research article dengue patients exhibit higher...

Research ArticleDengue Patients Exhibit Higher Levels of PrM and E AntibodiesThan Their Asymptomatic Counterparts

Adeline Syin Lian Yeo1 Anusyah Rathakrishnan1 Seok Mui Wang2

Sasheela Ponnampalavanar3 Rishya Manikam4 Jameela Sathar5

Santha Kumari Natkunam6 and Shamala Devi Sekaran1

1Department of Medical Microbiology Faculty of Medicine University of Malaya Lembah Pantai 50603 Kuala Lumpur Malaysia2Institute for Medical Molecular Biotechnology Universiti Teknologi MARA Sungai Buloh Campus Jalan Hospital47000 Sungai Buloh Selangor Malaysia3Division of Infectious Diseases Department of Medicine University Malaya Medical Centre 50603 Kuala Lumpur Malaysia4Department of TraumaandEmergencyMedicineUniversityMalayaMedical Centre LembahPantai 50603Kuala LumpurMalaysia5Hospital Ampang Pandan Mewah Jalan Mewah Utara 68000 Ampang Selangor Malaysia6Hospital Tengku Ampuan Rahimah Persiaran Tengku Ampuan Rahimah 41200 Klang Malaysia

Correspondence should be addressed to Shamala Devi Sekaran shamalamyyahoocom

Received 2 December 2014 Revised 9 February 2015 Accepted 12 February 2015

Academic Editor Cheng-Feng Qin

Copyright copy 2015 Adeline Syin Lian Yeo et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Dengue virus infection is a common tropical disease which often occurs without being detected These asymptomatic casesprovide information in relation to the manifestation of immunological aspects In this study we developed an ELISA method tocompare neutralizing effects of dengue prMandE antibodies between dengue patients and their asymptomatic householdmembersRecombinant D2 premembrane (prM) was constructed cloned and tested for antigenicity The recombinant protein was purifiedand testedwith controls by using an indirect ELISAmethod Positive dengue serum samples with their asymptomatic pair were thencarried out onto the developed ELISA In addition commercially available recombinant envelope (E) protein was used to developan ELISA which was tested with the same set of serum samples in the prM ELISA Asymptomatic individuals showed preexistingheterotypic neutralizing antibodiesThe recombinant prM was antigenically reactive in the developed ELISA Dengue patients hadhigher prM and E antibodies compared to their household members Our study highlights the neutralizing antibodies levels withrespect to dengue prM and E between dengue patients and asymptomatic individuals

1 Introduction

Dengue virus (DENV) is a Flavivirus with four serotypes(DENV1ndash4) Approximately 36 billion people who are about55 of the worldrsquos population across the globe are at riskof being infected with dengue [1] A recent annual reportsuggested that there are 390 million dengue infections thatoccur yearly of which about 96million represent dengue fever(DF) dengue hemorrhagic fever (DHF) and dengue shocksyndrome (DSS) whereas the other 300 million representmild or asymptomatic cases [2] Infection by a particularserotype confers a lifelong immunity against the homologous

serotype but only limited cross-protection to the remainingthree serotypes [3] Primary DENV infections are oftenasymptomatic andwill generate immunity to the homologousstrain However about 90 cases of dengue with warningsigns reportedly occur following second exposure to a het-erologous strain of DENV [4]The presence of cross-reactivenonneutralizing antibodies generated during a primary infec-tion has been suggested to enhance the pathogenicity ofsubsequent infections via the process of antibody-dependentenhancement (ADE) [5] The occurrence of ADE couldsubstantially increase the risk of manifesting severe dengueduring subsequent infections especially in the asymptomatic

Hindawi Publishing CorporationBioMed Research InternationalVolume 2015 Article ID 420867 10 pageshttpdxdoiorg1011552015420867

2 BioMed Research International

cohort Therefore asymptomatic dengue cases should notbe taken lightly as they provide ample opportunities forresearchers to explore the host immune factors

The significance of the prM protein is undeniably impor-tant as this structural protein plays an important role inviral infectivity During viral infection dengue virions areassembled on the membrane of the endoplasmic reticulum(ER) and the virus buds in the lumen of the ER as imma-ture virions The immature virion particles will undergotransition to mature particles during secretion out of theinfected cells [6] As the prM protein is the precursor forthe formation of M protein cellular protease cleaves prMprotein to generate the mature M protein in the trans-Golgicompartment The process of intracellular DENV matura-tion appears to be inefficient because many immature andpartially mature virions are also released from the infectedcells [7 8] Moreover recent studies have shown that partiallymature and even fully immature particles can be infectiousunder certain conditions [9 10] While generally the hostanti-DENV response is dominated antibodies that targetthe envelope (E) protein recently an immunological studyshowed that prM-specific antibodies were also dominant inboth primary and secondary infections [9]The prM-specificantibodies were observed to be highly cross-reactive andnonneutralizing When complexed with immature DENV ithas the ability to render normally noninfectious immatureDENV highly infectious [10] Like mentioned earlier themajor immunogen for inducing neutralizing antibodies is theE protein however these antibodies show cross-reactivitywith other DENV serotypes [11] The glycosylated E proteinof the DENV is known to be one of the most importantproteins for neutralization due to its role in virus attachmentto cells and fusion with membranes Neutralizing antibodiesdirected towards the E protein appear to be pivotal antibodythat mediates homologous protection against reinfectionAntibodies against E have been shown to inhibit viral bindingto cells and to neutralize viral infectivity in vitro [11] Serumantibodies against DENV E protein have been the focus ofseveral studies as this is themain antigen on the virion surfaceand the target of neutralizing antibody Thus this gives theopportunity to study the prM and E protein with regard to itsnature as a target for neutralizing antibody Here we soughtto develop an ELISA to detect prM and E antibodies and tocompare the levels of these antibodies in dengue patients andtheir accompanying asymptomatic household member

2 Materials and Methods

21 Sample Collection Blood samples were collected fromHospital Tengku Ampuan Rahimah (Klang) HospitalAmpang and University Malaya Medical Centre (UMMC)The study protocols were approved by the institutionalreview board of the University of Malaya Medical Centre(Ethics number 78290) and from both Ampang andKlang Hospitals (Ethics no NMRR-10-683-6420) Writteninformed consent from patients and asymptomatic donorswere obtained prior to blood collection and the study wasconducted in accordance with the Declaration of Helsinki

The blood collection was carried out on two groups inthe infectious diseases ward (1) patients suspected tohave dengue according to the WHO dengue classificationand (2) their accompanying household members Serumsamples were collected for the acute defervescence andthe convalescence stage of dengue patient however onlyone point of blood sampling was done for the suspectedasymptomatic household member This is because thepresumably healthy individuals whose cognate householdmembers were dengue positive were recruited on a voluntarybasis for the study

