rep-2, a rab escort protein encoded by the choroideremia-like gene

Tm JOURNAL OF BIOLOQICAL CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc

Vol. 269, No. 3, Issue of January 21, pp. 2111-2117, 1994 Printed in U.S.A.

REP-2, a Rab Escort Protein Encoded by the Choroideremia-like Gene*

(Received for publication, August 27, 1993)

Frans P. M. Creme&, Scott A. Armstrongl, Miguel C. Seabran, Michael S. Brown, and Joseph L. Goldsteinll From the Department of Molecular Genetics, University of lkxas Southwestern Medical Center at Dallas, Dallas, lkxas 75235-9046

Rab escort proteins (REPS) bind to newly synthesized Rab proteins and remain bound during and after the attachment of a geranylgeranyl (GG) group by the catalytic component of the Rab GG transferase. Transfer of the GG group is absolutely dependent on the participa- tion of a REP. REP-1, the first characterized REP, is produced by a gene on the X chromosome that is defective in patients with choroideremia, a form of retinal degeneration. Cremers et al. (Cremers, E P. M., Molloy, C. M., van de Pol, D. J. R.., van den Hurk, J. A. J. M., Bach, I., Geurts van Kessel, A. H. M., and Ropers, H.-H. (1992) Hum. Mol. Genet. 1,71-75) isolated a related gene designated choroideremia-like, which encodes a protein that closely resembles REP-1. In the current studies, we produced REP-1 and REP-2 by recombinant DNA methods and showed that both proteins were approximately equal in facilitating the attachment of GG groups to several Rab proteins, including RablA, Rab5A, and Ram. However, REP-2 was only 25% as active as REP-1 in supporting GG attachment to Rab3A and Rab3D. The low activity toward Rab3A was increased to that of RablA when the COOH-terminal12 amino acids of Rab3A were replaced with the corresponding residues of RablA. We suggest that REP-2 substitutes for the absent function of REP-1 in nonretinal cells of patients with choroideremia, thus preventing cellular dysfunction throughout the body. In the retina, REP9 may be only partially effective, leading eventually to retinal degeneration and blindness.

Rab proteins are low molecular weight GTP-binding proteins that adhere to the cytoplasmic surfaces of cell membranes by virtue of covalently attached 20-carbon isoprenes called geranylgeranyl (GG)’ (1-3). The GG groups are attached to cysteines

* This work was supported by the National Institutes of Health Grant HL20948 and by a research grant from the Perot Family Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

.$ Recipient of a sabbatical fellowship from the Royal Netherlands Academy ofArts and Sciences. Present address is at the Department of Human Genetics, University Hospital Nijmegen, P. 0. Box 9101, 6500 HB Nijmegen, The Netherlands.

11 Recipient of a Fulbright Scholarship. 8 Supported by Medical Scientists naining Grant GM08014.

Genetics, University of Texas Southwestern Medical Center at Dallas, 11 To whom correspondence should be addressed Dept. of Molecular

5323 Harry Hines Blvd., Dallas, TX 752359046, Tel.: 214-648-2141;

emia; CHML, choroideremia-like; GGPP, geranylgeranyl pyrophos- The abbreviations used are: GG, geranylgeranyl; CHM, choroider-

phate; GGTase, geranylgeranyl transferase; REP-1 and REP-2, Rab escort proteins 1 and 2; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; kb, kilobase.

F~:214-648-8804.

at the COOH termini of the Rab proteins by an enzyme, Rab GG transferase (Rab GGTase, also called GGTase 111, which uses GG pyrophosphate (GGPP) as a donor (4,5). The catalytic component of the enzyme consists of tightly associated a and p subunits with molecular weights of approximately 60,000 and 38,000, respectively (4-6). This catalytic component (previously designated component B and now- called Rab GGTase) is only poorly active, however, unless an additional 95-kDa protein (previously designated component A and now called Rab escort protein-1 (REP-1)) is present (4, 5, 7). REP-1 binds to the Rab protein and presents it to the catalytic component, thereby facilitating the transfer of the GG group (7). REP-1 remains associated with the Rab protein aRer geranylgeranylation, and it can only be released in vitro by addition of detergents (7). In vivo, REP-1 is suspected to deliver the geranylgeranylated Rab to some protein acceptor that is responsible for its insertion into a cellular membrane (7).

More than 20 different Rab proteins have been identified, each of which has a characteristic distribution on cellular membranes (2,3,8). For example, RablA is found predominantly in the endoplasmic reticulum, whereas Rab3A is a component of neuronal synaptic vesicles. In several instances Rab proteins have been demonstrated to be required for the specific fusion of one type of vesicle with another. Thus, mutations in SEC4 and YPT1, two yeast Rab proteins, block fusion of exocytotic vesicles with plasma membranes and endoplasmic reticulum vesicles with Golgi membranes, respectively (9). Rab5A is required for the fusion of plasma membranes and early endo- somes (lo), and Rab6 is implicated in vesicular transport between Golgi cisternae (11).

cDNA cloning of REP-1 from the rat revealed that it was the counterpart of the human protein encoded by the choroideremia (CHM) gene (5, 7). This gene was identified by positional cloning as the site of mutation in patients with choroideremia, an X-linked form of late-onset retinal degeneration (12, 13). In confirmation of this hypothesis, lymphoblasts from CHM patients were shown to have a functional deficiency in Rab GGTase activity that was reversed in vitro by the addition of purified REP-1, but not by Rab GGTase, the catalytic component of the enzyme (14).

The attribution of choroideremia to a deficiency of REP-1 immediately raised several questions. First, how can we account for the specificity of the disease state? Rab proteins are present in all cells, and geranylgeranylation is absolutely required for Rab function. Yet, in individuals who inherit dele- tions encompassing the entire CHM gene, the sole functional consequence seems to be a progressive degeneration of the retina and choroid. Second, how can we account for the incom- plete loss of Rab GGTase activity in lymphoblasts from patients with mutations that abolish the CHM gene? These mutant cells attached GG to Rab3A at rates that were 20-25% of normal. The rate with RablA was 75% of normal (14).

2111

2112 Rab Escort Proteins

These considerations raised the possibility of a second REP protein (here designated REP-2) that compensates for a deficiency of the initially cloned REP-1 protein, in tissues other than the retina and perhaps partially in the retina as well. This theory is supported by the identification by Cremers et al. (15) of a second gene related to CHM, which was designated "choroideremia-like" (CHML). The CHML gene, located on human chromosome 1, encodes a protein of 656 amino acids. Residues 16-656 are 71% identical to the corresponding residues in the CHM gene product (REP-1).2 Like CHM, the CHML protein shows scattered areas of sequence identity with Rab GDI (7, 151, another known Rab binding protein (3, 16).

