endonucleaseenzymes were employed for species recognition and geno-typing respectively based on manufacturerrsquos protocol asearlier described [20] Then the mixture was incubatedfor approximately 8 hours at 37∘C Eventually visualiza-tion of the digested products was carried out under UVtransilluminator after 15 agarose gel electrophoresis andethidium bromide staining [20 26] The nested-PCR pos-itive samples were purified using Bioneer kit corporation(Korea) and were sequenced by the same corporationSequence alignments were constructed by CLUSTAL Wsoftware (httpwwwddbjnigacjpsearchclustalwehtml)

Journal of Tropical Medicine 3

M 1 432

100 bp

200 bp

500 bp

800 bp

Figure 1 Secondary stage of nested-PCR findings on agarose gelLaneM DNA size marker Lane 1 positive control for Cryptosporid-ium Lanes 2ndash4 positive Cryptosporidium samples (830 bp)

Nucleotide sequence data reported in current article areavailable in the GenBank at accession numbers AB986579AB986580 and AB986581

3 Results

Three out of 100 samples were detected as positive forCryptosporidium spp using modified Ziehl-Neelsen stainingunder light microscope In addition nested-PCR was doneand showed 830 bp band which confirmed only 3 samplesas Cryptosporidium spp (Figure 1) So overall prevalenceof Cryptosporidium infection in rodents of Ahvaz city wascalculated at 3 using both methods All positive samplesbelonged to R norvegicus (373) and fromM musculus (06)and R rattus (021) no positive cases were observed In orderto determine the genotype PCR-RFLP technique using SspIand VspI restriction enzymes was utilized With SspI restric-tion enzyme three cuttings were seen in locations of 108258 and 421 bp visible on agarose gel after electrophoresisAlso after using from VspI enzyme three cuttings happenedin locations 104 106 and 600 bp (Figure 2) and indicate Cparvum pattern The amplified 18s rRNA genes from PCR-RFLP products of three C parvum were sequenced Aftersubmitting the results to the DDBJGenBank at accessionnumbers AB986579 AB986580 and AB986581 the nucle-otide sequences were aligned with nucleotide sequences ofC parvum certified in GenBank with accession numberAB986578 (Figure 3) Based on findings C parvum wasrecognized as infectious agent of Ahvaz rodents

4 Discussion

Cryptosporidium spp belong to Apicomplexa phylum withcosmopolitan distribution [1] Rodents with maintaining the

pathogens transmission cycle in surrounding regions play akey role in morbidity and mortality of human and livestockespecially in areas with dense population [7]

The routine method for diagnosis of Cryptosporidiumspp is based on direct observation of oocysts in stoolspecimens using optical microscope Since this method haslow sensitivity and needs expertise also it is unable to distin-guish between different species of parasites thus moleculartechniques like PCR have been used and developed recentlyPCR-based techniques with high sensitivity specificity andrapidly features are capable of differentiating among speciesand genotypes in different specimens that is water stooland animal or human tissues although they are expensivePreviously genotyping of Cryptosporidium spp has beendone successfully by nested PCR-RFLP method according toSSU-rRNA (18S rRNA) gene [4 18 20 24 26 27]

According to previous epidemiological reports preva-lence and rate of infection ofCryptosporidium spp in rodentsranged from 0 to 63 and could be highly variableworldwide [12 19] Present investigation is the first reportwhich focused on the prevalence and molecular detection ofCryptosporidium spp inwild rodents of Ahvaz city southwestof Iran We found 3 (3100) prevalence by both directmicroscopic observations with Ziehl-Neelsen staining andnested-PCR (830 bp) while in Bahrami et al [20] surveyin Tehran city (capital of Iran) using these methods theprevalence was reported at 13 and 273 respectively Alsoall positive samples identified C parvum by PCR-RFLP usingSspI and VspI restriction enzymes and were confirmed bysequencing that is in agreement with our study Differencesbetween Tehran and Ahvaz findings could be justified withsample size location of sampling cities population hygienicconditions sewage systems and so forth It is worth men-tioning that Tehran as capital of Iran is the most crowdedcity with highest density population over the country whichis multifold than Ahvaz In Mashhad city (northeast of Iran)prevalence of Cryptosporidium spp with 0 [19] was lowerthan our study (3) while higher prevalence was reportedfrom USA 328 [13] China 115 [16] Australia 82 [18]Philippines 258 [17] and Tehran city (north of Iran) 273[20]

