research article effects of electroacupuncture on pain ... · meperidine . ± . && §§ nn...
TRANSCRIPT
Research ArticleEffects of Electroacupuncture on Pain Threshold of LaboringRats and the Expression of Norepinephrine Transporter and 1205722Adrenergic Receptor in the Central Nervous System
Qianli Tang1 Qiuyan Jiang2 Suren R Sooranna3 Shike Lin1 Yuanyuan Feng2 Qi Zhang2
Meili Wang2 and Yu Wang1
1Youjiang Medical University for Nationalities Key Lab of Western Guangxi High Incident Disease Baise Guangxi 533000 China2Department of Gynaecology and Obstetrics The First Affiliated Hospital of Guangxi University of Chinese MedicineNanning Guangxi 530023 China3Chelsea ampWestminster Hospital Imperial College London London SW10 9NH UK
Correspondence should be addressed to Qiuyan Jiang qiuyanjiang2011163com
Received 27 January 2016 Accepted 9 June 2016
Academic Editor Jeng-Ren Duann
Copyright copy 2016 Qianli Tang et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited
To observe the effects of electroacupuncture on pain threshold of laboring rats and the expression of norepinephrine transporter and1205722 adrenergic receptor in the central nervous system to determine the mechanism of the analgesic effect of labor 120 pregnant ratswere divided into 6 groups a control group 4 electroacupuncture groups and a meperidine group After interventions the warmwater tail-flick test was used to observe pain threshold NE levels in serum NET and 1205722ARmRNA and protein expression levels inthe central nervous systemwere measured No difference in pain threshold was observed between the 6 groups before interventionAfter intervention increased pain thresholds were observed in all groups except the control group with a higher threshold seen inthe electroacupuncture groups SerumNE levels decreased in the electroacupuncture andMP groups Increases in NET and 1205722ARexpression in the cerebral cortex and decreases in enlarged segments of the spinal cord were seen Acupuncture increases uptakeof NE via cerebral NET and decreases its uptake by spinal NET The levels of 1205722AR are also increased and decreased respectivelyin both tissues This results in a decrease in systemic NE levels and may be the mechanism for its analgesic effects
1 Introduction
According to the pain index labor pain is just secondary onlyto burning pain To relieve the laboring pain commonmeth-ods used at present such as epidural puncture may presentthemotherwith certain risks andmedication analgesia aswellas produce side effects on the infant by introducing medicineinto fetus through placenta Nowadays there has been a focuson research on analgesia by noninvasive and drug-free meth-ods Electroacupuncture is a form of acupuncture where asmall electric current is passed between pairs of acupunctureneedles and this is generally thought to be particularly goodfor treating different types of pain Our research group hasfound that electroacupuncture could relive labor pain [1]Presently research suggests that norepinephrine (NE) bindsto the alpha 2 adrenergic receptor (1205722AR) to induce analgesia
and the norepinephrine transporter (NET) could reabsorbthe NE released from the neuron back to the presynapticmembrane as a way to regulate NE levels By using real-timePCR and western blot analysis the research presented hereattempts to unravel themechanism of acupuncture analgesiaThis is done by exploring the effects of electroacupuncture onNET and 1205722AR mRNA and protein expression in the centralnervous system of laboring rats
2 Materials and Methods
21 Animals Healthy adult specific-pathogen-free Sprague-Dawley rats 150 females and 50males 3-month-old sexuallymature weighing 300 g plusmn 50 g were provided by the Experi-mental Animal Center of Guangxi Medical University (Qual-ification number SCXK Guangxi 2009-0002) Rats were fed
Hindawi Publishing CorporationEvidence-Based Complementary and Alternative MedicineVolume 2016 Article ID 9068257 8 pageshttpdxdoiorg10115520169068257
2 Evidence-Based Complementary and Alternative Medicine
under conditions free of specific pathogens at 22ndash25∘C andkept in an environment of 40ndash60 relative humidity in theAnimal Research Institute of Guangxi University of ChineseMedicine All procedures involving rats were approved by theCommittee on the Ethics of Animal Experiments of GuangxiUniversity of Chinese Medicine and were carried out inaccordance with the National Institute of Health guidelinesFemales and males at a ratio of 1 1 were reared in cages anddaily morning checks were conducted If a vaginal plug wasidentified rats were moved out and labeled for observationuntil abdominal expansion confirmed a pregnancy From theabove cohort 120 pregnant rats were divided randomly into acontrol group Sanyinjiao (SP 6) group Hegu (LI 4) groupHegu (LI 4) and Sanyinjiao (SP 6) group Xuehai (SP 10)group and a medication group with 20 in each group
22 Treatment and Intervention (1) There was no interven-tion for control group and these animals were allowed todeliver their pups naturally
(2) Acupoints were selected according to Zhenqiu andYongyong [2] Electroacupuncture was applied as deliverywas induced
In S the Sanyinjiao (SP 6) group needles were insertedinto a point 10mm above the medial malleolus of the twohindlimbs with depth of 3mm deep and another needle wasinserted 1mm adjacent into the same point
In H the Hegu (LI 4) group needles were inserted ata point between the first and second phalanx of the twoforelimbs with depth of 1mm and another needle wasinserted 1mm adjacent into the same point
HampS the above methods were applied in the Hegu (LI 4)and Sanyinjiao (SP 6) group
In X the Xuehai (SP 10) group needles were inserted onthe medial aspect of the thigh the point of lower 19 on theline between mediosuperior border of the patella and pubicsymphysis with a depth of 5mm and another needle wasinserted 1mm adjacent into the same point
To avoid short circuit the two needles should not beconnected Needles were stabilized in place with adhesivetape and connected with electroacupuncture therapeuticinstrument with the same pair of positive and negativeelectrodes at the same point Slight tremble of limbs wasconsidered to be Deqi sensation [3]
The parameters of electroacupuncture were as follows2100Hz frequency with automatic shifting between 2 and100Hz 9V voltage 01 to 03mA intensity 02sim06mS pulsewidth Each stimulation cycle lasted 20min and stimulationwas given every 2 hours until the last rat fetus was born Nee-dles were electrically stimulated with HANS electroacupunc-ture therapeutic instrument (LH202H Beijing Huawei CoLtd Beijing China) and needles were 017mm thick times 7mmlong (Tianjin Xinglin College Medical Instrument Co LtdTianjin China)
(3) Medication (MP) group after delivery startedmeperidine was administrated by subcutaneous injectionusing a dose calculated by a body surface area conversion fac-tor [4]Meperidinewas produced byQinghai PharmaceuticalFactory Co Ltd (Xining China License H63020022)
23 Nociceptive Testing [5] Thewarmwater tail-flick test wasused to determine pain threshold Test was conducted beforeand after treatment and was stopped shortly after the deliveryof the first pup 4 cm of the rat tail was placed in 50 plusmn 05∘Cwarm water and the time between tail input and withdrawalfrom the water was recorded (3 tests were conducted andthe average in units of seconds was recorded) Because painthreshold may appear at different times after acupuncturethe test was conducted 5 times before acupuncture and at10 20 30 and 60min after acupuncture and the largestvalues were used for statistical analysis All data are expressedas mean plusmn SD STATA 200 software package was used foranalysis and paired-sample 119905-test was used for comparisonsof before and after acupuncture One-way ANOVA was usedfor comparisons between the groups
24 Specimen Collection After treatment and delivery ratswere anesthetized with 10 chloral hydrate by abdominalinjection at a dose of 400mgkg and then decapitated andcleaned with saline Thereafter samples were taken from thecerebral cortex and the enlarged segment of spinal cord andkept at minus80∘C for real-time PCR and western blotting Allsamples were tested within 3 months
25 Experimental Procedures
251 Serum NE Rat NE ELISA kits (TSZ UAS FA02097B)were purchased from Shanghai Kexing Trade Company andwere used according to the manufacturerrsquos instructions
252 Real-Time PCR for Analysis of NETmRNAExpression inthe Central Nervous System The Trizol method was used toextract RNA from the cerebral cortex and enlarged segmentof spinal cord and RNA was reverse-transcribed to cDNAand then kept inminus20∘C for use ABI StepOne fluorescence re-action PCR instrument was used tomeasure gene expressionPrimer sequences were generated with Primer 50 system onNCBI website and designed and synthesized by ShanghaiSangon Biotechnology Ltd housekeeping gene (120573-actin)primers F 51015840-CGTAAAGACCTCTATGCCAACA-31015840 and R51015840-CGGACTCATCGTACTCCTGCT-31015840 amplifiedwith a prod-uct of 229 bp NET primers F 51015840 GAGCTTTGTTATTAC-TTCATGTCCC 31015840 and R 51015840TGCCTTCTCAATGCTACCCA31015840 amplified with a product of 136 bp and 1205722AR primers F 51015840-ACACTCGAGGGATCCTGGCCTCTCTCGGATC-31015840 andRn 51015840ACAA AGCTTGGGCGCAAAGCTGCCCTCGG-31015840amplified with a product of 217 bp The amplification condi-tions were 95∘C for 2min 95∘C for 10 s and extension step at60∘C for 40 s for 40 cycles Relative expressionwas calculated= 2minusΔCt ΔCt = Ct (target gene) minus Ct (housekeeping gene)
253 Western Blot Analysis to Test Expression of NE and1205722AR in the Central Nervous System Total protein extractwas extracted from the cerebral cortex and the enlargedsegment of lumbar spinal cord and 120mg was weighed500120583L of precooled cell lysis buffer was added for pyrolysis at4∘C for 30min followed by centrifugation (4∘C at 12000 rpmfor 20min) and protein extraction Sample loading bufferwas diluted into the samples boiled for 4min and kept in
Evidence-Based Complementary and Alternative Medicine 3
Table 1 Comparison of pain threshold in the 6 groups (119909 plusmn 119904 unit S)
Group 119899 Before treatment After treatmentControl 20 694 plusmn 089 726 plusmn 109Electroacupuncture Sanyinjiao 20 698 plusmn 106 1826 plusmn 121lowastlowastampamp
Electroacupuncture Hegu 20 686 plusmn 100 1596 plusmn 152lowastlowastampampnn
Electroacupuncture Hegu + Sanyinjiao 20 731 plusmn 082 1428 plusmn 097lowastlowastampampnnsectsect
Electroacupuncture Xuehai 20 677 plusmn 104 1214 plusmn 130lowastlowastampampnnsectsect
Meperidine 20 701 plusmn 096 1945 plusmn 184lowastlowast
119865 0736 216361119875 119875 = 0598 gt 005 119875 = 0000 lt 001
119875 lt 001 versus that before treatment lowastlowast119875 lt 001 versus control group ampamp119875 lt 001 versus meperidine group sectsect119875 lt 001 versus Hegu (LI 4) group nn119875 lt001 versus Hegu (LI 4) and Sanyinjiao (SP 6) group 119875 lt 001 versus Xuehai (SP 10) group
minus80∘C for later use Protein was separated by SDS-PAGEuntil the bromophenol blue indicatrix reached the edge ofthe gel The protein was transferred to a polyvinylidenedifluoride membrane (250mA 90min) which was removedand blocked with 5 nonfat milk by shaking for 1-2 h atroom temperature Primary antibody was incubated with theblocked membrane and then kept at 4∘C overnight On thenext day protein was removed by washing with PBS (15mintimes 1 time) and the membrane was washed with TBST 4 times(5min each time) and incubated with secondary antibodyat room temperature for 1 h After washing with TBST colordeveloper was added to the front of the PVDF membraneand four-star image analysis system was used to analyze theintensity of the target protein Biovision BCA Protein AssayKit Santa Cruz NET 1205722AR and 120573-actin primary antibodiesand rabbit secondary antibody and the chemiluminescencekit were all used according to manufacturerrsquos instructions
26 Statistical Analysis All statistical analyses were per-formed with SPSS 200 for Windows All data are presentedas mean plusmn standard deviation (119909 plusmn 119904) One-way ANOVA wasperformed for comparisons between multiple groups Theleast significant difference was used for comparison of meansbetween groups A value of 119875 lt 005 was considered asstatistically significant
3 Results31 Comparison of Pain Threshold between the 6 GroupsThere was no difference in pain threshold in the 6 groupsbefore treatment (all 119875 gt 005) and significant increaseswere seen after treatments (all 119875 lt 001) LSD multiplecomparisons further showed that pain threshold was in theorder of control group lt X lt HampS lt H lt S lt MP group(Figure 1 and Table 1)
32 Serum NE After treatment there were significantdecreases in serumNE expression level between the 6 groupsin the order of control group ltX =HampS =H lt S ltMP groupAmong different groups the levels in the S group decreasedthe most (Figure 2 and Table 2)
33 NET and 1205722AR Protein Expression in the Central NervousSystem Western blot was used to measure NET and 1205722AR
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Electroacupuncture
0
5
10
15
20
25
Pain
thre
shol
d (s
)
sectsect998779998779
lowastlowast
lowastlowast
lowastlowast
lowastlowast
ampamp ampamp ampamp
sectsect
lowastlowast
ampamp
Before treatmentAfter treatment
Figure 1 Effects of electroacupuncture on pain threshold of labor-ing rats Before and after treatment with electroacupuncture painin all rats undergoing parturition was evaluated by the warm watertail-flick test 119875 lt 001 versus before treatment lowastlowast119875 lt 001 versuscontrol ampamp
119875 lt 001 versus meperidine sectsect119875 lt 001 versus Hegu
nn119875 lt 001 versus Hegu + Sanyinjiao 998779998779119875 lt 001 versus Xuehai119873 = 20 for each group
protein expression in the central nervous system Analysis ofvariance was performed for the cerebral cortex NET (119865 =5689 119875 lt 001) and 1205722AR (119865 = 6882 119875 lt 001) There weresignificant increases between the 6 groups in NET and 1205722ARprotein expression (119875 lt 001) by LSD multiple comparisonsin the order of control group ltX =HampS =H = S ltMP groupwith no difference between the electroacupuncture groupsHowever there were significant decreases in the enlargedsegment of the spinal cord with NET (119865 = 14171 119875 lt001) and 1205722AR (119865 = 35373 119875 lt 001) by LSD multiplecomparisons in the order of control group lt X = HampS = H =S ltMP group (Figure 3 and Table 3)
34 NET and 1205722AR mRNA Expression in the Central NervousSystem Real-time PCR analysis of NET and 1205722AR showedsignificant differences in the cerebral cortex mRNA expres-sion between the 6 groups (119865 = 7868 119875 lt 001) and 1205722AR
4 Evidence-Based Complementary and Alternative Medicine
Table 2 Comparison of serum NE after treatment (119909 plusmn 119904)
Group 119899 NE (pgmL)Control 20 19117 plusmn 861Electroacupuncture Sanyinjiao 20 16154 plusmn 1087lowastlowast
Electroacupuncture Hegu 20 17225 plusmn 979lowastlowast
Electroacupuncture Hegu + Sanyinjiao 20 18023 plusmn 1452lowastlowastamp
Electroacupuncture Xuehai 20 18061 plusmn 1250lowastlowastamp
Meperidine 20 15918 plusmn 1702lowastlowastampampsectsectnn
119865 19182119875 119875 lt 001
Note comparison of serum NE with control group lowastlowast119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001with Hegu (LI 4) and Sanyinjiao (SP 6) group sectsect119875 lt 001 with Xuehai (SP 10) nn119875 lt 001
Electroacupuncture
0
50
100
150
200
250
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Seru
m N
E (p
gm
L)
sectsectlowastlowast
lowastlowast
lowastlowast
amp
lowastlowast lowastlowast
amp
ampamp
Serum NE
Figure 2 Comparison of serumNE with control group lowastlowast119875 lt 001with Sanyinjiao (SP 6) group 119875 lt 001 with Hegu (LI 4) groupamp119875 lt 005 ampamp
119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6)group sectsect119875 lt 001 with Xuehai (SP 10) group nn119875 lt 001 119873 = 20for each group
(119865 = 6517 119875 lt 001) Using LSD multiple comparisonsNET and 1205722AR mRNA expression increased significantly inall electroacupuncture groups and the MP group in the orderof control group lt X = HampS = H = S lt MP group withno difference between electroacupuncture groups Similarchanges were seen in mRNA expression in the enlargedsegment of the spinal cord for with NET (119865 = 22543 119875 lt001) and 1205722AR (119865 = 21576 119875 lt 001 Figure 4 and Table 4)
4 Discussion
It is believed in traditional Chinese medicine that laborpain during delivery results from uterine contraction fetalhead descending and pressure on local tissues and fromdisharmony of Qi and blood due to fear and nervousnesswhich is roughly translated as ldquostagnation results in painrdquoIt is said in the chapter of Nine Needles Arid Twelve Yuan ofthe Miraculous Pivot that needles could be used to unblock