In the current studies we demonstrate that the CHML gene product (here called REP-2) can substitute for REP-1 in supporting the Rab GGTase reaction, but its substrate specificity differs from that of REP-1. Although both proteins are roughly equivalent in supporting the prenylation of RablA, Rab5A, and Rab6, REP-1 is more effective than REP-2 with respect to the Rab3 family. These findings support the hypothesis that REP-2 substitutes for most functions of REP-1 when the REP-1 gene is defective in CHM.

EXPERIMENTAL PROCEDURES General Procedures-Standard molecular biology techniques were

used (17). Sequencing reactions were performed on an Applied Biosys- tems model 373A DNA sequenator. REP-1 and Rab GGTase were purified from rat brain as previously described (4,5). The protein content of samples was determined by the method of Bradford (18) or estimated by Coomassie Blue staining and densitometric scanning of a 12.5% SDS- polyacrylamide gel in which known amounts (0.5-2 pg) of standard proteins were used as a reference (4, 5).

Assay for Rub GG lkansferase Actiuity-Rab GGTase activity was determined by measuring the amount of [SHlgeranylgeranyl transferred from [3Hlgeranylgeranyl pyrophosphate (L3H1GGPP, American Radiochemical Co.) to Rab proteins (4, 14). Unless otherwise indicated, the standard reaction mixture contained the following concentrations of components in a final volume of 50 pl: 50 IIIM HepedNa (pH 7.2), 5 m~ MgCl,, 1 IIIM Nonidet P-40, 1 m~ dithiothreitol, 0.5 1.1~ PHIGGPP (33,000 dpdpmol), and the indicated amounts of Rab protein, REP-1 or REP-2, and Rab GGTase. After incubation for the indicated time at 37 "C, the amount of ethanoVHC1-precipitable radioactivity (19) was measured by filtration on a glass fiber filter (14). Recombinant histidine-tagged Rab proteins, recombinant histidine-tagged REP-1 and REP-2, and recombinant Rab GGTase were used in all experiments except where indicated in Figs. 1-3.

Recombinant Wild-type Rub Proteins-pET3a plasmids containing canine RablA, human Rab3A, human Rab5A, and human Rab6 (20,21) were kindly provided by Channing Der (University of North Carolina, Chapel Hill, NC). Bovine Rab3B (22) in pCMv, and murine Rab3D (23) in pRSET-C were kindly provided by Thomas Siidhof (University of Texas Southwestern Medical Center, Dallas, TX) and Philipp Scherer and Harvey Lodish (Whitehead Institute, Cambridge, MA), respectively. Fusion proteins containing six histidine residues at the NH2 terminus of each of the Rab proteins (His-tagged Rabs) were prepared as follows. NdeI-BamHI fragments from each of the pET3a-Rab constructs were introduced into the expression vector pETl4b (Novagen) and transformed into BL21 (DE3) Escherichia coli cells. One ng of the original pCMV-Rab3B clone was amplified by PCR according to the manufacturer's instructions using Pfu polymerase (Stratagene) with the 5' oligonucleotide GAGTGGCATATGGC'ITCAGTGACCGATGGT and the 3' oligonucleotide GCCATCGGATCCCTAGCACGAGCAGCITC- TGCTG. The PCR products were cut with NdeI and BamHI, gel purified, introduced into the vector pET14b, and transformed into BL21 (DE3) E. coli cells. pRSET-C-Rab3D containing six histidine codons at the NH, terminus of Rab3D was transformed into BL21 (DE3) E. coli cells.

E. coli cells containing the histidine-tagged Rab constructs were grown and lysed as recommended by the manufacturer. The supernatant from a 30,000 x g spin (1 h at 4 "C) was subjected to Ni2+-Sepharose affinity chromatography under the conditions recommended by the manufacturer (Novagen). The column was eluted with a 0.1 to 0.4 M imidazole gradient in buffer containing 20 lll~ Tris-HC1 (pH 7.9), 0.5 M

H. v. Bokhoven and F. P. M. Cremers, unpublished observations.

TABLE I DNA sequences of 3' oligonucleotides used for producing mutant

RablA and Rab3Aprotein.s The details of the PCRs used for producing the COOH-teminal mu-

tants of canine RablA and human Rab3A are described under "Experi- mental Procedures." The COOH-terminal wild-type amino acid sequences for RablA and Rab3A are RablA-TPVKQSGGGCC and Rab3A- DQQVPPHQDCAC, respectively.

COOH-terminal amino acid sequence of

mutant Rab protein DNA sequence of 3'

oligonucleotide

RablA-CAC AGTCGAATTCAAGCTTAGCAGGCG

RablA-DQQVPPHQ GCCATCGGATCCCTAGCAGGCG CAACCTCCACCTGACTGCTTGACC

.. DCAC

GTCGCTCTGAATTTTCACATTGGACTT CAGTCCTGGTGCGGTGGCACCTGCTG

Rab3A-CC GCCATCGGATCCCTAGCAGCAGTCCTG GTGCGGTGGCACCTG

Rab3A-TPVKQSGG GCCATCGGATCCCTAGCAGCAACCTC GCC CACCTGACTGCTTGACCGGAGTACT

GAGCTGTGGGCCCTGCTT ~

NaCI, and 1 m~ p-mercaptoethanol. The His-tagged RablA, RabsD, Rab5A, and Rab6 (>95% pure as judged by SDS-PAGE) were each dialyzed against buffer A (20 m~ Tris-HC1 (pH 7.5), 100 m~ NaCl, 3 m~ MgCI,, 1 m~ EDTA, 1 m~ dithiothreitol, and 0.1 IIIM GDP). After dialy- sis, the proteins were stored in multiple aliquots at -70 "C. The His- tagged Rab3A and Rab3B were dialyzed against two changes of buffer B (20 n" bis-Tris-HC1 at pH 6.4, 3 m~ MgC12, 1 m~ EDTA, and 1 IXIM

dithiothreitol), after which they were loaded onto a Mono Q HR5/5 column (Pharmacia LKB Biotechnology Inc.) that was equilibrated in buffer B. The column (bed volume, 1 ml) was washed with 20 ml of buffer B at a flow rate of 1 d m i n . Rab3A and Rab3B were each eluted (2 mufraction) with a 50-ml gradient of 0 to 0.2 M NaCl in buffer B. Aliquots of fractions were subjected to electrophoresis (30 mA, 45 min, 24 "C) on a 12.5% SDS-polyacrylamide minigel and stained with Coo- massie Blue. Fractions containing Rab3A or Rab3B protein of the expected size were pooled and dialyzed against buffer A.