22 Dengue Diagnostic and Confirmatory Tests All serumsamples collected were subjected to dengue diagnostic testsas previously carried out real-time RT-PCR [12] in-houseIgM capture ELISA [13] DENV antigen via NS1 assay (Pan-E dengue early ELISA kit Panbio Australia) and hemag-glutination inhibition (HI) test [14] Positive dengue sampleswere then subjected to plaque reduction neutralization test(PRNT) [15]

23 Construction Cloning and Expression of RecombinantprMProtein Dengue virus type 2 strainNewGuineaC (pro-totype strain) was obtained from the Department of MedicalMicrobiology University ofMalaya DENV supernatant fromvirus stock was subjected to RNA extraction by using HighPure Viral RNA Isolation Kit (Roche Diagnostics) accordingto the manufacturerrsquos protocol Primers flanking the DENVprM region were designed with specific oligonucleotidecontaining restriction enzyme sequences forward primerACAGTGGATCCGTTCCATTTAACCACACGT and reve-rse primer TATAAGCTTCTATGTCATTGAAGGAGC-GAC The RT-PCR amplification of the target gene was thencarried out and the PCR products were then analysed bygel electrophoresis The amplified PCR products for DENV2obtained from RT-PCR consisted of the appropriate rest-riction sites engineered into the primer sequences The PCRproducts and pET28b(+) vector (Novagen pET System) werethen digested and ligated and cloning was performed inDH5120572 (Novagen) competent cells through heatshock trans-formation Positive transformants were selected on LB platesupplemented with kanamycin antibioticThe positive cloneswere checked for the correct sequence and orientation byrestriction enzyme digestion and by sequencing Plasmidcarrying the prM insert was extracted and then transformedinto expression host E coliBL21 (DE3) for protein expression

24 Testing for Protein Expression Expression of target pro-tein was tested with SDS-PAGE and western blotting Thepresence of fusion protein was detected with 6X His-TagHRP antibody For total protein analysis the bacterial pelletwas resuspended in 1X nonreducing sample buffer The celllysate was then heated at 100∘C for 10 minutes and spun at13000 rpm for 10 minutes before loading onto SDS-PAGETo check the solubility of the target protein the bacterialpellet from a 10mL culture was washed once with 1X PBS andresuspended in 1mL of inclusion body buffer (IBB) (50mMTris-HCl pH 8 1mM EDTA and 100mM NaCl) The cell

BioMed Research International 3

suspension was sonicated for 3 times of 1 minute each at 4∘CThe sonicated lysatewas then spun at 12000 g for 15minutes at4∘CThe extract was collected and the pellet was resuspendedin 05mL of IBB SDS-PAGE analysis was performed and theprotein bands were stained with Coomassie blue and thentransferred to a nitrocellulose membrane by electrotransferin Towbinrsquos transfer buffer in the western blot assay

25 Scale-Up Purification and Quantitation The methodused for purification of protein with His-Tag system wasadapted from the pET system manual (Novagen MadisonWI USA)The stocks of 8X charged buffer (400mMNiSO

4)

8X binding buffer (40mM imidazole 4MNaCl and 160mMTris-HCl pH 79) and 4X elute buffer (4M imidazole 2MNaCl and 80mM Tris-HCl pH 79) were diluted to 1X withsterile deionized water before use His-Bind resin was mixedby gentle inversion and was added to a column using awide-mouth pipette The resin was allowed to pack undergravity flow (2mL of settled resin) The column was washedwith 75mL sterile deionized water charged with 125mL1X charged buffer followed by equilibration with 75mL 1Xbinding buffer The cells from a 200mL induced culture wereharvested by centrifugation at 5000 g at 4∘C for 5minutesThesupernatant was decanted and the cell pellet was resuspendedin 20mLof ice-cold 1X binding bufferThe cells were vortexedvigorously and the DNA was sheared using a sonicator atfull power for 10 times of 1 minute each at 4∘C The celllysates were then centrifuged at 39000 g for 20 minutes at4∘C The supernatant was transferred to a fresh tube andwas filtered through a 02120583mmembrane before being loadedonto column The binding buffer was allowed to drain to thetop of the column bed before loading the column with theprepared extract The column was then washed with 25mLof 1X binding buffer followed by 15mL of 1X washing bufferThe protein was eluted in 15mL of 1X elute bufferThe proteinconcentration was determined with UV spectrophotometerat 260 nm and 280 nm using the WarburgChristian methodwith a semiquartz-glass cuvette

26 Development of IgG Indirect ELISA An indirect ELISAwas developed to detect prM and E antibodies The recom-binant E protein was obtained commercially (Fischer Anti-bodies) while the recombinant prM antibody was preparedas described above Optimization was carried out underdifferent conditions through the chessboardcheckerboardtitrations (CBTs)The variables were the percentage of block-ing buffer the concentration of the recombinant proteinsused the dilution of the antibody detecting the antigens(prM and E) and the secondary antibody conjugated withHRP Optimization of both E and prM ELISA was conductedsimultaneously

27 Testing of Recombinant Proteins with Samples Clinicalsamples of the dengue patients and their accompanyinghousehold memberrsquos sera were then tested Briefly 96-wellmicrotiter plates were coated with either the purified prMor E proteins diluted to a final concentration of 10120583gmLin phosphate-buffered saline (PBS) The plate was covered

with adhesive plastic and incubated in 4∘C overnight Thecoating solution was removed and the plate was washed sixtimes by filling the wells with wash buffer (both areas) (PBS-005Tween-20)The solutionwas removed and casein (20milk in PBS) was then dispensed into the coated wells toblock the remaining protein-binding sitesThe plate was thencovered with adhesive plastic and incubated for at least 2hours at 37∘C The plate was then washed twice with thewashing solution Clinical serum samples with known titerswere then added into the wells and incubated for 1 hour at37∘CThe plate was then washed with washing solution and a100 120583L of IgG-HRPwas added into each well and was allowedto incubate for 1 hour at 37∘C The plate was then washed6 times with the washing solution followed by addition of100 120583L of substrate solution Lastly 50120583L of stop solution wasthen added into the wells and absorbance of each of the wellwas read with a plate reader at 490 nm

3 Results

31 Sample Collection and Dengue Confirmatory Tests Thenumbers of blood samples collected from the three hospitalswere 448 patients and 62 household members Samples wereconsidered as dengue positive if (1) DENV nucleic acid wasdetected (2) DENVNS1 antigenwas present or (3) (i) DENVIgM seroconversion occurred in paired sera (iii) dengue totalantibodies had a fourfold rise in titers in paired sera or(iv) a combination of the above Patients who were eitherIgM positive or with HI titer of above 1280 but withoutseroconversion or fourfold rise were considered presumptiveA total of 270 patients and 3 household members wereconfirmed to be dengue positive while 81 patients and 14household members were presumptive dengue

