R proteins: molecular switches controlled by their nucleotide binding

status

Internship report of:Leonardo Furci (5918928)

Supervisor: Ewa Łukasik

Examiner: dr. ing. Frank L. W. TakkenCo-assessor: dr. Martijn Rep

January 2009-december 2009

Swammerdam Institute for Life Sciences

Faculty of Science

Universiteit van Amsterdam

2

1. Abstract

Plant relies on their innate immune system to overcome the threat posed by the high number of pathogens who attacks them. In addition to a basal aspecific defence system based on recognition of Pathogen-Associated Molecular Patterns (PAMP), plants evolved a more specific “gene-for-gene” defence mechanism.In this mechanism R (resistance) proteins from the plant recognize specific gene products from a specific pathogen (also called effectors or AVRs) and consequently trigger a second layer of more specific defence responses. R proteins recognize only one or few specific AVRs from a specific pathogen, and only when there is a match between the plant R protein and the pathogen AVR (which are both strain-specific) the specific defenses are triggered, granting immunity to the infected plant.For the CNL (CC-NBARC-LRR) class of R protein it was proposed a model of activation based on its nucleotide binding status. According to the models those protein accumulate in a “resting” stage (inactive) while bound to ADP. After recognition of the pathogen’s AVR and subsequent exchange of ADP for ATP the protein switches in its “active” stage thus triggering the defence response.In this model the NB-ARC domain (Nucleotide Binding domain) acts as a real molecular switch, regulating the protein activity according to which nucleotide (ADP or ATP) is bound.The goal of our project is to validate this model by making an ATP binding and hydrolysis assay in Mi-1.2 and I-2 R proteins (both belonging to the CNL class) produced in planta.In order to produce the protein we followed two different approaches. First we tried to clone the protein of interest into the pEAQ-HT vector for transient protein expression in plants. Then we tried to optimize the conditions for Agrobacterium-mediated transient transformation using known construct in order to increase the efficiency of transient protein expression.Even if we succeeded in the optimization of the conditions for Agrobacterium-mediated transient transformation, several difficulties encountered during the cloning process limited possibility to test positive clones for protein expression and nucleotide binding properties.

3

4

2. Introduction

2.1. Plant-pathogen interactions during pathogen infection

Plants are attacked by a broad range of pathogens that cause them diseases, ranging from nematodes to fungi, bacteria and viruses.To survive this enormous amount of enemies plants have evolved an innate immune system, while on the other hand pathogens themselves evolved sophisticated strategies to overcome the plant defenses. This continuous evolutionary arm-race between plants and pathogens led to the development of a multi-layered system of interaction between the two contenders, in the continuous attempt to overcome each other (1).At the basal level plant developed a recognition system of highly conserved and slowly evolving Pathogen-Associated Molecular Patterns (PAMPs), like bacterial flagellin, bacterial lipopolysaccharides or fungal chitin. For this recognition plants rely on PAMP Recognition Receptors (PRRs), membrane-bound or cytoplasmic proteins of different families that recognize those specific pathogen-associated molecules and trigger the plant immune response (PAMP Triggered Immunity: PTI) (1,2).  The PTI response consists  mainly in the activation of generic defense mechanisms, like reinforcement of cell wall (deposition of callose, ligning, suberin), production of antimicrobial compounds such as ROS, phytoalexins, antimicrobial proteins (defensin, PR-1) and antimicrobial enzymes (chitinase, beta-glucanase, peroxidase). This defence mechanism can overall inhibit or stop the pathogen growth inside the plant (3).To overcome the plant PTI the pathogens secrete into the plant some effectors referred as AVRs (Avirulence). Those effectors increase the pathogen virulence by blocking the plant defenses, interfering with the downstream signaling of PPRs or the transcriptional activation of defence-related genes or both (1).The plants, in turn, possess another layer of defence against the pathogen effectors based on resistance (R) proteins, which can recognize the AVRs and bypass their effect, leading to reactivation of plant defenses. In fact when a specific R protein recognizes an AVR effector from a pathogen, a more effective (than PTI) defence response is triggered, called Effector Triggered Immunity (ETI); during ETI not only the normal plant defenses are re-activated, but also some pathogen-specific defence mechanisms are triggered. In some cases the specific defence mechanisms consist in the triggering of programmed cell death around the infection site. This programmed cell death, called Hypersensitive Response (HR) stops any further spreading of the pathogens inside the plants by blocking their growth (in the case of biotrophic pathogens) (1, 2) (Figure 2.1).Interestingly there is a direct correlation between pathogens’ AVRs and plants’ R proteins, in which a specific R protein can recognize only one (rarely more) specific AVR from a pathogen; the ETI in fact is triggered only when the R protein from the plant matches with its correspondent AVR from the pathogen, in what is called “gene-for-gene” relationship. (4).

5

Figure 2.1: Overview of plant-pathogen interactions during a pathogen infection of a plant. See text for explanation.

6

2.2. R proteins and Mi 1.2: Structure and model of activation

In the last years more than 50 R genes were cloned from different plants (5), divided in 4 classes based on their cellular localization and domains composition. Two classes consist of plasma membrane-spanning receptors characterized by the presence of a predicted extracellular Leucine Rich Repeat domain (eLRR): the RLK class (Receptor-Like Kinase), containing a small cytoplasmic domain homologous to kinase domain, and the RLP class (Receptor-Like Proteins), containing a small cytoplasmic domain lacking homology with kinase domain (6).The other 2 classes consist of intracellular receptors, divided according to the N-terminal domain and differences in aminoacids’s sequence of NB domain coserved motifs (6,7). The name of this two classes, TNL and CNL, derives from the 3 domains that constitute those proteins: a TIR (Toll interleukin-like) domain or a predicted CC (Coiled Coil) domain on the N-terminal part; a central NB-ARC (Nucleotide Binding domain shared with Apaf-1, R proteins and Ced-4) and a C-terminal LRR domain (Leucine-Rich Repeat) (see Figure 2.2 for the schematic structure of an TNL/CNL protein) (6). The central NB-ARC domain makes the TNL/CNL proteins belong to the STAND (Signal Transduction ATPases with Numerous Domains) superfamily of NTPases (8).According to the latest model each domain has specific function and specific intra- or inter-molecular interactions (9).The CC/TIR domain is supposed to be a platform for upstream interaction, by directly or indirectly recognizing the AVRs (9).The LRR domain is divided in two sub-domains with different functions: a C-terminal LRR involved in specificity of pathogen recognition and an N-terminal LRR involved in modulation of activation of the protein itself (auto-inhibition/activation) (9).The NB-ARC domain (also divided into NB, ARC1 and ARC2 sub-domains) is supposed to bind and hydrolyze ATP and modulate the protein activity (along with the LRR domain) (9). Among all these genes the tomato Mi-1.2 encodes a resistance protein against the root knot nematode (Meloidogyne incognita) and the sweet potato whitefly (Bemisia tabaci) (6,10). The protein encoded by this gene belongs to the CNL class containing a C terminal LRR domain, a central NB-ARC domain and a N-terminal CC domain.The N-terminal CC domain of Mi-1.2 however is slightly different from other CNL proteins and is referred as extended CC domain (6). This extended CC domain is found only in solanaceous R proteins and is characterized by the presence of additional domains. Among them it was identified the protein-protein interaction domain called Solanaceous domain (SD) (11). The extended N-terminal domain of Mi-1.2 is usually divided in two sub-domains: the NT1 (N-terminal 1, first 161 aminoacid) domain containing the solanaceous domain and the NT2 (N-terminal 2) domain. The NT1 domain it was shown to have auto-inhibitory function in domain swap experiments between Mi-1.1 and Mi-1.2 (6).

7

Figure 1.2: Structure of a TNL/CNL protein with the different domains, sub-domains and motifs.

 According to the last model of activation based on Rx, both the CC domain and the LRR domain are bound to the NB-ARC(9).In the absence of the pathogen the protein remains in the “resting” (inactive) stage, where the N-terminal LRR exerts its auto-inhibiting function keeping the protein inactive in a closed conformation. The three sub-domains of the NB-ARC domain form a closed nucleotide-binding pocket, and during the resting stage the NB-ARC is supposed to bind ADP.After direct or indirect (through guard/decoy putative interactors) recognition of the pathogen’s Avr on the CC and LRR domain, the protein undergoes a conformational change involving the LRR domain. This conformational change releases the auto-inhibition of the LRR domain itself and opens the nucleotide-binding pocket (due to direct interactions between N-terminal LRR and ARC2 sub-domains). The opening of NB-ARC domain causes a release of ADP and its subsequent exchange with ATP.The binding of ATP causes in turn a second conformational change affecting the NB-ARC domain and modifying the interactions with CC and LRR domain, thus putting the protein in the “active” state. In the “active” state the protein is supposed to be able to interact with the downstream signaling partner, triggering the signaling cascade that leads to ETI.It is supposed that subsequent hydrolysis of ATP into ADP from the NB-ARC domain puts the protein back into the “resting state” after activation (9) (see Figure 2.3 for a schematic overview of this model).

Figure 2.1: Reference model for Mi-1.2 activation. In the upper part the protein in the “resting” stage while bound to ADP. In this stage the LRR and CC domain are tightly bound to the NB-ARC blocking the nucleotide exchange. After recognition of the AVR (lower right) the protein undergoes a conformational change thus opening the nucleotide binding pocket and releasing ADP. A subsequent nucleotide exchange for ATP (lower left) puts the protein in the “active” stage in which it can interact with signaling partners. Putative hydrolysis of ATP into ADP (dashed line) puts the protein back in the “resting” stage. G/D= Guard/Decoy. (Lukasik and Takken 2009)

8

2.3. NB-ARC: the molecular switch

According to the model explained above, it appears that the NB-ARC domain acts as a molecular switch that regulates the protein activity depending on its nucleotide binding status: inactive protein while bound to ADP or active protein when bound to ATP (9).Some evidence of this switch-like model of activation for R proteins and for Mi-1.2 itself were already given in the past year.The first evidence was given in 2002 when the NT2-NB-ARC domain of Mi-1 (produced in E. coli) showed a clear ATPase activity (12), indicating that the protein is capable of ATP hydrolysis.Indirect evidence came from a biochemical analysis of the role of nucleotide-binding status in activation of hApaf-1 (human Apoptotic Peptidase Activating Factor 1).Apaf-1 is a human caspase activator that triggers apoptosis through the formation of the apoptosome who activates the caspase cascade. This protein is closely related to Nod-1 protein in mammals and R protein in plant, and it shares with them a central NB domain.In this model Apaf-1 (like R proteins in plant) is auto-inhibited in normal state, but is bound to dATP in the NB domain instead of ADP. After binding with cytochrome C the protein hydrolyses dATP into dADP, who is subsequently exchanged with dATP. The nucleotide exchange from dADP to dATP leads to protein activation and subsequent formation of apoptosome, while, in case the exchange does not happen, the dATP-bound form of the protein leads to the formation of an inactive aggregate (13).These findings support the idea that the NB-ARC domain regulates protein activation depending on its nucleotide-binding status.The last evidence came from the analysis of some mutants of Mi-1.2 (14).In this study one loss-of-function (KT556/557AA, also referred as “P-loop” mutant) and several autoactive mutants (H840A, T556S, D630E, D841V) of Mi-1.2 were tested for their ability to trigger HR in absence of elicitors.Interestingly all these mutations occurs in the NB-ARC domain of Mi, and more precisely at the interface of the nucleotide binding pocket (see Figure 2.4), suggesting that the alterations in protein activity that those mutants show are due to a change in their ability to bind/hydrolyze ATP.In fact an analogue loss-of-function mutation in the P-loop motif of NB-ARC domain of I-2 (I-2 K207R, corresponding to Mi-1.2 KT556/557AA) was shown to be unable to bind ATP (12). Based to these findings the P-loop mutant of Mi was also predicted to be unable to bind ATP, with the resulting loss-of-activity being a consequence of the protein inability to switch to the active stage (according to the model explained above).Similarly an autoactive mutation in the Walker B motif of I-2 (I-2 D283E, corresponding to Mi-1.2 D630E) was shown to be impaired in ATP hydrolysis but not binding (15), suggesting the autoactive phenotype derives from the protein inability to switch back to its “resting” stage, thus accumulating in the “active stage” (after spontaneous exchange of ADP for ATP) above the threshold level required for the triggering of HR.