COOH-terminal Mutants of RablA and Rab3A-Mutations in the COOH-terminal sequences of canine RablA and human Rab3A were introduced by PCR of 1 ng of DNA from the original pET3a-RablA and pET3a-Rab3A clones, respectively. To change wild-type RablA COOH- terminal 11 amino acids (TPVKQSGGGCC) to DQQVPPHQDCAC, we used a 5' oligonucleotide (containing the ATG codon) whose sequence was TACTAGCATATGTCCAGCATGAATCCCGAATAT. To change wild- type RablA COOH-terminal 2 amino acids (CC) to CAC, we used a 5' oligonucleotide whose sequence was CACAACAGCAAAGGAATIT- GCGG (RablA nucleotides 408430). To change wild-type Rab3A COOH-terminal12 amino acids (DQQVPPHQDCAC) and 3 amino acids (CAC) to TPVKQSGGGCC and CC, respectively, we used the 5' oligonucleotide GAGTGGCATATGGCATCGGCCACAGACTCG. The 3' oligonucleotides used for these PCRs are listed in Table I. The conditions for PCR were similar to those described below for generation of pVL-REP1 and pVL-REP2. The PCR products were cut with NdeI and BamHI, gel purified, and introduced into the NdeI and BamHI sites of pET14b (Novagen) except for the RablA-CAC PCR product, which was cut with EcoRI and cloned into pET14b-RablAusing EcoRI sites (5). The RablA and Rab3A mutant proteins were expressed in BL21 (DE3) E. coli cells and purified as described above for the histidine-tagged wild-type RablA and Rab3A proteins, respectively. The COOH-terminal amino acid sequences of all mutant Rab proteins were verified by DNA sequencing of the mutant plasmids.

Production of Recombinant REP-1 and REP-2 in Sf9 Cells-Fusion proteins containing six histidine residues at the COOH terminus of REP-1 or REP-2 were prepared as follows. One ng of hRB19-1 cDNA encoding rat REP-1 (7) was amplified by PCR according to the manufacturer's instructions using pfu polymerase (Stratagene) with the 5' oligonucleotide GAGTGGGGATCCAGATGGCGGATAATCTCCCCIT- CGG and the 3' oligonucleotide GCCATCTCTAGACTAGTGGTGGTG- GTGGTGATG'ITCAGAAGGCTCCITCTGGG'MTCC. The PCR product was cut with BamHI and XbaI, gel purified, and introduced into the BamHI and XbaI sites of the baculovirus expression vector pVL1393 (24). The resulting plasmid was designated pVL-REP1. The complete open reading frame of the human REP-2 gene (formerly called CHML) was constructed by co-ligation of a 0.95-kb EcoRI-NcoI fragment of clone 643 (X), a 1.9-kb NcoI-PstI fragment of clone 641 (15). and the EcoRI-PstI fragment of pCMV5 (25). One ng of DNA of this construct

Rub Escort Proteins 2113 was amplified with the 5' oligonucleotide TAGTGGTCTAGAAATGGC- GGACAATCTTCCC and the 3' oligonucleotide GCCATCCTCGAGC- TAGTGATGGTGATGGTGATGA'ITITGAAGGTGCTTCTCTGG as described above. The PCR product (originally cloned into pGEX-KG) (26) was cut with XbaI and XhoI, and the ends were blunted by filling in with Kienow polymerase and introduced into the SnaI site of pVL1393. The resulting plasmid was designated pVL-REPP. The total sizes of the His-tagged rat REP-1 and human REP-2 fusion proteins are 656 and 662 amino acids, respectively. Amino acid sequences of the NH2 and COOH termini of both proteins were verified by DNA sequencing of the plasmids.

Recombinant baculoviruses expressing REP-1 and REP-2 were gen- erated by cotransfection of fall armyworm ovarian (Sf91 cells in mono- layers with either pVL-REP1 or pVL-REP2 and linearized BacPAK6 viral DNA(C1ontech) by the Lipofectin method (27). Positive viral clones were isolated by plaque assay and amplified by three rounds of rein- fection. To produce REP-1 and REP-2 proteins, Sf9 cells (250 ml in suspension) were grown and infected with recombinant baculoviruses containing pVL-REP1 or pVL-REP2 as described (7). Forty-eight h after infection, Sf9 cells were collected by centrifugation and washed once with ice-cold phosphate-buffered saline. The cells were lysed with a Parr cell disruption bomb in 30 ml of buffer containing 50 m~ HepedNa (pH 7.2), 0.1 mM Nonidet P-40,lO m~ NaCI, 1 mM p-mercaptoethanol, 5 pg/ml pepstatin, 5 pg/ml leupeptin, and 5 pg/ml aprotinin. The lysate was then centrifuged at lo5 x g for 30 min at 4 "C. The supernatant was subjected to Ni2'-Sepharose affinity chromatography as described above for the His-tagged Rab proteins. The His-tagged REP-1 and REP-2 (>go% pure as judged by SDS-PAGE) were dialyzed against two changes of buffer containing 50 m~ HepedNa (pH 7.2), 10 m~ NaCl, 0.1 mM Nonidet P-40, and 1 mM dithiothreitol and stored in multiple aliquots a t -70 "C.

Preparation ofRecombinunt Rat Rub GGTase-The EcoRI fragments from pRabGGTa and pRabGGTp (6) were separately cloned into the EcoRI site of pVL1393 (24). and the orientation was identified by re- striction digestion. The resulting plasmids were designated pVL- RabGGTa and pVL-RabGGTP. Recombinant baculoviruses were gener- ated and isolated as described above. Active a and p subunits of Rab GGTase were produced by coinfection of Sf9 cells (1 liter in suspension) with recombinant viruses containing pVL-RabGGTa and pVL- RabGGTp. The cells were grown as described (7) and infected at a multiplicity of infection of one a and one p subunit-encoding virus per cell. Forty-eight h post-infection the cells were harvested by centrifugation and washed once with ice-cold phosphate-buffered saline. Cells were lysed using a Parr cell disruption bomb in 200 ml of buffer containing 50 m~ HepedNa (pH 7.2), 0.3 m~ Nonidet P-40, 10 m~ NaCI, 1 mM dithiothreitol, and 1 m~ phenylmethylsulfonyl fluoride. The lysate was then centrifuged a t lo" x g for 1 h a t 4 "C, and 25 ml of the supernatant were chromatographed on a Mono Q 10110 column as described (4). The active fractions were pooled and loaded onto a Superdex 200 gel filtration column that had been equilibrated in 20 m~ HepedNa (pH 7.2), 0.5 M NaCI, 0.1 m~ Nonidet P-40, and 1 mM dithiothreitol as described elsewhere (4, 5). Active fractions were analyzed by enzyme assay and SDS-PAGE. Fractions that contained only the a and p subunits of Rab GGTase were stored in multiple aliquots at -70 "C.