meridians and regulate Qi and blood [6] Thus it is the beliefthat acupuncture can be used to relieve pain
S is the crossing point of the kidney spleen and livermeridians H is the source point of the large intestinemeridian of Hand-Yangming and Yangming meridians andis characterized by plenty of Qi and blood Qi is the masterof blood and blood would follow if Qi moves HampS is amatch with distal and proximal acupoints X is the point ofthe spleenmeridian Inmeridian theory the uterus is directlyconnected with the Chong Ren and Du meridians whichall correspond to the kidney spleen and liver meridians [6]In this study electroacupuncture was applied to stimulatedifferent acupoints to activate the Qi of the kidney spleenliver and Ren meridians to unblock meridians and thusregulate Qi and blood and calm mind In addition it canstimulate the sensory fibers of nerves in order to relive pain
In modern medicine labor pain results from uterinecontraction and cervical dilation during the first stage andthe fetus descending during the second and third stages oflabor Along with anxiety fear and nervousness sympatheticactivation is increased which leads to an increase in NEsecretion followed by an increase in pain sensitivity [7]NE spreads throughout the nervous system and internalorgans andNEneuronsmostly exist in themidbrain reticularformation the locus coeruleus and the ventrolateral part ofthe medulla
NE can act as a hormone in almost every internal organand it is a neurotransmitter of the sympathetic nerve andcentral nervous system It was one of the neurotransmittersthat had been the focus of early acupuncture research [8]It was found that intracerebroventricular injection of NEcan antagonize morphine indicating that NE plays a role incounteracting its analgesic in the brainWhenDawson-Basoa[9] applied electroacupuncture on rats after intraventricularinjection of dioctyl phthalate (DOP) he demonstrated thatthere was an increase in circulating NE and also found a sig-nificant decrease in analgesia efficiency from electroacupunc-ture On the contrary intraspinal injection of DOP resultedin an increased efficiency It was suggested that an increasedrelease of NE in brain counteracts the analgesic effect ofelectroacupuncture However an increasing release of NEin the spinal cord led to strengthening of the effect of elec-troacupuncture However a feedback mechanism whereby
Evidence-Based Complementary and Alternative Medicine 5
Table 3 Comparison of gray value of NET and 1205722AR in the central nervous system of the rats
Group 119899
Gray matter region Lumbar spinal cordNET 1205722AR NET 1205722AR
Control 20 024 plusmn 012 022 plusmn 009 076 plusmn 030 049 plusmn 012Electroacupuncture Sanyinjiao 20 047 plusmn 021lowastlowast 047 plusmn 021lowastlowast 029 plusmn 018lowastlowast 013 plusmn 006lowastlowast
Electroacupuncture Hegu 20 044 plusmn 026lowastlowast 049 plusmn 019lowastlowast 045 plusmn 017lowastlowast 035 plusmn 014lowastlowast
Electroacupuncture Hegu + Sanyinjiao 20 044 plusmn 022lowastlowast 043 plusmn 029lowastlowast 048 plusmn 026lowastlowast 032 plusmn 014lowastlowast
Electroacupuncture Xuehai 20 046 plusmn 023lowastlowast 048 plusmn 026lowastlowast 057 plusmn 021lowastlowast 037 plusmn 010lowastlowast
Meperidine 20 062 plusmn 028lowastlowastampsectn 065 plusmn 029lowastlowastampsectsectn 020 plusmn 011lowastlowastampampsectsectnn 011 plusmn 005lowastlowastampampsectsectnn
119865 5689 688 14171 35373119875 119875 lt 001 119875 lt 001 119875 lt 001 119875 lt 001
Note comparison of NET and 1205722AR mRNA expression in central nervous system significant difference 119875 lt 005 With control group lowastlowast119875 lt 001 withSanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005sectsect119875 lt 001 with Xuehai (SP 10) n119875 lt 005 nn119875 lt 001
Electroacupuncture
000
010
020
030
040
050
060
070
080
090
100
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
NET
Control Sanyinjiao Hegu Xuehai MeperidineHegu +Sanyinjiao
1205722AR
120573-actin
lowastlowastlowastlowast lowastlowastlowastlowastlowastlowast
lowastlowast
lowastlowast
lowastlowastlowastlowastlowastlowast
sectsectampamp
NET1205722AR
(a)
Electroacupuncture
Control Sanyinjiao Hegu Xuehai Meperidine
Control Sanyinjiao Hegu Xuehai MeperidineHegu +Sanyinjiao
NET
1205722AR
120573-actin
000
020
040
060
080
100
120
Hegu +Sanyinjiao
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowastlowastlowast
lowastlowast
sectsect
sectsect
ampamp
ampamp
NET1205722AR
(b)
Figure 3 Comparison of NET and 1205722AR protein expression in the central nervous system (a) gray matter and (b) lumbar spinal cord Thewestern blots shown are the representative images With control group lowastlowast119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 withHegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005 sectsect119875 lt 001 with Xuehai (SP 10) groupn119875 lt 005
nn119875 lt 001119873 = 20 for each group
6 Evidence-Based Complementary and Alternative Medicine
Table 4 Comparison of NET and 1205722AR mRNA expression in central nervous system
Group 119899
Gray matter region Lumbar spinal cordNET 1205722AR NET 1205722AR
Control 20 10000 10000 10000 10000Electroacupuncture Sanyinjiao 20 13535 plusmn 03008lowastlowast 13465 plusmn 03124lowastlowast 03931 plusmn 17217lowastlowast 03689 plusmn 01891lowastlowast
Electroacupuncture Hegu 20 13961 plusmn 02977lowastlowast 13068 plusmn 03293lowastlowast 05793 plusmn 03482lowastlowast 05862 plusmn 03410lowastlowast
Electroacupuncture Hegu+ Sanyinjiao 20 13823 plusmn 03527lowastlowast 13381 plusmn 03963lowastlowast 07393 plusmn 03158lowastlowastamp 08124 plusmn 03414lowastampamp
Electroacupuncture Xuehai 20 13883 plusmn 03400lowastlowast 13063 plusmn 02767lowastlowast 07358 plusmn 02178lowastlowastamp 07460 plusmn 02394lowastlowastamp
Meperidine 20 16084 plusmn 04064lowastlowastampsectn 15475 plusmn 03585lowastlowastampsectn 03446 plusmn 01606lowastlowastampampsectsectnn 03515 plusmn 0203lowastlowastampampsectsectnn
119865 7868 6517 22243 21576119875 119875 lt 001 119875 lt 001 119875 lt 001 119875 lt 001
Note comparison of NET and 1205722AR mRNA expression in cerebral cortex and spinal cord significant difference 119875 lt 005 With control group lowast119875 lt 005lowastlowast
119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6)group sect119875 lt 005 sectsect119875 lt 001 with Xuehai (SP 10) n119875 lt 005 nn119875 lt 001
00000
05000
10000
15000
20000
25000
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Electroacupuncture
lowastlowastlowastlowast lowastlowastlowastlowastlowastlowastlowastlowast lowastlowast
lowastlowast
lowastlowast
lowastlowast
sectsect
ampamp
NET1205722AR
(a)
00000
05000
10000
15000
20000
25000
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Electroacupuncture
lowastlowast
lowastlowast
lowastlowastlowastlowastlowastlowast
lowastlowast
lowastlowastlowastlowast
lowastlowastlowastlowast
sectsectsectsectampamp
ampamp
NET1205722AR
(b)
Figure 4 Comparison of NET and 1205722AR mRNA expression in the central nervous system (a) gray matter and (b) lumbar spinal cord Thewestern blots shown are the representative images With control group lowastlowast119875 lt 005 lowastlowast119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005 sectsect119875 lt 001 with Xuehai
(SP 10) group n119875 lt 005 nn119875 lt 001119873 = 20 for each group
NET acted to uptake NE back to the presynaptic membraneoccurred This helped to regulate the NE concentration inthe synaptic cleft and to terminate nerve impulse signalsand thus to maintain the sensitivity of receptors to theneurotransmitter [10] In recent years this has been a researchfocus as a target for antidepressants and anti-drug-abusetherapy [11]
In the animal neuralgia model norepinephrine inhibitorexperiments showed an analgesia effect and spinal nerve lig-ation (SNL) experiments showed an increase of NET whichindicated the analgesic mechanism of transporter-targetedantidepressant [12] Research suggested that it is essentialto inhibit norepinephrine transporter for the synergismof analgesic effect from monoamine transmitter reuptakeinhibitors and of opioid drugs [13] Cerebral NET activitywas associated with agitation of PTSD (posttraumatic stress
disorder) patients [14] As a membrane-bound G protein-coupled receptor 1205722AR can amplify and transduce the extra-cellular stimulating signal into cells to trigger intracellularbiological reactions It has a feedback inhibitory effect on NEsecretion Research in recent years [15] indicated that therewas no visible side effect on respiratory depression and thegastrointestinal system when 1205722AR agonist in the form ofopioids was administered for acute pain
As mentioned above NET can reuptake NE to thepresynapticmembrane so as to regulate theNE concentrationin the synaptic cleft [16] Alpha 2AR also has a feedbackinhibitory effect on NE secretion It has therefore beensuggested that NE plays a role in the development of pain byNET and 1205722AR
In this research a significant increasing expression ofNET 1205722AR protein andmRNA in the cerebra and a decrease
Evidence-Based Complementary and Alternative Medicine 7
in the spinal cord were found in electroacupuncture groupsIt is speculated that the electroacupuncture stimulation couldactivate NET and 1205722AR on the presynaptic membrane ofthe central noradrenergic nerve resulting in an increasedexpression of NET and 1205722ARmRNA and proteinThis wouldlead to an increased reuptake of NE by NET strengthenedfeedback inhibition of 1205722AR toNE and thus a decrease of NEreleaseMoreover spinal reflex is controlled by cerebraWhencerebral NE release is decreased the expression of NET and1205722AR in spinal cordwould also reduce leading to a decreasedreuptake of NE by NET leading to a decreased feedbackinhibition of 1205722AR to NE and thus an overall increase of NErelease
As for the different results obtained from different acu-points this may be related to the neuroanatomical location ofthe acupoints The sympathetic nerve controlling the uterusis from T10-S2 [17] and parasympathetic nerve is from L6-S1 [18 19] which means that the nerve controlling the uterusin the rat is from T10-S2 and the peaks are from T13-L2 andL6-S10 The nerve controlling Sanyinjiao (SP 6) is from L3-6 the nerve controlling Hegu (LI 4) is from C5-T1 and thenerve controlling Xuehai (SP 10) is from L3-4 [20]This couldhave led to the different effects being seen on the differentacupoints
This research indicates that the role of NE in the analgesicmechanism of acupuncture is related to reuptake of NE byNET and feedback inhibition of 1205722AR Under the effect ofelectroacupuncture there was an increasing reuptake of NEby NET in the cerebra strengthened feedback inhibition of1205722AR to NE and thus a decrease of NE release In additiona decreasing reuptake of NE by NET in spinal cord was alsoseen leading to a decreasing feedback inhibition of 1205722AR toNE and thus an increase of NE release
Competing Interests
The authors do not have any conflict of interests financial orotherwise to declare
Authorsrsquo Contributions
Yuanyuan Feng Qi Zhang YuWang andMeiliWang carriedout the experimental work Qiuyan Jiang and Qianli Tangparticipated in the design of the study and Qiuyan Jiangalso performed the statistical analysis Qianli Tang QiuyanJiang and Suren R Sooranna conceived of the study andparticipated in its design and coordination Qiuyan JiangSuren R Sooranna and Shike Lin helped to draft the paperAll authors read and approved the final paper
Acknowledgments
This study was supported by the National Natural ScienceFoundation Project Grant (81260547 and 81373685)
References
[1] J Qiuyan M Haixia S Jinling et al ldquoThe effect of the elec-troacupuncture on labor analgesia and dynorphin regulation
impactrdquo Maternal and Child Health Care of China vol 27 no5 pp 733ndash734 2012
[2] S Zhenqiu and X YongyongMedical Statistics Peoplersquos Medi-cal Publishing House Beijing China 4th edition 2014
[3] Y Shuai R Xiaoxuan Z Yafang et al ldquoEffects of electroacupun-ture on Baihui(GV20) and Zusanli(ST36) on behavior and 5-HT level in rats with chronic visceral painrdquo Jilin Journal ofTraditional Chinese Medicine vol 33 no 4 pp 400ndash401 2013
[4] W Wei W Ximei and L Yuanjian Experimental Methodologyof Pharmacology vol 7 Peoplersquos Medical Publishing HouseBeijing China 4th edition 2010
[5] S Wegert M H Ossipov M L Nichols et al ldquoDifferentialactivities of intrathecal MK-801 or morphine to alter responsesto thermal and mechanical stimuli in normal or nerve-injuredratsrdquo Pain vol 71 no 1 pp 57ndash64 1997
[6] S Kulkarni and S T Sia ldquoHazards of labour pain and the roleof non-neuraxial labour analgesiardquo Trends in Anaesthesia andCritical Care vol 4 no 4 pp 109ndash114 2014
[7] Z Dengben and S Lijun Complete Note and Interpretation ofHuangdi Nei JingThe 2nd Version 1 NewWorld Press BeijingChina 2010
[8] H Jisheng and F Bifa Pain Peking University Press BeijingChina 1st edition 2012
[9] M Dawson-Basoa and A R Gintzler ldquoInvolvement of spinalcord 120575 opiate receptors in the antinociception of gestation andits hormonal simulationrdquo Brain Research vol 757 no 1 pp 37ndash42 1997
[10] A B Pramod J Foster L Carvelli and L K Henry ldquoSLC6transporters structure function regulation disease associationand therapeuticsrdquoMolecular Aspects of Medicine vol 34 no 2-3 pp 197ndash219 2013
[11] J M V Timple L G Magalhaes K C Souza Rezende etal ldquoThe lignan (minus)-hinokinin displays modulatory effects onhuman monoamine and gaba transporter activitiesrdquo Journal ofNatural Products vol 76 no 10 pp 1889ndash1895 2013
[12] M L Rojo A Rodrıguez-Gaztelumendi A Pazos and A DıazldquoDifferential adaptive changes on serotonin and noradrenalinetransporters in a rat model of peripheral neuropathic painrdquoNeuroscience Letters vol 515 no 2 pp 181ndash186 2012
[13] F Shen P R Tsuruda J A M Smith G P Obedencioand W J Martin ldquoRelative contributions of norepinephrineand serotonin transporters to antinociceptive synergy betweenmonoamine reuptake inhibitors andmorphine in the rat forma-lin modelrdquo PLoS ONE vol 8 no 9 article e74891 2013
[14] X Zhao Y Huang H Ma Q Jin Y Wang and G ZhuldquoAssociation between major depressive disorder and the nore-pinephrine transporter polymorphisms T-182C and G1287A ameta-analysisrdquo Journal of Affective Disorders vol 150 no 1 pp23ndash28 2013
[15] S R Arain R M Ruehlow T D Uhrich and T J Ebert ldquoTheefficacy of dexmedetomidine versus morphine for postoper-ative analgesia after major inpatient surgeryrdquo Anesthesia andAnalgesia vol 98 no 1 pp 153ndash158 2004
[16] C Schroeder and J Jordan ldquoNorepinephrine transporter func-tion and human cardiovascular diseaserdquo American Journal ofPhysiologymdashHeart and Circulatory Physiology vol 303 no 11pp H1273ndashH1282 2012
[17] E Houdeau A Rousseau C Meusnier M-J Prudrsquohomme andJ-P Rousseau ldquoSympathetic innervation of the upper and lowerregions of the uterus and cervix in the rat have different originsand routesrdquo Journal of Comparative Neurology vol 399 no 3pp 403ndash412 1998
8 Evidence-Based Complementary and Alternative Medicine
[18] B Baljet and J Drukker ldquoThe extrinsic innervation of the pelvicorgans in the female ratrdquoActaAnatomica vol 107 no 3 pp 241ndash267 1980
[19] R E Papka H H Traurig M Schemann J Collins T Copelinand K Wilson ldquoCholinergic neurons of the pelvic autonomicganglia and uterus of the female rat distribution of axons andpresence of muscarinic receptorsrdquo Cell and Tissue Research vol296 no 2 pp 293ndash305 1999
[20] Y Anfeng andY PingAnatomy and Tissue of Rat Science PressBeijing China 1985
Submit your manuscripts athttpwwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
2 Evidence-Based Complementary and Alternative Medicine
under conditions free of specific pathogens at 22ndash25∘C andkept in an environment of 40ndash60 relative humidity in theAnimal Research Institute of Guangxi University of ChineseMedicine All procedures involving rats were approved by theCommittee on the Ethics of Animal Experiments of GuangxiUniversity of Chinese Medicine and were carried out inaccordance with the National Institute of Health guidelinesFemales and males at a ratio of 1 1 were reared in cages anddaily morning checks were conducted If a vaginal plug wasidentified rats were moved out and labeled for observationuntil abdominal expansion confirmed a pregnancy From theabove cohort 120 pregnant rats were divided randomly into acontrol group Sanyinjiao (SP 6) group Hegu (LI 4) groupHegu (LI 4) and Sanyinjiao (SP 6) group Xuehai (SP 10)group and a medication group with 20 in each group
22 Treatment and Intervention (1) There was no interven-tion for control group and these animals were allowed todeliver their pups naturally