In this study 58 dengue patients and 62 householdmembers were included in forthcoming analyses (whereby4 dengue patients had more than 1 household member) Atotal of 7 patients and 1 household member were RT-PCRpositive Serotyping revealed that 4 patients had DENV-1 and3 patients were DENV-3 positive while the asymptomatichousehold members had a DENV-3 infection (Table 1) Thein-house IgM-Capture ELISA was performed by calculatingthe positivenegative (PN) ratio Samples tested for IgMagainst DENV was considered positive if the PN ratiowas ge20 A PN ratio from 5 to 8 was considered highlypositive while the PN ratio of low positive sample wasbetween 2 and 4 DENV IgM antibodies were detected in35 (603) patientsrsquo acute-phase serum samples while in theconvalescent-phase samples collected 28 samples (667)were positive Meanwhile in the asymptomatic group 16samples (258) of the patientsrsquo household members showedpositive results in IgM-captured ELISA Hemagglutinationinhibition (HI) assay was carried out on all serum samplesto detect the total antibodies in the subjects and also todifferentiate the samples to primary and secondary infectionThe peak titers below 1 1280 in acute-phase serum samplesindicate a primary infection and the peak titers more than1 1280 in acute-phase serum samples indicate a possiblesecondary infection A recent infection was determined with


Table 1 Summary of dengue diagnostic results

RT-PCR IgM PN ratio Hemagglutination testDENV1 DENV2 DENV3 DENV4 Positive Negative lt1280 gt1280 lt10

Dengue patientAcute 4 0 3 0 35 23 29 15 14 603 397 50 259 241Convalescence NA NA NA NA 28 14 14 20 8 667 333 333 476 19

Asymptomatic household 0 0 1 0 16 46 38 3 21258 742 613 48 339

Total 4 0 4 0 79 83 81 38 43488 512 500 235 265

Table 2 Comparison of neutralizing antibodies detected in patients and their asymptomatic household members

Category Monotypic infection Heterotypic infection No neutralizing antibody detected Total() () ()

Acute-phase patient sera 17 16 2 35(486) (457) (57)

Convalescent-phase patient sera 15 19 1 35(429) (543) (28)

Asymptomatic household members 10 9 16 35(286) (257) (457)

Total 42 44 19 105(400) (420) (180)

4-fold or even greater increase in titers between acute andconvalescent serum samples [16] Among the acute-phaseserum samples from the patients 29 (500) show peak titersat or below 1 1280 while 15 (259) of the patientsrsquo acute-phase serum samples show titers exceeding 1 1280 Thissuggests that half of the patients were having primary DENVinfection whereas the other 259of the patients were havingsecondary DENV infection We also observed that 14 (241)of the patientsrsquo acute-phase sera and 8 (190) of the patientsrsquoconvalescent-phase sera showHI titer below 1 10There were19 patients (452) having 4-fold rise in the titers betweenacute and convalescent serum samples indicating that thesepatients are having a recent infection In the asymptomaticgroup 3 samples (48) were having HI titers more than1 1280 38 (613) were having HI titers below 1 1280 and21 samples (339) from the asymptomatic group show HItiters of lt10 in their serum samples

32 Plaque Reduction Neutralization Tests (PRNTs) Plaquereduction neutralization tests were done to verify and deter-mine the serotype specific neutralizing antibodies in theserum samples collected Thirty-five samples of completepaired acute and convalescent sera which were dengue posi-tive together with their accompanying household memberswere tested for PRNT Table 2 shows the comparison ofneutralizing antibodies between dengue patients and theirasymptomatic household members In both the denguepatients and the asymptomatic household members theneutralizing antibodies are detected in monotypic (only one

serotype) and heterotypic (onmore than one serotype) infec-tion [16] It was observed that monotypic neutralizing anti-bodies are detected more frequently in both the patients andtheir householdmembers with 486 (acute sera) and 286respectivelyHowever the number of heterotypic neutralizingantibodies increased in acute sera to convalescent sera withmore than half of the convalescent sera having heterotypicneutralizing antibodies Asymptomatic household membershave the highest percentage at 457 having no neutralizingantibodies towards DENV infection

33 Expression of Recombinant prM Protein The RT-PCRamplified DENV2 prM region was used for the constructionof recombinant plasmid DNA (Figure 1) The recombinantplasmid DNA constructed was screened for prM insert byrestriction enzyme digestion to identify plasmids containingthe correct insert and Figure 2 represents DENV prM genecloned into pET28b(+) vector The gel obtained showed thatthe digestion of the vector with restriction enzymes wasable to separate the target prM protein at its correct sizeThe sequence orientation and reading frame were furtherdetermined and confirmed by sequencing analysis shown inFigure 3

Expression of target protein was checked by Coomassieblue staining of SDS-PAGE and immunoblotting In Figure 4the presence of His-Tag fusion protein was detected by anti-HisG antibody which recognizes the sequence -His-His-His-His-His-His-Gly (6 times His-Gly epitope) on the fusion proteinwhile the antigenicity of the expressed protein was further


M P Neg

1000

500

(bp)

522 bp

Figure 1 PCR product flanked with restriction enzyme sites Theexpected prM plus restriction enzyme sites PCR product size was522 bp Lane M 100 bp DNA ladder marker (Fermentas) Lane PDENV2 prM + restriction enzyme site PCR product Lane NEGnegative control

M1 L 1 2 3 4 5 6 M2

5000

1500

500

(bp)

prM insert 508bp

500bp

Figure 2 Restriction enzyme digestion profile of the recombinantplasmid DNA Digestion of the recombinant clone produced avector band and prM insert band at 508 bp LaneM1 GeneRuler 1 kbplusDNA laddermarker (Fermentas) Lane L linearized pET28b(+)plasmid with BamHI digestion with expected size 5368 bp Lanes1ndash6 are positive clones selected randomly out of 42 positive clonesobtained Shown here are the vectors at 5343 bp and the prM insertat 508 bp uponHindIII and BamHI digestion LaneM2 100 bpDNAladder marker (Fermentas)

detected by using a polyclonal positive dengue IgG serum inFigure 5 which detects the prM target protein

Based on the western blot results obtained the DENVprM gene was successfully expressed as a pET28b recombi-nant protein inE coli and the expressed product were reactivewith serum After purification the final concentration of thepurified prM recombinant proteinwas 200120583gmL whichwasthen used to develop an ELISA system