RESULTS

We used a baculovirus-Sf9 insect cell system to prepare recombinant versions of rat REP-1 and human REP-2 with hexahistidine sequences at the COOH termini. The proteins were purified by affinity chromatography, and both gave single bands whose molecular weights were similar to that of rat brain REP-1 upon SDS-polyacrylamide gel electrophoresis (Fig. 1, left panel 1. We also used the Sf9 system to produce recombinant rat Rab GGTase by simultaneously infecting the cells with recombinant viruses encoding both the ct and p subunits. The heterodimeric GGTase was purified by ion exchange and gel filtration chromatography and was judged to be at least 90% pure by SDS-polyacrylamide gel electrophoresis. The apparent M, of the ct and /3 bands were similar to those of the purified rat brain GGTase (Fig. 1, left panel). We prepared hexahistidine- tagged versions of recombinant RablA, Rab3A, Rab5A, and Rab6 by expression in E. coli and purification on nickel-Sepha- rose columns (Fig. 1, right panel 1.

Fig. 2 shows an experiment in which we measured the ability

p? 9 r' X

97- - 66 - 45 - 31 -

His-Tagged

' 2 s s (0' n n n n m m m m a: a: a:a: 80 - 49 - 32- , 27-

18-

I""

1 2 3 4 5 6 7 8 9

GGTase subunits and histidine-tagged Rab proteins. Left panel, FIG. 1. SDS-gel electrophoresis of purified recombinant Rab

aliquots of the indicated REP (0.3 pg) and Rab GGTase (0.5 pg) were subjected to electrophoresis (30 mA, 45 min, 24°C) on a 10% SDS- polyacrylamide minigel, and the protein bands were detected by silver nitrate staining. Right panel, aliquots of the indicated recombinant histidine-tagged Rab proteins (4 pg) were subjected to electrophoresis on a 12.5% SDS-polyacrylamide minigel and stained with Coomassie Blue. The gels were calibrated with the indicated protein molecular weight standards. rREP, recombinant REP; rRab GGTase, recombinant Rab GGTase.

A. Brain REP-I B. Recombinant REP-1

No Rab GGT

0 50 loo 0 50 100 REP-1 (ng)

FIG. 2. Stimulation of RablA GGTase activity by recombinant REP-1: comparison with REP-1 purified from rat brain. Each reaction mixture contained, in a final volume of 50 pl, 2 p~ RablA, 0.5 PM [RH]GGPP (33,000 dpdpmol), the indicated concentration of either purified brain REP-1 ( A ) or recombinant REP-1 ( B ) in the absence (A,O) or presence (A,.) of 14 ng of recombinant Rab GGTase. m e r incubation for 10 min at 37 "C, the amount of ["IGG transferred to RablA was determined in duplicate. The amount of [3H]GG transferred in the absence of REP-1 (0.03 pmol/tube) was not subtracted from the values shown.

of recombinant Rab GGTase to transfer [3HlGG from [3HlG- GPP to RablA in the presence of various concentrations of native or recombinant REP-1. In the absence of REP-1, little transfer was detected. Recombinant REP-1 by itself also had no significant GGTase activity (Fig. 2B, open circles). However, increasing amounts of recombinant REP-1 markedly stimu- lated the activity of the recombinant Rab GGTase, with a maxi- mum occurring at 50 ng of recombinant REP-1. The results with purified REP-1 from rat brain were similar except that this protein had slight GGTase activity on its own, apparently as a result of contamination with Rab GGTase (Fig. 2A ).

Recombinant Rab GGTase had an activity similar to that of purified brain Rab GGTase in the geranylgeranylation of RablA (Fig. 3). The native and recombinant enzymes both showed little activity in the absence of REP-1. Taken together, the data presented in Figs. 1-3 demonstrate that the recombinant proteins are structurally and functionally similar to the purified ones, and therefore all subsequent studies were done with recombinant REPS and Rab GGTase.

To test whether REP-2 participates in the geranylgeranylation of Rab proteins, we compared the abilities of REP-1 and REP-2 to stimulate geranylgeranylation of RablA by Rab GG- Tase (Fig. 4). When studied as a function of time (Panel A) or protein concentration (Panel B ) , REP-1 and REP-2 were nearly


3 A. Brain Rab GGT I B. Recombinant Rab GGT I

+ REP-1

P f 2 + REP-1

No REP-1 NO REP-1

I

0 50 100 0 50 100

Rab GGT (ng)

FIG. 3. Geranylgeranylation of RablA by recombinant Rab GGTase: comparison with Rab GGTase purified from rat brain. Each reaction mixture contained, in a final volume of 50 pl, 2 p~ RablA, 0.5 p c3H1GGPP (33,000 dpdpmol), the indicated concentration of either purified brain Rab GGTase ( A ) or recombinant Rab GGTase (B) in the absence (A,O) or presence (A,.) of 7 ng of purified brain REP-1. After incubation for 10 min at 37 "C, the amount of [SH]GG transferred to RablA was determined in duplicate. The amount of [3HlGG transferred in the absence of Rab GGTase (0.04 pmol/tube) was not subtracted from the values shown.