(2) Acupoints were selected according to Zhenqiu andYongyong [2] Electroacupuncture was applied as deliverywas induced
In S the Sanyinjiao (SP 6) group needles were insertedinto a point 10mm above the medial malleolus of the twohindlimbs with depth of 3mm deep and another needle wasinserted 1mm adjacent into the same point
In H the Hegu (LI 4) group needles were inserted ata point between the first and second phalanx of the twoforelimbs with depth of 1mm and another needle wasinserted 1mm adjacent into the same point
HampS the above methods were applied in the Hegu (LI 4)and Sanyinjiao (SP 6) group
In X the Xuehai (SP 10) group needles were inserted onthe medial aspect of the thigh the point of lower 19 on theline between mediosuperior border of the patella and pubicsymphysis with a depth of 5mm and another needle wasinserted 1mm adjacent into the same point
To avoid short circuit the two needles should not beconnected Needles were stabilized in place with adhesivetape and connected with electroacupuncture therapeuticinstrument with the same pair of positive and negativeelectrodes at the same point Slight tremble of limbs wasconsidered to be Deqi sensation [3]
The parameters of electroacupuncture were as follows2100Hz frequency with automatic shifting between 2 and100Hz 9V voltage 01 to 03mA intensity 02sim06mS pulsewidth Each stimulation cycle lasted 20min and stimulationwas given every 2 hours until the last rat fetus was born Nee-dles were electrically stimulated with HANS electroacupunc-ture therapeutic instrument (LH202H Beijing Huawei CoLtd Beijing China) and needles were 017mm thick times 7mmlong (Tianjin Xinglin College Medical Instrument Co LtdTianjin China)
(3) Medication (MP) group after delivery startedmeperidine was administrated by subcutaneous injectionusing a dose calculated by a body surface area conversion fac-tor [4]Meperidinewas produced byQinghai PharmaceuticalFactory Co Ltd (Xining China License H63020022)
23 Nociceptive Testing [5] Thewarmwater tail-flick test wasused to determine pain threshold Test was conducted beforeand after treatment and was stopped shortly after the deliveryof the first pup 4 cm of the rat tail was placed in 50 plusmn 05∘Cwarm water and the time between tail input and withdrawalfrom the water was recorded (3 tests were conducted andthe average in units of seconds was recorded) Because painthreshold may appear at different times after acupuncturethe test was conducted 5 times before acupuncture and at10 20 30 and 60min after acupuncture and the largestvalues were used for statistical analysis All data are expressedas mean plusmn SD STATA 200 software package was used foranalysis and paired-sample 119905-test was used for comparisonsof before and after acupuncture One-way ANOVA was usedfor comparisons between the groups
24 Specimen Collection After treatment and delivery ratswere anesthetized with 10 chloral hydrate by abdominalinjection at a dose of 400mgkg and then decapitated andcleaned with saline Thereafter samples were taken from thecerebral cortex and the enlarged segment of spinal cord andkept at minus80∘C for real-time PCR and western blotting Allsamples were tested within 3 months
25 Experimental Procedures
251 Serum NE Rat NE ELISA kits (TSZ UAS FA02097B)were purchased from Shanghai Kexing Trade Company andwere used according to the manufacturerrsquos instructions
252 Real-Time PCR for Analysis of NETmRNAExpression inthe Central Nervous System The Trizol method was used toextract RNA from the cerebral cortex and enlarged segmentof spinal cord and RNA was reverse-transcribed to cDNAand then kept inminus20∘C for use ABI StepOne fluorescence re-action PCR instrument was used tomeasure gene expressionPrimer sequences were generated with Primer 50 system onNCBI website and designed and synthesized by ShanghaiSangon Biotechnology Ltd housekeeping gene (120573-actin)primers F 51015840-CGTAAAGACCTCTATGCCAACA-31015840 and R51015840-CGGACTCATCGTACTCCTGCT-31015840 amplifiedwith a prod-uct of 229 bp NET primers F 51015840 GAGCTTTGTTATTAC-TTCATGTCCC 31015840 and R 51015840TGCCTTCTCAATGCTACCCA31015840 amplified with a product of 136 bp and 1205722AR primers F 51015840-ACACTCGAGGGATCCTGGCCTCTCTCGGATC-31015840 andRn 51015840ACAA AGCTTGGGCGCAAAGCTGCCCTCGG-31015840amplified with a product of 217 bp The amplification condi-tions were 95∘C for 2min 95∘C for 10 s and extension step at60∘C for 40 s for 40 cycles Relative expressionwas calculated= 2minusΔCt ΔCt = Ct (target gene) minus Ct (housekeeping gene)
253 Western Blot Analysis to Test Expression of NE and1205722AR in the Central Nervous System Total protein extractwas extracted from the cerebral cortex and the enlargedsegment of lumbar spinal cord and 120mg was weighed500120583L of precooled cell lysis buffer was added for pyrolysis at4∘C for 30min followed by centrifugation (4∘C at 12000 rpmfor 20min) and protein extraction Sample loading bufferwas diluted into the samples boiled for 4min and kept in
Evidence-Based Complementary and Alternative Medicine 3
Table 1 Comparison of pain threshold in the 6 groups (119909 plusmn 119904 unit S)
Group 119899 Before treatment After treatmentControl 20 694 plusmn 089 726 plusmn 109Electroacupuncture Sanyinjiao 20 698 plusmn 106 1826 plusmn 121lowastlowastampamp
Electroacupuncture Hegu 20 686 plusmn 100 1596 plusmn 152lowastlowastampampnn
Electroacupuncture Hegu + Sanyinjiao 20 731 plusmn 082 1428 plusmn 097lowastlowastampampnnsectsect
Electroacupuncture Xuehai 20 677 plusmn 104 1214 plusmn 130lowastlowastampampnnsectsect
Meperidine 20 701 plusmn 096 1945 plusmn 184lowastlowast
119865 0736 216361119875 119875 = 0598 gt 005 119875 = 0000 lt 001
119875 lt 001 versus that before treatment lowastlowast119875 lt 001 versus control group ampamp119875 lt 001 versus meperidine group sectsect119875 lt 001 versus Hegu (LI 4) group nn119875 lt001 versus Hegu (LI 4) and Sanyinjiao (SP 6) group 119875 lt 001 versus Xuehai (SP 10) group
minus80∘C for later use Protein was separated by SDS-PAGEuntil the bromophenol blue indicatrix reached the edge ofthe gel The protein was transferred to a polyvinylidenedifluoride membrane (250mA 90min) which was removedand blocked with 5 nonfat milk by shaking for 1-2 h atroom temperature Primary antibody was incubated with theblocked membrane and then kept at 4∘C overnight On thenext day protein was removed by washing with PBS (15mintimes 1 time) and the membrane was washed with TBST 4 times(5min each time) and incubated with secondary antibodyat room temperature for 1 h After washing with TBST colordeveloper was added to the front of the PVDF membraneand four-star image analysis system was used to analyze theintensity of the target protein Biovision BCA Protein AssayKit Santa Cruz NET 1205722AR and 120573-actin primary antibodiesand rabbit secondary antibody and the chemiluminescencekit were all used according to manufacturerrsquos instructions
26 Statistical Analysis All statistical analyses were per-formed with SPSS 200 for Windows All data are presentedas mean plusmn standard deviation (119909 plusmn 119904) One-way ANOVA wasperformed for comparisons between multiple groups Theleast significant difference was used for comparison of meansbetween groups A value of 119875 lt 005 was considered asstatistically significant
3 Results31 Comparison of Pain Threshold between the 6 GroupsThere was no difference in pain threshold in the 6 groupsbefore treatment (all 119875 gt 005) and significant increaseswere seen after treatments (all 119875 lt 001) LSD multiplecomparisons further showed that pain threshold was in theorder of control group lt X lt HampS lt H lt S lt MP group(Figure 1 and Table 1)
32 Serum NE After treatment there were significantdecreases in serumNE expression level between the 6 groupsin the order of control group ltX =HampS =H lt S ltMP groupAmong different groups the levels in the S group decreasedthe most (Figure 2 and Table 2)
33 NET and 1205722AR Protein Expression in the Central NervousSystem Western blot was used to measure NET and 1205722AR
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Electroacupuncture
0
5
10
15
20
25
Pain
thre
shol
d (s
)
sectsect998779998779
lowastlowast
lowastlowast
lowastlowast
lowastlowast
ampamp ampamp ampamp
sectsect
lowastlowast
ampamp
Before treatmentAfter treatment
Figure 1 Effects of electroacupuncture on pain threshold of labor-ing rats Before and after treatment with electroacupuncture painin all rats undergoing parturition was evaluated by the warm watertail-flick test 119875 lt 001 versus before treatment lowastlowast119875 lt 001 versuscontrol ampamp
119875 lt 001 versus meperidine sectsect119875 lt 001 versus Hegu
nn119875 lt 001 versus Hegu + Sanyinjiao 998779998779119875 lt 001 versus Xuehai119873 = 20 for each group
protein expression in the central nervous system Analysis ofvariance was performed for the cerebral cortex NET (119865 =5689 119875 lt 001) and 1205722AR (119865 = 6882 119875 lt 001) There weresignificant increases between the 6 groups in NET and 1205722ARprotein expression (119875 lt 001) by LSD multiple comparisonsin the order of control group ltX =HampS =H = S ltMP groupwith no difference between the electroacupuncture groupsHowever there were significant decreases in the enlargedsegment of the spinal cord with NET (119865 = 14171 119875 lt001) and 1205722AR (119865 = 35373 119875 lt 001) by LSD multiplecomparisons in the order of control group lt X = HampS = H =S ltMP group (Figure 3 and Table 3)
34 NET and 1205722AR mRNA Expression in the Central NervousSystem Real-time PCR analysis of NET and 1205722AR showedsignificant differences in the cerebral cortex mRNA expres-sion between the 6 groups (119865 = 7868 119875 lt 001) and 1205722AR
4 Evidence-Based Complementary and Alternative Medicine
Table 2 Comparison of serum NE after treatment (119909 plusmn 119904)
Group 119899 NE (pgmL)Control 20 19117 plusmn 861Electroacupuncture Sanyinjiao 20 16154 plusmn 1087lowastlowast
Electroacupuncture Hegu 20 17225 plusmn 979lowastlowast
Electroacupuncture Hegu + Sanyinjiao 20 18023 plusmn 1452lowastlowastamp
Electroacupuncture Xuehai 20 18061 plusmn 1250lowastlowastamp
Meperidine 20 15918 plusmn 1702lowastlowastampampsectsectnn
119865 19182119875 119875 lt 001
Note comparison of serum NE with control group lowastlowast119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001with Hegu (LI 4) and Sanyinjiao (SP 6) group sectsect119875 lt 001 with Xuehai (SP 10) nn119875 lt 001
Electroacupuncture
0
50
100
150
200
250
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Seru
m N
E (p
gm
L)
sectsectlowastlowast
lowastlowast
lowastlowast
amp
lowastlowast lowastlowast
amp
ampamp
Serum NE
Figure 2 Comparison of serumNE with control group lowastlowast119875 lt 001with Sanyinjiao (SP 6) group 119875 lt 001 with Hegu (LI 4) groupamp119875 lt 005 ampamp
119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6)group sectsect119875 lt 001 with Xuehai (SP 10) group nn119875 lt 001 119873 = 20for each group
(119865 = 6517 119875 lt 001) Using LSD multiple comparisonsNET and 1205722AR mRNA expression increased significantly inall electroacupuncture groups and the MP group in the orderof control group lt X = HampS = H = S lt MP group withno difference between electroacupuncture groups Similarchanges were seen in mRNA expression in the enlargedsegment of the spinal cord for with NET (119865 = 22543 119875 lt001) and 1205722AR (119865 = 21576 119875 lt 001 Figure 4 and Table 4)
4 Discussion
It is believed in traditional Chinese medicine that laborpain during delivery results from uterine contraction fetalhead descending and pressure on local tissues and fromdisharmony of Qi and blood due to fear and nervousnesswhich is roughly translated as ldquostagnation results in painrdquoIt is said in the chapter of Nine Needles Arid Twelve Yuan ofthe Miraculous Pivot that needles could be used to unblock
meridians and regulate Qi and blood [6] Thus it is the beliefthat acupuncture can be used to relieve pain
S is the crossing point of the kidney spleen and livermeridians H is the source point of the large intestinemeridian of Hand-Yangming and Yangming meridians andis characterized by plenty of Qi and blood Qi is the masterof blood and blood would follow if Qi moves HampS is amatch with distal and proximal acupoints X is the point ofthe spleenmeridian Inmeridian theory the uterus is directlyconnected with the Chong Ren and Du meridians whichall correspond to the kidney spleen and liver meridians [6]In this study electroacupuncture was applied to stimulatedifferent acupoints to activate the Qi of the kidney spleenliver and Ren meridians to unblock meridians and thusregulate Qi and blood and calm mind In addition it canstimulate the sensory fibers of nerves in order to relive pain
In modern medicine labor pain results from uterinecontraction and cervical dilation during the first stage andthe fetus descending during the second and third stages oflabor Along with anxiety fear and nervousness sympatheticactivation is increased which leads to an increase in NEsecretion followed by an increase in pain sensitivity [7]NE spreads throughout the nervous system and internalorgans andNEneuronsmostly exist in themidbrain reticularformation the locus coeruleus and the ventrolateral part ofthe medulla
NE can act as a hormone in almost every internal organand it is a neurotransmitter of the sympathetic nerve andcentral nervous system It was one of the neurotransmittersthat had been the focus of early acupuncture research [8]It was found that intracerebroventricular injection of NEcan antagonize morphine indicating that NE plays a role incounteracting its analgesic in the brainWhenDawson-Basoa[9] applied electroacupuncture on rats after intraventricularinjection of dioctyl phthalate (DOP) he demonstrated thatthere was an increase in circulating NE and also found a sig-nificant decrease in analgesia efficiency from electroacupunc-ture On the contrary intraspinal injection of DOP resultedin an increased efficiency It was suggested that an increasedrelease of NE in brain counteracts the analgesic effect ofelectroacupuncture However an increasing release of NEin the spinal cord led to strengthening of the effect of elec-troacupuncture However a feedback mechanism whereby
Evidence-Based Complementary and Alternative Medicine 5
Table 3 Comparison of gray value of NET and 1205722AR in the central nervous system of the rats
Group 119899
Gray matter region Lumbar spinal cordNET 1205722AR NET 1205722AR
Control 20 024 plusmn 012 022 plusmn 009 076 plusmn 030 049 plusmn 012Electroacupuncture Sanyinjiao 20 047 plusmn 021lowastlowast 047 plusmn 021lowastlowast 029 plusmn 018lowastlowast 013 plusmn 006lowastlowast
Electroacupuncture Hegu 20 044 plusmn 026lowastlowast 049 plusmn 019lowastlowast 045 plusmn 017lowastlowast 035 plusmn 014lowastlowast
Electroacupuncture Hegu + Sanyinjiao 20 044 plusmn 022lowastlowast 043 plusmn 029lowastlowast 048 plusmn 026lowastlowast 032 plusmn 014lowastlowast
Electroacupuncture Xuehai 20 046 plusmn 023lowastlowast 048 plusmn 026lowastlowast 057 plusmn 021lowastlowast 037 plusmn 010lowastlowast
Meperidine 20 062 plusmn 028lowastlowastampsectn 065 plusmn 029lowastlowastampsectsectn 020 plusmn 011lowastlowastampampsectsectnn 011 plusmn 005lowastlowastampampsectsectnn
119865 5689 688 14171 35373119875 119875 lt 001 119875 lt 001 119875 lt 001 119875 lt 001
Note comparison of NET and 1205722AR mRNA expression in central nervous system significant difference 119875 lt 005 With control group lowastlowast119875 lt 001 withSanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005sectsect119875 lt 001 with Xuehai (SP 10) n119875 lt 005 nn119875 lt 001
Electroacupuncture
000
010
020
030
040
050
060
070
080
090
100
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
NET
Control Sanyinjiao Hegu Xuehai MeperidineHegu +Sanyinjiao
1205722AR
120573-actin
lowastlowastlowastlowast lowastlowastlowastlowastlowastlowast
lowastlowast
lowastlowast
lowastlowastlowastlowastlowastlowast
sectsectampamp
NET1205722AR
(a)
Electroacupuncture
Control Sanyinjiao Hegu Xuehai Meperidine
Control Sanyinjiao Hegu Xuehai MeperidineHegu +Sanyinjiao
NET
1205722AR
120573-actin
000
020
040
060
080
100
120
Hegu +Sanyinjiao
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowastlowastlowast
lowastlowast
sectsect
sectsect
ampamp
ampamp
NET1205722AR
(b)
Figure 3 Comparison of NET and 1205722AR protein expression in the central nervous system (a) gray matter and (b) lumbar spinal cord Thewestern blots shown are the representative images With control group lowastlowast119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 withHegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005 sectsect119875 lt 001 with Xuehai (SP 10) groupn119875 lt 005
nn119875 lt 001119873 = 20 for each group