9

Figure 2.2 Predicted 3D structure of the NB-ARC domain of Mi-1.2 with the three sub-domains (green: ARC1; blue: ARC 2; pink: NB) and the position of the different mutations. Van Ooijen et al. 2008

2.4. Aim of the internship

The aim of this internship is to validate the model explained above showing the ability of the full length (FL) Mi-1.2 and its mutants to bind and/or hydrolyze ATP.The final goal of this internship is to do an ATP binding and hydrolysis assay on WT Mi-1.2, the D630E autoactive mutant (putatively impaired in ATP hydrolysis) and the KT556/557AA loss-of-function mutant (putatively impaired in ATP binding). In the previous study the proteins were produced in a bacterial system in partial form (NT2-NBARC) (12). Subsequent attempt to produce the protein again in bacterial system or eukaryotic system (Pichia pastoris) did not succeed (Lukasik unpublished).For these reasons the proteins will be produced in planta, with the advantage of avoiding misfolding or incorrect splicing of procariotic systems and having correct glycosilation patterns.For the ATP binding and hydrolysis test we will need to produce and purify high levels of proteins, and to do so we will follow two different approaches: the first one will be the cloning of the different proteins in a suitable vector for a high-yield transient expression in planta. The second one will be the optimization of Agrobacterium-mediated transient transformation conditions to increase the yield of protein expression.

10

3. Cloning

11

3.1. Introduction: the pEAQ-HT vector

The vector we intended to use for cloning the Mi-1.2 constructs was kindly provided by professor Lomonossoff and professor Sainsbury. This vector, named pEAQ-HT, is an unpublished upgraded version of CPMV-HT (16), a vector built from the disabled version of CowPea Mosaic Virus (“deconstructed virus” strategy (17)). The CPMV-HT vector was claimed from the creators to express the desired protein up to 20% of the total extractable proteins (16).This vector was designed for transformation into Agrobacterium for transient protein expression, with the advantage of being faster and easier than the creation of stable transgenic plant. This feature makes it also suitable to work with autoactive R proteins, which will kill a stably transformed plant in the early phases of its growth.The MCS of the vector contains six restriction sites divided in three groups of 2, spaced out by two small sequences that codify for six histidines each. This structure allows cloning of the desired insert with respectively C-terminal or N-terminal His-tag, or no tag (see picture 2.1 for detail).The vector also contains the P19 (viral suppressor of RNA silencing) sequence, a Kanamycin resistance cassette (NPTII) and a very-low copy origin of replication (from 1 to maximum 5 copies per cell).

3.2. Results

12

Figure 3.1: Structure overview of the pEAQ-HT vector and detail of the MCS. The colored boxes indicate the restriction sites.

3.2.1. Preliminary testing of the vector

Both empty pEAQ-HT vector and pEAQ-HT+GFP vector (cloned into AgeI and XhoI sites) were provided by professor Sainsbury and Lomononnoff.Before using this DNA for further experiments we decided to test it through digestion with restriction enzymes.As first test we digested two samples of pEAQ-HT DNA with SacII and two samples of pEAQ-HT+GFP with AgeI and XhoI. According to the sequence provided a SacII digestion on the empty vector will produce three DNA fragments of 4Kb, 3Kb and 2.5Kb, while the double digestion of pEAQ-HT+GFP with AgeI and XhoI will excise the GFP insert out of the vector (500bp).After 2 hours incubation of the samples at 37C the digestion products were loaded on agarose gel (see “materials and methods” part) for analysis. Results are in Figure 3.2 below.

Figure 3.2: Analysis of pEAQ-HT and pEAQ-HT+GFP on agarose gel after digestion with restriction enzymes

Sample A of pEAQ-HT and sample A of pEAQ-HT+GFP showed the correct digestion pattern according to the predicted one from the sequence. Those two samples were then used for the creation of an E. coli glycerol stock and for all further experiments.

We also tested the pEAQ-HT+GFP DNA for its ability to express the GFP insert, to confirm the correct and high protein expression of this system.

13

We transformed the DNA into Agrobacterium and used the transformants to infiltrate a N. benthamiana plant (for complete procedure of transformation and Agroinfiltration see “materials and methods” part). Two days after infiltration (also referred as DPI, Days Post Infiltration) we analyzed the infiltrated leaves under the UV transilluminator, to check for an eventual response from the newly expressed GFP to UV light. The infiltrated area showed a clear green fluorescence, indicating that the protein was expressed correctly (Figure 3.3). Western blot analysis of protein extracted from a fully infiltrated leaves confirmed the high levels of expression (data not shown).

Figure 3.3: Black and white picture of Nicotiana benthamiana leaf infiltrated with pEAQ-HT+GFP. The picture was taken while the leaf was irradiated with UV light in the transilluminator. In bright is the infiltrated area that was glowing in the dark due to the presence of GFP.

3.2.2. First cloning attempt

14

We prepared several construct based on WT, KT556/557AA and D630E Mi-1.2 templates to be cloned into the pEAQ-HT vector, along with one I-2 construct.We choose those specific mutants of Mi-1.2 as their analogue in I-2 were already tested for their ability to bind or hydrolyze ATP (12, 15, see introduction). In addition due to the fact that up to date no specific elicitors for Mi were identified, we can use autoactive/loss of function mutants of Mi-1.2 to mock the behavior of the protein in presence/absence of elicitors.The I-2 construct will be used as a sort of positive control as the I-2 protein was investigated in more details for its ATP binding and hydrolysis ability (12,15).For the MI-1.2 constructs we decided to produce the full length protein (FL), a shortened version containing part of the N-terminal domain and the NB-ARC domain (NT2-NBARC, as it was tested in [12]) and the NB-ARC domain alone (see picture 2.4 for a list of all constructs with their respective names).Desired fragments of Mi-1.2 or I-2 were amplified by PCR reaction from a template of WT, KT556/557AA, D630E Mi-1.2 or FL WT I-2 in cTAPi vector and equipped with restriction sites (see materials and methods for list of primers and detail on PCR reactions).

Figure 3.4: Constructs used for cloning. Those constructs were extracted from a template through PCR and flanked with restriction sites (see text for details).

We decided to clone the Mi-1.2 constructs using the first 2 groups of restriction sites in the MCS of pEAQ-HT to obtain C-terminal His tagged protein. The His-tag will help us in the purification step after production, as for the ATP binding/hydrolysis assay we need the lowest levels of contamination as possible from exogenous ATPases. We choose to add (through PCR reaction) the NruI (blunt) restriction site to the 5’end because Mi-1.2 contains an AgeI restriction site in its sequence. At the 3’we put an XmaI/SmaI restriction site and we decided to use SmaI to digest the inserts, due to the fact that XmaI (Cfr9I from Fermentas) requires a very high concentration of DNA (minimum 50vg/μl). Due to its low-copy origin of replication in fact we couldn’t achieve such high concentration of pEAQ-HT vector.

NT1 NT2 NB-ARC LRR

D630E

D630E

KT556/557AA

KT556/557AA

WT I-2

Mi-1.2

1. FL WT Mi

2. NT2-NBARC WT Mi

3. NB-ARC WT Mi

4. FL P-Loop Mi

5. NT2-NBARC P-loop Mi

6. FL D630E Mi

7. NT2-NBARC D630E Mi

8. WT FL I-2

Name Sequence

NT2 NB-ARC

NB-ARC

NT1 NT2 NB-ARC LRR

NT2 NB-ARC

NT1 NT2 NB-ARC LRR

NT2 NB-ARC

≈ 0.5Kb ≈ 1kb ≈ 1kb ≈ 1.5kb

≈ 4kb

15

See picture 2.5 for an explaining scheme of the cloning strategy.We choose to clone the I-2 construct into the first and last group of restriction sites on the MCS to produce untagged version of the protein. It was shown in fact (van Oijen unpublished) that I-2 is not completely functional with a tag on C-terminal or N-terminal part.For this reason we decided to add (again through PCR reaction) an NruI restriction site at the 5’end and an XhoI site at the 3’end of the I-2 construct.After the addition of the restriction sites both the vector and the inserts were digested with the respective enzymes, while the vector was dephosphorilated to avoid its re-closure during ligation (due to double blunt ends produced by the chosen restriction enzymes). Then the vector and the inserts were ligated and subsequently transformed to E. coli (see “materials and method” for a more detailed description of cloning steps).

After plating the transformants were screened through colony PCR to test if they were carrying the insert or just the empty vector. Eleven colonies were analyzed for every construct using primers (see “materials and methods”) designed to anneal both on the insert sequence and on the NOS terminator of the vector. The expected length of the amplified fragment was ≈1Kb for all the constructs.The PCR products were loaded on agarose gel for analysis (Figure 3.6).Some bands were detectable in the constructs 1, 4 and 6. Unfortunately we could not detect the marker in the gel and for this reason we were not able to determine if the bands corresponded to the expected length or were just artifacts.However even without marker the bands seemed to be lower than the expected size, thus making us decide not to continue with the screening.

16

AgeI

Figure 3.5: Scheme of the first cloning strategy used to clone the Mi constructs into the pAEQ-HT vector. The restriction sites ad the ends of the insert were added through PCR. For I-2 constructs we added XhoI site instead of XmaI/SmaI.