P REP-1 2.5

.. I

Time (minutes) REP-1 or REP-2 (ng)

REP-1 (0) or REP-2 (A). Assays contained, in a final volume of 50 pl, FIG. 4. Stimulation of RablA GGTase activity by recombinant

2 p~ RablA, 0.5 p~ f3H1GGPP (33,000 dpdpmol), and the following: Panel A, 30 ng recombinant Rab GGTase and 30 ng of either recombinant REP-1 (0) or REP-2 (A); Panel B, 14 ng of recombinant Rab GGTase and the indicated amount of recombinant REP-1 (0) or REP-2 (A). After incubation in duplicate a t 37 "C for either the indicated time (A) or 10 min (B), the amount of L3H1GG transferred to RablA was determined. In Panel A, a blank value determined for the complete reaction at zero time (0.11 pmol/tube) was subtracted from each value. In Panel B, a blank value in parallel reactions without REP-1 or REP-2 (0.01 pmol/tube) was subtracted from each value.

indistinguishable in their abilities to stimulate this reaction. A different result was obtained when Rab3A was the substrate. In this case REP-1 was much more active than REP-2 in stimu- lating the reaction (Fig. 5). The extent of the geranylgeranylation reaction at 60 min was 4-fold higher with REP-1 than with REP-2 (Panel A). When measured at linear time points, REP-1 gave a 4-fold higher reaction velocity (PuneE B) . To determine whether the difference between REP-1 and

REP-2 pertained to other Rab proteins, we measured the rate of geranylgeranylation as a function of Rab protein concentration using either REP-1 or REP-2 (Fig. 6). The saturation curves for RablA, RabSA, and Rab6 were similar with REP-1 and REP-2. Although REP-1 tended to be slightly more active, the difference was not nearly as pronounced as it was with RabSA, where REP-1 gave a 4-fold higher maximal velocity as compared with REP-2 (Fig. 6B).

The substrate saturation curves of Fig. 6 were analyzed by a curve-fitting program, and the results are shown in Table 11. The concentration of Rab3A giving a half-maximal reaction velocity (so.5) was similar for REP-1 and REP-2, but the maximal velocity of the reaction was 4-fold higher with REP-1 as compared to REP-2. The other three Rab proteins showed little difference in so.5 values or V,, values for REP-1 uersus REP-2.

P I I A.

+ REP-1

0.5

0.75

+ REP-1 0.50

0.25

0 25 50 75 100'

Time (minutes) REP-1 or REP-2 (ng)

FIG. 5. Stimulation of RabSA GGTase activity by recombinant REP-1 (0) or REP-2 (A). Assays contained, in a final volume of 50 pl, 2 p RabSA, 0.5 p~ [3HlGGPP (33,000 dpdpmol), and the following: Panel A, 30 ng of recombinant Rab GGTase and 30 ng of either recombinant REP-1 (0) or REP-2 (A); Panel B , 14 ng of recombinant Rab GGTase and the indicated amount of either REP-1 (0) or REP-2 (A). After incubation in duplicate at 37 "C for either the indicated time (A) or 10 min ( B ) , the amount of L3H1GG transferred to Rab3A was determined. In Panel A, a blank value determined for the complete reaction

B, a blank value in parallel reactions without REP-1 or REP-2 (0.02 at zero time (0.04 pmoUtube) was subtracted from each value. In Panel

pmol/tube) was subtracted from each value.

A. RablA-CC B. Rab3AEAC I

1 .o 0.5

Rab Prolein (pM)

FIG. 6. Geranylgeranylation of various Rab proteins by Rab GGTase in the presence of REP-1 (0) or REP-2 (A). Panels A , C, and D, assays contained, in a final volume of 50 pl, 30 ng of recombinant Rab GGTase, 0.5 p [3H]GGPP (33,000 dpdpmol), and varying concentrations of the indicated Rab protein in the presence of 30 ng of either recombinant REP-1 (0) or REP-2 (A). After incubation for 10 min at 37 "C, the amount of [3H]GG transferred to the indicated Rab protein was determined in duplicate. Panel B, assays contained 40 ng of recombinant Rab GGTase, 0.5 1.1~ c3H1GGPP, and varying concentrations of Rab3A in the presence of 40 ng of either recombinant REP-1 (0) or REP-2 (A). Incubations were carried out in duplicate for 15 min at 37 "C. Blank values carried out in parallel reactions in the absence of the appropriate Rab protein (0.01-0.02 pmol/tube) were subtracted from each value.

The Rab3 protein family contains several members in addition to Rab3A. We prepared recombinant forms of Rab3B (22) and Rab3D (23) and tested them as acceptors in the GGTase assay with REP-1 or REP-2 as activators (Fig. 7). When either REP was used, Rab3A and Rab3D were relatively poor sub- strates as compared with RablA. Rab3B was intermediate. In comparing the activities of REP-1 and REP-2, we found that REP-1 was much more active than REP-2 on Rab3D as well as Rab3A. As previously demonstrated, the two REPS were nearly equal with RablA as a substrate. Rab3B gave an intermediate result (Fig. 7, compare Panels A and B ) .

RablA (canine) and Rab3A(human) are only 42% identical in amino acid sequence (28). They differ from each other at the COOH-terminal acceptor site for the GG group. RablA termi- nates in CysCys (CC), whereas Rab3Aterminates in CysAlaCys (CAC). When REP-1 was used in the geranylgeranylation reaction, the maximal velocity obtained with RablA was 4-fold

Rab Escort Proteins 2115 TABLE I1

Kinetic parameters for Rub GGZhse: interaction of REP-1 and REP-2 with different Rub proteins

Data were analyzed with a program (K. CAT from BioMetallics, Prin- ceton, NJ) on a Macintosh IIci computer. This program was used to find the substrate concentration giving half-maximal velocity (so.s) and the maximal velocity (V,&. These values were determined from the saturation curves shown in Fig. 6. No assumptions were made regarding reaction mechanisms. The standard errors of the mean for so.6 and V,, values were 0.03-0.12 p~ and 0.02-0.20 nmolmin".rng of protein", respectively.

b b . SO.6 Apparent V,, protan REP-1 REP-2 REP-I REP-2

I r M nmol.min"mg of protein" RablA 0.56 4.0 3.0 Rab3A

0.64 0.37 0.21 2.5 0.55

Rab5A 0.36 0.43 Rab6

4.0 0.49

3.1 0.78 1.5 1.4

Rab Protein (pM)

FIG. 7. Geranylgeranylation of RabS proteins by Rab GGTase in the presence of REP-1 (Panel A) or REP-2 (Panel B) . Assays contained in a final volume of 50 pl, 30 ng of recombinant Rab GGTase, 0.5 p~ L3H1GGPP (33,000 dpdpmol), and varying concentrations of canine RablA (O), human Rab3A ( 0 , bovine Rab3B (O), or murine

A ) or REP-2 (Panel B ) . After incubation for 15 min at 37 "C, the amount Rab3D (A) in the presence of 30 ng of either recombinant REP-1 (Panel

of L3H]GG transferred to the indicated Rab protein was determined in

of the appropriate Rab protein (0.02-0.03 pmoYtube) were subtracted duplicate. Blank values carried out in parallel reactions in the absence

from each value.

higher than with Rab3A (Fig. 8A). To determine whether the COOH-terminal residues account for this difference, we used oligonucleotide-directed mutagenesis to exchange the COOH- terminal sequences. Placement of a CAC terminus into RablA lowered the rate of geranylgeranylation by about 40%, but the rates remained much higher than the rates for native Rab3A (Fig. &I). The converse experiment, i.e. placement of a CC terminus into RabsA, failed to increase the rate of geranylgeranylation significantly. These data indicate that the difference in geranylgeranylation efficiency between RablA and Rab3A is not fully attributable to the CC uersus CAC COOH termini. When REP-2 was used in the same experiment, essentially the same results were obtained (Fig. 8B).