Based on current study 18s rRNA gene of C parvumwas detected only in R norvegicus (373) and from Rrattus and M musculus no positive samples were isolatedIt should be mentioned that R norvegicus is the mostabundant rodent in southwest of Iran (73100) and highestprevalence and rate of infection (41 373) allocate to thisspecies which corresponds to previous investigations [9 11]The obtained results of amplifying 18s rRNA gene aftersequencing were submitted to the DDBJGenBank underaccession numbersAB986579 AB986580 andAB986581 andthen compared with AB986578 as control Figure 3 illustratedseveral nucleotide replacements

Lv and colleagues [16] studied the wild laboratoryand pet rodents (totally 723 rodents from 18 species) inChina and prevalence of Cryptosporidium spp was reportedat 115 and C parvum C muris C andersoni and Cwrairi were identified as well Prevalence in wild laboratoryand pet rodents was 68 19 and 218 respectively


M 1 432

100 bp

200 bp

500 bp

(a)

M 1 432

100 bp

200 bp

600 bp

(b)

Figure 2 (a) PCR-RFLP products with SspI restriction enzyme Three cuttings in locations 108 258 and 421 bp are visible on gelelectrophoresis (b) PCR-RFLP products with VspI restriction enzymeThree cuttings in locations 104 106 and 600 bp are visible on agarosegel Lane M DNA size marker Lane 1 positive control for Cryptosporidium Lanes 2ndash4 positive Cryptosporidium samples

AB9865781GTAATTGGGGTGGCTCATAAAB9865811CCTTTCGGGTAGGTGATGGTAB9865791ACGGGTATAAATTGGGTTGAAB9865801ACCCATTTTAAATTGGGTTG

AB9865781GTAATTGGGGTGGCTCATAA AGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAA 292AB9865811CCTTTCGGGTAGGTGATGGT AGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAA 297AB9865791ACGGGTATAAATTGGGTTGA AGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAA 299AB9865801ACCCATTTTAAATTGGGTTG AGTCTGGTGCCTGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAA 300

AB9865781GTAATTGGGGTGGCTCATAAAB9865811CCTTTCGGGTAGGTGATGGT AGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCTGTTAATAATTTATA 347AB9865791ACGGGTATAAATTGGGTTGAAB9865801ACCCATTTTAAATTGGGTTG

AB9865781GTAATTGGGGTGGCTCATAA TAAAATATTTTGATGAATATTTATATAATATTAACATAATTCATATTACT 392AB9865811CCTTTCGGGTAGGTGATGGT TAAAATATTTTGATGAATATTTATATAATATTAACATAATTCATATTACT 397AB9865791ACGGGTATAAATTGGGTTGA TAAAATATTTTGATGAATATTTATATAATATTAACATAATTCATATTACT 399AB9865801ACCCATTTTAAATTGGGTTG TAAAACATTTTGAGGAATATTTATATAATATTAACATAATTCATAGTGCT 400

ATTGGAATGAGTTAAGTATAAACCCCTTTACAAGTATCAATTGGAGGGCA 242ATTGGAATGAGTTAAGTATAAACCCCTTTACAAGTATCAATTGGAGGGCA 247ATTGGAATGAGTTAAGAATAAACCCCTTTACAAGTATCAATTGGAGGGCA 249ATTGGAATGAGTTAAGTATAAACCCCTTTACAAGTATCAATTGGAGGGCA 250

AGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCTGTTAATAATTTATA 342

AGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCTGTTAATAATTTATA 349AGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCTGTTAATAATTTATA 350lowastlowastlowastlowastlowastlowast lowast lowast lowast lowastlowast lowast lowast lowast lowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowast

lowastlowastlowastlowastlowast lowast lowast lowastlowast lowast lowast lowast lowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowast lowast lowastlowast

lowastlowastlowastlowastlowastlowast lowast lowast lowastlowast lowast lowast lowast lowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowast

lowastlowastlowastlowastlowastlowast lowast lowast lowastlowast lowast lowast lowast lowastlowastlowast lowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowastlowast

Figure 3 Multiple alignments of 18s rRNA genes from three isolates which submitted to GenBank at accession numbers AB986579AB986580 and AB986581 Asterisks (lowast) show identical nucleotides

In another survey by Ng-Hublin et al [17] on 194 wild ratsand mice from five species including the Asian house rat (Rtanezumi) the rice-field rat (R argentiventer) the Pacific rat(R exulans) R norvegicus and M musculus in Philippinesoverall prevalence was reported at 258 In addition basedon sequencing and phylogenetic analysis of 18s rRNA geneand actin locus C muris C parvum C scrofarum C suis-like genotype and rat genotypes IndashIV were recognized Incurrent research only C parvum was identified using 18srRNA gene sequencing Throughout the world C parvumhave been isolated from numerous animals such as calves or

cattle [24] some ruminants (goats and sheep) [28] horses[29] pigs [30] alpacas [31] some carnivores (gray wolves anddogs) [32 33] reptiles [27] and rodents (rat hamster micenutria chipmunk squirrel and capybara) [13 16 17 20 34ndash37] In addition predominantCryptosporidium species in Iranis C parvum that has been verified frequently for example733 in humans and animals [38] 833 in Tehran (humansamples) [39] 100 in rodents of Tehran [20] 100 in cattleof Ilam [24] and 688 in Ahvaz (in immunocompromisedpatients and children) [4] In Rafiei et al investigation insouthwest of Iran on immunocompromised patients and


children (kidney transplant recipients persons with hema-tological malignancies HIV+ patients and children lessthan 5 years old) 390 stool specimens were collected andexamined Prevalence of Cryptosporidium spp was 41(16390) Moreover 3 different species were identified usingPCR-RFLP based on 18s rRNA gene including 11 C parvum4 C hominis and 1 C meleagridis [4] which was in consistentwith our results According to Rafiei et al [4] survey and ourstudy C parvum was identified as the most common speciesin both rodents and individuals in Ahvaz city In past studiesC parvum transmission from rodents to humanwas reportedrepeatedly [17 40]

5 Limitations

The present investigation was based on sampling of limitedrodents species in limited areas In future for better under-standing of exact burden ofCryptosporidium spp and geneticdiversity studies should be designed on wide spectrum ofboth wild and pet rodents (rats hamsters mice rabbits etc)in vast regions like throughout the Khuzestan province

6 Conclusion

Present paper was the first report which focused on theprevalence and molecular characterization of Cryptosporid-ium spp in wild rodents of Ahvaz city southwest of Iranthat showed rate of infection in R norvegicus is remarkableAlso rodents could be potential reservoir for C parvum Theresults can help public health care to pursue new strategies(environmental sanitation increasing the hygienic conditionincreasing the hygienic condition etc) In future adoptinga suitable strategy for control and combat with rodents inorder to decrease human cases is necessary and should becontinued

Ethical Approval

All applicable international national andor institutionalguidelines for the care and use of animals were followed

Competing Interests

The authors declare that they have no conflict of interests

Authorsrsquo Contributions

Jasem Saki contributed toward concept design and defi-nition of intellectual content Reza Asadpouri collected thesamples and performed the experiments Masoud Foroutan-Rad contributed to the literature search and manuscriptpreparation Jasem Saki and Masoud Foroutan-Rad editedand reviewed the manuscript

Acknowledgments

This study was conducted and financially supported byAhvaz Jundishapur University of Medical Sciences Grant no

CMRC-91 The authors appreciate the support of the staff ofthe Protozoology Laboratory at the JundishapurUniversity ofMedical SciencesThey would like to thankMr Nezam Salehifor his help in collecting the samples

References

[1] J Plutzer and P Karanis ldquoGenetic polymorphism in Cryp-tosporidium species an updaterdquo Veterinary Parasitology vol165 no 3-4 pp 187ndash199 2009

[2] M Bouzid P R Hunter R M Chalmers and K M TylerldquoCryptosporidium pathogenicity and virulencerdquo Clinical Micro-biology Reviews vol 26 no 1 pp 115ndash134 2013