Figure 3.6: Colony-PCR screen of the transformants. In the white boxes is indicated the name of the constructs. 1: negative control 1 (PCR mix incubated with a sample striped from the agar of the plate); 2: negative control 2 (PCR mix incubated with empty vector); 3: negative control 3 (PCR mix alone)

1. FL WT Mi 4. FL KT556/557AA Mi

6. FL D630E Mi 3. NB-ARC WT Mi

2. NT2-NBARC WT Mi 5. NT2-NBARC P-loop Mi

7. NT2-NBARC D630E Mi 8. FL WT I-2

1 2 3

17

3.2.3. Second cloning attempt

After the failure of the screening we made a second attempt with the same strategy (Figure 2.5). We realized that the amount of DNA extractable from a normal 5ml E. coli culture (around 0.1-0.2 μg) was not enough for the cloning.For this reasons we decided to grow a 100ml culture of E.coli + pEAQ-HT and extract the DNA through Qiagen Midi-prep extraction kit ™.This allowed a higher concentration of vector DNA that gave us possibility to use XmaI (sticky ends) for digestion and consequently avoid the dephosphorilation step (which decreases the efficiency of ligation).Due to the increased amount of vector DNA available we also decided to try both 1:1 and 1:3 ratios of vector:insert DNA in the ligation mixture. The results from the count of the transformants are in the table below:

Table 3.1: Number of transformants after plating. The dotted numbers indicate the construct as explained in Figure 3.4

Control: Mi no T4

Control: Mi +T4

Control: I-2 no T4

Control: I-2 +T4

1.1:1

2.1:1

2.1:3

3.1:1

3.1:3

4.1:1

Colonies 19 375 5 <500 18 500 47 135 <450 45Control Mi no T4

Control Mi +T4

Control I-2 no T4

Control I-2 +T4

5.1:1

5.1:3

6.1:1

7.1:1

7.1:3

81:1

Colonies 19 375 5 <500 800 500 500 1000 400 24

Mi no T4: bacteria transformed with empty vector digested with NruI/XmaI (negative control for digestion, Mi constructs)Mi + T4: bacteria transformed with empty vector digested with NruI/XmaI and incubated 2hrs with T4 ligase (negative control for ligation, Mi constructs)I-2 no T4: bacteria transformed with empty vector digested with NruI/XhoI (negative control for digestion, I-2 construct)I-2 + T4: bacteria transformed with empty vector digested with NruI/XhoI and incubated 2hrs with T4 ligase (negative control for ligation, I-2 construct)

In green are the constructs who showed a higher number of transformants (enrichment) compared to the control of digested empty vector incubated with ligase (purple boxes). The control with digested empty vector and ligase indicates the basal level of transformants to expect in each ligation reaction, while the enrichment then (intended as a positive difference between the sample plate and the control background) indicates a possible presence of positive clones.Out of those seven we selected five plates to use for further analysis: 2. 1:1 (FL WT Mi); 3. 1:3 (NB-ARC WT Mi); 5. 1:1 (NT2-NBARC P-loop Mi); 6. 1:1 (FL D630E Mi); 7. 1:1 (NT2-NBARC D630E Mi)

18

From each plate we isolated the plasmidic DNA of seven different colonies and tested it via digestion with NruI and SmaI restriction enzymes.The expected digestion pattern for each construct is:

- 1. (FL WT Mi) 10kb + 4kb- 3. (NB-ARC WT Mi) 10kb + 1kb- 5. (NT2-NBARC P-loop Mi) 10kb + 2kb- 6. (FL D630E Mi) 10Kb + 4kb- 7. (NT2-NBARC D630E Mi) 10Kb + 2kb

Figure 3.7: Screening of clones through NruI/SmaI double digestion. Numbers indicate individual clone tested for every construct (as numbered in Figure 3.4). ex. 6.2= clone number 2 of construct 6.; M= marker

19

M 1.1 1.2 1.3 1.4 1.5 1.6 1.7 M 7.1 7.2

M 3.1 3.2 3.3 3.4 3.5 3.6 3.7 M 7.3 7.4

M 5.1 5.2 5.3 5.4 5.5 5.6 5.7 M 7.5 7.6

M 6.1 6.2 6.3 6.4 6.5 6.6 6.7 M 7.7

10kb4kb2kb1kb

0.5kb

3.2.4. Third cloning attempt: pGEM-T easy® strategy

In the next cloning attempt we adopted a new strategy based on the use of the pGEM-T easy® vector from Promega as second cloning vector.The idea behind this strategy is to ligate our constructs (with the newly added restriction sites at the extremities) into the pGEM-T easy® vector and transform them into E. coli to produce it in high quantity (see “materials and methods” for more details on the protocol for cloning with pGEM-T easy® vector). Subsequently we can extract the plasmid and excise out our constructs through a double digestion with the NruI (at the 5’ end of our constructs) and SalI (26 base downstream the ligation site in the MCS of the pGEM-T easy® vector) restriction enzymes. SalI restriction enzyme generates a sticky end compatible with the one generated by XhoI, and this allows us to clone the constructs (excised from pGEM-T easy®) into the 2nd and 3rd group of restriction sites in the pEAQ-HT vector: the SmaI site (compatible with NruI due to the blunt end they both generate) and the XhoI site (which, as stated before, shares a compatible end with SalI). This strategy will generate N-terminal His-tagged protein (see Figure 3.8 for a schematic explanation of this strategy).

The main advantage of this technique is that we can discriminate between digested and undigested inserts after loading on agarose gel the digested pGEM-t easy® vector + inserts. The number of transformants from the previous experiments in fact indicated that ligation was performed with partially undigested inserts and/or vector (see Discussion part). Use of agarose gel purification or purification kits (see materials and methods part) on PCR products after restriction enzyme digestion (without ligation into the pGEM-t easy® vector) makes it unable to distinguish between digested and undigested one, due to the fact that they differ only for few nucleotides.

20

Figure 3.8: Schematic explanation of the pGEM-T easy® cloning strategy. The NruI and SmaI/XmaI cloning sites were first added through PCR using the same primers used before. The PCR products are then cloned into the pGEM-T easy® via poly-a tailing (see “matherials and methods”). SalI and XhoI restriction sites shares compatible ends after cut with the correspondent restriction enzyme.

Using this strategy instead the undigested insert will remain ligated to the vector and thus visible on agarose gel as a higher band, allowing us to isolate only the band corresponding to the fully digested insert.In addition there are several other advantages using this strategy:

- The ligation of the inserts in the pGEM-T easy® vector will increase the digestion efficiency. In fact in the Fermentas manual it was reported a decrease of digestion efficiency when the restriction site was placed at the end of a PCR product. Even if through our primers we added extra nucleotides to the ends of our inserts (as suggested in the manual), the digestion efficiency could still have been impaired in previous experiments. With the insert ligated into the pGEM-T easy® vector however this problem is overcome.

- Our constructs will be isolated in high quantity due to the f1 ORI (very high copy) of the pGEM-T easy® vector.

- The sticky(SalI/XhoI)/blunt(NruI) second ligation (in the pEAQ-HT vector) will allow us to avoid the vector dephosporilation step that usually reduces ligation efficiency.

During the first cloning step of PCR products into the pGEM-T easy® vector we could not clone the construct 4 (FL P-loop Mi) and no transformants were found carrying this insert. We decided however to continue with the second cloning step with the other transformants.We then isolated the DNA from the other seven correctly transformed clones and digest it with NruI/SalI restriction enzymes to excise our constructs from the pGEM-T easy® vector.The expected size of the fragment to be cut out of the pGEM-T easy® vector for each construct corresponds to the size of the insert itself

- 1. ≈ 4kb- 2. ≈ 2kb- 3. ≈ 1kb- 5. ≈ 2kb- 6. ≈ 4kb- 7. ≈ 2kb- 8. ≈ 4kb

21

M 1. 2. 3. 5. 6. 7. 8.

M 1. 2. 3. 5. 6. 7. 8.

B

A

Figure 3.9: Double digestion (NruI/SalI) of the constructs cloned into pGEM-T easy® vector. Only 5 of the 7 constructs that we could clone into pGEM-T easy® showed a band correspondent to the length of the insert. Those bands were subsequently cut from the gel (part B), purified from agarose and used for cloning into pEAQ-HT.

10kb 4kb 2kb

1kb

0.5kb

10kb 4kb 2kb

1kb

0.5kb

Only five out of seven clones showed a band corresponding to the size of the constructs (2., 3., 5., 6., 7. respectively, see Figure 3.9 A). The DNA in those bands were then isolated from the gel (Figure 3.9 B) and used for cloning in pEAQ-HT vector (see “materials and methods”) for the cloning protocol.Fourteen colonies for every construct were screened via colony-PCR using primers designed to anneal on the Mi sequence (Figure 3.10, details in materials and methods part). In this way we were able to check if the selected colonies from the plates do contain the construct and not just the empty vector.From the colony-PCR 5 clones appeared to contain the correct insert (2.10, 3.3, 3.6, 5.10 and 6.4; Figure 3.10).We isolated and sequenced the plasmid DNA from those clones to check it for the presence of additional unwanted mutations. However the sequencing reaction didn’t work (probably due to a too low concentration of template DNA), making us unable to determine the accuracy of the clones sequence.

22

3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 3.9 3.10 3.11 3.12 3.13 3.14 M 7.6 7.7 7.8 7.9 7.10

5.1 5.2 5.3 5.4 5.5 5.6 5.7 5.8 5.9 5.10 5.11 5.12 5.13 5.14 M 7.11 7.12 7.13 7.14

6.1 6.2 6.3 6.4 6.5 6.6 6.7 6.8 6.9 6.10 6.11 6.12 6.13 6.14 M -1 -2 +

2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 2.9 2.10 2.11 2.12 2.13 2.14 M 7.1 7.2 7.3 7.4 7.5 Figure 3.10: Screening of transformants via Colony-PCR. After digestion out of the pGEM-T easy® vector the inserts were ligated into pEAQ-HT. Numbers indicate individual clone tested for every construct (as numbered in figure 2.4). ex. 6.2= clone number 2 of construct 6.; M= marker; -1= negative control 1 (PCR mix alone); -2= negative control 2 (sample striped from the agar of the plate); += positive control (cTAPi vector containing FL WT Mi).

3.2.5. Last cloning attempt

In the next cloning attempt we adopted a different strategy, in which we reduced the number of constructs to clone and changed the PCR primers to add different restriction sites to the inserts. A lower number of constructs to clone in fact would make the cloning easier and would allow performing a more detailed screening of the transformants.We decided to clone only NT2-NBARC-LRR domains of WT Mi-1.2 and its two mutants KT556-557AA (P-loop) and D630E, along with FL WT I-2, due to the fact that the NT1 domain was reported to create some difficulties to the cloning process (van Oijen, unpublished data).

Figure 3.11: New constructs used for the new cloning strategy. Those constructs were extracted from a template through PCR and flanked with restriction sites (see text for details).

Subsequently we decided to change the primers for the PCR reaction to add different restriction sites at the extremities of the constructs while we extract/amplify them from the template (see “materials and methods” for primer sequences and explanation)With this new set of primers we can add an XmaI restriction site at the 5’end and a double XmaI/SalI at the 3’end of our constructs.Due to the fact that SalI and XhoI generate compatible ends, this new strategy allows us to clone the Mi constructs into XmaI/XhoI digested pEAQ-HT vector generating N-terminal His-tagged proteins (Figure 3.12). In addiction this combination of enzymes generates two different sticky ends in both the constructs and the vector (with the previous strategies we had blunt/blunt or sticky/blunt ends), making the ligation reactions more precise and removing the need of dephosphorilating the vector.Another advantage of this combination is that we can also clone the I-2 construct into AgeI and XhoI restriction sites of the pEAQ-HT vector (untagged protein) due to the fact that AgeI and XmaI generates compatible ends as well (Figure 3.12).Last we decided to switch from normal PCR reaction to touchdown PCR (see “materials and methods”) for the production of our constructs. Using touchdown PCR we could avoid all the optimization steps of PCR conditions required for the new set of primers and increase the yield of PCR products.

NT2 NB-ARC LRR

D630E

KT556/557AA

WT I-2

Mi-1.2

A: NT2-NBARC-LRR WT Mi Mi

B: NT2-NBARC-LRR P-Loop Mi

D: WT FL I-2

Name Sequence

NT2 NB-ARC LRR

NT2 NB-ARC LRR

1kb 1kb 1.5kb

C: NT2-NBARC-LRR D630E Mi

4kb

23

Figure 3.12: Schematic explanation of new cloning strategy. The restriction sites at the ends of the inserts were added via PCR using the primers listed in “materials and methods”. Blue lines represent the set of restrictions sites/restriction enzymes used for cloning the Mi constructs; green lines represent the set of restrictions sites/restriction enzymes used for cloning the I-2 construct.