To determine whether additional COOH-terminal sequences account for the difference in geranylgeranylation efficiency, we exchanged the 11 or 12 COOH-terminal amino acids of RablA and Rab3A (Fig. 9). When REP-1 was used as activator, Rab3A terminating in the last 11 residues of RablA was as effective as RablA in accepting GG groups (Fig. 9A). With REP-2 as activator, the reversal was almost as complete (Fig. 9B). In the converse experiment, replacement of the 11 COOH-terminal amino acids of RablA with the 12 COOH-terminal amino acids of Rab3A markedly reduced the rate of geranylgeranylation in the presence of either REP-1 or REP-2, but the effect with REP-2 was more profound.

1A-CAC

0 2 4 6 8 1 0

I 8. REP-2

Rab Protein

1A-CAC

0 2 4 6 8 1 0 Flab Protein (VM)

FIG. 8. Geranylgeranylation of COOH-terminal mutants of RablA and RabSA by Rab GGTase in the presence of REP-1

50 pl, 30 ng of recombinant Rab GGTase, 0.5 p~ f3HlGGPP (33,000 (Panel A) or REP-2 (Panel B) . Assays contained, in a final volume of

dpdpmol), and varying concentrations of the indicated Rab protein (see below) in the presence of 30 ng of either recombinant REP-1 (Panel A) or REP-2 (Panel B ) . After incubation for 10 min at 37 "C, the amount of f3H]GG transferred to the indicated Rab protein was determined in duplicate. Blank values carried out in parallel reactions in the absence of Rab protein (0.03-0.04 pmoYtube) were subtracted from each value. Closed symbols denote RablA proteins in which the wild-type COOH- terminal 2 amino acids (0, CC) are replaced by CAC (A). Open symbols denote Rab3A proteins in which the wild-type COOH-terminal3 amino acids (0, CAC) are replaced by CC (A). The wild-type RablA and Rab3A COOH-terminal sequences are boxed.

IIA-TPVKQSGGGCC~

4

1

0

Rab Protein (uM)

RablA and RabSA by Rab G G h e in the presence of REP-1 FIG. 9. Geranylgeranylation of COOH-terminal mutants of

(Panel A) or REP-2 (Panel B ) . Assays contained, in a final volume of 50 pl, 30 ng of recombinant Rab GGTase, 0.5 p~ f3H1GGPP (33,000 dpdpmol), and varying concentrations of the indicated Rab protein (see below) in the presence of 30 ng of either recombinant REP-1 (Panel A ) or REP-2 (Panel B ) . After incubation for 15 min at 37 "C, the amount of l3H1GG transferred to the indicated Rab protein was determined in duplicate. Blank values carried out in parallel reactions in the absence of Rab protein (0.02-0.03 pmoytube) were subtracted from each value. Closed symbols denote RablA proteins in which the wild-type COOH- terminal 11 amino acids (0, "F'VKQSGGGCC) are replaced by DQQVP- PHQDCAC (B). Open symbols denote Rab3A proteins in which the wild-type COOH-terminal 12 amino acids (0, DQQVPPHQDCAC) are replaced by TPVKQSGGGCC (m). The wild-type RablA and Rab3A COOH-terminal sequences are boxed.

In previous studies we showed that REP-1 binds to the RablA substrate and remains associated aRer geranylgeranylation (7). At submicellar concentrations of detergent, the reaction stops when all of the REP-1 is occupied by geranylgeranylated RablA. At micellar detergent concentrations, the reaction continues, apparently because the detergent permits the dissociation of the REP-1.RablA complex, allowing the REP-1 to recycle (7). Fig. 10 repeats this experiment with Rab3A and REP-1 (Panel A) or REP-2 (Panel B) . The reaction was conducted at 24 "C to slow the initial rate so that more precise measurements could be made. At low detergent concentrations, the extent of geranylgeranylation with REP-2 was the same as with REP-1. Raising the detergent concentration led to a higher rate of geranylgeranylation with REP-1, but not with REP-2.


A. REP-I 0. REPP

+ 1 mM NP-40

+ 0.05 mM NP-40

A. REP-I 0. REPP

t + 1 mM NP-40 I 0. REP-2

0 2 0 4 0 8 0 Tlme [minutes)

FIG. 10. Geranylgeranylation of Rab3A by Rab GGTase in the presence of recombinant REP-1 (Panel A) or REP-2 (Panel B ) at low and high concentrations of Nonidet P-40. Assays contained, in a final volume of 50 pl, 2 p~ RabsA, 100 ng of recombinant Rab GGTase, 1.0 p~ PHIGGPP (33,000 dpdpmol), and either 100 ng of recombinant REP-1 (Panel A ) or REP-2 (Panel B ) in the presence of either 0.05 m~ (0) or 1 rn (0) Nonidet P-40 as indicated. After incubation in duplicate at 24 "C for the indicated time, the amount of c3H1GG transferred to Rab3A was determined. Blank values determined at zero time (0.02 pmolhube) were subtracted from each value.

.. Time (mlnutecr)

FIG. 12. Geranylgeranylation of Rab3A"I'PVKQSGGGCC by Rab GGTase in the presence of recombinant REP-1 (Panel A) or REP-2 (Panel B ) at low and high concentrations of Nonidet P-40. Assays contained, in a final volume of 50 pl, 2 p~ Rab3A- TPVKQSGGGCC, 100 ng of recombinant Rab GGTase, 1.0 p~ L3H1G- GPP (33,000 dpdpmol), and either 100 ng of recombinant REP-1 (Panel A ) or REP-2 (Panel B ) in the presence of either 0.05 m~ (0,A) or 1 rn (.,A) Nonidet P-40 as indicated. After incubation in duplicate a t 24 "C for the indicated time, the amount of PHIGG transferred to Rab3A-TPVKQSGGGCC was determined. Blank values determined at zero time (0.03-0.04 pmol/tube) were subtracted from each value.