34 Development of Recombinant ELISA After obtainingthe recombinant protein the ELISA was first developedby optimization through the CBT method The optimizedconcentrations for the recombinant prM and E proteins were5 120583gmL while the most suitable dilution factor for the sera tobe tested is 1 100 Meanwhile the secondary conjugate withHRP was optimized to a dilution factor of 1 10000 In orderto obtain the optimum concentration of antibody towards thedeveloped ELISA serum IgG of confirmed dengue with HItitre of gt10240 was used as positive control while the negativecontrol used was from non-dengue serum with HI titre lt10

35 Analysis of prM and E Antibodies with Developed ELISAAll samples that were tested for the PRNT were tested onthe developed prM and E ELISA As shown in Table 3 outof the 35 pairs 31 samples were positive for either DENVprM or E or both with a PN ratio of ge20 The significantdifferences between the positivenegative (PN) ratio of theELISA optical density (OD) reading was within 2 standarddeviationThese samples were titrated by ELISA to determinethe levels of antibodies towards the prM and E antigen Fromthe analysis of antibody positivity towards the prM and Eantigens between the dengue patients and their asymptomatichousehold members it was observed that dengue patientsshowed higher percentage of positivity in prM antibodies at74 (26 patients) compared to their asymptomatic house-hold members at 57 (20 people) On the other hand theasymptomatic household members showed higher positivitytowards the E antigen at 89 (31 people) rather than thedengue patients who had 83 (29 patients) positivity towardsthe E antigen Besides that we observed that prM antibodytiters were very low in the asymptomatic householdmemberswith most cases having titers of 2560 and below (le2560)Comparison of antibody titers between prM and E in patientsand asymptomatic household members is shown in Figure 6

4 Discussion

The determinants of asymptomatic versus symptomatic out-come in DENV infections remain vaguely unexploredMore-over asymptomatic infections are not detected in routinesurveillance and can only be captured in the context ofprospective cohort or index cluster studies [17] Hence thisstudy was focused on investigating the neutralizing antibod-ies levels among asymptomatic individuals in comparisonwith their symptomatic counterparts We observed a largenumber of asymptomatic individuals showing high titersof antibody levels despite lacking clinical manifestationsMore than half of the asymptomatic population had neu-tralizing antibodies towards DENV infection Analysis ofinfection outcome is complicated by immune responses tomultiple infections with different DENV serotypes whichcan be either protective or pathogenic In a cohort studyin Thailand circulating DENV serotype and the number ofcirculating serotypes were identified as factors influencingasymptomatic versus symptomatic infection outcome [18 19]Our observation shows a larger occurrence of homologousDENV infections as observed by the higher percentage of


Table 3 Determination of antibody titers towards the prM and E antigen on the developed ELISA

Patient Asymptomatic householdIdentification prM Envelope Identification prM EnvelopeAH023 640 2560 AH023F1 20 160AH023 640 2560 AH023F2 1280 5120AH071 160 2560 AH071F1 40 160AH078 20 640 AH078F1 Negative 640AH090 Negative Negative AH090F1 Negative NegativeAH100 Negative Negative AH100F1 Negative NegativeAH101 320 160 AH101F1 640 640AH103 Negative 160 AH103F1 Negative 640AH147 320 640 AH147F1 320 640AH148 1280 160 AH148F1 Negative 40AH155 5120 gt10240 AH155F1 Negative 640AH155 Negative Negative AH155F2 Negative NegativeAH166 2560 gt10240 AH166F1 160 640AH192 Negative 640 AH192F1 10 640AH226 Negative Negative AH226F1 Negative 10AH232 20 640 AH232F1 20 2560AH232 20 640 AH232F2 Negative 20AH240 160 640 AH240F1 160 160KH015 2560 20 KH015F1 10 160KH049 Negative Negative KH049F1 160 gt10240KH076 20 320 KH076F1 20 20KH114 640 2560 KH114F1 Negative 1280KH121 640 20 KH121F1 Negative 1280KH125 160 640 KH125F1 20 640KH144 1280 5120 KH144F1 Negative 40KH145 20 640 KH145F1 320 1280KH148 160 160 KH148F1 80 160KH149 160 640 KH149F1 80 80KH157 1280 1280 KH157F1 320 640KH162 Negative 2560 KH162F1 640 2560KH165 640 640 KH165F1 Negative 160KH166 10 160 KH166F1 Negative 160KH168 320 640 KH168F1 640 5120KH204 1280 2560 KH204F1 2560 gt10240KH217 Negative Negative KH217F1 Negative Negative

monotypic neutralizing antibodies among the asymptomaticindividuals This observation may be due to the existingantibody levels that persist in the asymptomatic individualswhich confers protection towards DENV infection Earlyexperimental studies in DENV-naıve healthy volunteers alsoshowed that infection with one DENV serotype confersimmunity to that particular serotype for up to 18 months[20] In fact this protection is thought to be life-long On theother hand infection with one serotype only conferred short-term (lt2 months) complete protection against heterologousinfection with a different serotype [20]

Diagnostic assays of dengue infection were carried outin this study for case confirmation and differential diag-nosis with other infectious diseases The selection criteria

for asymptomatic household members were solely basedon the presumptive positive IgM levels and HI titers ofa single sample because obtaining a second blood samplefrom this cohort was difficult because the collection was onvoluntary basis RT-PCR that was carried out was able todetect and serotype DENV and this usually occurs duringfirst few days after onset of fever whereby a positive resultindicates a current dengue infection Because antibodies areonly detected later RT-PCR has become a primary tool todetect virus early in the course of illness [16] Accordingto WHO blood sample is taken from a patient 5 or moredays after the onset of symptoms and laboratory diagnosisis best made using a test for IgM antibody to DENV [21]Besides we also determined the neutralizing antibodies titers


TAGACAAG

AGAAAGGGAAAAGTCTTCTGTTTAAAACAGAGGATGGTGTGAACATGTGTACCCTCATGGC

CATGGACCT

ACTGTCGACAGCGAGGAAGTTACTGTTACGCAACGTATCCTTATAGTTA

TCTCTGAAACATCTTCCCCA

ACTTTGTAGAAGGGGT

ACAGTGGATCCTTCCATTTAACCACACGT

CAGCGAGGAAGTTACTGTATCTTCGAATAT

ATTCCAACAGTGATGGCGTTCCATTTAACCACACGTAACGGAGAACCACACATGATCGTCAG

TGACAGCTGTCGCTCCTTCAATGACAATGCGTTGCATAGGAATATCAAATAGAG

Note 5998400

5998400

FPRI421

prM491

(561ndash911) Envelope

cDNA

RPRI(lt936) HindIII

BamHI (gt439)