For this cloning we decided again to try the 1:1 and 1:3 ratio of vector:insert in the ligation mixture due to the very high amount of constructs we obtained with touchdown PCR. After transformation we also decided not to plate all the transformant bacteria in one plate but to split them in two different fractions (100μl and 900μl) and plate them separately.Resulting transformant bacteria obtained after plating were firstly screened via colony PCR using primers designed to anneal on Mi (in case of Mi constructs) or I-2 (in case of I-2 construct) sequence. We selected 22 clones per construct for the screening, selected randomly between the 100μl and 900μl plates, both in 1:1 or 1:3 ratio (Figure 3.13).Out of all these clones we selected four per each construct that showed a clear amplification compared to the positive control. The names we gave to those clones are indicated in Figure 3.13.

AgeI XhoI

24

We extracted and purified the plasmid DNA from those clones for a more specific analysis in search of positive clones.First we used the DNA as a template in a touchdown PCR reaction using the same primers used for the creation of our constructs. This second round of PCR analysis

allows the screening of a clean sample of plasmidic DNA, of which we could not be sure in the col-PCR reaction. In the col-PCR in fact there could have been presence of contamination of non-ligated inserts from the ligation mixture after plating, thus creating false positive clones.The same DNA was then used in a digestion test with XbaI restriction enzyme. The results from this double test are in Figure 3.14.

25

1:1 1:3 1:1 1:3

100μl 900μl

A

B

C

D

M M M -1 -2 -3 +1 +2

M M M

M M M

M M M

10kb4kb2kb

1kb

0.5kb

A1 A2 A3 A4

B1 B2 B3 B4

C1 C2 C3 C4

D1 D2 D3 D4

Figure 3.13: Colony-PCR screening of tranformants after cloning. Big letters on the left side indicate which contruct is analyzed in each row, as named in figure 2.11 (22 clones screened per construct). Small numbered letters in the inner part of the figure indicate the putative positive cloned that were selected and further analyzed. -1= negative control 1: PCR mix alone; -2= negative control 2: empty pEAQ-HT digested with XmaI/XhoI (for Mi constructs); -3= negative control 3: empty pEAQ-HT digested with AgeI/XhoI (for I-2 construct); +1= positive control 1: cTAPi vector containing FL WT Mi; +2= positive control 2; cTAPi vector containing WT FL I-2; M=marker.

The expected digestion patterns after digestion with XbaI (based on the sequence of the pEAQ-HT vector and of the constructs) are:

- Empty vector= 10kb + 0.5kb- Vector containing the correct insert= 10kb + 2x1.3kb + 2x0.5kb

After this double analysis only 6 clones appeared to have the correct insert: A1 (NT2-NBARC-LRR WT Mi); B1, B3 and B4 (NT2-NBARC-LRR P-Loop Mi); C3 and C4 (NT2-NBARC-LRR D630E Mi).All the 4 clones we chose for the I-2 construct (D) turned out to be false positives.The other 6 positive clones were sent for sequencing to check the eventual presence of unwanted mutations in the sequence.From the sequencing in fact it turned out that the A1, C3 and C4 clones had more than one non-silent point mutation which makes them unusable for protein expression. On the other hand the B1, B3 and B4 clones were completely free of mutations, even the double KT556/557AA mutation they should had from the template. This was probably caused by an error during the cloning process or a contamination of the original template DNA with the WT template. Another more remote option is that the stock from which we took the template was else wrong or contaminated as well.For the fact those three clones were free of mutations we decided to test them for protein expression as WT NT2-NBARC-LRR construct (A).No proteins could be detected at all after immunoblotting on a total protein extract from plant tissue infiltrated with our clones (data not shown), but we suspect an error during the protein extraction process (see “Discussion” for more details).However due to a matter of time we could not test these clones anymore.

26

A1 A2 A3 A4 M B1 B2 B3 B4 M C1 C2 C3 C4 / D1 D2 D3 D4 M

M A1 A2 A3 A4 / B1 B2 B3 B4 M C1 C2 C3 C4 M D1 D2 D3 D4

Figure 3.14: Second analysis of putative positive clones through touchdown PCR (upper part) and digestion with XbaI (lower part). M= marker

10kb4kb2kb1kb

0.5kb

4. Optimization of Agrobacterium-mediated transient transformation conditions

4.1. Introduction

For the ATP binding and hydrolysis assay we need to produce in planta high levels of recombinant Mi-1.2 protein (both WT and mutants). To achieve this goal we decided to transiently express the protein in Nicotiana benthamiana leaves through Agrobacterium-mediated transient transformation.This technique is preferable to stable transformation of plants due to the fact is easier and faster. Also, using new-generation vectors for transient expression (based on disabled viral replicons), the expression levels obtainable are equal or even higher than the one obtained with stable transformants (see “introduction to cloning” part or “discussion” part).

27

Due to a moving of our laboratory in a new building we lost our previous optimal condition for transient protein expression in N. benthamiana. Other colleague reported in fact some problems with protein expression and developing of HR using transient transformation in the new laboratory (Gawehns unpublished, Lukasik unpublished).For this reasons we tested both new growth conditions and new post-infiltration conditions of our test plants to try to optimize the process.To test the expression levels under different conditions we infiltrated N. benthamiana with Agrobacterium carrying different autoactive Mi-1.2 mutants, using HR response triggered by those mutants as an indirect indicator of protein expression. For those tests we infiltrated the leaf of a plant with an autoactive Mi-1.2 mutant on one side and WT Mi-1.2 on the other side, as negative control for the HR response (figure 4.1). In addition to analyze if the desired protein is expressed we extracted the protein from infiltrated leaves and analyzed the total extract with western blot. For this analysis we fully infiltrated the leaf of a test plant with the desired protein and harvested some days after infiltration (figure 4.1).

4.2. Results

4.2.1. Test of different growth conditions

As a first test we checked the influence of different growth conditions of N. benthamiana plants on protein expression after transient transformation. We tested 4 different growth conditions in our greenhouse in 4 different compartments:

Name of the compartment

Temperature RelativeHumidity

28

Autoactive Mi-1.2 mutant

WT Mi-1.2 (negative control)

A: Infiltration scheme for experiments of HR response analysis

B: Infiltration scheme for experiments of quantification of protein expression

Figure 4.1: Schemes of infiltration used in the experiments of optimization of transient transformation conditions. The circles represent the infiltrated area on the leaf.

Nicotiana (N) 22.5ºC ≈60%

Arabidopsis (Ar) 21ºC ≈50%

Petunia (P) 22.5ºC ≈70%

Caterpillar (Cat)(Presence of ethylene)

22.5ºC ≈70%

Before infiltration plants already showed some differences in shape and overall conditions (figure 4.2). [Plants grown in Petunia (P) and Caterpillar (C) compartments appeared more elongated and with more secondary leaves. Plant grown in Arabidopsis (Ar) and Petunia (P) compartments also showed more expanded leaves, while plants grown in Caterpillar (C) compartment showed a bit of chlorosis (figure 4.2)]

After 4 weeks of growing those plants were infiltrated as explained in figure 4.1. To test the development of HR we used the H840A autoactive mutant of Mi-1.2 (14, pG114) versus WT Mi-1.2 (in cTAPi, figure 4.1A). For the analysis of protein expression we used WT Mi-1.2 (in cTAPi) in a fully infiltrated leaf (figure 4.1B).After infiltration all plants were kept in the same conditions (18ºC under normal greenhouse illumination). After 2 dpi (Days Post Infiltration) the fully infiltrated leaves were harvested for protein extraction and quantification of expression via western blot.After 3 and 5 dpi leaves infiltrated with H840A Mi-1.2 versus WT Mi1.2 were scored for the presence of HR response.No plant showed any HR response, apart some small necrotic areas in the plant grown in Arabidopsis compartment. However plants grown in Nicotiana (N), Arabidopsis (Ar) and Petunia (P) compartments showed a good level of expression of WT Mi-1.2 (figure 4.3). this data however is not quantitative due to the fact we did not equalize the protein content before loading the samples on poliacrylammide gel.

29

Figure 4.2: Overview of sample plants grown in the four different growth conditions: N= Nicotiana compartment; Ar= Arabidopsis compartment; P= Petunia compartment; Cat= Caterpillar

Figure 4.3: Overview of growth conditions test. Black circles indicate the area of the leaf Agroinfiltrated with WT Mi-1.2 in cTAPi (negative control). Orange circles indicate the area of the leaf Agroinfiltrated with H840A Mi-1.2 in cTAPi. In the small blue boxes the results from the analysis of protein expression. The analyis was performed via western blot on total protein extract from leaves fully Agroinfiltrated with WT Mi-1.2 in cTAPi.

4.2.2. Test of conditions after infiltrations

While analyzing the effect of different growth conditions we wanted to test also a possible influence of environmental conditions after infiltration on protein expression levels.We tested two specific parameters: the temperature in which the plants are kept after Agroinfiltration and the illumination the plants receive.For this test we used autoactive H840A mutant of Mi-1.2 versus WT Mi-1.2, infiltrated as explained in figure 4.1A, along with T557S autoactive mutant of Mi-1.2 in transcomplementation (Lukasik unpublished).We decided to use this mutant due to the fact that the H840A mutant did not trigger any detectable HR response in the previous experiment (4.2.1).

30

Two leaves were infiltrated with Agrobacterium carrying Mi WT on the right side and with Agrobacterium carrying an autoactive mutant on the left side (as explained in figure 4.1A). The autoactive mutants were: 1) a mixture of Agrobacterium carrying WT NT1NT2 fragment of Mi-1.2 in nTAPi and Agrobacterium carrying T557S NB-ARC-LRR domains of Mi-1.2 in cTAPi, or 2) Agrobacterium carrying H840A mutant of Mi-1.2.To analyze the protein expression we infiltrated one plant per each different condition with Agrobacterium carrying WT FL Mi-1.2 (as illustrated in figure 4.1B).All plants were grown in Nicotiana (N) conditions.After infiltration plants were kept in two different compartments at 18ºC and 20ºC respectively. In addition in each compartment plants were kept in two different illumination conditions: normal illumination (natural light plus artificial light) and low illumination (plants were kept under a table and covered from the side).After 2 dpi leaves fully infiltrated with Agrobacterium carrying WT Mi-1.2 in cTAPi were harvested for subsequent protein extraction and quantification of protein expression via western blot. After 3 dpi leaves infiltrated with Agrobacterium carrying autoactive Mi-1.2 mutants versus Agrobacterium carrying WT Mi1.2 in cTAPi were scored for the presence of HR response (figure 4.4).Again H840A mutant of Mi-1.2 did not show any relevant HR response compared to the control (WT Mi-1.2). On the other hand T557S transcomplementing mutant of Mi-1.2 showed a clear HR response in the whole infiltrated area that changed in intensity in the different conditions.From a visual comparison based of intensity of HR response in fact the optimal conditions after infiltration appeared to be 20ºC under low illumination.