I' Rab 3A

Time (rnlnutes)

FIG. 11. Geranylgeranylation of RablA (Panel A) or Rab3A (Panel B ) by recombinant REP-1 (0) or REP-2 (0) in the presence of 0.06 mrd Nonidet P-40. Assays contained, in a final volume of 50 pl, 100 ng of recombinant Rab GGTase, 1.0 p~ [3H]GGPP (33,000 dpdpmol), 100 ng of recombinant REP-1 (0) or REP-2 (0) as indicated, 0.05 m~ Nonidet P-40, and either 2 p~ RablA (Panel A ) or Rab3A (Panel Bt . After incubation in duplicate a t 24 "C for the indicated time, the amount of r3H1GG transferred to the indicated Rab protein was determined. Blank values determined at zero time (0.02 pmol/tube) were subtracted from each value. The inset in Panel B shows assays at early time points in which each value represents one incubation per time point.

Fig. 11 compares GG attachment of RablA and Rab3A with REP-1 and REP-2 at 24 "C and low detergent concentration. Although the extent of geranylgeranylation of Rab3A was the same with REP-1 and REP-2, the initial rate of the reaction was much slower with REP-2 (Fig. llB, inset), suggesting im- paired interaction between the REP-2-Rab3A complex and Rab GGTase. In contrast, both the rate and extent of geranylgeranylation of RablA were the same with REP-1 and REP-2 (Fig. 1lA 1.

When we placed the COOH-terminal 11 amino acids of RablA into Rab3A, the reaction became susceptible to stimulation with micellar detergents (Fig. 12). Moreover, the rate of the reaction with REP-2 approached that with REP-1 (compare Panels A and €3). Considered together, the data in Figs. 10-12 suggest that the catalytic efficiency of the REP.Rab GGTase complex is determined in large part by the COOH-terminal 11-12 amino acids of the Rab substrate.

DISCUSSION

The current experiments demonstrate that REP-2 is as effective as the previously described REP-1 in permitting Rab GGTase to attach GG groups to several Rab proteins, including RablA, RabBA, and Rab6. REP-2 was not as active as REP-1 with respect to members of the Rab3 family. The most detailed

comparisons were conducted with Rab3A and RablA. Rab3A was geranylgeranylated less efficiently than RablA in the presence of either REP-1 or REP-2. However, the decrease with REP-2 was much more severe than with REP-1.

One obvious difference between RablA and Rab3A is in the COOH-terminal target sequence for geranylgeranylation. RablA ends in two adjacent cysteines (CC), whereas Rab3A has an intervening residue (CAC). I n vivo Rab3A was shown to bear GG groups on both cysteines (29). We have not yet been able to determine definitively whether both cysteines are geranylgeranylated by the Rab GGTase in vitro. Whether RablAis geranylgeranylated on both cysteines i n vivo or in vitro is unknown.

The low geranylgeranylation efficiency of Rab3A was not attributable to the COOH-terminal CAC sequence. Replace- ment of this sequence with CC failed to increase the rate of geranylgeranylation with either REP-1 or REP-2 (Fig. 8). Rather, the difference was attributable to the adjacent peptide sequences. Thus, replacement of the 12 COOH-terminal amino acids of Rab3A with the 11 COOH-terminal amino acids of RablA raised the rate of geranylgeranylation with REP-1 to equal that of RablA (Fig. 9A). With REP-2 the increase was nearly as great (Fig. 9B). Conversely, placement of the 12 COOH-terminal amino acids of Rab3A into RablA profoundly reduced the rate of geranylgeranylation in the presence of either REP-1 or REP-2 (Fig. 9).

The reaction mechanism for geranylgeranylation of Rab proteins is extremely complex, involving an escort protein (REP) and a heterodimeric catalyst that transfers either one or two molecules of GG to cysteine residues (5, 7). More extensive studies will be necessary to relate the observed kinetics of this reaction to its mechanism. From the data now available, it seems that the difference in catalytic efficiency between RablA and Rab3A does not relate to the affinity of these proteins for the Rab recognition machinery. Indeed, the so.5 value for Rab3A in the GG transfer reaction was actually lower than the value for RablA, either in the presence of REP-1 or REP-2 (Table 11). Rather, the difference appears to lie in variable catalytic efficiency, which leads to lower reaction rates with Rab3A than with RablA (Fig. 8). The COOH-terminal peptide of the REP.Rab3A complex may not be presented as efficiently to the catalytic site, and/or this sequence, once geranylgeranylated, may not dissociate as readily from the site as does the REP.RablA complex. The catalytic inefficiency with Rab3A is more pronounced with REP-2 than it is with REP-1, owing to the combination of mechanisms described above.

The relative inefficiency of REP-2 in supporting geranylger-

Rab Escort Proteins 2117

anylation of Rab3A extended to other members of the Rab3 sion of the various REPs and Rabs in retina and other tissues family, including Rab3D and Rab3B (Fig. 7). Other Rab pro- are performed. teins such as RabSA and Rab6, like RablA, did not show selec- tive resistance to even Rab6 Doug Andres, and Tor Smeland for and helpful comments;

Acknowledgments-We thank our colleagues Hans v. Bokhoven,

having an intervening residue between the CooH-terminal Veronica Martinez for excellent technical assistance; Jeff C o d e r for cysteines (csc) (Fig. 6). The Rab family includes more than 20 oligonucleotide synthesis and DNA sequence; and Lisa Beatty for in- members (2, 3, 8), most of which have not yet been tested for valuable help in gowing Sf9 cells. geranylgeranylation in vitro. Additional REPs may also exist. It is possible that specific Rab proteins may show a preference REFERENCES for specific REPS to a degree even greater than demonstrated in 1. Glomset, J. A,, Gelb, M. H., and Farnsworth, C. C. (1991) Cum Opin. Lipidol. this report.