6 Evidence-Based Complementary and Alternative Medicine
Table 4 Comparison of NET and 1205722AR mRNA expression in central nervous system
Group 119899
Gray matter region Lumbar spinal cordNET 1205722AR NET 1205722AR
Control 20 10000 10000 10000 10000Electroacupuncture Sanyinjiao 20 13535 plusmn 03008lowastlowast 13465 plusmn 03124lowastlowast 03931 plusmn 17217lowastlowast 03689 plusmn 01891lowastlowast
Electroacupuncture Hegu 20 13961 plusmn 02977lowastlowast 13068 plusmn 03293lowastlowast 05793 plusmn 03482lowastlowast 05862 plusmn 03410lowastlowast
Electroacupuncture Hegu+ Sanyinjiao 20 13823 plusmn 03527lowastlowast 13381 plusmn 03963lowastlowast 07393 plusmn 03158lowastlowastamp 08124 plusmn 03414lowastampamp
Electroacupuncture Xuehai 20 13883 plusmn 03400lowastlowast 13063 plusmn 02767lowastlowast 07358 plusmn 02178lowastlowastamp 07460 plusmn 02394lowastlowastamp
Meperidine 20 16084 plusmn 04064lowastlowastampsectn 15475 plusmn 03585lowastlowastampsectn 03446 plusmn 01606lowastlowastampampsectsectnn 03515 plusmn 0203lowastlowastampampsectsectnn
119865 7868 6517 22243 21576119875 119875 lt 001 119875 lt 001 119875 lt 001 119875 lt 001
Note comparison of NET and 1205722AR mRNA expression in cerebral cortex and spinal cord significant difference 119875 lt 005 With control group lowast119875 lt 005lowastlowast
119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6)group sect119875 lt 005 sectsect119875 lt 001 with Xuehai (SP 10) n119875 lt 005 nn119875 lt 001
00000
05000
10000
15000
20000
25000
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Electroacupuncture
lowastlowastlowastlowast lowastlowastlowastlowastlowastlowastlowastlowast lowastlowast
lowastlowast
lowastlowast
lowastlowast
sectsect
ampamp
NET1205722AR
(a)
00000
05000
10000
15000
20000
25000
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Electroacupuncture
lowastlowast
lowastlowast
lowastlowastlowastlowastlowastlowast
lowastlowast
lowastlowastlowastlowast
lowastlowastlowastlowast
sectsectsectsectampamp
ampamp
NET1205722AR
(b)
Figure 4 Comparison of NET and 1205722AR mRNA expression in the central nervous system (a) gray matter and (b) lumbar spinal cord Thewestern blots shown are the representative images With control group lowastlowast119875 lt 005 lowastlowast119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005 sectsect119875 lt 001 with Xuehai
(SP 10) group n119875 lt 005 nn119875 lt 001119873 = 20 for each group
NET acted to uptake NE back to the presynaptic membraneoccurred This helped to regulate the NE concentration inthe synaptic cleft and to terminate nerve impulse signalsand thus to maintain the sensitivity of receptors to theneurotransmitter [10] In recent years this has been a researchfocus as a target for antidepressants and anti-drug-abusetherapy [11]
In the animal neuralgia model norepinephrine inhibitorexperiments showed an analgesia effect and spinal nerve lig-ation (SNL) experiments showed an increase of NET whichindicated the analgesic mechanism of transporter-targetedantidepressant [12] Research suggested that it is essentialto inhibit norepinephrine transporter for the synergismof analgesic effect from monoamine transmitter reuptakeinhibitors and of opioid drugs [13] Cerebral NET activitywas associated with agitation of PTSD (posttraumatic stress
disorder) patients [14] As a membrane-bound G protein-coupled receptor 1205722AR can amplify and transduce the extra-cellular stimulating signal into cells to trigger intracellularbiological reactions It has a feedback inhibitory effect on NEsecretion Research in recent years [15] indicated that therewas no visible side effect on respiratory depression and thegastrointestinal system when 1205722AR agonist in the form ofopioids was administered for acute pain
As mentioned above NET can reuptake NE to thepresynapticmembrane so as to regulate theNE concentrationin the synaptic cleft [16] Alpha 2AR also has a feedbackinhibitory effect on NE secretion It has therefore beensuggested that NE plays a role in the development of pain byNET and 1205722AR
In this research a significant increasing expression ofNET 1205722AR protein andmRNA in the cerebra and a decrease
Evidence-Based Complementary and Alternative Medicine 7
in the spinal cord were found in electroacupuncture groupsIt is speculated that the electroacupuncture stimulation couldactivate NET and 1205722AR on the presynaptic membrane ofthe central noradrenergic nerve resulting in an increasedexpression of NET and 1205722ARmRNA and proteinThis wouldlead to an increased reuptake of NE by NET strengthenedfeedback inhibition of 1205722AR toNE and thus a decrease of NEreleaseMoreover spinal reflex is controlled by cerebraWhencerebral NE release is decreased the expression of NET and1205722AR in spinal cordwould also reduce leading to a decreasedreuptake of NE by NET leading to a decreased feedbackinhibition of 1205722AR to NE and thus an overall increase of NErelease
As for the different results obtained from different acu-points this may be related to the neuroanatomical location ofthe acupoints The sympathetic nerve controlling the uterusis from T10-S2 [17] and parasympathetic nerve is from L6-S1 [18 19] which means that the nerve controlling the uterusin the rat is from T10-S2 and the peaks are from T13-L2 andL6-S10 The nerve controlling Sanyinjiao (SP 6) is from L3-6 the nerve controlling Hegu (LI 4) is from C5-T1 and thenerve controlling Xuehai (SP 10) is from L3-4 [20]This couldhave led to the different effects being seen on the differentacupoints
This research indicates that the role of NE in the analgesicmechanism of acupuncture is related to reuptake of NE byNET and feedback inhibition of 1205722AR Under the effect ofelectroacupuncture there was an increasing reuptake of NEby NET in the cerebra strengthened feedback inhibition of1205722AR to NE and thus a decrease of NE release In additiona decreasing reuptake of NE by NET in spinal cord was alsoseen leading to a decreasing feedback inhibition of 1205722AR toNE and thus an increase of NE release
Competing Interests
The authors do not have any conflict of interests financial orotherwise to declare
Authorsrsquo Contributions
Yuanyuan Feng Qi Zhang YuWang andMeiliWang carriedout the experimental work Qiuyan Jiang and Qianli Tangparticipated in the design of the study and Qiuyan Jiangalso performed the statistical analysis Qianli Tang QiuyanJiang and Suren R Sooranna conceived of the study andparticipated in its design and coordination Qiuyan JiangSuren R Sooranna and Shike Lin helped to draft the paperAll authors read and approved the final paper
Acknowledgments
This study was supported by the National Natural ScienceFoundation Project Grant (81260547 and 81373685)
References
[1] J Qiuyan M Haixia S Jinling et al ldquoThe effect of the elec-troacupuncture on labor analgesia and dynorphin regulation
impactrdquo Maternal and Child Health Care of China vol 27 no5 pp 733ndash734 2012
[2] S Zhenqiu and X YongyongMedical Statistics Peoplersquos Medi-cal Publishing House Beijing China 4th edition 2014
[3] Y Shuai R Xiaoxuan Z Yafang et al ldquoEffects of electroacupun-ture on Baihui(GV20) and Zusanli(ST36) on behavior and 5-HT level in rats with chronic visceral painrdquo Jilin Journal ofTraditional Chinese Medicine vol 33 no 4 pp 400ndash401 2013
[4] W Wei W Ximei and L Yuanjian Experimental Methodologyof Pharmacology vol 7 Peoplersquos Medical Publishing HouseBeijing China 4th edition 2010
[5] S Wegert M H Ossipov M L Nichols et al ldquoDifferentialactivities of intrathecal MK-801 or morphine to alter responsesto thermal and mechanical stimuli in normal or nerve-injuredratsrdquo Pain vol 71 no 1 pp 57ndash64 1997
[6] S Kulkarni and S T Sia ldquoHazards of labour pain and the roleof non-neuraxial labour analgesiardquo Trends in Anaesthesia andCritical Care vol 4 no 4 pp 109ndash114 2014
[7] Z Dengben and S Lijun Complete Note and Interpretation ofHuangdi Nei JingThe 2nd Version 1 NewWorld Press BeijingChina 2010
[8] H Jisheng and F Bifa Pain Peking University Press BeijingChina 1st edition 2012
[9] M Dawson-Basoa and A R Gintzler ldquoInvolvement of spinalcord 120575 opiate receptors in the antinociception of gestation andits hormonal simulationrdquo Brain Research vol 757 no 1 pp 37ndash42 1997
[10] A B Pramod J Foster L Carvelli and L K Henry ldquoSLC6transporters structure function regulation disease associationand therapeuticsrdquoMolecular Aspects of Medicine vol 34 no 2-3 pp 197ndash219 2013
[11] J M V Timple L G Magalhaes K C Souza Rezende etal ldquoThe lignan (minus)-hinokinin displays modulatory effects onhuman monoamine and gaba transporter activitiesrdquo Journal ofNatural Products vol 76 no 10 pp 1889ndash1895 2013
[12] M L Rojo A Rodrıguez-Gaztelumendi A Pazos and A DıazldquoDifferential adaptive changes on serotonin and noradrenalinetransporters in a rat model of peripheral neuropathic painrdquoNeuroscience Letters vol 515 no 2 pp 181ndash186 2012
[13] F Shen P R Tsuruda J A M Smith G P Obedencioand W J Martin ldquoRelative contributions of norepinephrineand serotonin transporters to antinociceptive synergy betweenmonoamine reuptake inhibitors andmorphine in the rat forma-lin modelrdquo PLoS ONE vol 8 no 9 article e74891 2013
[14] X Zhao Y Huang H Ma Q Jin Y Wang and G ZhuldquoAssociation between major depressive disorder and the nore-pinephrine transporter polymorphisms T-182C and G1287A ameta-analysisrdquo Journal of Affective Disorders vol 150 no 1 pp23ndash28 2013
[15] S R Arain R M Ruehlow T D Uhrich and T J Ebert ldquoTheefficacy of dexmedetomidine versus morphine for postoper-ative analgesia after major inpatient surgeryrdquo Anesthesia andAnalgesia vol 98 no 1 pp 153ndash158 2004
[16] C Schroeder and J Jordan ldquoNorepinephrine transporter func-tion and human cardiovascular diseaserdquo American Journal ofPhysiologymdashHeart and Circulatory Physiology vol 303 no 11pp H1273ndashH1282 2012
[17] E Houdeau A Rousseau C Meusnier M-J Prudrsquohomme andJ-P Rousseau ldquoSympathetic innervation of the upper and lowerregions of the uterus and cervix in the rat have different originsand routesrdquo Journal of Comparative Neurology vol 399 no 3pp 403ndash412 1998
8 Evidence-Based Complementary and Alternative Medicine
[18] B Baljet and J Drukker ldquoThe extrinsic innervation of the pelvicorgans in the female ratrdquoActaAnatomica vol 107 no 3 pp 241ndash267 1980
[19] R E Papka H H Traurig M Schemann J Collins T Copelinand K Wilson ldquoCholinergic neurons of the pelvic autonomicganglia and uterus of the female rat distribution of axons andpresence of muscarinic receptorsrdquo Cell and Tissue Research vol296 no 2 pp 293ndash305 1999
[20] Y Anfeng andY PingAnatomy and Tissue of Rat Science PressBeijing China 1985
Submit your manuscripts athttpwwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
Evidence-Based Complementary and Alternative Medicine 3
Table 1 Comparison of pain threshold in the 6 groups (119909 plusmn 119904 unit S)
Group 119899 Before treatment After treatmentControl 20 694 plusmn 089 726 plusmn 109Electroacupuncture Sanyinjiao 20 698 plusmn 106 1826 plusmn 121lowastlowastampamp
Electroacupuncture Hegu 20 686 plusmn 100 1596 plusmn 152lowastlowastampampnn
Electroacupuncture Hegu + Sanyinjiao 20 731 plusmn 082 1428 plusmn 097lowastlowastampampnnsectsect
Electroacupuncture Xuehai 20 677 plusmn 104 1214 plusmn 130lowastlowastampampnnsectsect
Meperidine 20 701 plusmn 096 1945 plusmn 184lowastlowast
119865 0736 216361119875 119875 = 0598 gt 005 119875 = 0000 lt 001
119875 lt 001 versus that before treatment lowastlowast119875 lt 001 versus control group ampamp119875 lt 001 versus meperidine group sectsect119875 lt 001 versus Hegu (LI 4) group nn119875 lt001 versus Hegu (LI 4) and Sanyinjiao (SP 6) group 119875 lt 001 versus Xuehai (SP 10) group
minus80∘C for later use Protein was separated by SDS-PAGEuntil the bromophenol blue indicatrix reached the edge ofthe gel The protein was transferred to a polyvinylidenedifluoride membrane (250mA 90min) which was removedand blocked with 5 nonfat milk by shaking for 1-2 h atroom temperature Primary antibody was incubated with theblocked membrane and then kept at 4∘C overnight On thenext day protein was removed by washing with PBS (15mintimes 1 time) and the membrane was washed with TBST 4 times(5min each time) and incubated with secondary antibodyat room temperature for 1 h After washing with TBST colordeveloper was added to the front of the PVDF membraneand four-star image analysis system was used to analyze theintensity of the target protein Biovision BCA Protein AssayKit Santa Cruz NET 1205722AR and 120573-actin primary antibodiesand rabbit secondary antibody and the chemiluminescencekit were all used according to manufacturerrsquos instructions
26 Statistical Analysis All statistical analyses were per-formed with SPSS 200 for Windows All data are presentedas mean plusmn standard deviation (119909 plusmn 119904) One-way ANOVA wasperformed for comparisons between multiple groups Theleast significant difference was used for comparison of meansbetween groups A value of 119875 lt 005 was considered asstatistically significant
3 Results31 Comparison of Pain Threshold between the 6 GroupsThere was no difference in pain threshold in the 6 groupsbefore treatment (all 119875 gt 005) and significant increaseswere seen after treatments (all 119875 lt 001) LSD multiplecomparisons further showed that pain threshold was in theorder of control group lt X lt HampS lt H lt S lt MP group(Figure 1 and Table 1)
32 Serum NE After treatment there were significantdecreases in serumNE expression level between the 6 groupsin the order of control group ltX =HampS =H lt S ltMP groupAmong different groups the levels in the S group decreasedthe most (Figure 2 and Table 2)
33 NET and 1205722AR Protein Expression in the Central NervousSystem Western blot was used to measure NET and 1205722AR
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Electroacupuncture
0
5
10
15
20
25
Pain
thre
shol
d (s
)
sectsect998779998779
lowastlowast
lowastlowast
lowastlowast
lowastlowast
ampamp ampamp ampamp
sectsect
lowastlowast
ampamp
Before treatmentAfter treatment
Figure 1 Effects of electroacupuncture on pain threshold of labor-ing rats Before and after treatment with electroacupuncture painin all rats undergoing parturition was evaluated by the warm watertail-flick test 119875 lt 001 versus before treatment lowastlowast119875 lt 001 versuscontrol ampamp
119875 lt 001 versus meperidine sectsect119875 lt 001 versus Hegu
nn119875 lt 001 versus Hegu + Sanyinjiao 998779998779119875 lt 001 versus Xuehai119873 = 20 for each group
protein expression in the central nervous system Analysis ofvariance was performed for the cerebral cortex NET (119865 =5689 119875 lt 001) and 1205722AR (119865 = 6882 119875 lt 001) There weresignificant increases between the 6 groups in NET and 1205722ARprotein expression (119875 lt 001) by LSD multiple comparisonsin the order of control group ltX =HampS =H = S ltMP groupwith no difference between the electroacupuncture groupsHowever there were significant decreases in the enlargedsegment of the spinal cord with NET (119865 = 14171 119875 lt001) and 1205722AR (119865 = 35373 119875 lt 001) by LSD multiplecomparisons in the order of control group lt X = HampS = H =S ltMP group (Figure 3 and Table 3)
34 NET and 1205722AR mRNA Expression in the Central NervousSystem Real-time PCR analysis of NET and 1205722AR showedsignificant differences in the cerebral cortex mRNA expres-sion between the 6 groups (119865 = 7868 119875 lt 001) and 1205722AR
4 Evidence-Based Complementary and Alternative Medicine
Table 2 Comparison of serum NE after treatment (119909 plusmn 119904)
Group 119899 NE (pgmL)Control 20 19117 plusmn 861Electroacupuncture Sanyinjiao 20 16154 plusmn 1087lowastlowast
Electroacupuncture Hegu 20 17225 plusmn 979lowastlowast
Electroacupuncture Hegu + Sanyinjiao 20 18023 plusmn 1452lowastlowastamp
Electroacupuncture Xuehai 20 18061 plusmn 1250lowastlowastamp
Meperidine 20 15918 plusmn 1702lowastlowastampampsectsectnn
119865 19182119875 119875 lt 001
Note comparison of serum NE with control group lowastlowast119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001with Hegu (LI 4) and Sanyinjiao (SP 6) group sectsect119875 lt 001 with Xuehai (SP 10) nn119875 lt 001
Electroacupuncture
0
50
100
150
200
250
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Seru
m N
E (p
gm
L)
sectsectlowastlowast
lowastlowast
lowastlowast
amp
lowastlowast lowastlowast
amp
ampamp
Serum NE
Figure 2 Comparison of serumNE with control group lowastlowast119875 lt 001with Sanyinjiao (SP 6) group 119875 lt 001 with Hegu (LI 4) groupamp119875 lt 005 ampamp
119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6)group sectsect119875 lt 001 with Xuehai (SP 10) group nn119875 lt 001 119873 = 20for each group