31

Figure 4.4: Test of influence of post-infiltration conditions on protein expression levels. Black circles indicate the area of the leaf Agroinfiltrated with WT Mi-1.2 in cTAPi (negative control). Orange circles indicate the area of the leaf Agroinfiltrated with H840A Mi-1.2 in cTAPi or WT NT1NT2 in cTAPi + T557S NB-ARC-LRR in cTAPi (indicated as T557S)

4.2.3. Combined test of growth conditions and post-infiltration conditions

After the positive results obtained with the T557S autoactive mutant of Mi-1.2 in transcomplementation we decided to use it in an additional test. In this test we combined both growth conditions and post-infiltration conditions to validate the results obtained in the previous experiments.For the growth conditions we choose both the Nicotiana (N) and the Arabidopsis (Ar) compartments, as from the previous experiment it also looked suitable to grow N. benthamiana (4.2.1, figure 4.2). In addition the plants in the Nicotiana (N) compartment were grown with and without the addition of organic fertilizer.For the post-infiltration conditions we decided to use 20ºC as it appeared to be the best incubation temperature after infiltration the previous test. We also decided to test again the effect of normal and low illumination on protein expression levels.To analyze differences in HR response in the different conditions we infiltrated the plants with a mixture of Agrobacterium carrying WT NT1NT2 fragment of Mi-1.2 in nTAPi and Agrobacterium carrying T557S NB-ARC-LRR domains of Mi-1.2 in cTAPi in one area. A second area was infiltrated with Agrobacterium carrying WT Mi-1.2 as negative control (as illustrated in figure 4.1A).

32

For analysis of protein expression we fully infiltrated one plant per each condition with Agrobacterium carrying T557S NB-ARC-LRR fragment of Mi-1.2 in nTAPi (as illustrated in figure 4.1B).After 2dpi leaves were scored for HR response while leaves infiltrated for protein expression analysis were harvested for protein extraction.The results confirmed the findings of the previous experiments (4.2.3). The stronger HR development in fact was found in plants grown in Nicotiana (N) compartment (without fertilizer) and kept, after infiltration, in low illumination conditions in 20°C (figure 4.5). The protein expression analysis seemed to support those findings, even if the data are not quantitative (see “discussion”).

33

Figure 4.5: Combined test of growth and post-infiltration conditions. Green circles indicate the area of the leaf Agroinfiltrated with WT Mi-1.2 in cTAPi (negative control). Red circles indicate the area of the leaf Agroinfiltrated with H840A Mi-1.2 in cTAPi or WT NT1NT2 in cTAPi + T557S NB-ARC-LRR in cTAPi.

4.2.4. Test of different autoactive mutants

The H840A autoactive mutant of Mi-1.2 did not trigger any HR response in the previous experiments, even if it was reported as the second stronger between all the autoactive mutants of Mi-1.2 (14).For this reason we decided to make an additional test, to verify if the problem resided in the construct itself we used to express the H840A mutant of Mi-1.2 or if there was a more general problem regarding development of HR response. The construct we used in fact was stored form a long time, and we suspected that this could influence its efficiency in transforming the plants or expressing the protein.We tested the construct we used in the previous experiments in comparison with a freshly transformed one and in comparison with other different autoactive mutants.We infiltrated different plants using the following constructs:

- Agrobacterium carrying H840A autoactive mutant Mi-1.2 in cTAPi (14, pG114; same construct used in prevous experiments)

- Agrobacterium carrying WT NT1NT2 domain of Mi-1.2 in cTAPi plus Agrobacterium carrying T557S NB-ARC-LRR domains of Mi-1.2 in cTAPi (T557S autoactive mutant Mi-1.2 in transcomplementation)

- Agrobacterium carrying H840A autoactive mutant of Mi-1.2 in cTAPi (14, pG114; freshly transformed)

- Agrobacterium carrying FL T557S autoactive mutant of Mi-1.2 in cTAPi (14, pG120)- Agrobacterium carrying D630E autoactive mutant of Mi-1.2 in cTAPi (14, pG121- Agrobacterium carrying R961D autoactive mutant of Mi-1.2 in cTAPi (an additional

unpublished putative autoactive mutant of Mi-1.2)

All those constructs were infiltrated versus Agrobacterium carrying WT Mi-1.2 in cTAPi as negative control for HR response (as illustrated in figure 4.1A).Six plants were also fully infiltrated with one of the constructs listed before (as illustrated in figure 4.1B) to analyze the protein expression levels.After 2 dpi leaves fully infiltrated for quantification of protein expression were harvested for protein extraction.After 3 and 5 dpi leaves infiltrated with Agrobacterium carrying different autoactive mutants versus Agrobacterium carrying WT Mi-1.2 were scored for the presence of HR.Only T557S autoactive mutant of Mi-1.2 in transcomplementation triggered a significantly stronger HR than the negative control (figure 4.6). The protein extraction and quantification did not give any interpretable result, probably due to some errors in the protein extraction procedure or the blotting procedure.

34

35

Figure 4.6: Analysis of different Mi-1.2 autoactive mutants for their ability to trigger HR response. Black circles indicate the area of the leaf Agroinfiltrated with WT Mi-1.2 (negative control). Red circles indicate the area Agroinfiltrated with different autoactive Mi-1.2 mutants (as listed in the upper part of the picture). H840A old= constructed used in previous experiment (from glycerol stock). H840A new= freshly transformed H840A autoactive mutant of Mi-1.2 in cTAPi.

4.2.5. Second test of different autoactive mutants

After no one of the autoactive mutants showed any HR response even after 5 days after infiltration we decided to test different parameters that could lead to the negative results found in the previous experiment.Since some construct we used in the previous experiment were carrying a C-terminal TAP tag and since the same autoactive mutants published in (14) were used in the untagged version, we thought of a possible negative influence of TAP tag on protein ability to trigger HR.To test this possibility we infiltrated each leaf with Agrobacterium carrying the untagged (published) version of an autoactive mutant of Mi-1.2 (H840A, pG114; T557S, pG91; D630E, pG93) versus Agrobacterium carrying the C-terminal tagged one (H840A, pG123; T557S, pG120; D630E, pG121). In the same leaf we also infiltrated Agrobacterium Carrying WT Mi-1.2 (negative control for HR response) and a mixture of Agrobacterium carrying WT NT1NT2 domain of Mi-1.2 plus Agrobacterium carrying T557S NB-ARC-LRR domains of Mi-1.2 (positive control for HR response), as illustrated in figure 4.7.

Another parameter we wanted to test was the OD600 of the Agrobacterium culture used for infiltration. Through conductivity assay in fact it was reported that a high OD600 of the colture used for infiltration can have an inhibitory effect on HR response (Gawehns and Hydra 2009, unpublished).For this reason we repeated each experiment using for infiltration Agrobacterium culture at 1 (as used in the previous experiments) or 0.5 OD600.The R961D autoactive mutant was never produced with C-terminal TAP tag so we tested it only infiltrating different OD600 of Agrobacterium cultures.Since in the previous experiment (4.2.4) we did not found any significant difference between old constructs and freshly transformed ones (figure 4.6) we used old glycerol stocks (the same used in [14]) to prepare the Agrobacterium suspensions carrying the untagged version of the autoactive mutants of Mi-1.2.Eight plants were also fully infiltrated as described in figure 4.1 B with Agrobacterium carrying one of the single autoactive mutants and with Agrobacterium carrying WT M1-1.2 for analysis of protein expression.After 2 dpi leaves fully infiltrated for quantification of protein expression were harvested for protein extraction.After 3 and 5 dpi leaves infiltrated with Agrobacterium carrying different autoactive mutants versus Agrobacterium carrying WT Mi-1.2 were scored for the presence of HR.

36

WT Mi-1.2 (negative control)

T557S autoactive Mi-1.2 in transcomplementation (positive control)

Untagged version of tested autoactive mutant (published)

C-terminal TAP tagged version of tested autoactive mutant

Figure 4.7: Scheme of infiltration used in the second test of different autoactive mutants. Circles represent the infiltrated areas on the leaf.

In this case the scoring for HR response was also supported by visualization of necrotic areas via Trypan blue staining (figure 4.8). The staining was performed on the same leaves scored for HR response 5 days after infiltration. Only the positive control T557S autoactive mutant of Mi-1.2 in transcomplementation showed a clear HR response (figure 4.8). We could not get any data from the protein expression quantification and for this reason we were not able to say if the lack of HR depends from a lack of protein expression or from some external factor.However the fact that the T557S autoactive mutant in transcomplementation showed a clear HR response (meaning that the protein was expressed) suggests that most likely the problem resides in some external factors more than a lack of protein expression per se (see “discussion” part).Due to a lack of time we did not proceed with further testing.

37

5.D

iscussion

5.1. Cloning

We choose to use a transient expression system to produce the proteins in planta due to the nature itself of the proteins we wanted to work with. Over-expression of R proteins in stably transformed

38

Figure 4.8: Overview of different conditions tested in the second test of different autoactive mutants for their ability to trigger HR response. Black circles indicate the area of the leaf Agroinfiltrated with WT Mi-1.2 in cTAPi (negative control). Green circles indicate the area of the leaf Agroinfiltrated with H840A Mi-1.2 in cTAPi or WT NT1NT2 in cTAPi + T557S NB-ARC-LRR in cTAPi. Red circles indicate the area of the leaf Agroinfiltrated with TAP-tagged version of different autoactive mutants (except R961D, each mutant tested is indicated above each picture). Blue circles indicate the area of the leaf Agroinfiltrated with untagged version of different autoactive mutants (published).

plants in fact (especially the autoactive mutants) can trigger a non-elicitor based HR response, thus killing the transformant plant itself in its early stages of growth.Using a transient expression system on the other hand we can express the proteins of interest in a specific stage of growth of a plant and harvest them before the triggering of HR.In addition the use of new-generation vectors based on viral replicons allows obtaining a protein yield equal or even higher than the one obtainable with stable expression (16).For these reasons we decided to use the pEAQ-HT vector, an upgraded version of the CPMV-HT created by prof. Sainsbury and prof. Lomonossoff (16).This vector maintains the RNA-1 sequences from the cowpea mosaic virus, while the MCS is inserted in between the 5’ UTR (Un-Translated Region) and 3’ UTR substituting the viral RNA-2. The inserts cloned in between 5’and 3’ UTR mimics the viral RNA-2 and it can be replicated by the viral replication complex encoded by the RNA-1. In this way the desired protein is produced at the same rate as a viral protein would.In addition the vector is equipped with a P19 silencing suppressor (a viral suppressor of a plant anti-viral RNA silencing response) and a deletion of the AUG 161 in the RNA-2 leader (called HyperTransatable leader, HT). The combination of the viral backbone of the vector with those two modifications was shown to enhance the production of the protein of interest up to 20% of the total extractable proteins (16).Another advantage of this vector is its peculiar MCS, which as we showed before allows tagging of the desired protein with C-terminal or N-terminal His-tag. This helps with purification of the desired protein after production, which for us is a key feature since we need as more pure protein as possible for ATP binding and hydrolysis assay.