Figure 3 Sequence analysis of the recombinant prM plasmid Plasmid was flanked with restriction enzymes BamHI andHindIII at 51015840 and 31015840of the target prM gene

NEG

37

25

20

(kDa)

sim30kDa His-Tag fusion protein

Figure 4 Western blot to detect the presence of His-Tag fusionprotein The His-Tag was detected with the His-Tag antibody at sim30 kDawhile the negative control is empty pET28b(+)without targetprM gene

by using the PRNT PRNT is one of the gold standardtests used widely in the determination and quantificationof neutralizing antibodies against DENV infection [22] Weshowed that asymptomatic individuals had high presenceof neutralizing antibodies against DENV infection Despitehaving heterotypic infections half of these asymptomaticindividuals are protected against clinical dengue Interest-ingly they do not show any clinical manifestations albeithaving the infection One of the most likely explanationsis that neutralizing antibodies may play an important roletowards combating the disease It has been reported that

1 2

25

20

17

11

(kDa)

sim21kDa recombinant prM protein

Figure 5 Protein antigenicity with polyclonal positive dengue IgGserum Strip 1 positive control of DENV and Strip 2 recombinantprM protein detected at sim21 kDa

antibodies could play a greater role than immune cells inheterologous DENV infection [23]

Our study suggests that circulating neutralizing antibod-ies in the asymptomatic individuals may neutralize denguevirus infection Preexisting neutralizing antibodies presentin the asymptomatic individuals may function to eliminatethe DENV infection This is supported in recent data thatantibodies against Flavivirus (West Nile virus and DENV)increase their neutralization capacity when left to interact forlonger periods of time [24]This suggests that even antibodiesthat bind poorly to virus particles will lead to inactivationof the virion if left to interact for long enough in vitro TheDENVneutralization requires sufficient levels of neutralizing


18

16

14

12

10

8

6

4

2

0

No prM antibody

Num

ber o

f pat

ient

s

Antibody titers

Comparison of prM antibody titers between patientand household members

PatientAsymptomatic household

Comparison of E antibody titers between patientand household members

10

9

8

7

6

5

4

3

2

1

0

No E antibody

Num

ber o

f pat

ient

s

Antibody titers


prM antibody gt2560 E antibody gt2560

Figure 6 Comparison of prM and E antibody titers between dengue patients and their asymptomatic household members 119910-axis representsthe number of subjects No prME antibody signifies antibody titers of lt10 while antibody titers of gt2560 signifies high antibody titers

antibodiesThenumber of antibodies bound to a single virionto exceed the threshold of enhancement will depend onantibody avidity and the accessibility of epitopes on the virusparticle [25] In an antibody mediated neutralization studythe avidity of anti-Flavivirus monoclonal antibodies (mAbs)was shown to positively correlate with neutralization activityin vitro [26] Conversely antigenic variants may also reducethe strength of antibody binding rendering less sensitivity toneutralization Studies have shown that genotypic variation ofDENV reduces the neutralizing activity of antibodies againstheterologous strains of the same DENV serotype which canbe explained by differences in antibody affinity [27 28]

Bacterial expression is usually one of the first choicesin protein expression studies due to its simplicity and largeyield of recombinant proteins [29] However information onexpressing Flavivirus prM proteins using bacterial expres-sion systems is scarce Previously there are known proteinexpressions that were done on the proteins E [30] and NS1[31] Besides studies on the antigenic structure of DENV1envelope and NS1 proteins in the form of recombinant fusionproteins expressed in E coli [32] were also done Hencerecombinant E protein was easily obtained commerciallyto expedite the study All Flavivirus strains share commonepitopes on the E protein which is themajor antigen inducingneutralizing and protective antibodies [33] Thus the earliestimmune response to a Flavivirus infection would be againstthe E which is the major surface protein of the virus In ourstudy we used prMprotein as an antigen to develop amethodto detect anti-prM antibodies in dengue virus infection Thisis because recent studies have shown that anti-prM antibodyis a major component of the serological response to DENVinfection [9 34]

Much interest has been put on the impact of structuraldynamics of dengue virusThis is because the viral conforma-tional structure determines the accessibility of epitopeswhich

then determines the neutralization of the virus In our currentstudy results showed that dengue patients elucidated moreprM antibodies compared to their asymptomatic householdmembers Since prM is present in the immature virions ahost immune response to prM suggests that an infectionhas been established This is because the maturation step ofprM is often incomplete resulting in a significant fraction ofonly partially mature virions released from infected cells [8]These virions are infectious and have been shown to displayboth mature- and immature-like patches on the same virion[35] displaying antigenic characteristics of both types [36]Interestingly studies have shown that antibodies against prMhave been shown to enhance wild type DENV infection [37]and the levels of prM antibodies were found to be higher inpatients with secondary infections compared with sera fromprimary DENV infections [38]

In the present study it was observed that dengue patientshad higher prM than E antibody titers compared to theirasymptomatic household membersThe prM protein containantigenic domain that may cross-react with the E antibodyThere were cross-competition experiments that revealedthis phenomenon whereby it was shown that monoclonalantibodies (mAbs) generated recognize the same or overlap-ping epitopes instead of binding to distinct epitopes [39]Antibodies supposedly bound to the E-prM protein surpris-ingly recognized the E protein as well Therefore the cross-reactivity between the epitopes of these structural proteinsshould further be investigated The reactivity of mAbs withboth prM and E suggests a quaternary epitope with sharedsites on the heterodimeric prM-E protein which in similarfindings has been reported for mouse antibodies [40 41]Thus consistent with a recent study [9] the prM antibodiesmay be cross-reactive among the DENV serotypes and maynot be neutralizing but potently promote ADE


5 Conclusions

In conclusion serological testing of dengue virus infectionamong the asymptomatic individuals provides insights intothe association of disease severity to the antibody levels thatmay render useful in future studiesThe use of prM protein indiagnosing dengue virus infection should further be assessedin light of the extensive cross-reactions of antibodies to thebinding on shared epitopes

Disclosure

All funding bodies did not have any involvement in the studydesign in the collection analysis and interpretation of datain the writing of the paper and in the decision to submit thepaper for publication

Conflict of Interests

All authors have declared that no conflict of interests exists

Acknowledgments

The authors thank the clinicians and the nurses at theUniversity Malaya Medical Centre (UMMC) Ampang Hos-pital and Klang Tengku Ampuan Rahimah Hospital Malay-sia who assisted in collecting blood samples and thepatients for their participation in this study This study wassupported by High Impact Research Grant UM-MOHEUMC6251HIRMOHEH-20001-00-E000053 and UMPostgraduate Research Fund (PV0392012A)