(119865 = 6517 119875 lt 001) Using LSD multiple comparisonsNET and 1205722AR mRNA expression increased significantly inall electroacupuncture groups and the MP group in the orderof control group lt X = HampS = H = S lt MP group withno difference between electroacupuncture groups Similarchanges were seen in mRNA expression in the enlargedsegment of the spinal cord for with NET (119865 = 22543 119875 lt001) and 1205722AR (119865 = 21576 119875 lt 001 Figure 4 and Table 4)
4 Discussion
It is believed in traditional Chinese medicine that laborpain during delivery results from uterine contraction fetalhead descending and pressure on local tissues and fromdisharmony of Qi and blood due to fear and nervousnesswhich is roughly translated as ldquostagnation results in painrdquoIt is said in the chapter of Nine Needles Arid Twelve Yuan ofthe Miraculous Pivot that needles could be used to unblock
meridians and regulate Qi and blood [6] Thus it is the beliefthat acupuncture can be used to relieve pain
S is the crossing point of the kidney spleen and livermeridians H is the source point of the large intestinemeridian of Hand-Yangming and Yangming meridians andis characterized by plenty of Qi and blood Qi is the masterof blood and blood would follow if Qi moves HampS is amatch with distal and proximal acupoints X is the point ofthe spleenmeridian Inmeridian theory the uterus is directlyconnected with the Chong Ren and Du meridians whichall correspond to the kidney spleen and liver meridians [6]In this study electroacupuncture was applied to stimulatedifferent acupoints to activate the Qi of the kidney spleenliver and Ren meridians to unblock meridians and thusregulate Qi and blood and calm mind In addition it canstimulate the sensory fibers of nerves in order to relive pain
In modern medicine labor pain results from uterinecontraction and cervical dilation during the first stage andthe fetus descending during the second and third stages oflabor Along with anxiety fear and nervousness sympatheticactivation is increased which leads to an increase in NEsecretion followed by an increase in pain sensitivity [7]NE spreads throughout the nervous system and internalorgans andNEneuronsmostly exist in themidbrain reticularformation the locus coeruleus and the ventrolateral part ofthe medulla
NE can act as a hormone in almost every internal organand it is a neurotransmitter of the sympathetic nerve andcentral nervous system It was one of the neurotransmittersthat had been the focus of early acupuncture research [8]It was found that intracerebroventricular injection of NEcan antagonize morphine indicating that NE plays a role incounteracting its analgesic in the brainWhenDawson-Basoa[9] applied electroacupuncture on rats after intraventricularinjection of dioctyl phthalate (DOP) he demonstrated thatthere was an increase in circulating NE and also found a sig-nificant decrease in analgesia efficiency from electroacupunc-ture On the contrary intraspinal injection of DOP resultedin an increased efficiency It was suggested that an increasedrelease of NE in brain counteracts the analgesic effect ofelectroacupuncture However an increasing release of NEin the spinal cord led to strengthening of the effect of elec-troacupuncture However a feedback mechanism whereby
Evidence-Based Complementary and Alternative Medicine 5
Table 3 Comparison of gray value of NET and 1205722AR in the central nervous system of the rats
Group 119899
Gray matter region Lumbar spinal cordNET 1205722AR NET 1205722AR
Control 20 024 plusmn 012 022 plusmn 009 076 plusmn 030 049 plusmn 012Electroacupuncture Sanyinjiao 20 047 plusmn 021lowastlowast 047 plusmn 021lowastlowast 029 plusmn 018lowastlowast 013 plusmn 006lowastlowast
Electroacupuncture Hegu 20 044 plusmn 026lowastlowast 049 plusmn 019lowastlowast 045 plusmn 017lowastlowast 035 plusmn 014lowastlowast
Electroacupuncture Hegu + Sanyinjiao 20 044 plusmn 022lowastlowast 043 plusmn 029lowastlowast 048 plusmn 026lowastlowast 032 plusmn 014lowastlowast
Electroacupuncture Xuehai 20 046 plusmn 023lowastlowast 048 plusmn 026lowastlowast 057 plusmn 021lowastlowast 037 plusmn 010lowastlowast
Meperidine 20 062 plusmn 028lowastlowastampsectn 065 plusmn 029lowastlowastampsectsectn 020 plusmn 011lowastlowastampampsectsectnn 011 plusmn 005lowastlowastampampsectsectnn
119865 5689 688 14171 35373119875 119875 lt 001 119875 lt 001 119875 lt 001 119875 lt 001
Note comparison of NET and 1205722AR mRNA expression in central nervous system significant difference 119875 lt 005 With control group lowastlowast119875 lt 001 withSanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005sectsect119875 lt 001 with Xuehai (SP 10) n119875 lt 005 nn119875 lt 001
Electroacupuncture
000
010
020
030
040
050
060
070
080
090
100
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
NET
Control Sanyinjiao Hegu Xuehai MeperidineHegu +Sanyinjiao
1205722AR
120573-actin
lowastlowastlowastlowast lowastlowastlowastlowastlowastlowast
lowastlowast
lowastlowast
lowastlowastlowastlowastlowastlowast
sectsectampamp
NET1205722AR
(a)
Electroacupuncture
Control Sanyinjiao Hegu Xuehai Meperidine
Control Sanyinjiao Hegu Xuehai MeperidineHegu +Sanyinjiao
NET
1205722AR
120573-actin
000
020
040
060
080
100
120
Hegu +Sanyinjiao
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowastlowastlowast
lowastlowast
sectsect
sectsect
ampamp
ampamp
NET1205722AR
(b)
Figure 3 Comparison of NET and 1205722AR protein expression in the central nervous system (a) gray matter and (b) lumbar spinal cord Thewestern blots shown are the representative images With control group lowastlowast119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 withHegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005 sectsect119875 lt 001 with Xuehai (SP 10) groupn119875 lt 005
nn119875 lt 001119873 = 20 for each group
6 Evidence-Based Complementary and Alternative Medicine
Table 4 Comparison of NET and 1205722AR mRNA expression in central nervous system
Group 119899
Gray matter region Lumbar spinal cordNET 1205722AR NET 1205722AR
Control 20 10000 10000 10000 10000Electroacupuncture Sanyinjiao 20 13535 plusmn 03008lowastlowast 13465 plusmn 03124lowastlowast 03931 plusmn 17217lowastlowast 03689 plusmn 01891lowastlowast
Electroacupuncture Hegu 20 13961 plusmn 02977lowastlowast 13068 plusmn 03293lowastlowast 05793 plusmn 03482lowastlowast 05862 plusmn 03410lowastlowast
Electroacupuncture Hegu+ Sanyinjiao 20 13823 plusmn 03527lowastlowast 13381 plusmn 03963lowastlowast 07393 plusmn 03158lowastlowastamp 08124 plusmn 03414lowastampamp
Electroacupuncture Xuehai 20 13883 plusmn 03400lowastlowast 13063 plusmn 02767lowastlowast 07358 plusmn 02178lowastlowastamp 07460 plusmn 02394lowastlowastamp
Meperidine 20 16084 plusmn 04064lowastlowastampsectn 15475 plusmn 03585lowastlowastampsectn 03446 plusmn 01606lowastlowastampampsectsectnn 03515 plusmn 0203lowastlowastampampsectsectnn
119865 7868 6517 22243 21576119875 119875 lt 001 119875 lt 001 119875 lt 001 119875 lt 001
Note comparison of NET and 1205722AR mRNA expression in cerebral cortex and spinal cord significant difference 119875 lt 005 With control group lowast119875 lt 005lowastlowast
119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6)group sect119875 lt 005 sectsect119875 lt 001 with Xuehai (SP 10) n119875 lt 005 nn119875 lt 001
00000
05000
10000
15000
20000
25000
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Electroacupuncture
lowastlowastlowastlowast lowastlowastlowastlowastlowastlowastlowastlowast lowastlowast
lowastlowast
lowastlowast
lowastlowast
sectsect
ampamp
NET1205722AR
(a)
00000
05000
10000
15000
20000
25000
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Electroacupuncture
lowastlowast
lowastlowast
lowastlowastlowastlowastlowastlowast
lowastlowast
lowastlowastlowastlowast
lowastlowastlowastlowast
sectsectsectsectampamp
ampamp
NET1205722AR
(b)
Figure 4 Comparison of NET and 1205722AR mRNA expression in the central nervous system (a) gray matter and (b) lumbar spinal cord Thewestern blots shown are the representative images With control group lowastlowast119875 lt 005 lowastlowast119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005 sectsect119875 lt 001 with Xuehai
(SP 10) group n119875 lt 005 nn119875 lt 001119873 = 20 for each group
NET acted to uptake NE back to the presynaptic membraneoccurred This helped to regulate the NE concentration inthe synaptic cleft and to terminate nerve impulse signalsand thus to maintain the sensitivity of receptors to theneurotransmitter [10] In recent years this has been a researchfocus as a target for antidepressants and anti-drug-abusetherapy [11]
In the animal neuralgia model norepinephrine inhibitorexperiments showed an analgesia effect and spinal nerve lig-ation (SNL) experiments showed an increase of NET whichindicated the analgesic mechanism of transporter-targetedantidepressant [12] Research suggested that it is essentialto inhibit norepinephrine transporter for the synergismof analgesic effect from monoamine transmitter reuptakeinhibitors and of opioid drugs [13] Cerebral NET activitywas associated with agitation of PTSD (posttraumatic stress
disorder) patients [14] As a membrane-bound G protein-coupled receptor 1205722AR can amplify and transduce the extra-cellular stimulating signal into cells to trigger intracellularbiological reactions It has a feedback inhibitory effect on NEsecretion Research in recent years [15] indicated that therewas no visible side effect on respiratory depression and thegastrointestinal system when 1205722AR agonist in the form ofopioids was administered for acute pain
As mentioned above NET can reuptake NE to thepresynapticmembrane so as to regulate theNE concentrationin the synaptic cleft [16] Alpha 2AR also has a feedbackinhibitory effect on NE secretion It has therefore beensuggested that NE plays a role in the development of pain byNET and 1205722AR
In this research a significant increasing expression ofNET 1205722AR protein andmRNA in the cerebra and a decrease
Evidence-Based Complementary and Alternative Medicine 7
in the spinal cord were found in electroacupuncture groupsIt is speculated that the electroacupuncture stimulation couldactivate NET and 1205722AR on the presynaptic membrane ofthe central noradrenergic nerve resulting in an increasedexpression of NET and 1205722ARmRNA and proteinThis wouldlead to an increased reuptake of NE by NET strengthenedfeedback inhibition of 1205722AR toNE and thus a decrease of NEreleaseMoreover spinal reflex is controlled by cerebraWhencerebral NE release is decreased the expression of NET and1205722AR in spinal cordwould also reduce leading to a decreasedreuptake of NE by NET leading to a decreased feedbackinhibition of 1205722AR to NE and thus an overall increase of NErelease
As for the different results obtained from different acu-points this may be related to the neuroanatomical location ofthe acupoints The sympathetic nerve controlling the uterusis from T10-S2 [17] and parasympathetic nerve is from L6-S1 [18 19] which means that the nerve controlling the uterusin the rat is from T10-S2 and the peaks are from T13-L2 andL6-S10 The nerve controlling Sanyinjiao (SP 6) is from L3-6 the nerve controlling Hegu (LI 4) is from C5-T1 and thenerve controlling Xuehai (SP 10) is from L3-4 [20]This couldhave led to the different effects being seen on the differentacupoints
This research indicates that the role of NE in the analgesicmechanism of acupuncture is related to reuptake of NE byNET and feedback inhibition of 1205722AR Under the effect ofelectroacupuncture there was an increasing reuptake of NEby NET in the cerebra strengthened feedback inhibition of1205722AR to NE and thus a decrease of NE release In additiona decreasing reuptake of NE by NET in spinal cord was alsoseen leading to a decreasing feedback inhibition of 1205722AR toNE and thus an increase of NE release
Competing Interests
The authors do not have any conflict of interests financial orotherwise to declare
Authorsrsquo Contributions
Yuanyuan Feng Qi Zhang YuWang andMeiliWang carriedout the experimental work Qiuyan Jiang and Qianli Tangparticipated in the design of the study and Qiuyan Jiangalso performed the statistical analysis Qianli Tang QiuyanJiang and Suren R Sooranna conceived of the study andparticipated in its design and coordination Qiuyan JiangSuren R Sooranna and Shike Lin helped to draft the paperAll authors read and approved the final paper
Acknowledgments
This study was supported by the National Natural ScienceFoundation Project Grant (81260547 and 81373685)
References
[1] J Qiuyan M Haixia S Jinling et al ldquoThe effect of the elec-troacupuncture on labor analgesia and dynorphin regulation
impactrdquo Maternal and Child Health Care of China vol 27 no5 pp 733ndash734 2012
[2] S Zhenqiu and X YongyongMedical Statistics Peoplersquos Medi-cal Publishing House Beijing China 4th edition 2014
[3] Y Shuai R Xiaoxuan Z Yafang et al ldquoEffects of electroacupun-ture on Baihui(GV20) and Zusanli(ST36) on behavior and 5-HT level in rats with chronic visceral painrdquo Jilin Journal ofTraditional Chinese Medicine vol 33 no 4 pp 400ndash401 2013
[4] W Wei W Ximei and L Yuanjian Experimental Methodologyof Pharmacology vol 7 Peoplersquos Medical Publishing HouseBeijing China 4th edition 2010
[5] S Wegert M H Ossipov M L Nichols et al ldquoDifferentialactivities of intrathecal MK-801 or morphine to alter responsesto thermal and mechanical stimuli in normal or nerve-injuredratsrdquo Pain vol 71 no 1 pp 57ndash64 1997
[6] S Kulkarni and S T Sia ldquoHazards of labour pain and the roleof non-neuraxial labour analgesiardquo Trends in Anaesthesia andCritical Care vol 4 no 4 pp 109ndash114 2014
[7] Z Dengben and S Lijun Complete Note and Interpretation ofHuangdi Nei JingThe 2nd Version 1 NewWorld Press BeijingChina 2010
[8] H Jisheng and F Bifa Pain Peking University Press BeijingChina 1st edition 2012
[9] M Dawson-Basoa and A R Gintzler ldquoInvolvement of spinalcord 120575 opiate receptors in the antinociception of gestation andits hormonal simulationrdquo Brain Research vol 757 no 1 pp 37ndash42 1997
[10] A B Pramod J Foster L Carvelli and L K Henry ldquoSLC6transporters structure function regulation disease associationand therapeuticsrdquoMolecular Aspects of Medicine vol 34 no 2-3 pp 197ndash219 2013
[11] J M V Timple L G Magalhaes K C Souza Rezende etal ldquoThe lignan (minus)-hinokinin displays modulatory effects onhuman monoamine and gaba transporter activitiesrdquo Journal ofNatural Products vol 76 no 10 pp 1889ndash1895 2013
[12] M L Rojo A Rodrıguez-Gaztelumendi A Pazos and A DıazldquoDifferential adaptive changes on serotonin and noradrenalinetransporters in a rat model of peripheral neuropathic painrdquoNeuroscience Letters vol 515 no 2 pp 181ndash186 2012
[13] F Shen P R Tsuruda J A M Smith G P Obedencioand W J Martin ldquoRelative contributions of norepinephrineand serotonin transporters to antinociceptive synergy betweenmonoamine reuptake inhibitors andmorphine in the rat forma-lin modelrdquo PLoS ONE vol 8 no 9 article e74891 2013
[14] X Zhao Y Huang H Ma Q Jin Y Wang and G ZhuldquoAssociation between major depressive disorder and the nore-pinephrine transporter polymorphisms T-182C and G1287A ameta-analysisrdquo Journal of Affective Disorders vol 150 no 1 pp23ndash28 2013
[15] S R Arain R M Ruehlow T D Uhrich and T J Ebert ldquoTheefficacy of dexmedetomidine versus morphine for postoper-ative analgesia after major inpatient surgeryrdquo Anesthesia andAnalgesia vol 98 no 1 pp 153ndash158 2004
[16] C Schroeder and J Jordan ldquoNorepinephrine transporter func-tion and human cardiovascular diseaserdquo American Journal ofPhysiologymdashHeart and Circulatory Physiology vol 303 no 11pp H1273ndashH1282 2012
[17] E Houdeau A Rousseau C Meusnier M-J Prudrsquohomme andJ-P Rousseau ldquoSympathetic innervation of the upper and lowerregions of the uterus and cervix in the rat have different originsand routesrdquo Journal of Comparative Neurology vol 399 no 3pp 403ndash412 1998
8 Evidence-Based Complementary and Alternative Medicine
[18] B Baljet and J Drukker ldquoThe extrinsic innervation of the pelvicorgans in the female ratrdquoActaAnatomica vol 107 no 3 pp 241ndash267 1980
[19] R E Papka H H Traurig M Schemann J Collins T Copelinand K Wilson ldquoCholinergic neurons of the pelvic autonomicganglia and uterus of the female rat distribution of axons andpresence of muscarinic receptorsrdquo Cell and Tissue Research vol296 no 2 pp 293ndash305 1999
[20] Y Anfeng andY PingAnatomy and Tissue of Rat Science PressBeijing China 1985
Submit your manuscripts athttpwwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
4 Evidence-Based Complementary and Alternative Medicine
Table 2 Comparison of serum NE after treatment (119909 plusmn 119904)
Group 119899 NE (pgmL)Control 20 19117 plusmn 861Electroacupuncture Sanyinjiao 20 16154 plusmn 1087lowastlowast