Along all these advantages however we found also several disadvantages in the use of this vector which contributed to make our cloning process quite difficult.The first one is the very low copy of vector per bacterial cell. Due to its pBR322 origin of replication and its big size (around 10kbp) in fact the vector is maintained from 1 to maximum 5 copies per cell. For this reason the amount of vector DNA available for cloning, after extraction from a regular 5ml E. coli culture, was very low. Due to the high number of inserts we decided to clone at the beginning (see 3.2.2) and the loss of DNA during the purification steps the concentration of vector DNA that was used in each sample during ligation was way below the optimal level.However we could easily overcome this problem by using larger cultures of E. coli (from 200ml up to 1L). Since the second cloning attempt in fact (3.2.3) we used this strategy to obtain enough vector DNA to reach concentrations above 100vg/μl.Another problem related to the use of this vector comes from the structure of its MCS. As we said already on one side the peculiar MCS of this vector allows very versatile tagging of the protein. On the other hand however the restriction sites available on this MCS are very few and the restriction enzymes that recognize them are not optimal. For example 3 out of 6 restriction sites are recognized by blunt-end cleaving restriction enzymes. This type of end requires dephosphorilation to prevent re-closure of the vector during ligation, but this procedure could reduce efficiency of the ligation process itself, thus making these enzymes not very likely to be used. Another example is the XmaI restriction site. The correspondent XmaI (Cfr9I from Fermentas) restriction enzyme requires high concentrations of DNA to work properly (above 50vg/μl). This trait in combination with the very-low-copy origin of replication of the vector itself made us decide to avoid the use of this restriction site in the first cloning attempt (see 3.2.2).A clear effect of the partial inefficiency of some restriction enzymes can be seen in table 3.1 (yellow and purple boxes). In this cloning attempt in fact we used NruI and XmaI restriction enzymes, avoiding dephosphorilation of the vector due to the fact those enzymes produce incompatible sticky ends.

39

As can be seen from the table of transformants the first negative controls (yellow boxes, digested empty vectors without ligase) showed a proper low amount of colonies, indicating that the vector was linearized. The second negative control however (purple boxes, digested empty vector incubated with T4 ligase) showed a very high number of colonies, indicating that the linearized vector could ligate back after incubation with T4 ligase.One of the possible explanation to such high numbers of colonies in the second negative control in fact could be that the vector was digested in only one of the two restriction sites, which was then ligated back after incubation with the T4 ligase (due to the fact we did not dephosphorilate the vector after digestion).

The digestion problems we encountered however were not limited to the vector, but also to our inserts.Our inserts in fact were equipped with restriction sites at their ends through PCR reaction. It is known that digestion of restriction sites placed at the end of PCR products can have very low efficiency, mainly due to the fact that the restriction enzymes itself has some difficulties to stably associate with the restriction site without the presence of additional nucleotides flanking the restriction site sequence.To overcome this problem we designed our primers to add extra nucleotides to the end of the PCR products after the restriction site (the number of additional nucleotides was determined according to the numbers suggested in the EnzymeX software database).However this solution appeared to be not enough, as it can be seen again from table 3.1 (green and orange boxes). Transformants for constructs 2. 5. and 7. showed a higher numbers of colonies in 1:1 (vector:insert) ratio samples than in 1:3 ratio ones.This phenotype is usually caused by the presence of partially digested inserts in the ligation mixture, which ligates only on one side (where the insert is digested) leaving the vector open and thus not producing any visible colonies. The number of colonies in 1:1 ratio samples in fact can be described as the sum of the background colonies containing empty vector ( derived from partially digested vector who ligated back) with the colonies containing the insert (derived from fully digested vector that ligated with the insert). In 1:3 ratio samples on the other hand the higher presence of partially digested insert produces more open vector-insert ligation products which do not produce any colony. Those open ligation products can occur with both partially or fully digested vector, thus reducing the overall numbers of colonies in the plate.The presence of undigested or partially digested inserts in the ligation mixture however is not imputable only to a low efficiency of digestion, but also to our impossibility to distinguish and consequently separate on agarose gel digested inserts from undigested ones.

The use of the pGEM-T easy® strategy (3.2.4) was meant to overcome both the problem of digestion on the end of PCR products and the identification and isolation of digested inserts from undigested ones. The first by ligating the insert in the pGEM-T easy® and thus facilitating the restriction enzyme to associate with its corresponding site. The second by separating the digested inserts from the pGEM-T easy® vector on an agarose gel (fully digested inserts and pGEM-T easy® vector have different sizes).However after we screened the digested pGEM-T easy® vector containing the inserts on agarose gel (figure 3.9) the identification of correctly digested inserts appeared to be not as clear as intended. Due to the fact that no bands corresponding to undigested vector with inserts were detected (all above 4kbp) the digestion was probably successful. On the other hand on the gel were also present unexpected DNA bands from the size of 700bp up to 4kbp (if we exclude a big band of the size of 3kb probably corresponding to the empty pGEM-T easy® vector). Those bands do not correspond to any combinations of vector with multiple inserts or multiple inserts alone.

40

One explanation we could hypothesize is that those bands are result of star activity of the restriction enzymes. However the restriction enzymes we used are not prone to display star activity (according to the producer’s manual), and the reaction conditions (enzyme concentration, incubation time and buffer composition) were preserved according to the Fermentas user manual.Another hypothesis is that our restrictions enzymes were contaminated with different restriction enzymes. However the same stock of restriction enzymes was used in previous and subsequent experiments and no one did show similar results.The last hypothesis is that the DNA samples we used for transformation were contaminated with external DNA, thus being transformed and consequently produced in the bacterial cells along with the pGEM-T easy® vector containing our inserts.Due to this high contamination of additional bands we could not be sure if the bands we isolated (figure 3.9, lower part) were effectively corresponding the digested inserts or were part of the contamination. For example a band corresponding to 2kb was detectable in each sample, even if it should have been present only in samples containing a 2kb insert (NT2-NBARC constructs of Mi-1.2). A band isolated from those samples could have easily been a mixture of digested insert with contaminant DNA.As said before the main purpose of this strategy was to make able to distinguish and isolate digested and undigested inserts to avoid problems during ligation. For these reasons the presence of such high levels of contamination made us decide not to repeat this strategy after the first unsuccessful attempt.

For the last cloning attempt we decided to use a different strategy.To overcome the digestion problems we choose to use a different set of restrictions sites (see 3.2.5) and a higher concentration of restriction enzyme in the digestion buffer.In addition we reduced the number of constructs to be cloned in order to decrease overall cloning difficulty.With this strategy we obtained the best results so far, and we could obtain six positive cloned (see 3.2.5 for details).However after sequencing three out of six clones turned out to contain additional point mutations making them not usable.From the three clones that were tested in planta for protein expression we could not detect any of the proteins of interest (after immunoblotting on the total protein extract of infiltrated leaves). Due to the fact that not even the usual protein background caused by Mi antibody was present on the blot, we are convinced that the absence of protein was caused by some errors made during the protein extraction process. Due to a matter of time however we could not test these clones anymore.In the end we could not isolate any clone able to expressing any of the protein of interest before the end of the internship. This made us unable to perform the planned ATP binding/hydrolysis assay.The last cloning strategy however seemed to be the most effective one, even if we could not produce any positive clone. We are firmly convinced that more attempts with this strategy would have led us (if we had more time) to the achievement of positive clones.

In the same periods in which we finished our practical work prof. Sainsbury and prof. Lomonossoff published the complete series of pEAQ vectors (18). Among them they designed some pEAQ vectors compatible for Gateway® cloning (18). These vectors are strongly recommended in case of a future attempt to clone Mi-1.2 derived constructs, since a successful attempt using the Gateway® technology was already done to clone those proteins (14).

41

It has to be noted that, after comparison of the published sequence of the pEAQ-HT vector (Genbank) with the sequence prof. Sainsbury provided us prior to publication, we found a 4 nucleotide difference around the XhoI restriction site in the MCS. Those nucleotides were present in the sequence we kindly received before publication, but they were not anymore in the published one. This small difference however should have not influenced our current results, because the eventual resulting ORF shift would not modify the frame of the protein. Nevertheless re-sequencing of the vector would be highly recommended in case of future cloning attempts.

5.2. Optimization of Agrobacterium-mediated transient transformation

Using the T557S autoactive mutant of Mi-1.2 (NT1NT2 fragment + mutated NB-ARC fragment, Lukasik unpublished) we could find the optimal conditions for transient transformation.

42

Based on visual comparison of HR development (figure 4.5) the optimal conditions were identified as:

-       growth of N. benthamiana plant at 22.5°C with 60% RH

-       incubation of the plant after Agroinfiltration at 20°C in low illumination

The same optimal conditions were confirmed in a parallel experiment (Gawehns and Hydra unpublished) and used by other researchers in our lab for their own experiments. The growth conditions are similar to the one used in the majority of papers in which Agroinfiltration was performed in N. benthamiana.What is more interesting is the influence that the conditions after infiltration seem to have on protein expression. It was reported that expression of I-2 was below detectable levels when plants were kept after infiltration in the same conditions used for growth (19).  Most papers which analyzed optimization of Agroinfiltration conditions focused mainly on different conditions before infiltration, such as plant growth conditions, composition of Agrobacterium suspension and OD600 of Agrobacterium suspension (20, 21).In our case we found that the only relevant conditions before infiltration were the plant growth conditions (chapter 4.2.1, figures 4.2 and 4.3), while the OD600 of Agrobacterium suspension did not have any considerable effect (figure 4.8, based on visual comparison of HR of the T557S transcomplementing mutant of Mi-1.2). Different compositions of Agrobacterium suspensions were never tested in our experiments. One study about the optimization of Agroinfiltration in Arabidopis mentioned the role of  two different conditions after infiltration, high levels of relative humidity and SD (Short Day) illumination cycle, in increasing protein transient expression (20).another report suggested that low relative humidity and low temperature enhance Agrobacterium-mediated VIGS (Virus-Induced Gene Silencing) in tomato (22).In our case we found that high levels of relative humidity after infiltration lowered the transient protein expression (data not shown). The same findings were confirmed in a parallel experiment made by other researchers of our lab (Gawehns and Hydra unpublished). Those findings are in contrast with Arabidopsis experiment (20) and in line with VIGS results reported in (22). In conclusion humidity level after infiltrations seems to play a role in regulation of protein transient expression. On the other hand we found a similar to Arabidopsis experiment (20) effect of low levels of illumination and similar to VIGS experiment (22) effect of lower temperature on transient protein expression (figure 4.4 and 4.5). However we used an indirect indicator to test the different levels of protein expression, which is visual comparison between HR responses in different conditions. For these reasons we cannot be sure if the seen effect on protein expression influences directly the protein expression itself or eventually the HR development. The results from the analysis of protein expression (figure 4.5, small boxes) seemed to confirm the first hypothesis. As said however those data are not quantitative, not allowing us to make a precise comparison between different levels of protein expression in different conditions. Before choosing to use the T557S autoactive Mi-1.2 mutant in transcomplementation (Lukasik unpublished) we began our experiments with another autoactive mutant of Mi-1.2, H840A FL (14, pG114).This mutant however did non trigger any stronger HR than the negative control (figure 4.3 and 4.4), even if it was reported as one the fastest and more effective in triggering HR (14).