[3] K Shi F Jian C Lv et al ldquoPrevalence genetic characteristicsand zoonotic potential of Cryptosporidium species causinginfections in farm rabbits in Chinardquo Journal of Clinical Microbi-ology vol 48 no 9 pp 3263ndash3266 2010

[4] A Rafiei Z Rashno A Samarbafzadeh and S KhademvatanldquoMolecular characterization of Cryptosporidium spp Isolatedfrom immunocompromised patients and childrenrdquo JundishapurJournal of Microbiology vol 7 no 4 Article ID e9183 2014

[5] S Gholami M Khanmohammadi E Ahmadpour et al ldquoCryp-tosporidium infection in patients with gastroenteritis in SariIranrdquo Iranian Journal of Parasitology vol 9 no 2 pp 226ndash2322014

[6] F A Nime J D Burek D L Page M A Holscher and J HYardley ldquoAcute enterocolitis in a human being infected with theprotozoanCryptosporidiumrdquoGastroenterology vol 70 no 4 pp592ndash598 1976

[7] B GMeerburg G R Singleton and A Kijlstra ldquoRodent-bornediseases and their risks for public healthrdquo Critical Reviews inMicrobiology vol 35 no 3 pp 221ndash270 2009

[8] R Dehghani H Seyedi S Dehqan and H Sharifi ldquoGeograph-ical distribution of mouse and mouse-borne diseases in Iran areview articlerdquo Feyz vol 17 pp 203ndash219 2013

[9] J Saki and S Khademvatan ldquoDetection of Toxoplasma gondiiby PCR and mouse bioassay in rodents of Ahvaz DistrictSouthwestern Iranrdquo BioMed Research International vol 2014Article ID 383859 5 pages 2014

[10] Z Seifollahi B Sarkari M H Motazedian Q Asgari MJ Ranjbar and S Abdolahi Khabisi ldquoProtozoan parasitesof rodents and their zoonotic significance in Boyer-AhmadDistrict Southwestern Iranrdquo Veterinary Medicine Internationalvol 2016 Article ID 3263868 5 pages 2016

[11] E Kia M Homayouni A Farahnak M Mohebail and SShojai ldquoStudy of endoparasites of rodents and their zoonoticimportance inAhvaz SouthWest Iranrdquo Iranian Journal of PublicHealth vol 30 pp 49ndash52 2001

[12] J PWebster andDWMacdonald ldquoCryptosporidiosis reservoirin wild brown rats (Rattus norvegicus) in the UKrdquo Epidemiologyand Infection vol 115 no 1 pp 207ndash209 1995

[13] Y Feng K A Alderisio W Yang et al ldquoCryptosporidiumgenotypes in wildlife from a New York watershedrdquo Applied andEnvironmental Microbiology vol 73 no 20 pp 6475ndash64832007

[14] M Kvac L Hofmannova S Bertolino L Wauters G Tosiand D Modry ldquoNatural infection with two genotypes ofCryptosporidium in red squirrels (Sciurus vulgaris) in ItalyrdquoFolia Parasitologica vol 55 no 2 pp 95ndash99 2008

[15] L Zhou R Fayer J M Trout U M Ryan F W Schaefer IIIand L Xiao ldquoGenotypes of Cryptosporidium species infecting


fur-bearing mammals differ from those of species infectinghumansrdquo Applied and Environmental Microbiology vol 70 no12 pp 7574ndash7577 2004

[16] C Lv L Zhang R Wang et al ldquoCryptosporidium spp in wildlaboratory and pet rodents in China prevalence and molecularcharacterizationrdquoApplied and Environmental Microbiology vol75 no 24 pp 7692ndash7699 2009

[17] J S Y Ng-Hublin G R Singleton and U Ryan ldquoMolecularcharacterization of Cryptosporidium spp from wild rats andmice from rural communities in the Philippinesrdquo InfectionGenetics and Evolution vol 16 pp 5ndash12 2013

[18] A Paparini B Jackson S Ward S Young and U M RyanldquoMultiple Cryptosporidium genotypes detected in wild blackrats (Rattus rattus) from northern Australiardquo ExperimentalParasitology vol 131 no 4 pp 404ndash412 2012