References

[1] N R da Costa Faria R M R Nogueira A M B de Filippiset al ldquoTwenty years of DENV-2 activity in Brazil molecularcharacterization and phylogeny of strains isolated from 1990 to2010rdquo PLoS Neglected Tropical Diseases vol 7 no 3 Article IDe2095 2013

[2] S Bhatt PWGethingO J Brady et al ldquoThe global distributionand burden of denguerdquo Nature vol 496 no 7446 pp 504ndash5072013

[3] S C Kliks A Nisalak W E Brandt L Wahl and D S BurkeldquoAntibody-dependent enhancement of dengue virus growth inhuman monocytes as a risk factor for dengue hemorrhagicfeverrdquo The American Journal of Tropical Medicine and Hygienevol 40 no 4 pp 444ndash451 1989

[4] A Mathew and A L Rothman ldquoUnderstanding the contribu-tion of cellular immunity to dengue disease pathogenesisrdquoImmunological Reviews vol 225 no 1 pp 300ndash313 2008

[5] S B Halstead ldquoPathogenisis of dengue challenges tomolecularbiologyrdquo Science vol 239 no 4839 pp 476ndash481 1988

[6] R Perera and R J Kuhn ldquoStructural proteomics of denguevirusrdquo Current Opinion in Microbiology vol 11 no 4 pp 369ndash377 2008

[7] M V Cherrier B Kaufmann G E Nybakken et al ldquoStructuralbasis for the preferential recognition of immature flavivirusesby a fusion-loop antibodyrdquo The EMBO Journal vol 28 no 20pp 3269ndash3276 2009

[8] J Junjhon T J Edwards U Utaipat et al ldquoInfluence of pr-Mcleavage on the heterogeneity of extracellular dengue virusparticlesrdquo Journal of Virology vol 84 no 16 pp 8253ndash83582010

[9] W Dejnirattisai A Jumnainsong N Onsirisakul et al ldquoCross-reacting antibodies enhance dengue virus infection in humansrdquoScience vol 328 no 5979 pp 745ndash748 2010

[10] I A Rodenhuis-Zybert H M van der Schaar J M da SilvaVoorham et al ldquoImmature dengue virus a veiled pathogenrdquoPLoS Pathogens vol 6 no 1 Article ID e1000718 2010

[11] J T Roehrig R A Bolin andR G Kelly ldquoMonoclonal antibodymapping of the envelope glycoprotein of the dengue 2 virusJamaicardquo Virology vol 246 no 2 pp 317ndash328 1998

[12] Y Y Kong C HThay T C Tin and S Devi ldquoRapid detectionserotyping and quantitation of dengue viruses by TaqMan real-time one-step RT-PCRrdquo Journal of Virological Methods vol 138no 1-2 pp 123ndash130 2006

[13] S K Lam S Devi and T Pang ldquoDetection of specific IgMin dengue infectionrdquo The Southeast Asian Journal of TropicalMedicine and Public Health vol 18 no 4 pp 532ndash538 1987

[14] D H Clarke and J Casals ldquoTechniques for hemagglutina-tion and hemagglutination-inhibition with arthropod-bornevirusesrdquo The American Journal of Tropical Medicine andHygiene vol 7 no 5 pp 561ndash573 1958

[15] P K Russell A Nisalak P Sukhavachana and S Vivona ldquoAplaque reduction test for dengue virus neutralizing antibodiesrdquoThe Journal of Immunology vol 99 no 2 pp 285ndash290 1967

[16] W Dengue Guidelines for Diagnosis Treatment Preventionand Control World Health Organization Geneva Switzerland2009

[17] M Montoya L Gresh J C Mercado et al ldquoSymptomatic ver-sus inapparent outcome in repeat dengue virus infections isinfluenced by the time interval between infections and studyyearrdquo PLoS Neglected Tropical Diseases vol 7 no 8 Article IDe2357 2013

[18] T P Endy K B Anderson A Nisalak et al ldquoDeterminants ofinapparent and symptomatic dengue infection in a prospectivestudy of primary school children in Kamphaeng Phet Thai-landrdquo PLoSNeglected Tropical Diseases vol 5 no 3 article e9752011

[19] I-K Yoon A L Rothman D Tannitisupawong et al ldquoUnder-recognizedmildly symptomatic viremic dengue virus infectionsin rural thai schools and villagesrdquo Journal of Infectious Diseasesvol 206 no 3 pp 389ndash398 2012

[20] A B Sabin ldquoResearch on dengue during World War IIrdquo TheAmerican Journal of Tropical Medicine and Hygiene vol 1 pp30ndash50 1952

[21] TDRWHO Dengue Guidelines for Diagnosis Treatment Pre-vention and Control TDRWHO Geneva Switzerland 2009

[22] S J Thomas J Hombach and A Barrett ldquoScientific consulta-tion on cell mediated immunity (CMI) in dengue and denguevaccine developmentrdquoVaccine vol 27 no 3 pp 355ndash368 2009

[23] J L Kyle S J Balsitis L Zhang P R Beatty andEHarris ldquoAnti-bodies play a greater role than immune cells in heterologousprotection against secondary dengue virus infection in a mousemodelrdquo Virology vol 380 no 2 pp 296ndash303 2008

[24] K A Dowd C A Jost A P Durbin S S Whitehead and T CPierson ldquoA dynamic landscape for antibody binding modulatesantibody-mediated neutralization of West Nile virusrdquo PLoSPathogens vol 7 no 6 Article ID e1002111 2011


[25] K A Dowd and T C Pierson ldquoAntibody-mediated neutraliza-tion of flaviviruses a reductionist viewrdquo Virology vol 411 no 2pp 306ndash315 2011

[26] T C Pierson Q Xu S Nelson et al ldquoThe stoichiometry ofantibody-mediated neutralization and enhancement of WestNile virus infectionrdquoCell Host andMicrobe vol 1 no 2 pp 135ndash145 2007

[27] J D Brien S K Austin S Sukupolvi-Petty et al ldquoGenotype-specific neutralization and protection by antibodies againstdengue virus type 3rdquo Journal of Virology vol 84 no 20 pp10630ndash10643 2010

[28] W M P B Wahala E F Donaldson R de Alwis M AAccavitti-Loper R S Baric and A M de Silva ldquoNatural strainvariation and antibody neutralization of dengue serotype 3virusesrdquo PLoS Pathogens vol 6 no 3 Article ID e1000821 2010

[29] M Kamionka ldquoEngineering of therapeutic proteins productionin Escherichia colirdquo Current Pharmaceutical Biotechnology vol12 no 2 pp 268ndash274 2011

[30] R J Sugrue T CuiQXu J Fu andYCChan ldquoTheproductionof recombinant dengue virus E protein using Escherichia coliand Pichia pastorisrdquo Journal of Virological Methods vol 69 no1-2 pp 159ndash169 1997

[31] T N Athmaram S Saraswat P Misra et al ldquoOptimization ofDengue-3 recombinant NS1 protein expression in E coli and invitro refolding for diagnostic applicationsrdquoVirus Genes vol 46no 2 pp 219ndash230 2013

[32] P W Mason M U Zugel A R Semproni M J Fournier andT L Mason ldquoThe antigenic structure of dengue type 1 virusenvelope andNS1 proteins expressed inEscherichia colirdquo Journalof General Virology vol 71 no 9 pp 2107ndash2114 1990

[33] F Megret J P Hugnot A Falconar et al ldquoUse of recombinantfusion proteins and monoclonal antibodies to define linear anddiscontinuous antigenic sites on the dengue virus envelopeglycoproteinrdquo Virology vol 187 no 2 pp 480ndash491 1992

[34] M J Cardosa S M Wang M S H Sum and P H Tio ldquoAnti-bodies against prM protein distinguish between previous infec-tion with dengue and Japanese encephalitis virusesrdquo BMCMicrobiology vol 2 article 9 2002

[35] P Plevka A J Battisti J Junjhon et al ldquoMaturation of flavi-viruses starts from one or more icosahedrally independentnucleation centresrdquo EMBO Reports vol 12 no 6 pp 602ndash6062011

[36] S Nelson C A Jost Q Xu et al ldquoMaturation ofWest Nile virusmodulates sensitivity to antibody-mediated neutralizationrdquoPLoS Pathogens vol 4 no 5 Article ID e1000060 2008

[37] K-J Huang Y-T Cheng Y-S Lin et al ldquoAnti-prM antibody asan autoantibody in dengue virus infectionrdquoAmerican Journal ofInfectious Diseases vol 4 no 1 pp 60ndash68 2008

[38] C-Y Lai W-Y Tsai S-R Lin et al ldquoAntibodies to envelopeglycoprotein of dengue virus during the natural course of infec-tion are predominantly cross-reactive and recognize epitopescontaining highly conserved residues at the fusion loop ofdomain IIrdquo Journal of Virology vol 82 no 13 pp 6631ndash66432008

[39] A K I Falconar ldquoIdentification of an epitope on the denguevirus membrane (M) protein defined by cross-protective mon-oclonal antibodies design of an improved epitope sequencebased on common determinants present in both envelope (EandM) proteinsrdquo Archives of Virology vol 144 no 12 pp 2313ndash2330 1999

[40] E AGould A BuckleyN Cammack et al ldquoExamination of theimmunological relationships between flaviviruses using yellowfever virus monoclonal antibodiesrdquo Journal of General Virologyvol 66 no 7 pp 1369ndash1382 1985

[41] C Puttikhunt P Keelapang N Khemnu N Sittisombut WKasinrerk and PMalasit ldquoNovel anti-denguemonoclonal anti-body recognizing conformational structure of the prM-E heter-odimeric complex of dengue virusrdquo Journal of Medical Virologyvol 80 no 1 pp 125ndash133 2008

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


cohort Therefore asymptomatic dengue cases should notbe taken lightly as they provide ample opportunities forresearchers to explore the host immune factors

The significance of the prM protein is undeniably impor-tant as this structural protein plays an important role inviral infectivity During viral infection dengue virions areassembled on the membrane of the endoplasmic reticulum(ER) and the virus buds in the lumen of the ER as imma-ture virions The immature virion particles will undergotransition to mature particles during secretion out of theinfected cells [6] As the prM protein is the precursor forthe formation of M protein cellular protease cleaves prMprotein to generate the mature M protein in the trans-Golgicompartment The process of intracellular DENV matura-tion appears to be inefficient because many immature andpartially mature virions are also released from the infectedcells [7 8] Moreover recent studies have shown that partiallymature and even fully immature particles can be infectiousunder certain conditions [9 10] While generally the hostanti-DENV response is dominated antibodies that targetthe envelope (E) protein recently an immunological studyshowed that prM-specific antibodies were also dominant inboth primary and secondary infections [9]The prM-specificantibodies were observed to be highly cross-reactive andnonneutralizing When complexed with immature DENV ithas the ability to render normally noninfectious immatureDENV highly infectious [10] Like mentioned earlier themajor immunogen for inducing neutralizing antibodies is theE protein however these antibodies show cross-reactivitywith other DENV serotypes [11] The glycosylated E proteinof the DENV is known to be one of the most importantproteins for neutralization due to its role in virus attachmentto cells and fusion with membranes Neutralizing antibodiesdirected towards the E protein appear to be pivotal antibodythat mediates homologous protection against reinfectionAntibodies against E have been shown to inhibit viral bindingto cells and to neutralize viral infectivity in vitro [11] Serumantibodies against DENV E protein have been the focus ofseveral studies as this is themain antigen on the virion surfaceand the target of neutralizing antibody Thus this gives theopportunity to study the prM and E protein with regard to itsnature as a target for neutralizing antibody Here we soughtto develop an ELISA to detect prM and E antibodies and tocompare the levels of these antibodies in dengue patients andtheir accompanying asymptomatic household member

2 Materials and Methods

21 Sample Collection Blood samples were collected fromHospital Tengku Ampuan Rahimah (Klang) HospitalAmpang and University Malaya Medical Centre (UMMC)The study protocols were approved by the institutionalreview board of the University of Malaya Medical Centre(Ethics number 78290) and from both Ampang andKlang Hospitals (Ethics no NMRR-10-683-6420) Writteninformed consent from patients and asymptomatic donorswere obtained prior to blood collection and the study wasconducted in accordance with the Declaration of Helsinki

The blood collection was carried out on two groups inthe infectious diseases ward (1) patients suspected tohave dengue according to the WHO dengue classificationand (2) their accompanying household members Serumsamples were collected for the acute defervescence andthe convalescence stage of dengue patient however onlyone point of blood sampling was done for the suspectedasymptomatic household member This is because thepresumably healthy individuals whose cognate householdmembers were dengue positive were recruited on a voluntarybasis for the study

22 Dengue Diagnostic and Confirmatory Tests All serumsamples collected were subjected to dengue diagnostic testsas previously carried out real-time RT-PCR [12] in-houseIgM capture ELISA [13] DENV antigen via NS1 assay (Pan-E dengue early ELISA kit Panbio Australia) and hemag-glutination inhibition (HI) test [14] Positive dengue sampleswere then subjected to plaque reduction neutralization test(PRNT) [15]