Electroacupuncture Hegu 20 17225 plusmn 979lowastlowast
Electroacupuncture Hegu + Sanyinjiao 20 18023 plusmn 1452lowastlowastamp
Electroacupuncture Xuehai 20 18061 plusmn 1250lowastlowastamp
Meperidine 20 15918 plusmn 1702lowastlowastampampsectsectnn
119865 19182119875 119875 lt 001
Note comparison of serum NE with control group lowastlowast119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001with Hegu (LI 4) and Sanyinjiao (SP 6) group sectsect119875 lt 001 with Xuehai (SP 10) nn119875 lt 001
Electroacupuncture
0
50
100
150
200
250
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Seru
m N
E (p
gm
L)
sectsectlowastlowast
lowastlowast
lowastlowast
amp
lowastlowast lowastlowast
amp
ampamp
Serum NE
Figure 2 Comparison of serumNE with control group lowastlowast119875 lt 001with Sanyinjiao (SP 6) group 119875 lt 001 with Hegu (LI 4) groupamp119875 lt 005 ampamp
119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6)group sectsect119875 lt 001 with Xuehai (SP 10) group nn119875 lt 001 119873 = 20for each group
(119865 = 6517 119875 lt 001) Using LSD multiple comparisonsNET and 1205722AR mRNA expression increased significantly inall electroacupuncture groups and the MP group in the orderof control group lt X = HampS = H = S lt MP group withno difference between electroacupuncture groups Similarchanges were seen in mRNA expression in the enlargedsegment of the spinal cord for with NET (119865 = 22543 119875 lt001) and 1205722AR (119865 = 21576 119875 lt 001 Figure 4 and Table 4)
4 Discussion
It is believed in traditional Chinese medicine that laborpain during delivery results from uterine contraction fetalhead descending and pressure on local tissues and fromdisharmony of Qi and blood due to fear and nervousnesswhich is roughly translated as ldquostagnation results in painrdquoIt is said in the chapter of Nine Needles Arid Twelve Yuan ofthe Miraculous Pivot that needles could be used to unblock
meridians and regulate Qi and blood [6] Thus it is the beliefthat acupuncture can be used to relieve pain
S is the crossing point of the kidney spleen and livermeridians H is the source point of the large intestinemeridian of Hand-Yangming and Yangming meridians andis characterized by plenty of Qi and blood Qi is the masterof blood and blood would follow if Qi moves HampS is amatch with distal and proximal acupoints X is the point ofthe spleenmeridian Inmeridian theory the uterus is directlyconnected with the Chong Ren and Du meridians whichall correspond to the kidney spleen and liver meridians [6]In this study electroacupuncture was applied to stimulatedifferent acupoints to activate the Qi of the kidney spleenliver and Ren meridians to unblock meridians and thusregulate Qi and blood and calm mind In addition it canstimulate the sensory fibers of nerves in order to relive pain
In modern medicine labor pain results from uterinecontraction and cervical dilation during the first stage andthe fetus descending during the second and third stages oflabor Along with anxiety fear and nervousness sympatheticactivation is increased which leads to an increase in NEsecretion followed by an increase in pain sensitivity [7]NE spreads throughout the nervous system and internalorgans andNEneuronsmostly exist in themidbrain reticularformation the locus coeruleus and the ventrolateral part ofthe medulla
NE can act as a hormone in almost every internal organand it is a neurotransmitter of the sympathetic nerve andcentral nervous system It was one of the neurotransmittersthat had been the focus of early acupuncture research [8]It was found that intracerebroventricular injection of NEcan antagonize morphine indicating that NE plays a role incounteracting its analgesic in the brainWhenDawson-Basoa[9] applied electroacupuncture on rats after intraventricularinjection of dioctyl phthalate (DOP) he demonstrated thatthere was an increase in circulating NE and also found a sig-nificant decrease in analgesia efficiency from electroacupunc-ture On the contrary intraspinal injection of DOP resultedin an increased efficiency It was suggested that an increasedrelease of NE in brain counteracts the analgesic effect ofelectroacupuncture However an increasing release of NEin the spinal cord led to strengthening of the effect of elec-troacupuncture However a feedback mechanism whereby
Evidence-Based Complementary and Alternative Medicine 5
Table 3 Comparison of gray value of NET and 1205722AR in the central nervous system of the rats
Group 119899
Gray matter region Lumbar spinal cordNET 1205722AR NET 1205722AR
Control 20 024 plusmn 012 022 plusmn 009 076 plusmn 030 049 plusmn 012Electroacupuncture Sanyinjiao 20 047 plusmn 021lowastlowast 047 plusmn 021lowastlowast 029 plusmn 018lowastlowast 013 plusmn 006lowastlowast
Electroacupuncture Hegu 20 044 plusmn 026lowastlowast 049 plusmn 019lowastlowast 045 plusmn 017lowastlowast 035 plusmn 014lowastlowast
Electroacupuncture Hegu + Sanyinjiao 20 044 plusmn 022lowastlowast 043 plusmn 029lowastlowast 048 plusmn 026lowastlowast 032 plusmn 014lowastlowast
Electroacupuncture Xuehai 20 046 plusmn 023lowastlowast 048 plusmn 026lowastlowast 057 plusmn 021lowastlowast 037 plusmn 010lowastlowast
Meperidine 20 062 plusmn 028lowastlowastampsectn 065 plusmn 029lowastlowastampsectsectn 020 plusmn 011lowastlowastampampsectsectnn 011 plusmn 005lowastlowastampampsectsectnn
119865 5689 688 14171 35373119875 119875 lt 001 119875 lt 001 119875 lt 001 119875 lt 001
Note comparison of NET and 1205722AR mRNA expression in central nervous system significant difference 119875 lt 005 With control group lowastlowast119875 lt 001 withSanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005sectsect119875 lt 001 with Xuehai (SP 10) n119875 lt 005 nn119875 lt 001
Electroacupuncture
000
010
020
030
040
050
060
070
080
090
100
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
NET
Control Sanyinjiao Hegu Xuehai MeperidineHegu +Sanyinjiao
1205722AR
120573-actin
lowastlowastlowastlowast lowastlowastlowastlowastlowastlowast
lowastlowast
lowastlowast
lowastlowastlowastlowastlowastlowast
sectsectampamp
NET1205722AR
(a)
Electroacupuncture
Control Sanyinjiao Hegu Xuehai Meperidine
Control Sanyinjiao Hegu Xuehai MeperidineHegu +Sanyinjiao
NET
1205722AR
120573-actin
000
020
040
060
080
100
120
Hegu +Sanyinjiao
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowastlowastlowast
lowastlowast
sectsect
sectsect
ampamp
ampamp
NET1205722AR
(b)
Figure 3 Comparison of NET and 1205722AR protein expression in the central nervous system (a) gray matter and (b) lumbar spinal cord Thewestern blots shown are the representative images With control group lowastlowast119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 withHegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005 sectsect119875 lt 001 with Xuehai (SP 10) groupn119875 lt 005
nn119875 lt 001119873 = 20 for each group
6 Evidence-Based Complementary and Alternative Medicine
Table 4 Comparison of NET and 1205722AR mRNA expression in central nervous system
Group 119899
Gray matter region Lumbar spinal cordNET 1205722AR NET 1205722AR
Control 20 10000 10000 10000 10000Electroacupuncture Sanyinjiao 20 13535 plusmn 03008lowastlowast 13465 plusmn 03124lowastlowast 03931 plusmn 17217lowastlowast 03689 plusmn 01891lowastlowast
Electroacupuncture Hegu 20 13961 plusmn 02977lowastlowast 13068 plusmn 03293lowastlowast 05793 plusmn 03482lowastlowast 05862 plusmn 03410lowastlowast
Electroacupuncture Hegu+ Sanyinjiao 20 13823 plusmn 03527lowastlowast 13381 plusmn 03963lowastlowast 07393 plusmn 03158lowastlowastamp 08124 plusmn 03414lowastampamp
Electroacupuncture Xuehai 20 13883 plusmn 03400lowastlowast 13063 plusmn 02767lowastlowast 07358 plusmn 02178lowastlowastamp 07460 plusmn 02394lowastlowastamp
Meperidine 20 16084 plusmn 04064lowastlowastampsectn 15475 plusmn 03585lowastlowastampsectn 03446 plusmn 01606lowastlowastampampsectsectnn 03515 plusmn 0203lowastlowastampampsectsectnn
119865 7868 6517 22243 21576119875 119875 lt 001 119875 lt 001 119875 lt 001 119875 lt 001
Note comparison of NET and 1205722AR mRNA expression in cerebral cortex and spinal cord significant difference 119875 lt 005 With control group lowast119875 lt 005lowastlowast
119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6)group sect119875 lt 005 sectsect119875 lt 001 with Xuehai (SP 10) n119875 lt 005 nn119875 lt 001
00000
05000
10000
15000
20000
25000
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Electroacupuncture
lowastlowastlowastlowast lowastlowastlowastlowastlowastlowastlowastlowast lowastlowast
lowastlowast
lowastlowast
lowastlowast
sectsect
ampamp
NET1205722AR
(a)
00000
05000
10000
15000
20000
25000
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Electroacupuncture
lowastlowast
lowastlowast
lowastlowastlowastlowastlowastlowast
lowastlowast
lowastlowastlowastlowast
lowastlowastlowastlowast
sectsectsectsectampamp
ampamp
NET1205722AR
(b)
Figure 4 Comparison of NET and 1205722AR mRNA expression in the central nervous system (a) gray matter and (b) lumbar spinal cord Thewestern blots shown are the representative images With control group lowastlowast119875 lt 005 lowastlowast119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005 sectsect119875 lt 001 with Xuehai
(SP 10) group n119875 lt 005 nn119875 lt 001119873 = 20 for each group
NET acted to uptake NE back to the presynaptic membraneoccurred This helped to regulate the NE concentration inthe synaptic cleft and to terminate nerve impulse signalsand thus to maintain the sensitivity of receptors to theneurotransmitter [10] In recent years this has been a researchfocus as a target for antidepressants and anti-drug-abusetherapy [11]
In the animal neuralgia model norepinephrine inhibitorexperiments showed an analgesia effect and spinal nerve lig-ation (SNL) experiments showed an increase of NET whichindicated the analgesic mechanism of transporter-targetedantidepressant [12] Research suggested that it is essentialto inhibit norepinephrine transporter for the synergismof analgesic effect from monoamine transmitter reuptakeinhibitors and of opioid drugs [13] Cerebral NET activitywas associated with agitation of PTSD (posttraumatic stress
disorder) patients [14] As a membrane-bound G protein-coupled receptor 1205722AR can amplify and transduce the extra-cellular stimulating signal into cells to trigger intracellularbiological reactions It has a feedback inhibitory effect on NEsecretion Research in recent years [15] indicated that therewas no visible side effect on respiratory depression and thegastrointestinal system when 1205722AR agonist in the form ofopioids was administered for acute pain
As mentioned above NET can reuptake NE to thepresynapticmembrane so as to regulate theNE concentrationin the synaptic cleft [16] Alpha 2AR also has a feedbackinhibitory effect on NE secretion It has therefore beensuggested that NE plays a role in the development of pain byNET and 1205722AR
In this research a significant increasing expression ofNET 1205722AR protein andmRNA in the cerebra and a decrease
Evidence-Based Complementary and Alternative Medicine 7
in the spinal cord were found in electroacupuncture groupsIt is speculated that the electroacupuncture stimulation couldactivate NET and 1205722AR on the presynaptic membrane ofthe central noradrenergic nerve resulting in an increasedexpression of NET and 1205722ARmRNA and proteinThis wouldlead to an increased reuptake of NE by NET strengthenedfeedback inhibition of 1205722AR toNE and thus a decrease of NEreleaseMoreover spinal reflex is controlled by cerebraWhencerebral NE release is decreased the expression of NET and1205722AR in spinal cordwould also reduce leading to a decreasedreuptake of NE by NET leading to a decreased feedbackinhibition of 1205722AR to NE and thus an overall increase of NErelease
As for the different results obtained from different acu-points this may be related to the neuroanatomical location ofthe acupoints The sympathetic nerve controlling the uterusis from T10-S2 [17] and parasympathetic nerve is from L6-S1 [18 19] which means that the nerve controlling the uterusin the rat is from T10-S2 and the peaks are from T13-L2 andL6-S10 The nerve controlling Sanyinjiao (SP 6) is from L3-6 the nerve controlling Hegu (LI 4) is from C5-T1 and thenerve controlling Xuehai (SP 10) is from L3-4 [20]This couldhave led to the different effects being seen on the differentacupoints
This research indicates that the role of NE in the analgesicmechanism of acupuncture is related to reuptake of NE byNET and feedback inhibition of 1205722AR Under the effect ofelectroacupuncture there was an increasing reuptake of NEby NET in the cerebra strengthened feedback inhibition of1205722AR to NE and thus a decrease of NE release In additiona decreasing reuptake of NE by NET in spinal cord was alsoseen leading to a decreasing feedback inhibition of 1205722AR toNE and thus an increase of NE release
Competing Interests
The authors do not have any conflict of interests financial orotherwise to declare
Authorsrsquo Contributions
Yuanyuan Feng Qi Zhang YuWang andMeiliWang carriedout the experimental work Qiuyan Jiang and Qianli Tangparticipated in the design of the study and Qiuyan Jiangalso performed the statistical analysis Qianli Tang QiuyanJiang and Suren R Sooranna conceived of the study andparticipated in its design and coordination Qiuyan JiangSuren R Sooranna and Shike Lin helped to draft the paperAll authors read and approved the final paper
Acknowledgments
This study was supported by the National Natural ScienceFoundation Project Grant (81260547 and 81373685)
References
[1] J Qiuyan M Haixia S Jinling et al ldquoThe effect of the elec-troacupuncture on labor analgesia and dynorphin regulation
impactrdquo Maternal and Child Health Care of China vol 27 no5 pp 733ndash734 2012
[2] S Zhenqiu and X YongyongMedical Statistics Peoplersquos Medi-cal Publishing House Beijing China 4th edition 2014
[3] Y Shuai R Xiaoxuan Z Yafang et al ldquoEffects of electroacupun-ture on Baihui(GV20) and Zusanli(ST36) on behavior and 5-HT level in rats with chronic visceral painrdquo Jilin Journal ofTraditional Chinese Medicine vol 33 no 4 pp 400ndash401 2013
[4] W Wei W Ximei and L Yuanjian Experimental Methodologyof Pharmacology vol 7 Peoplersquos Medical Publishing HouseBeijing China 4th edition 2010
[5] S Wegert M H Ossipov M L Nichols et al ldquoDifferentialactivities of intrathecal MK-801 or morphine to alter responsesto thermal and mechanical stimuli in normal or nerve-injuredratsrdquo Pain vol 71 no 1 pp 57ndash64 1997
[6] S Kulkarni and S T Sia ldquoHazards of labour pain and the roleof non-neuraxial labour analgesiardquo Trends in Anaesthesia andCritical Care vol 4 no 4 pp 109ndash114 2014
[7] Z Dengben and S Lijun Complete Note and Interpretation ofHuangdi Nei JingThe 2nd Version 1 NewWorld Press BeijingChina 2010
[8] H Jisheng and F Bifa Pain Peking University Press BeijingChina 1st edition 2012
[9] M Dawson-Basoa and A R Gintzler ldquoInvolvement of spinalcord 120575 opiate receptors in the antinociception of gestation andits hormonal simulationrdquo Brain Research vol 757 no 1 pp 37ndash42 1997
[10] A B Pramod J Foster L Carvelli and L K Henry ldquoSLC6transporters structure function regulation disease associationand therapeuticsrdquoMolecular Aspects of Medicine vol 34 no 2-3 pp 197ndash219 2013
[11] J M V Timple L G Magalhaes K C Souza Rezende etal ldquoThe lignan (minus)-hinokinin displays modulatory effects onhuman monoamine and gaba transporter activitiesrdquo Journal ofNatural Products vol 76 no 10 pp 1889ndash1895 2013
[12] M L Rojo A Rodrıguez-Gaztelumendi A Pazos and A DıazldquoDifferential adaptive changes on serotonin and noradrenalinetransporters in a rat model of peripheral neuropathic painrdquoNeuroscience Letters vol 515 no 2 pp 181ndash186 2012
[13] F Shen P R Tsuruda J A M Smith G P Obedencioand W J Martin ldquoRelative contributions of norepinephrineand serotonin transporters to antinociceptive synergy betweenmonoamine reuptake inhibitors andmorphine in the rat forma-lin modelrdquo PLoS ONE vol 8 no 9 article e74891 2013
[14] X Zhao Y Huang H Ma Q Jin Y Wang and G ZhuldquoAssociation between major depressive disorder and the nore-pinephrine transporter polymorphisms T-182C and G1287A ameta-analysisrdquo Journal of Affective Disorders vol 150 no 1 pp23ndash28 2013
[15] S R Arain R M Ruehlow T D Uhrich and T J Ebert ldquoTheefficacy of dexmedetomidine versus morphine for postoper-ative analgesia after major inpatient surgeryrdquo Anesthesia andAnalgesia vol 98 no 1 pp 153ndash158 2004
[16] C Schroeder and J Jordan ldquoNorepinephrine transporter func-tion and human cardiovascular diseaserdquo American Journal ofPhysiologymdashHeart and Circulatory Physiology vol 303 no 11pp H1273ndashH1282 2012