[19] H Borji J Khoshnegah G Razmi H Amini and M Shari-atzadeh ldquoA survey on intestinal parasites of golden hamster(Mesocricetus auratus) in the northeast of Iranrdquo Journal ofParasitic Diseases vol 38 no 3 pp 265ndash268 2014

[20] F Bahrami J Sadraei and M Frozandeh ldquoMolecular char-acterization of Cryptosporidium spp in Wild Rats of TehranIran using 18s rRNA gene and PCR RFLPmethodrdquo JundishapurJournal of Microbiology vol 5 no 3 pp 486ndash490 2012

[21] E Etemad Mammals of Iran Vol 1 (Rodents and their identi-fication keys) A publication of the National Society for NaturalResource and Environment Conservation Iran 1978

[22] T Fujino T Matsuo M Okada and T Matsui ldquoDetectionof a small number of Cryptosporidium parvum oocysts bysugar floatation and sugar centrifugation methodsrdquo Journal ofVeterinary Medical Science vol 68 no 11 pp 1191ndash1193 2006

[23] M Pirestani J Sadraei A Dalimi Asl M Zavvar and HVaeznia ldquoMolecular characterization of Cryptosporidium iso-lates from human and bovine using 18s rRNA gene in Shahriarcounty of Tehran Iranrdquo Parasitology Research vol 103 no 2 pp467ndash472 2008

[24] M Mahami Oskouei E Fallah M Ahmadi et al ldquoMolecularand parasitological study of Cryptosporidium isolates fromcattle in Ilam west of Iranrdquo Iranian Journal of Parasitology vol9 no 3 pp 435ndash440 2014

[25] M Foroutan-Rad S Khademvatan J Saki and M Hashemita-bar ldquoHolothuria leucospilota extract induces apoptosis in Leish-mania major promastigotesrdquo Iranian Journal of Parasitologyvol 11 pp 339ndash349 2016

[26] K Manouchehri Naeini M Asadi and M HashemzadeChaleshtori ldquoDetection and molecular characterization ofCryptosporidium species in recreational waters of Chaharmahalva Bakhtiyari province of Iran using nested-PCR-RFLPrdquo IranianJournal of Parasitology vol 6 pp 20ndash27 2011

[27] L Xiao U M Ryan T K Graczyk et al ldquoGenetic diversity ofCryptosporidium spp in captive reptilesrdquo Applied and Environ-mental Microbiology vol 70 no 2 pp 891ndash899 2004

[28] J Quılez E Torres R M Chalmers S J Hadfield E DelCacho and C Sanchez-Acedo ldquoCryptosporidium genotypesand subtypes in lambs and goat kids in Spainrdquo Applied andEnvironmental Microbiology vol 74 no 19 pp 6026ndash60312008

[29] R M Chalmers A L Thomas B A Butler and M C GMorel ldquoIdentification of Cryptosporidium parvum genotype 2in domestic horsesrdquo Veterinary Record vol 156 no 2 pp 49ndash50 2005

[30] M Kvac B Sak D Hanzlıkova J Kotilova and D KvetonovaldquoMolecular characterization of Cryptosporidium isolates from

pigs at slaughterhouses in South Bohemia Czech RepublicrdquoParasitology Research vol 104 no 2 pp 425ndash428 2009

[31] D F Twomey A M Barlow S Bell et al ldquoCryptosporidiosisin two alpaca (Lama pacos) holdings in the South-West ofEnglandrdquo Veterinary Journal vol 175 no 3 pp 419ndash422 2008

[32] A Giangaspero R Iorio B Paoletti D Traversa andG CapellildquoMolecular evidence for Cryptosporidium infection in dogs inCentral Italyrdquo Parasitology Research vol 99 no 3 pp 297ndash2992006

[33] A Paziewska M Bednarska H Niewegłowski G Karbowiakand A Bajer ldquoDistribution ofCryptosporidium andGiardia sppin selected species of protected and gamemammals fromnorth-eastern Polandrdquo Annals of Agricultural and EnvironmentalMedicine vol 14 no 2 pp 265ndash270 2007

[34] M V Meireles R M Soares F Bonello and S M GennarildquoNatural infection with zoonotic subtype of Cryptosporidiumparvum in Capybara (Hydrochoerus hydrochaeris) from BrazilrdquoVeterinary Parasitology vol 147 no 1-2 pp 166ndash170 2007

[35] A Bajer S Caccio M Bednarska J M Behnke N J Pieniazekand E Sinski ldquoPreliminary molecular characterization of Cryp-tosporidium parvum isolates of wildlife rodents from PolandrdquoJournal of Parasitology vol 89 no 5 pp 1053ndash1055 2003

[36] U Ryan L Xiao C Read L Zhou A A Lal and I PavlasekldquoIdentification of novel Cryptosporidium genotypes from theCzech Republicrdquo Applied and Environmental Microbiology vol69 no 7 pp 4302ndash4307 2003

[37] F Berrilli D Di Cave C Orazi et al ldquoGiardia and Cryp-tosporidium in kennel dogs pet rabbits and hamsters fromRome (Italy)rdquo Parassitologia vol 48 no 1-2 p 261 2006

[38] A R Meamar K Guyot G Certad et al ldquoMolecular character-ization of Cryptosporidium isolates from humans and animalsin Iranrdquo Applied and Environmental Microbiology vol 73 no 3pp 1033ndash1035 2007

[39] ADalimi F Tahvildar-Biderouni F Ghaffarifar andB KazemildquoThe identification of human Cryptosporidium species inTehran by PCRRFLPrdquo Modares Journal of Medical SciencesPathobiology vol 17 pp 39ndash48 2014

[40] L Xiao and R Fayer ldquoMolecular characterisation of species andgenotypes of Cryptosporidium and Giardia and assessment ofzoonotic transmissionrdquo International Journal for Parasitologyvol 38 no 11 pp 1239ndash1255 2008

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014


MEDIATORSINFLAMMATION

of


Behavioural Neurology

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom


Recently several molecular studies have been conductedto determine the Cryptosporidium genotypes Small subunit-rRNA (SSU 18s rRNA) gene is being utilized for identi-fication of Cryptosporidium spp worldwide extensively Ac-cording to SSU-rRNA gene sequencing at least 20 Cryp-tosporidium species have been identified and more than six-ty Cryptosporidium genotypes have undeterminate statustill now Approximately eight Cryptosporidium speciesgeno-types includingC parvumC hominisC felisCmeleagridisC ubiquitum C viatorum C canis and C cuniculus arethe main species responsible for human infections althoughC hominis and C parvum account for over 90 of humancryptosporidiosis worldwide [1 2]

Numerous epidemiological surveys have been performedthroughout the globe and prevalence of Cryptosporidiuminfection in rodents was highly varied from 63 in UK[12] 328 in United States of America (USA) [13] 243in Italy [14] 76 in Maryland [15] 115 in China [16]258 in Philippines [17] 82 in northern Australia [18]0 in northeast of Iran (Mashhad city) [19] and 273 innorth of Iran (Tehran city) [20] Due to lack of reports aboutCryptosporidium infection in rodents of southwest of Iran tillnow current study was aimed to determine the prevalenceand molecular characterization of Cryptosporidium spp inthis region

2 Materials and Methods

21 Study Area Ahvaz city capital of Khuzestan provincewhich is located in the southwest of Iran (31∘501015840 N and 49∘111015840 E) is ranked as the 7th largest city throughout the countryand based on the latest census its population was calculatedat 1395184 in 352128 familiesWeather temperature is highlyvariable throughout the year so that in summer temperatureexceeds 50∘C whereas in winter it falls to 5∘C Also annualaverage rainfall is approximately 230mm There is highdensity of rodents species and rat-man-domestic animalsadjacency is remarkable in Ahvaz city [9 11] Rodents areadditional reservoir for Cryptosporidium spp mostly preyedon by cats and dogs and hence could spread parasiticinfections via other animals [8]