43

After identification of optimal conditions for transient protein expression we decided then to further investigate the possible causes of the inability of the H840A autoactive mutant to trigger HR. To check if the problems found with H840A autoactive mutant were circumscribed to this particular mutant or they could be extended to others, we tested a full set of different autoactive Mi-1.2 mutants who were already published as able to trigger HR (14, see chapter 4.2.4 for the complete list).In all the subsequent experiments none of the autoactive mutants in FL could trigger any HR (figure 4.6 and 4.7), suggesting that the problem was not limited to the H840A construct we used in the first experiments.To test if the constructs we used in those experiments were containing the proper autoactive mutation we sequenced a 500 nucleotides sequence around the position of the mutation of each mutant.The sequencing did not give any result in most cases, but we could obtain the sequence for the D630E mutant, which contained its correct D630E point mutation. This result excluded the hypothesis of non-functional autoactive mutant in the case of D630E, but it did not exclude the possibility of additional point mutations in the rest of the mutant sequence. During each experiment we performed a parallel analysis of protein expression, to test if the lack of HR could have been caused by an effective lack of protein in the leaves. In some experiments we could not detect any protein expression (rather due to technical problems during protein extraction and processing), while in others we could (data not shown). Due to the fact that in both kinds of experiments no HR was detectable we excluded the hypothesis that the mutants’ inability to trigger HR was caused by a lack of protein expression.In the last experiment we also excluded the possibility that high OD600 of Agrobacterium suspension or the presence or absence of the TAP tag on our constructs (see “Atta” part for details) could negatively influence the developing of HR (figure 4.7). We hypothesized also that the problem could reside in low physiological conditions of the plants used in the experiments, resulting in plants inability to trigger HR.The supposed low physiological conditions however could not be due to the general growth and post-infiltration conditions we used in the experiments (the same found during the optimization process). The transcomplementing T557S autoactive mutant and different R proteins (tested by other researchers in our lab under the same conditions) were in fact giving a clear HR, meaning that the overall plants physiological conditions are good enough to trigger HR.From the last experiment (chapter 4.2.5) we could also exclude the possibility that low physiological conditions were restricted to individual plants (in our case the one we infiltrated with the FL autoactive mutants) independently from the general growth and post infiltration conditions. The same leaf of a plant in fact was infiltrated with both transcomplementing T557S (as a positive control) and one of the autoactive mutants (figure 4.8). The fact that transcomplementing T557S autoactive mutant was showing HR indicates that the plant physiological conditions were good enough to trigger HR, and that the cause of this lack of HR probably resides in a problem with the mutants themselves. Based on these apparently controversial findings we came up with another hypothesis in which both the overall experimental conditions and the autoactive mutants themselves are involved.In particular we assume that the conditions for transient expression we found (both growth and post-infiltration conditions) are still sub-optimal to work with autoactive Mi-1.2 mutants, meaning that even if the protein are expressed they are not able to trigger HR. The different Mi-1.2 autoactive mutants were classified based on their speed to trigger HR: mutants in the MHD motif (H840A and D841V) triggered HR 3 days after infiltration, while mutants in the P-loop and Walker B motifs (T557A and D630E respectively) triggered HR 5 days after infiltration

44

(14). The T557S autoactive mutants in transcomplementation (Lukasik unpublished) used in our experiments was on the other hand the “fastest” autoactive Mi-1.2 mutant reported so far. In fact the beginning of HR response was already visible 36hrs after infiltration and fully developed HR was visible 2 days after infiltration.It was already shown that transcomplementation of CC-NBARC fragment with LRR fragment of T557S (P-loop motif) and D630E (Walker B) mutants increased the speed of HR development (from 5 to 3 days) that was explained by overexpression of the fragments (14). However when the same mutants were tested with different transcomplementing fragments (NT1NT2 with NBARC-LRR) under the same conditions we used for our experiments, only T557S showed a clear HR, while D630E did not trigger any HR at all (Lukasik unpublished), indicating that probably the transcomplementation itself or connected with the overexpression of separate domains is not a possible cause of this mutant fast HR response. We hypothesize that due to its increased speed the T557S autoactive mutant in transcomplementation can trigger HR even if the general conditions appears to be sub-optimal for other autoactive mutants in FL. From this point of view then the conditions we found during the optimization process seems to be sub-optimal for the majority of autoactive Mi-1.2 mutants.On the other hand those conditions appeared to be optimal when working with elicitor-triggered HR by R proteins (Ghawens and Hydra, unpublished). To check proposed hypothesis first another round of sequencing of used construct should be done. Then an experiment with combined infiltrations using different R proteins in their autoactive form versus the elicitor-triggered WT will give more information about a possible role of plant conditions. In particular we suggest infiltrating the same leaf with autoactive mutants of different R proteins (like I-2) versus the elicitor trigger WT of the same protein, and also T557S transcomplementation mutant of Mi-1.2 versus the different autoactive Mi-1.2 mutants.

45

6. Materials and methods

6.1. PCRs

List of different PCR conditions:

46

PCR(3.2.2, 3.2.3 and 3.2.4)

Col-PCR(3.2.2, 3.2.4 and 3.4.5)

Touchdown PCR(3.2.5)

Temperature Time Cycles95C 5

min95C 30

sec

10X50C 30

sec72C 10

min95C 30

sec

10X47C 30

sec72C 10

min95C 30

sec

10X44C 30

sec72C 10

min95C 30

sec

10X40C 30

sec72C 10

min72C 10

min

Temperature Time Cycles95C 5

min95C 30

sec

30X50C 30

sec72C 1

min 72C 5

min

Temperature Time Cycles92C 5

min92C 30

sec 10X (-1

degree every cycle)

52-42C 30 sec

72C 5 min

92C 30 sec

20X50C 30

sec72C 5

min

Pfu polymerase Taq polymerase 18:1 Taq:Pfu polymerase

List of primers used in PCR reaction (chapters 3.2.2, 3.2.3 and 3.2.4):

- Constructs 1. (WT FL Mi-1,2); 4. (KT556/557AA FL Mi-1.2) and 6. (D630E FL Mi-1.2): FP 2299 (forward) and FP 2303(reverse)

- Constructs 2. (WT NT2-NBARC Mi-1.2); 5. (KT556/557AA NT2-NBARC Mi-1.2) and 7. (D630E NT2-NBARC Mi-1.2): FP 2300 (forward) and FP 2304 (reverse)

47

- Construct 3. (WT NB-ARC Mi-1.2): FP 2301 (forward) and FP 2304 (reverse)- Construct 8 (WT FL I-2): FP 2302 (forward) and FP 2305 (reverse)

List of primers used in touchdown PCR reaction (chapter 3.2.5):

- Construct A (WT NT2-NBARC-LRR Mi-1.2); B (KT556/557AA NT2-NBARC-LRR Mi-1.2) and C (D630E NT2-NBARC-LRR Mi-1.2): FP 2425 (forward) and FP 2428 (reverse)

- Construct D (FL WT I-2): FP 2427 (forward) and FP 2431 (reverse)

List of primers used in the Colony-PCR (chapter 3.2.2) by constructs:

- Constructs 1. (WT FL Mi-1,2); 4. (KT556/557AA FL Mi-1.2) and 6. (D630E FL Mi-1.2):FP 760 (forward) and FP 9 (reverse)

- Constructs 2. (WT NT2-NBARC Mi-1.2); 3. (WT NB-ARC Mi-1.2); 5. (KT556/557AA NT2-NBARC Mi-1.2) and 7. (D630E NT2-NBARC Mi-1.2): FP 862 (forward) and FP 9 (reverse)

- Construct 8. (WT FL I-2): FP 496 (forward) and FP 9 (reverse)

List of primers used in the Colony-PCR (chapter 3.2.4):

- Constructs 2. (WT NT2-NBARC Mi-1.2); 3. (WT NB-ARC Mi-1.2); 5. (KT556/557AA NT2-NBARC Mi-1.2); 6. (D630E FL Mi-1.2) and 7. (D630E NT2-NBARC Mi-1.2): FP 2301 (reverse) FP 429 (reverse)

List of primers used in Colony-PCR (chapter 3.2.5):

- Construct A (WT NT2-NBARC-LRR Mi-1.2); B (KT556/557AA NT2-NBARC-LRR Mi-1.2) and C (D630E NT2-NBARC-LRR Mi-1.2): FP 2431 (forward) and FP 2432 (reverse)

- Construct D (FL WT I-2): FP 939 (forward) and FP 987 (reverse)

For the sequences of the primers see “Appendix 1”

Purification of PCR products were performed either with QIAquick® PCR Purification kit or via separation on agarose gel (1% agarose, 0.005% ethidium bromide). After running in agarose gel the correct PCR products were isolated and purified from the gel itself (see below)

6.2. Cloning

Digestion:

The restriction enzymes chosen for digestion were described in the text. All enzymes were purchased form Fermentas.

48

The parameters of the reaction (restriction enzyme concentration, buffer type and concentration, DNA concentration) were maintained as suggested in the protocol explained in the Fermentas Protocols Application Guide.The reactions were incubated for two hours or O/N at the optimal temperature suggested in the protocol.The efficiency of digestion reactions was checked on agarose gels (1% agarose, 0.005% ethidium bromide).In case all the digestion products were loaded on gel, the desired piece of DNA was then isolated and purified from the gel (see below).

DNA isolation and purification from agarose gel:

Isolation and purification of digested DNA or PCR products from agarose gel was performed using the QIAquick® Gel Extraction Kit from Qiagen. All reactions were made according to the QIAquick Gel Extraction Handbook.The DNA was eluted from the columns with TE buffer instead of normal EB buffer present in the kit.

Ligation:

All ligation reactions were done using 1U of Fermentas T4 Ligase. The buffer concentration in the total volume of the ligation reaction was determined according to the protocol found in the Fermentas Protocol Application Guide.The ratios of vector:inserts were either 1:1 or 1:3 (as specified in the text). The reactions were incubated at room temperature (approximately 21C) for 2 hours or O/N.

Ligation in pGEM-T Easy® (Promega):

Inserts used in chapter 3.2.4, after amplification via PCR (see above), were subjected to A-tailing procedure as explained in the Promega pGEM-T easy® technical manual.A-tailed inserts were then ligated into the pGEM-T easy® vector with standard ligation procedure using the vector’s 3’ T overhang. The ligated vectors with inserts were then transformed into E. coli (see below).Transformants were plated on selective medium (LB agar with ampicillin 100g/ml, IPTG20g/ml and X-Gal40g/ml) and incubated O/N at 37C.The correct transformants were selected through blue/white selection.

Transformation of E. coli and plating:

Ligation products were transformed in DH5 E. coli competent cells via heat-shock.5l of ligation products were mixed with 100l of bacteria (OD600 1) and incubated for 1 hour at 4C. The bacteria were then heat-shocked for 1 min at 42C and cooled down in ice for an additional minute. Heat-shocked bacteria were then recovered with 1ml of liquid SOC or LB medium and incubated at 37C for 1 hour.Recovered bacteria were spinned down in a tabletop microcentrifuge (2 minutes at 5000rpm) and plated on selective medium (LB agar with 50g/ml of Kanamycin or 100g/ml of Spectinomycin).After plating bacteria were incubated o/n at 37C.

Transformation of A. tumefaciens and plating:

49

All vectors from cloning of from the vector database were transformed in GV3101 electrocompetent A. tumefaciens cells via electroporation.The mixture of bacterial cells and vectors was then transferred into an electric cuvette and electroporated (0.9ms pulse at 1.25V, 200 resistance, 25FD capacitance).Electroporated bacteria were rescued with 1ml SOC or LBtum liquid medium and incubated at 28C for 2 hours.Recovered bacteria were spinned down in a tabletop microcentrifuge (2 minutes at 5000rpm) and plated on selective medium (LBtum agar with 20g/ml of Rifampicin and 50g/ml of Kanamycin or 20g/ml of Rifampicin and 100g/ml of Spectinomycin).After plating bacteria were incubated at 28C for 2 days.

6.3. Sequencing

Sequencing was performed using the dye-terminator method.Data were analyzed using 4Peaks® and SeqMan® softwares.For a list and a map of primers used to analyze clones containing Mi-based inserts see “Appendix 2

6.4. Plant material

All Nicotiana benthamiana plants were grown at 22.5 with 60% relative humidity (“Nicotiana” compartment) if not indicated differently in the text.All plants were grown for 4 weeks before use.Other changes in standard growing conditions are listed in the text.

6.5. Agroinfiltration

Preparation of Agrobacterium cultures for infiltration:

The clones transformed with respective vectors for Agroinfiltration were inoculated in a starter 3ml culture of selective liquid medium (LBtum with 20g/ml of Rifampicin and 50g/ml of Kanamycin or 20g/ml of Rifampicin and 100g/ml of Spectinomycin) and incubated O/N at 28C.After incubation the starter cultures were used to inoculate bigger 25ml cultures of liquid selective medium. The OD600 of the starter 3ml cultures was measured with a spectrophotometer before inoculation and compared to a standard growth curve. The data obtained was used to calculate the amount of starter culture to be inoculated in the 50ml cultures to obtain a desired OD600 after 16hrs of growth.After inoculation the 50ml cultures were incubated at 28C for 16hrs until they reached OD600 1. The OD600 of the 25ml cultures was monitored the morning after inoculation with a spectrophotometer.After reaching the optimal OD600 the cultures were spinned down for 20 minutes at 4000rpm and resuspended with MMA (0.5% MS salts, 10mM MES pH 5.6, 2% sucrose, 200M Acetosyringone) to the optimal concentration of 0.5-0.8 OD600.Cultures suspended in MMA were incubated at room temperature (21C) for 2 hours before infiltration.Infiltration:

Infiltrations were performed with a needless syringe on the lower side of the 4th, 5th and 6th leaves of N. benthamiana plants using Agrobacterium suspensions prepared as explained before.A needle was used to make a hole in the leaf tissue; the tip of the loaded syringe was pressed in correspondence of the hole on the lower surface of the leaf, while a finger was gently pressed on the

50

upper surface to counterbalance the pressure and avoid spilling of the suspension. A low pressure on the syringe then was used to inject the Agrobacterium suspension in the aerial spaces of the leaf.

6.6. Protein extraction

Leaves from plants agroinfiltated for protein expression (see text) were cut off the plant and snap-frozen by immersion in liquid nitrogen.Leaves tissue was subsequently pre-grinded in liquid nitrogen and then grinded again in ice-cold protein extraction buffer (25mM Tris pH 8, 1mM EDTA, 150mM NaCl, 5mM DTT, 0.1% NP40, protease inhibitors, 2% PVPP). The grinded products were then spinned for 20min at 13.5krpm (at 4C). After spinning, the supernatant was filtered with Miracloth.If not used immediately for subsequent analysis the samples were stored at -80C.

6.7. Western blot

Protein electrophoresis:

The protein sample were mixed with 3x protein loading buffer (150nM Tris-HCl pH 6.8, 300mM DTT, 6% SDS, 0.3% Bromophenol blue, 30% glycerol) and denatured at 99C for 3 minutes before loading.Denaturated samples were loaded on poli-acrylamide gel (8% acrylamide in separating gel, 4% acrylamide in stacking gel) and separated via electrophoresis (45 min, 600V, 200mA, 100W).

Protein blotting:

The proteins were transferred from the acrylamide gel to Immobilontm PVDF membrane via electroblotting. Before blotting the membrane was pre-moisted with methanol, while both the membrane and the gel were covered on upper and lower side with Whatman® filter paper moisted with semidry blotting buffer (50mM TRIS, 40mM Glycine, 20% MetOH, 0.037% SDS).The transfer stack was blotted from 30 to 45 min (180V, 400mA, 100W).

Protein detection:

After blotting the membrane was blocked with 15ml of wash buffer (1x PBS, 0.1% Tween 20) with 5% powder milk for one hour.After blocking, the membrane was incubated with primary and secondary antibody (one hour each) on a rotor. After each incubation the membrane was washed with wash buffer (1x PBS, 0.1% Tween 20) 3 times (5 minutes each).For detection the membrane was treated with 1.25ml of GE Healthcare ECL Plus chemoluminescent solution.The chemoluminescence from the proteins was detected using a Kodak photographic film.

6.8. Trypan blue staining

Immediately after removal from the plant leaves were boiled in a mixture of 1:1 96% ethanol and trypan blue (0.33mg/ml) in lactophenol for 5-10 minutes.After boiling leaves were de-stained in 5ml of de-staining solution (2.5g/ml chloral hydrate in water) on a rotor O/N.

51

De-stained leaves were then deployed on a square plate and images were taken with a computer scanner.

Appendix 1. Sequences of primers used for PCR reactions:

Primer name Primer sequenceFP 9 GATAATCATCGCAAGACCGGCFP 429 CAACTTTCATCTGGTCTTAG

52

FP 496 ATCTCTCAAGGGACTGCGTFP 760 CGCGGATCCTTGGATTGCCTAACTGAACFP 862 TTGGATGAGTTGACAAGACCFP 939 GAGGGCCCTATCATTCTCTCFP 987 GCCATTGCTTCCACTCCGTCFP 2299 GGTCGCGAACCATGGAAAAACGAAAAGATATTFP 2300 GGTCGCGAACCATGGGGTTGATACTGAATGGTTGCFP 2301 GGTCGCGAACCATGGAGAGAAAGTCATTGACAACTGFP 2302 GGTCGCGAACCATGGAGATTGGCTTAGCAGFP 2303 CTCCCGGGCTTAAATAAGGGGATATTCFP 2304 CTCCCGGGAGAATGCCTTTTCTTATTTGFP 2305 CGCTCGAGTTAAATATATTTCCAATCGFP 2425 TTACCCGGGACCATGGGGTTGATACTGAATGGTTGCFP 2427 TATCCCGGGACCATGGAGATTGGCTTAGCAGFP 2428 AACCCCGGGGTCGACCTTAAATAAGGGGATATTCFP 2431 GCGCCCGGGGTCGAGTTAAATATATTTCCAATCGFP 2432 TCCGTCTTTTCCACAAATCC

Appendix 2. List, sequence and map of primers used for sequencing:

Primer name Primer sequenceCAA CTT TCA TCT GGT CTT AGCGGCATACCGGTGATCGAAAT

53

CGCGGATCCAGGCATTCTGGTAAACACCGCGGATCCTTGGATTGCCTAACTGAACCGGCATACCGGTGATCGAAATTTGGATGAGTTGACAAGACCGGGTGCTGAAGGATTTGTGAAAAAGCAGGCTCTATGGGGTTGATACTGAATGGTTGCAGAAAGCTGGGTTTTAATGGAAATCTCTTATGTTGCCACA

Figure 6.1: Map of the annealing positions of primers used for sequencing on the Mi-1.2 sequence.

7. References:

1. Jones JDC, Dangl JL: The plant immune system. Nature 2006, 444:323-329

54

2. Jones S: Plant pathogens: Coordinated defence. Nature Reviews Microbiology 2005, 3:584

3. Hammond-Kosack K and Jones JDG 2000. "Responses to plant pathogens." In: Buchanan, Gruissem and Jones, eds. Biochemistry and Molecular Biology of Plants

4. Flor HH: Current status of the Gene-for-Gene concept. Annu. Rev. Phytopatol. 1971, 9:275-296

5. Martin GB, Bogdanove AJ, Sessa G: Understanding the function of plant disease resistance proteins. Annu Rev Plant Biol 2003; 54: 23-61

6. van Ooijen G, van der Burg HA, Cornelissen BJ, Takken FLW: Structure and function of resistance proteins in solanaceous plants. Annu Rev Phytopathol 2007; 45:43-72

7. Tameling WIL, Takken FLW: Resistance proteins: scouts of the plant innate immune system. Euro J Plant Pathol 2008; 121:243-245

8. Leipe DD, Koonin EV, Aravindl: Evolution and classification of P-loop kinases and related proteins. J Mol Biol 2003; 333:781-815

9. Lukasik E, Takken FLW: STANDing strong, resistance proteins instigators of plant defence. Curr. Opin. Plant. Biol. 2009; 12:427-436

10. Milligan SB, Bodeau J, Yaghoobi J, Kaloshian I, Zabel P, Williamson VM: The root knot nematode resistance gene Mi from tomato is a member of the leucine zipper, nucleotide binding, leucine-rich repeat family of plant genes. Plant Cell 1998; 10:1307-1319

11. Mucyn TS, Clemente A, Andriotis VME, Balmuth AL, Oldroyd GED, et al.: The tomato NBARC-LRR protein Prf interacts with Pto kinase in vivo to regulate specific plant immunity. Plant Cell 2006; 18:2792–80

12. Tameling WIL, Elzinga SDJ, Darmin PS, Vossen JH, Takken FLW, Haring MA, Cornelissen BJC: The tomato R gene products I-2 and Mi-1 are functional ATP binding protein with ATPase activity. Plant Cell 2002; 14:2929-2939

13. Kim HE, Du F, Fang M, Wang X: Formation of apoptosome is initiated by cytochrome c-induced dATP hydrolysis and subsequent nucleotide exchange on Apaf-1. Proc Natl Acad Sci U S A 2005; 6:17545-17550

14. van Ooijen G, Mayr G, Albrecht M, Cornelissen BJC, Takken FLW: Transcomplementation, but not physical association of the CC-NB-ARC and LRR domains of tomato R protein Mi-1.2 is altered by mutations in the ARC2 subdomain. Mol Plant 2008; 1:401-410

15. Tameling V, Vossen JH, Albrecht M, Lengauer T, Berden JA, Haring MA, Cornelissen BJC, Takken FLW: Mutations in the NB-ARC Domain of I-2 That Impair ATP Hydrolysis Cause Autoactivation. Plant Physiol. 2006; 140:1233-1245

55

16. Sainsbury F, Lomonossoff GP: Extremely high-level and rapid transient protein production in plants without the use of viral replication. Plant Physiol. 2008; 148:1212-1218

17. Gleba Y, Marillonnet S, Klimyuk V: Engineering viral expression vectors for plants: the 'full virus' and the 'deconstructed virus' strategies. Curr Opin Plant Biol. 2004; 7:182-188

18. Sainsbury F, Thuenemann EC, Lomonossoff GP: pEAQ: versatile expression vectors for easy and quick transient expression of heterologous proteins in plants. Plant Biotechnol J 2009; 7:682-693

19. van Ooijen G, Mayr G, Kasiem MMA, Albrecht M, Cornelissen BJC and Takken FLW: Structure-function analysis of the NB-ARC domain of plant disease resistance proteins. J Exp Bot 2008; 59:1383-1397

20. Wroblewski T, Tomczak A and Michelmore R: Optimization of Agrobacterium-mediated transient assays of gene expression in lettuce, tomato and Arabidopsis. Plant Biotechnol J 2005; 3:259-273

21. Kim MJ, Baek K, and Park CM: Optimization of conditions for transient Agrobacterium-mediated gene expression assays in Arabidopsis. Plant Cell Rep 2009; 28:1159-1167

22. Fu DQ, Zhu BZ, Zhu HL, Zhang HX, Xie YH, Jiang WB, Zhao XD and Luo KB: Enhancement of virus-induced gene silencing in tomato by low temperature and low humidity. Mol Cells 2006; 21:153-160

Fin

56