[17] E Houdeau A Rousseau C Meusnier M-J Prudrsquohomme andJ-P Rousseau ldquoSympathetic innervation of the upper and lowerregions of the uterus and cervix in the rat have different originsand routesrdquo Journal of Comparative Neurology vol 399 no 3pp 403ndash412 1998
8 Evidence-Based Complementary and Alternative Medicine
[18] B Baljet and J Drukker ldquoThe extrinsic innervation of the pelvicorgans in the female ratrdquoActaAnatomica vol 107 no 3 pp 241ndash267 1980
[19] R E Papka H H Traurig M Schemann J Collins T Copelinand K Wilson ldquoCholinergic neurons of the pelvic autonomicganglia and uterus of the female rat distribution of axons andpresence of muscarinic receptorsrdquo Cell and Tissue Research vol296 no 2 pp 293ndash305 1999
[20] Y Anfeng andY PingAnatomy and Tissue of Rat Science PressBeijing China 1985
Submit your manuscripts athttpwwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
Evidence-Based Complementary and Alternative Medicine 5
Table 3 Comparison of gray value of NET and 1205722AR in the central nervous system of the rats
Group 119899
Gray matter region Lumbar spinal cordNET 1205722AR NET 1205722AR
Control 20 024 plusmn 012 022 plusmn 009 076 plusmn 030 049 plusmn 012Electroacupuncture Sanyinjiao 20 047 plusmn 021lowastlowast 047 plusmn 021lowastlowast 029 plusmn 018lowastlowast 013 plusmn 006lowastlowast
Electroacupuncture Hegu 20 044 plusmn 026lowastlowast 049 plusmn 019lowastlowast 045 plusmn 017lowastlowast 035 plusmn 014lowastlowast
Electroacupuncture Hegu + Sanyinjiao 20 044 plusmn 022lowastlowast 043 plusmn 029lowastlowast 048 plusmn 026lowastlowast 032 plusmn 014lowastlowast
Electroacupuncture Xuehai 20 046 plusmn 023lowastlowast 048 plusmn 026lowastlowast 057 plusmn 021lowastlowast 037 plusmn 010lowastlowast
Meperidine 20 062 plusmn 028lowastlowastampsectn 065 plusmn 029lowastlowastampsectsectn 020 plusmn 011lowastlowastampampsectsectnn 011 plusmn 005lowastlowastampampsectsectnn
119865 5689 688 14171 35373119875 119875 lt 001 119875 lt 001 119875 lt 001 119875 lt 001
Note comparison of NET and 1205722AR mRNA expression in central nervous system significant difference 119875 lt 005 With control group lowastlowast119875 lt 001 withSanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005sectsect119875 lt 001 with Xuehai (SP 10) n119875 lt 005 nn119875 lt 001
Electroacupuncture
000
010
020
030
040
050
060
070
080
090
100
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
NET
Control Sanyinjiao Hegu Xuehai MeperidineHegu +Sanyinjiao
1205722AR
120573-actin
lowastlowastlowastlowast lowastlowastlowastlowastlowastlowast
lowastlowast
lowastlowast
lowastlowastlowastlowastlowastlowast
sectsectampamp
NET1205722AR
(a)
Electroacupuncture
Control Sanyinjiao Hegu Xuehai Meperidine
Control Sanyinjiao Hegu Xuehai MeperidineHegu +Sanyinjiao
NET
1205722AR
120573-actin
000
020
040
060
080
100
120
Hegu +Sanyinjiao
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowast
lowastlowastlowastlowast
lowastlowast
sectsect
sectsect
ampamp
ampamp
NET1205722AR
(b)
Figure 3 Comparison of NET and 1205722AR protein expression in the central nervous system (a) gray matter and (b) lumbar spinal cord Thewestern blots shown are the representative images With control group lowastlowast119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 withHegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005 sectsect119875 lt 001 with Xuehai (SP 10) groupn119875 lt 005
nn119875 lt 001119873 = 20 for each group
6 Evidence-Based Complementary and Alternative Medicine
Table 4 Comparison of NET and 1205722AR mRNA expression in central nervous system
Group 119899
Gray matter region Lumbar spinal cordNET 1205722AR NET 1205722AR
Control 20 10000 10000 10000 10000Electroacupuncture Sanyinjiao 20 13535 plusmn 03008lowastlowast 13465 plusmn 03124lowastlowast 03931 plusmn 17217lowastlowast 03689 plusmn 01891lowastlowast
Electroacupuncture Hegu 20 13961 plusmn 02977lowastlowast 13068 plusmn 03293lowastlowast 05793 plusmn 03482lowastlowast 05862 plusmn 03410lowastlowast
Electroacupuncture Hegu+ Sanyinjiao 20 13823 plusmn 03527lowastlowast 13381 plusmn 03963lowastlowast 07393 plusmn 03158lowastlowastamp 08124 plusmn 03414lowastampamp
Electroacupuncture Xuehai 20 13883 plusmn 03400lowastlowast 13063 plusmn 02767lowastlowast 07358 plusmn 02178lowastlowastamp 07460 plusmn 02394lowastlowastamp
Meperidine 20 16084 plusmn 04064lowastlowastampsectn 15475 plusmn 03585lowastlowastampsectn 03446 plusmn 01606lowastlowastampampsectsectnn 03515 plusmn 0203lowastlowastampampsectsectnn
119865 7868 6517 22243 21576119875 119875 lt 001 119875 lt 001 119875 lt 001 119875 lt 001
Note comparison of NET and 1205722AR mRNA expression in cerebral cortex and spinal cord significant difference 119875 lt 005 With control group lowast119875 lt 005lowastlowast
119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6)group sect119875 lt 005 sectsect119875 lt 001 with Xuehai (SP 10) n119875 lt 005 nn119875 lt 001
00000
05000
10000
15000
20000
25000
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Electroacupuncture
lowastlowastlowastlowast lowastlowastlowastlowastlowastlowastlowastlowast lowastlowast
lowastlowast
lowastlowast
lowastlowast
sectsect
ampamp
NET1205722AR
(a)
00000
05000
10000
15000
20000
25000
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Electroacupuncture
lowastlowast
lowastlowast
lowastlowastlowastlowastlowastlowast
lowastlowast
lowastlowastlowastlowast
lowastlowastlowastlowast
sectsectsectsectampamp
ampamp
NET1205722AR
(b)
Figure 4 Comparison of NET and 1205722AR mRNA expression in the central nervous system (a) gray matter and (b) lumbar spinal cord Thewestern blots shown are the representative images With control group lowastlowast119875 lt 005 lowastlowast119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005 sectsect119875 lt 001 with Xuehai
(SP 10) group n119875 lt 005 nn119875 lt 001119873 = 20 for each group
NET acted to uptake NE back to the presynaptic membraneoccurred This helped to regulate the NE concentration inthe synaptic cleft and to terminate nerve impulse signalsand thus to maintain the sensitivity of receptors to theneurotransmitter [10] In recent years this has been a researchfocus as a target for antidepressants and anti-drug-abusetherapy [11]
In the animal neuralgia model norepinephrine inhibitorexperiments showed an analgesia effect and spinal nerve lig-ation (SNL) experiments showed an increase of NET whichindicated the analgesic mechanism of transporter-targetedantidepressant [12] Research suggested that it is essentialto inhibit norepinephrine transporter for the synergismof analgesic effect from monoamine transmitter reuptakeinhibitors and of opioid drugs [13] Cerebral NET activitywas associated with agitation of PTSD (posttraumatic stress
disorder) patients [14] As a membrane-bound G protein-coupled receptor 1205722AR can amplify and transduce the extra-cellular stimulating signal into cells to trigger intracellularbiological reactions It has a feedback inhibitory effect on NEsecretion Research in recent years [15] indicated that therewas no visible side effect on respiratory depression and thegastrointestinal system when 1205722AR agonist in the form ofopioids was administered for acute pain
As mentioned above NET can reuptake NE to thepresynapticmembrane so as to regulate theNE concentrationin the synaptic cleft [16] Alpha 2AR also has a feedbackinhibitory effect on NE secretion It has therefore beensuggested that NE plays a role in the development of pain byNET and 1205722AR
In this research a significant increasing expression ofNET 1205722AR protein andmRNA in the cerebra and a decrease
Evidence-Based Complementary and Alternative Medicine 7
in the spinal cord were found in electroacupuncture groupsIt is speculated that the electroacupuncture stimulation couldactivate NET and 1205722AR on the presynaptic membrane ofthe central noradrenergic nerve resulting in an increasedexpression of NET and 1205722ARmRNA and proteinThis wouldlead to an increased reuptake of NE by NET strengthenedfeedback inhibition of 1205722AR toNE and thus a decrease of NEreleaseMoreover spinal reflex is controlled by cerebraWhencerebral NE release is decreased the expression of NET and1205722AR in spinal cordwould also reduce leading to a decreasedreuptake of NE by NET leading to a decreased feedbackinhibition of 1205722AR to NE and thus an overall increase of NErelease
As for the different results obtained from different acu-points this may be related to the neuroanatomical location ofthe acupoints The sympathetic nerve controlling the uterusis from T10-S2 [17] and parasympathetic nerve is from L6-S1 [18 19] which means that the nerve controlling the uterusin the rat is from T10-S2 and the peaks are from T13-L2 andL6-S10 The nerve controlling Sanyinjiao (SP 6) is from L3-6 the nerve controlling Hegu (LI 4) is from C5-T1 and thenerve controlling Xuehai (SP 10) is from L3-4 [20]This couldhave led to the different effects being seen on the differentacupoints
This research indicates that the role of NE in the analgesicmechanism of acupuncture is related to reuptake of NE byNET and feedback inhibition of 1205722AR Under the effect ofelectroacupuncture there was an increasing reuptake of NEby NET in the cerebra strengthened feedback inhibition of1205722AR to NE and thus a decrease of NE release In additiona decreasing reuptake of NE by NET in spinal cord was alsoseen leading to a decreasing feedback inhibition of 1205722AR toNE and thus an increase of NE release
Competing Interests
The authors do not have any conflict of interests financial orotherwise to declare
Authorsrsquo Contributions
Yuanyuan Feng Qi Zhang YuWang andMeiliWang carriedout the experimental work Qiuyan Jiang and Qianli Tangparticipated in the design of the study and Qiuyan Jiangalso performed the statistical analysis Qianli Tang QiuyanJiang and Suren R Sooranna conceived of the study andparticipated in its design and coordination Qiuyan JiangSuren R Sooranna and Shike Lin helped to draft the paperAll authors read and approved the final paper
Acknowledgments
This study was supported by the National Natural ScienceFoundation Project Grant (81260547 and 81373685)
References
[1] J Qiuyan M Haixia S Jinling et al ldquoThe effect of the elec-troacupuncture on labor analgesia and dynorphin regulation
impactrdquo Maternal and Child Health Care of China vol 27 no5 pp 733ndash734 2012
[2] S Zhenqiu and X YongyongMedical Statistics Peoplersquos Medi-cal Publishing House Beijing China 4th edition 2014
[3] Y Shuai R Xiaoxuan Z Yafang et al ldquoEffects of electroacupun-ture on Baihui(GV20) and Zusanli(ST36) on behavior and 5-HT level in rats with chronic visceral painrdquo Jilin Journal ofTraditional Chinese Medicine vol 33 no 4 pp 400ndash401 2013
[4] W Wei W Ximei and L Yuanjian Experimental Methodologyof Pharmacology vol 7 Peoplersquos Medical Publishing HouseBeijing China 4th edition 2010
[5] S Wegert M H Ossipov M L Nichols et al ldquoDifferentialactivities of intrathecal MK-801 or morphine to alter responsesto thermal and mechanical stimuli in normal or nerve-injuredratsrdquo Pain vol 71 no 1 pp 57ndash64 1997
[6] S Kulkarni and S T Sia ldquoHazards of labour pain and the roleof non-neuraxial labour analgesiardquo Trends in Anaesthesia andCritical Care vol 4 no 4 pp 109ndash114 2014
[7] Z Dengben and S Lijun Complete Note and Interpretation ofHuangdi Nei JingThe 2nd Version 1 NewWorld Press BeijingChina 2010
[8] H Jisheng and F Bifa Pain Peking University Press BeijingChina 1st edition 2012
[9] M Dawson-Basoa and A R Gintzler ldquoInvolvement of spinalcord 120575 opiate receptors in the antinociception of gestation andits hormonal simulationrdquo Brain Research vol 757 no 1 pp 37ndash42 1997
[10] A B Pramod J Foster L Carvelli and L K Henry ldquoSLC6transporters structure function regulation disease associationand therapeuticsrdquoMolecular Aspects of Medicine vol 34 no 2-3 pp 197ndash219 2013
[11] J M V Timple L G Magalhaes K C Souza Rezende etal ldquoThe lignan (minus)-hinokinin displays modulatory effects onhuman monoamine and gaba transporter activitiesrdquo Journal ofNatural Products vol 76 no 10 pp 1889ndash1895 2013
[12] M L Rojo A Rodrıguez-Gaztelumendi A Pazos and A DıazldquoDifferential adaptive changes on serotonin and noradrenalinetransporters in a rat model of peripheral neuropathic painrdquoNeuroscience Letters vol 515 no 2 pp 181ndash186 2012
[13] F Shen P R Tsuruda J A M Smith G P Obedencioand W J Martin ldquoRelative contributions of norepinephrineand serotonin transporters to antinociceptive synergy betweenmonoamine reuptake inhibitors andmorphine in the rat forma-lin modelrdquo PLoS ONE vol 8 no 9 article e74891 2013
[14] X Zhao Y Huang H Ma Q Jin Y Wang and G ZhuldquoAssociation between major depressive disorder and the nore-pinephrine transporter polymorphisms T-182C and G1287A ameta-analysisrdquo Journal of Affective Disorders vol 150 no 1 pp23ndash28 2013
[15] S R Arain R M Ruehlow T D Uhrich and T J Ebert ldquoTheefficacy of dexmedetomidine versus morphine for postoper-ative analgesia after major inpatient surgeryrdquo Anesthesia andAnalgesia vol 98 no 1 pp 153ndash158 2004
[16] C Schroeder and J Jordan ldquoNorepinephrine transporter func-tion and human cardiovascular diseaserdquo American Journal ofPhysiologymdashHeart and Circulatory Physiology vol 303 no 11pp H1273ndashH1282 2012
[17] E Houdeau A Rousseau C Meusnier M-J Prudrsquohomme andJ-P Rousseau ldquoSympathetic innervation of the upper and lowerregions of the uterus and cervix in the rat have different originsand routesrdquo Journal of Comparative Neurology vol 399 no 3pp 403ndash412 1998
8 Evidence-Based Complementary and Alternative Medicine
[18] B Baljet and J Drukker ldquoThe extrinsic innervation of the pelvicorgans in the female ratrdquoActaAnatomica vol 107 no 3 pp 241ndash267 1980
[19] R E Papka H H Traurig M Schemann J Collins T Copelinand K Wilson ldquoCholinergic neurons of the pelvic autonomicganglia and uterus of the female rat distribution of axons andpresence of muscarinic receptorsrdquo Cell and Tissue Research vol296 no 2 pp 293ndash305 1999
[20] Y Anfeng andY PingAnatomy and Tissue of Rat Science PressBeijing China 1985
Submit your manuscripts athttpwwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
6 Evidence-Based Complementary and Alternative Medicine
Table 4 Comparison of NET and 1205722AR mRNA expression in central nervous system
Group 119899
Gray matter region Lumbar spinal cordNET 1205722AR NET 1205722AR
Control 20 10000 10000 10000 10000Electroacupuncture Sanyinjiao 20 13535 plusmn 03008lowastlowast 13465 plusmn 03124lowastlowast 03931 plusmn 17217lowastlowast 03689 plusmn 01891lowastlowast
Electroacupuncture Hegu 20 13961 plusmn 02977lowastlowast 13068 plusmn 03293lowastlowast 05793 plusmn 03482lowastlowast 05862 plusmn 03410lowastlowast
Electroacupuncture Hegu+ Sanyinjiao 20 13823 plusmn 03527lowastlowast 13381 plusmn 03963lowastlowast 07393 plusmn 03158lowastlowastamp 08124 plusmn 03414lowastampamp
Electroacupuncture Xuehai 20 13883 plusmn 03400lowastlowast 13063 plusmn 02767lowastlowast 07358 plusmn 02178lowastlowastamp 07460 plusmn 02394lowastlowastamp
Meperidine 20 16084 plusmn 04064lowastlowastampsectn 15475 plusmn 03585lowastlowastampsectn 03446 plusmn 01606lowastlowastampampsectsectnn 03515 plusmn 0203lowastlowastampampsectsectnn
119865 7868 6517 22243 21576119875 119875 lt 001 119875 lt 001 119875 lt 001 119875 lt 001
Note comparison of NET and 1205722AR mRNA expression in cerebral cortex and spinal cord significant difference 119875 lt 005 With control group lowast119875 lt 005lowastlowast
119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005 119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6)group sect119875 lt 005 sectsect119875 lt 001 with Xuehai (SP 10) n119875 lt 005 nn119875 lt 001
00000
05000
10000
15000
20000
25000
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Electroacupuncture
lowastlowastlowastlowast lowastlowastlowastlowastlowastlowastlowastlowast lowastlowast
lowastlowast
lowastlowast
lowastlowast
sectsect
ampamp
NET1205722AR
(a)
00000
05000
10000
15000
20000
25000
Control Sanyinjiao Hegu Hegu +Sanyinjiao
Xuehai Meperidine
Electroacupuncture
lowastlowast
lowastlowast
lowastlowastlowastlowastlowastlowast
lowastlowast
lowastlowastlowastlowast
lowastlowastlowastlowast
sectsectsectsectampamp
ampamp
NET1205722AR
(b)
Figure 4 Comparison of NET and 1205722AR mRNA expression in the central nervous system (a) gray matter and (b) lumbar spinal cord Thewestern blots shown are the representative images With control group lowastlowast119875 lt 005 lowastlowast119875 lt 001 with Sanyinjiao (SP 6) group 119875 lt 005119875 lt 001 with Hegu (LI 4) group amp119875 lt 005 ampamp119875 lt 001 with Hegu (LI 4) and Sanyinjiao (SP 6) group sect119875 lt 005 sectsect119875 lt 001 with Xuehai
(SP 10) group n119875 lt 005 nn119875 lt 001119873 = 20 for each group