22 Rodents Collection Ahvaz city initially divided into fivegeographical locations (north west south east and center)In each location Sherman live traps were placed outdoor atthe entrance of rodent colonies and baited with favorite pieceof foods (including cucumber pieces tomato and roastedalmonds)The Sherman live traps were installed at sunset andgathered before sunrise Overall 100 rodents were collectedfrom three different species (6M musculus 73 R norvegicusand 21 R rattus) Eventually trapped rodents were gath-ered and transferred to Department of Medical Parasitologyof Ahvaz JundishapurUniversity of Medical Sciences Thetrapped rodents were anaesthetized by putting the live trapsin a thick transparent polythene bag and then a cotton swabwas soaked in ether and placed near their nose Afterwardsthe anaesthetized rodents were dissected and fecal samplesgathered from rectum or large intestinal section Skull and

tooth structures were used for species identification TheIranian rodent key of Etemad was performed to identify therodents [21]

23 Detection of Cryptosporidium spp Oocysts Samples werecollected from intestine contents and fecal specimens ofrodents After sugar flotation (SG 1266 128 g sucrose and100 distilled water) [22] andmodified Ziehl-Neelsen stainingthe samples were examined to find the Cryptosporidium sppoocysts using opticalmicroscope undertimes1000magnificationDiagnosis of oocysts was based on morphological featureslike red spherical shapes Finally the samplesweremaintainedat 25 potassium dichromate (K

2Cr2O7) [23] and kept in

refrigerator (1-2 weeks) until DNA was extracted

24 DNA Extraction and Nested-PCR DNA extraction pro-cedure was performed using QIAamp DNA stool minikit (QIAamp DNA Stool Mini Kit USA) based on themanufacturerrsquos guideline The extracted DNA was kept inminus20∘C for next tests For nested-PCR method we used twospecific primers to detect 18s rRNA gene whose length ofproduced fragments was 1325 bp and 830 bp This dual stagestechnique was run using different primers that primary andsecondary stages primers were as following [4 20 23 24]

First Stage Primers

Forward (F1) 51015840-TTCTAGAGCTAATACATGCG-31015840

Reverse (R1) 51015840-CCCATTTCCTTCGAAACAGGA-31015840

Second Stage Primers

Forward (F2) 51015840-GGAAGGGTTGTATTTATT-AGATAAAG-31015840

Reverse (R2) 51015840-CTCATAAGGTGCTGAAGG-AGTA-31015840

Finally PCR products after loading on 15 agarose gel andelectrophoresis for 15 hours were stained with ethidiumbromide and then visualized under UV light using Gel Docdevice (Uvidoc Gel Documentation System CambridgeUK) [25]

25 Genotyping Cryptosporidium spp Using 18s rRNA PCR-RFLP and Sequencing RFLP assay was done to determinethe Cryptosporidium spp using digestion of secondary PCRproducts For this purpose SspI and VspI endonucleaseenzymes were employed for species recognition and geno-typing respectively based on manufacturerrsquos protocol asearlier described [20] Then the mixture was incubatedfor approximately 8 hours at 37∘C Eventually visualiza-tion of the digested products was carried out under UVtransilluminator after 15 agarose gel electrophoresis andethidium bromide staining [20 26] The nested-PCR pos-itive samples were purified using Bioneer kit corporation(Korea) and were sequenced by the same corporationSequence alignments were constructed by CLUSTAL Wsoftware (httpwwwddbjnigacjpsearchclustalwehtml)


M 1 432

100 bp

200 bp

500 bp

800 bp



3 Results


4 Discussion








M 1 432

100 bp

200 bp

500 bp

(a)

M 1 432

100 bp

200 bp

600 bp

(b)

















5 Limitations


6 Conclusion


Ethical Approval


Competing Interests




Acknowledgments



References

















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

















M 1 432

100 bp

200 bp

500 bp

800 bp



3 Results


4 Discussion








M 1 432

100 bp

200 bp

500 bp

(a)

M 1 432

100 bp

200 bp

600 bp

(b)

















5 Limitations


6 Conclusion


Ethical Approval


Competing Interests




Acknowledgments



References

















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

















M 1 432

100 bp

200 bp

500 bp

(a)

M 1 432

100 bp

200 bp

600 bp

(b)

















5 Limitations


6 Conclusion


Ethical Approval


Competing Interests




Acknowledgments



References

















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of


















5 Limitations


6 Conclusion


Ethical Approval


Competing Interests




Acknowledgments



References

















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















research article molecular characterization of

Documents