For Convenience, we used a rat REP-1 and a human REP-2 3. Takai,Y., Kaibuchi, K., Kikuchi,A., and Kawata. M. (199211nt. Rev. cytol. is, for these studies, but we know that rats, as well as humans, 187-230 have REP-1 and REP-2 as determined by Southern blots with 4. Seabra, M. C., Goldstein, J. L., Siidhof, T. C., and Brown, M. S . (1992) J. Biol.

genomic DNA and Northern blots with RNA. The mRNAs for 5. Seabra, M. C., Brown, M. S. , Slaughter, C. A,, Siidhof, T. C., and Goldstein, J. Chem. 267, 14497-14503

REP-1 and are distributed in a wide variety Of body 6. Armstrong, S . A, Seabra, M. C., Siidhof, T. C., Goldstein, J. L., and Brown, M. L. (1992) Cell 70, 1049-1057

tissues of humans, rats, and mice, including the retina (7, 12, S . (1993) J. Biol. Chem. 268, 12221-12229 13).2 We do not yet know whether both REP-1 and REP-2 are 7. Andres, D. A., Seabra, M. C., Brown, M. S. , Armstmng, s. A., Smeland, T. E.,

expressed in the Same If co-expression can 8. Fischer von Mollard, G., Siidhof, T. C., and Jahn, R. (1991) Nature 349,7941 be demonstrated, the data would support the suggestion that 9. Rossi, G., Jiang, Y., Newman, A. P., and Ferro-Novick, S . (1991) Nature 361, REP-2 for thereby widespread 10. Bucci, C., Parton, R. G., Mather, I. H., Stunnenberg, H., Simons, K, Hoflack, tissue abnormalities in patients with choroideremia who lack B., and Zerial, M. (1992) Cell 70,715-728 REP-1. This conclusion is supported by previous measurements 11. Goud, B., Zahraoui, A., Tavitian, A., and Saraste, J . (1990) Nature 346,553-

Of Rab GGTase activity in lymphoblasts from subjects with 12. Cremers, F. P. M., van de Pol, D. J. R., van Kerkhoff, L. P. M., Wieringa, B., and choroideremia (14). These mutant cells had a more severe re- Ropers, H-H. (19901 Nature 347,674-677 duction in the ability to attach groups to Rab3A ( 2 ~ 2 5 % of 13. Merry, D. E., J h n e , P. A., Landers, J. E., Lewis, R. A., and Nussbaum, R. L.

control) than to Rab1-4 (75% of control). This is the expected 14. Seabra, M. C., Brown, M. s., and Goldstein, J. L. (1993) Science 269,377381

efficient in supporting GG transfer to Rab3A than to RablA.

2,118-124 2. Pfeffer, S. R. (1992) Z k n d s Cell Biol. 2, 41-46

Cremers, F. P. M., and Goldstein, J. L. (1993) Cell 73,1091-1099

158-161

556

(1992) Proc. Natl. Acad. Sci. U. S. A 89,2135-2139

result if REP-2 substitutes for REP-1 and if REP-2 is less 15. Cremers, F. P. M., Molloy, C. M., van de Pol, D. J. R., van den Hurk, J. A. J. M., Bach, I., Geurts van Kessel, A. H. M., and Ropers, H.-H. (1992) Hum. Mol.

The question arises as to why individuals with choroider- 16. Ullrich, O., Stenmark, H., Alexandrov, K., Huber, L. A,, Kaibuchi, K, Sasaki, Genet. 1, 71-75

T., Takai, Y., and Zerial, M. (1993) J. Biol. Chem. 268, 18143-18150

Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

emia degeneration, which is 17. amb brook, J., Frits&, E. F,, and Maniatis, T. (1989) Molecular Cloning,. A to initiate in the retinal pigment epithelium (30). It is possible that retinal pigment epithelial cells have a relative deficiency of REP-2, perhaps resulting from late-onset developmental i:: ~ ~ ~ ~ , " M i , , ( ~ ~ ~ ~ 1 ~ ~ ~ ~ ~ ~ 7 ~ . , ~ ~ ~ ~ ~ s, D,, N, J., and suppression in a manner similar to that of other isoenzymes. Gibhs, J. B. (1992) Biochemistry 31, 38W3807 Alternatively, it is possible that the retinal pigment epithelium 20. Khosravi-Far, R., Lutz, R. J., COX, A. D., Clark, R., Bourne, J. R., Sinensky, M.,

contains a tissue-specific Rab protein that requires REP-1 and Balch, W. E., Buss, J. E., and Der, C. J . (1991)Proc. Natl. Acad. Sci. U. S. A. 88,6264-6268

does not recognize REP-2. Such a protein might be a member of 21. Zahraoui, A., Touchot, N., Chardin, P., and Tavitian, A. (1989) J. Biol. Chem.

the Rab3 Or another One Of the Rab not yet 22. Matsui, Y., Kikuchi, A,, Kondo, J., Hishida, T., Teranishi, Y., and Takai, Y. 264,12394-12401

It is highly that choroideremia patients have a gen- 23. Baldini, G., Hohl, T., Lin, H. Y., and Lodish, H. F. (1992) Proc. Natl. Acad. Sci.

era1 deficiency of geranykeranylated Rab3A9 since this would 24. O'Reilly, D. R., Miller, L. K., and Luckow, V. A. (1992) Baculouirus Expression

undiscovered REP, must be capable of supporting the geranyl- 25. Anderason, s., Davis, D. L., Dahlhack, H., Jornvall. H., and Russell, D. w.

studied. (1988) J. Biol. Chem. 263, 11071-11074

U. S . A. 89, 5049-5052

cripple neural tissue. Thus, in nerve tissue REP-2, or another Vectors A Laboratory Manual, W. H. Freeman & Co., New York

geranylation of Rab3A and the other Rab3 family members. 26. Guan, K., and Dixon, J. E. (1992) Anal. Biochem. 192,262-267

this level of activity might be sufficient to produce normal amounts of geranylgeranylated Rab3A in vivo. 29. Farnsworth, C. C., Kawata, M., Yoshida, Y., Takai, Y., Gelb, M. H., and Glom-

Cell. Biol. 10, 6578-6585

set, J. A. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 61-200

when tissue-specific and developmental studies of the expres lively, J . R., ed) pp. 176-187, J. B. Lippincott Co., New York

(1989) J. Biol. Chem. 264,822243229

Although REP-2 is only 25% as active as REP-1 with 27. Groebe, D. R., Chung, A. E., and Ho, C. (1990) Nucleic Acids Res. 16,4033 28. Chavrier, P., Vingron, M., Sander, C., Simons, K., and Zerial, M. (1990) Mol.

Of the above questions be to 30. Heckenlively, J. R., and Bird, A. C. (1988) in Retinitis Prgmentosa (Hecken-

rep-2, a rab escort protein encoded by the choroideremia-like gene

Documents