23 Construction Cloning and Expression of RecombinantprMProtein Dengue virus type 2 strainNewGuineaC (pro-totype strain) was obtained from the Department of MedicalMicrobiology University ofMalaya DENV supernatant fromvirus stock was subjected to RNA extraction by using HighPure Viral RNA Isolation Kit (Roche Diagnostics) accordingto the manufacturerrsquos protocol Primers flanking the DENVprM region were designed with specific oligonucleotidecontaining restriction enzyme sequences forward primerACAGTGGATCCGTTCCATTTAACCACACGT and reve-rse primer TATAAGCTTCTATGTCATTGAAGGAGC-GAC The RT-PCR amplification of the target gene was thencarried out and the PCR products were then analysed bygel electrophoresis The amplified PCR products for DENV2obtained from RT-PCR consisted of the appropriate rest-riction sites engineered into the primer sequences The PCRproducts and pET28b(+) vector (Novagen pET System) werethen digested and ligated and cloning was performed inDH5120572 (Novagen) competent cells through heatshock trans-formation Positive transformants were selected on LB platesupplemented with kanamycin antibioticThe positive cloneswere checked for the correct sequence and orientation byrestriction enzyme digestion and by sequencing Plasmidcarrying the prM insert was extracted and then transformedinto expression host E coliBL21 (DE3) for protein expression

24 Testing for Protein Expression Expression of target pro-tein was tested with SDS-PAGE and western blotting Thepresence of fusion protein was detected with 6X His-TagHRP antibody For total protein analysis the bacterial pelletwas resuspended in 1X nonreducing sample buffer The celllysate was then heated at 100∘C for 10 minutes and spun at13000 rpm for 10 minutes before loading onto SDS-PAGETo check the solubility of the target protein the bacterialpellet from a 10mL culture was washed once with 1X PBS andresuspended in 1mL of inclusion body buffer (IBB) (50mMTris-HCl pH 8 1mM EDTA and 100mM NaCl) The cell




4)





3 Results








Total 4 0 4 0 79 83 81 38 43488 512 500 235 265






Total 42 44 19 105(400) (420) (180)







M P Neg

1000

500

(bp)

522 bp


M1 L 1 2 3 4 5 6 M2

5000

1500

500

(bp)

prM insert 508bp

500bp






4 Discussion









TAGACAAG


CATGGACCT



ACTTTGTAGAAGGGGT





Note 5998400

5998400

FPRI421

prM491


cDNA

RPRI(lt936) HindIII

BamHI (gt439)


NEG

37

25

20

(kDa)




1 2

25

20

17

11

(kDa)






18

16

14

12

10

8

6

4

2

0

No prM antibody

Num

ber o

f pat

ient

s

Antibody titers




10

9

8

7

6

5

4

3

2

1

0

No E antibody

Num

ber o

f pat

ient

s

Antibody titers










5 Conclusions


Disclosure




Acknowledgments


References


















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology




4)





3 Results








Total 4 0 4 0 79 83 81 38 43488 512 500 235 265






Total 42 44 19 105(400) (420) (180)







M P Neg

1000

500

(bp)

522 bp


M1 L 1 2 3 4 5 6 M2

5000

1500

500

(bp)

prM insert 508bp

500bp






4 Discussion









TAGACAAG


CATGGACCT



ACTTTGTAGAAGGGGT





Note 5998400

5998400

FPRI421

prM491


cDNA

RPRI(lt936) HindIII

BamHI (gt439)


NEG

37

25

20

(kDa)




1 2

25

20

17

11

(kDa)






18

16

14

12

10

8

6

4

2

0

No prM antibody

Num

ber o

f pat

ient

s

Antibody titers




10

9

8

7

6

5

4

3

2

1

0

No E antibody

Num

ber o

f pat

ient

s

Antibody titers










5 Conclusions


Disclosure




Acknowledgments


References


















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology






Total 4 0 4 0 79 83 81 38 43488 512 500 235 265






Total 42 44 19 105(400) (420) (180)







M P Neg

1000

500

(bp)

522 bp


M1 L 1 2 3 4 5 6 M2

5000

1500

500

(bp)

prM insert 508bp

500bp






4 Discussion









TAGACAAG


CATGGACCT



ACTTTGTAGAAGGGGT





Note 5998400

5998400

FPRI421

prM491


cDNA

RPRI(lt936) HindIII

BamHI (gt439)


NEG

37

25

20

(kDa)




1 2

25

20

17

11

(kDa)






18

16

14

12

10

8

6

4

2

0

No prM antibody

Num

ber o

f pat

ient

s

Antibody titers




10

9

8

7

6

5

4

3

2

1

0

No E antibody

Num

ber o

f pat

ient

s

Antibody titers










5 Conclusions


Disclosure




Acknowledgments


References


















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


M P Neg

1000

500

(bp)

522 bp


M1 L 1 2 3 4 5 6 M2

5000

1500

500

(bp)

prM insert 508bp

500bp






4 Discussion









TAGACAAG


CATGGACCT



ACTTTGTAGAAGGGGT





Note 5998400

5998400

FPRI421

prM491


cDNA

RPRI(lt936) HindIII

BamHI (gt439)


NEG

37

25

20

(kDa)




1 2

25

20

17

11

(kDa)






18

16

14

12

10

8

6

4

2

0

No prM antibody

Num

ber o

f pat

ient

s

Antibody titers




10

9

8

7

6

5

4

3

2

1

0

No E antibody

Num

ber o

f pat

ient

s

Antibody titers










5 Conclusions


Disclosure




Acknowledgments


References


















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology








TAGACAAG


CATGGACCT



ACTTTGTAGAAGGGGT





Note 5998400

5998400

FPRI421

prM491


cDNA

RPRI(lt936) HindIII

BamHI (gt439)


NEG

37

25

20

(kDa)




1 2

25

20

17

11

(kDa)






18

16

14

12

10

8

6

4

2

0

No prM antibody

Num

ber o

f pat

ient

s

Antibody titers




10

9

8

7

6

5

4

3

2

1

0

No E antibody

Num

ber o

f pat

ient

s

Antibody titers










5 Conclusions


Disclosure




Acknowledgments


References


















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


18

16

14

12

10

8

6

4

2

0

No prM antibody

Num

ber o

f pat

ient

s

Antibody titers




10

9

8

7

6

5

4

3

2

1

0

No E antibody

Num

ber o

f pat

ient

s

Antibody titers










5 Conclusions


Disclosure




Acknowledgments


References


















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


5 Conclusions


Disclosure




Acknowledgments


References


















































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


























Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

research article dengue patients exhibit higher...

Documents