NET acted to uptake NE back to the presynaptic membraneoccurred This helped to regulate the NE concentration inthe synaptic cleft and to terminate nerve impulse signalsand thus to maintain the sensitivity of receptors to theneurotransmitter [10] In recent years this has been a researchfocus as a target for antidepressants and anti-drug-abusetherapy [11]
In the animal neuralgia model norepinephrine inhibitorexperiments showed an analgesia effect and spinal nerve lig-ation (SNL) experiments showed an increase of NET whichindicated the analgesic mechanism of transporter-targetedantidepressant [12] Research suggested that it is essentialto inhibit norepinephrine transporter for the synergismof analgesic effect from monoamine transmitter reuptakeinhibitors and of opioid drugs [13] Cerebral NET activitywas associated with agitation of PTSD (posttraumatic stress
disorder) patients [14] As a membrane-bound G protein-coupled receptor 1205722AR can amplify and transduce the extra-cellular stimulating signal into cells to trigger intracellularbiological reactions It has a feedback inhibitory effect on NEsecretion Research in recent years [15] indicated that therewas no visible side effect on respiratory depression and thegastrointestinal system when 1205722AR agonist in the form ofopioids was administered for acute pain
As mentioned above NET can reuptake NE to thepresynapticmembrane so as to regulate theNE concentrationin the synaptic cleft [16] Alpha 2AR also has a feedbackinhibitory effect on NE secretion It has therefore beensuggested that NE plays a role in the development of pain byNET and 1205722AR
In this research a significant increasing expression ofNET 1205722AR protein andmRNA in the cerebra and a decrease
Evidence-Based Complementary and Alternative Medicine 7
in the spinal cord were found in electroacupuncture groupsIt is speculated that the electroacupuncture stimulation couldactivate NET and 1205722AR on the presynaptic membrane ofthe central noradrenergic nerve resulting in an increasedexpression of NET and 1205722ARmRNA and proteinThis wouldlead to an increased reuptake of NE by NET strengthenedfeedback inhibition of 1205722AR toNE and thus a decrease of NEreleaseMoreover spinal reflex is controlled by cerebraWhencerebral NE release is decreased the expression of NET and1205722AR in spinal cordwould also reduce leading to a decreasedreuptake of NE by NET leading to a decreased feedbackinhibition of 1205722AR to NE and thus an overall increase of NErelease
As for the different results obtained from different acu-points this may be related to the neuroanatomical location ofthe acupoints The sympathetic nerve controlling the uterusis from T10-S2 [17] and parasympathetic nerve is from L6-S1 [18 19] which means that the nerve controlling the uterusin the rat is from T10-S2 and the peaks are from T13-L2 andL6-S10 The nerve controlling Sanyinjiao (SP 6) is from L3-6 the nerve controlling Hegu (LI 4) is from C5-T1 and thenerve controlling Xuehai (SP 10) is from L3-4 [20]This couldhave led to the different effects being seen on the differentacupoints
This research indicates that the role of NE in the analgesicmechanism of acupuncture is related to reuptake of NE byNET and feedback inhibition of 1205722AR Under the effect ofelectroacupuncture there was an increasing reuptake of NEby NET in the cerebra strengthened feedback inhibition of1205722AR to NE and thus a decrease of NE release In additiona decreasing reuptake of NE by NET in spinal cord was alsoseen leading to a decreasing feedback inhibition of 1205722AR toNE and thus an increase of NE release
Competing Interests
The authors do not have any conflict of interests financial orotherwise to declare
Authorsrsquo Contributions
Yuanyuan Feng Qi Zhang YuWang andMeiliWang carriedout the experimental work Qiuyan Jiang and Qianli Tangparticipated in the design of the study and Qiuyan Jiangalso performed the statistical analysis Qianli Tang QiuyanJiang and Suren R Sooranna conceived of the study andparticipated in its design and coordination Qiuyan JiangSuren R Sooranna and Shike Lin helped to draft the paperAll authors read and approved the final paper
Acknowledgments
This study was supported by the National Natural ScienceFoundation Project Grant (81260547 and 81373685)
References
[1] J Qiuyan M Haixia S Jinling et al ldquoThe effect of the elec-troacupuncture on labor analgesia and dynorphin regulation
impactrdquo Maternal and Child Health Care of China vol 27 no5 pp 733ndash734 2012
[2] S Zhenqiu and X YongyongMedical Statistics Peoplersquos Medi-cal Publishing House Beijing China 4th edition 2014
[3] Y Shuai R Xiaoxuan Z Yafang et al ldquoEffects of electroacupun-ture on Baihui(GV20) and Zusanli(ST36) on behavior and 5-HT level in rats with chronic visceral painrdquo Jilin Journal ofTraditional Chinese Medicine vol 33 no 4 pp 400ndash401 2013
[4] W Wei W Ximei and L Yuanjian Experimental Methodologyof Pharmacology vol 7 Peoplersquos Medical Publishing HouseBeijing China 4th edition 2010
[5] S Wegert M H Ossipov M L Nichols et al ldquoDifferentialactivities of intrathecal MK-801 or morphine to alter responsesto thermal and mechanical stimuli in normal or nerve-injuredratsrdquo Pain vol 71 no 1 pp 57ndash64 1997
[6] S Kulkarni and S T Sia ldquoHazards of labour pain and the roleof non-neuraxial labour analgesiardquo Trends in Anaesthesia andCritical Care vol 4 no 4 pp 109ndash114 2014
[7] Z Dengben and S Lijun Complete Note and Interpretation ofHuangdi Nei JingThe 2nd Version 1 NewWorld Press BeijingChina 2010
[8] H Jisheng and F Bifa Pain Peking University Press BeijingChina 1st edition 2012
[9] M Dawson-Basoa and A R Gintzler ldquoInvolvement of spinalcord 120575 opiate receptors in the antinociception of gestation andits hormonal simulationrdquo Brain Research vol 757 no 1 pp 37ndash42 1997
[10] A B Pramod J Foster L Carvelli and L K Henry ldquoSLC6transporters structure function regulation disease associationand therapeuticsrdquoMolecular Aspects of Medicine vol 34 no 2-3 pp 197ndash219 2013
[11] J M V Timple L G Magalhaes K C Souza Rezende etal ldquoThe lignan (minus)-hinokinin displays modulatory effects onhuman monoamine and gaba transporter activitiesrdquo Journal ofNatural Products vol 76 no 10 pp 1889ndash1895 2013
[12] M L Rojo A Rodrıguez-Gaztelumendi A Pazos and A DıazldquoDifferential adaptive changes on serotonin and noradrenalinetransporters in a rat model of peripheral neuropathic painrdquoNeuroscience Letters vol 515 no 2 pp 181ndash186 2012
[13] F Shen P R Tsuruda J A M Smith G P Obedencioand W J Martin ldquoRelative contributions of norepinephrineand serotonin transporters to antinociceptive synergy betweenmonoamine reuptake inhibitors andmorphine in the rat forma-lin modelrdquo PLoS ONE vol 8 no 9 article e74891 2013
[14] X Zhao Y Huang H Ma Q Jin Y Wang and G ZhuldquoAssociation between major depressive disorder and the nore-pinephrine transporter polymorphisms T-182C and G1287A ameta-analysisrdquo Journal of Affective Disorders vol 150 no 1 pp23ndash28 2013
[15] S R Arain R M Ruehlow T D Uhrich and T J Ebert ldquoTheefficacy of dexmedetomidine versus morphine for postoper-ative analgesia after major inpatient surgeryrdquo Anesthesia andAnalgesia vol 98 no 1 pp 153ndash158 2004
[16] C Schroeder and J Jordan ldquoNorepinephrine transporter func-tion and human cardiovascular diseaserdquo American Journal ofPhysiologymdashHeart and Circulatory Physiology vol 303 no 11pp H1273ndashH1282 2012
[17] E Houdeau A Rousseau C Meusnier M-J Prudrsquohomme andJ-P Rousseau ldquoSympathetic innervation of the upper and lowerregions of the uterus and cervix in the rat have different originsand routesrdquo Journal of Comparative Neurology vol 399 no 3pp 403ndash412 1998
8 Evidence-Based Complementary and Alternative Medicine
[18] B Baljet and J Drukker ldquoThe extrinsic innervation of the pelvicorgans in the female ratrdquoActaAnatomica vol 107 no 3 pp 241ndash267 1980
[19] R E Papka H H Traurig M Schemann J Collins T Copelinand K Wilson ldquoCholinergic neurons of the pelvic autonomicganglia and uterus of the female rat distribution of axons andpresence of muscarinic receptorsrdquo Cell and Tissue Research vol296 no 2 pp 293ndash305 1999
[20] Y Anfeng andY PingAnatomy and Tissue of Rat Science PressBeijing China 1985
Submit your manuscripts athttpwwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
Evidence-Based Complementary and Alternative Medicine 7
in the spinal cord were found in electroacupuncture groupsIt is speculated that the electroacupuncture stimulation couldactivate NET and 1205722AR on the presynaptic membrane ofthe central noradrenergic nerve resulting in an increasedexpression of NET and 1205722ARmRNA and proteinThis wouldlead to an increased reuptake of NE by NET strengthenedfeedback inhibition of 1205722AR toNE and thus a decrease of NEreleaseMoreover spinal reflex is controlled by cerebraWhencerebral NE release is decreased the expression of NET and1205722AR in spinal cordwould also reduce leading to a decreasedreuptake of NE by NET leading to a decreased feedbackinhibition of 1205722AR to NE and thus an overall increase of NErelease
As for the different results obtained from different acu-points this may be related to the neuroanatomical location ofthe acupoints The sympathetic nerve controlling the uterusis from T10-S2 [17] and parasympathetic nerve is from L6-S1 [18 19] which means that the nerve controlling the uterusin the rat is from T10-S2 and the peaks are from T13-L2 andL6-S10 The nerve controlling Sanyinjiao (SP 6) is from L3-6 the nerve controlling Hegu (LI 4) is from C5-T1 and thenerve controlling Xuehai (SP 10) is from L3-4 [20]This couldhave led to the different effects being seen on the differentacupoints
This research indicates that the role of NE in the analgesicmechanism of acupuncture is related to reuptake of NE byNET and feedback inhibition of 1205722AR Under the effect ofelectroacupuncture there was an increasing reuptake of NEby NET in the cerebra strengthened feedback inhibition of1205722AR to NE and thus a decrease of NE release In additiona decreasing reuptake of NE by NET in spinal cord was alsoseen leading to a decreasing feedback inhibition of 1205722AR toNE and thus an increase of NE release
Competing Interests
The authors do not have any conflict of interests financial orotherwise to declare
Authorsrsquo Contributions
Yuanyuan Feng Qi Zhang YuWang andMeiliWang carriedout the experimental work Qiuyan Jiang and Qianli Tangparticipated in the design of the study and Qiuyan Jiangalso performed the statistical analysis Qianli Tang QiuyanJiang and Suren R Sooranna conceived of the study andparticipated in its design and coordination Qiuyan JiangSuren R Sooranna and Shike Lin helped to draft the paperAll authors read and approved the final paper
Acknowledgments
This study was supported by the National Natural ScienceFoundation Project Grant (81260547 and 81373685)
References
[1] J Qiuyan M Haixia S Jinling et al ldquoThe effect of the elec-troacupuncture on labor analgesia and dynorphin regulation
impactrdquo Maternal and Child Health Care of China vol 27 no5 pp 733ndash734 2012
[2] S Zhenqiu and X YongyongMedical Statistics Peoplersquos Medi-cal Publishing House Beijing China 4th edition 2014
[3] Y Shuai R Xiaoxuan Z Yafang et al ldquoEffects of electroacupun-ture on Baihui(GV20) and Zusanli(ST36) on behavior and 5-HT level in rats with chronic visceral painrdquo Jilin Journal ofTraditional Chinese Medicine vol 33 no 4 pp 400ndash401 2013
[4] W Wei W Ximei and L Yuanjian Experimental Methodologyof Pharmacology vol 7 Peoplersquos Medical Publishing HouseBeijing China 4th edition 2010
[5] S Wegert M H Ossipov M L Nichols et al ldquoDifferentialactivities of intrathecal MK-801 or morphine to alter responsesto thermal and mechanical stimuli in normal or nerve-injuredratsrdquo Pain vol 71 no 1 pp 57ndash64 1997
[6] S Kulkarni and S T Sia ldquoHazards of labour pain and the roleof non-neuraxial labour analgesiardquo Trends in Anaesthesia andCritical Care vol 4 no 4 pp 109ndash114 2014
[7] Z Dengben and S Lijun Complete Note and Interpretation ofHuangdi Nei JingThe 2nd Version 1 NewWorld Press BeijingChina 2010
[8] H Jisheng and F Bifa Pain Peking University Press BeijingChina 1st edition 2012
[9] M Dawson-Basoa and A R Gintzler ldquoInvolvement of spinalcord 120575 opiate receptors in the antinociception of gestation andits hormonal simulationrdquo Brain Research vol 757 no 1 pp 37ndash42 1997
[10] A B Pramod J Foster L Carvelli and L K Henry ldquoSLC6transporters structure function regulation disease associationand therapeuticsrdquoMolecular Aspects of Medicine vol 34 no 2-3 pp 197ndash219 2013
[11] J M V Timple L G Magalhaes K C Souza Rezende etal ldquoThe lignan (minus)-hinokinin displays modulatory effects onhuman monoamine and gaba transporter activitiesrdquo Journal ofNatural Products vol 76 no 10 pp 1889ndash1895 2013
[12] M L Rojo A Rodrıguez-Gaztelumendi A Pazos and A DıazldquoDifferential adaptive changes on serotonin and noradrenalinetransporters in a rat model of peripheral neuropathic painrdquoNeuroscience Letters vol 515 no 2 pp 181ndash186 2012
[13] F Shen P R Tsuruda J A M Smith G P Obedencioand W J Martin ldquoRelative contributions of norepinephrineand serotonin transporters to antinociceptive synergy betweenmonoamine reuptake inhibitors andmorphine in the rat forma-lin modelrdquo PLoS ONE vol 8 no 9 article e74891 2013
[14] X Zhao Y Huang H Ma Q Jin Y Wang and G ZhuldquoAssociation between major depressive disorder and the nore-pinephrine transporter polymorphisms T-182C and G1287A ameta-analysisrdquo Journal of Affective Disorders vol 150 no 1 pp23ndash28 2013
[15] S R Arain R M Ruehlow T D Uhrich and T J Ebert ldquoTheefficacy of dexmedetomidine versus morphine for postoper-ative analgesia after major inpatient surgeryrdquo Anesthesia andAnalgesia vol 98 no 1 pp 153ndash158 2004
[16] C Schroeder and J Jordan ldquoNorepinephrine transporter func-tion and human cardiovascular diseaserdquo American Journal ofPhysiologymdashHeart and Circulatory Physiology vol 303 no 11pp H1273ndashH1282 2012
[17] E Houdeau A Rousseau C Meusnier M-J Prudrsquohomme andJ-P Rousseau ldquoSympathetic innervation of the upper and lowerregions of the uterus and cervix in the rat have different originsand routesrdquo Journal of Comparative Neurology vol 399 no 3pp 403ndash412 1998
8 Evidence-Based Complementary and Alternative Medicine
[18] B Baljet and J Drukker ldquoThe extrinsic innervation of the pelvicorgans in the female ratrdquoActaAnatomica vol 107 no 3 pp 241ndash267 1980
[19] R E Papka H H Traurig M Schemann J Collins T Copelinand K Wilson ldquoCholinergic neurons of the pelvic autonomicganglia and uterus of the female rat distribution of axons andpresence of muscarinic receptorsrdquo Cell and Tissue Research vol296 no 2 pp 293ndash305 1999
[20] Y Anfeng andY PingAnatomy and Tissue of Rat Science PressBeijing China 1985
Submit your manuscripts athttpwwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
8 Evidence-Based Complementary and Alternative Medicine
[18] B Baljet and J Drukker ldquoThe extrinsic innervation of the pelvicorgans in the female ratrdquoActaAnatomica vol 107 no 3 pp 241ndash267 1980
[19] R E Papka H H Traurig M Schemann J Collins T Copelinand K Wilson ldquoCholinergic neurons of the pelvic autonomicganglia and uterus of the female rat distribution of axons andpresence of muscarinic receptorsrdquo Cell and Tissue Research vol296 no 2 pp 293ndash305 1999
[20] Y Anfeng andY PingAnatomy and Tissue of Rat Science PressBeijing China 1985
Submit your manuscripts athttpwwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom
Submit your manuscripts athttpwwwhindawicom
Stem CellsInternational
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
MEDIATORSINFLAMMATION
of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Behavioural Neurology
EndocrinologyInternational Journal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Disease Markers
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
BioMed Research International
OncologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
PPAR Research
The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014
Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Journal of
ObesityJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Computational and Mathematical Methods in Medicine
OphthalmologyJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Diabetes ResearchJournal of
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Research and TreatmentAIDS
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Gastroenterology Research and Practice
Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014
Parkinsonrsquos Disease
Evidence-Based Complementary and Alternative Medicine
Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom