regulation of hypothalamic corticotropin-releasing hormone transcription by elevated glucocorticoids

Regulation of hypothalamic corticotropin releasinghormone transcription by elevated glucocorticoids

Andrew N Evans*#, Ying Liu*, Robert MacGregor, Victoria Huang, Greti Aguilera,

Section on Endocrine Physiology, Program in Developmental Endocrinology and Genetics, NationalInstitute of Child Health and Human Development, NIH, Bethesda, MD, USA. *ANE and YL contributedequally to this work; # ANE present address: University of Southern Mississippi, Gulf Coast ResearchLaboratory, 703 E Beach Dr, Ocean Springs, MS 39564

Negative glucocorticoid feedback is essential for preventing deleterious effects of excessive HPAaxis activation, with an important target being corticotropin releasing hormone (CRH) transcrip-tion in the hypothalamic paraventricular nucleus (PVN). These studies aim to determine whetherglucocorticoids repress CRH transcription directly in CRH neurons, by examining glucocorticoideffects on glucocorticoid receptor (GR)-CRH promoter interaction, and the activation of proteinsrequired for CRH transcription. Immunoprecipitation of hypothalamic chromatin from intact oradrenalectomized rats subjected to either stress or corticosterone injections showed minor asso-ciation of the proximal CRH promoter with GR compared to phospho-CREB (pCREB). In contrast,the Period-1 (Per1, a glucocorticoid-responsive gene) promoter markedly recruited GR. Stressincreased pCREB recruitment by the CRH but not the Per1 promoter, irrespective of circulatingglucocorticoids. In vitro, corticosterone pretreatment (30min or 18h) only slightly inhibited basaland forskolin-stimulated CRH heteronuclear (hn) RNA in primary hypothalamic neuronal cultures,and CRH promoter activity in hypothalamic 4B cells. In 4B cells, 30 min or 18h corticosteroneexposure had no effect on forskolin-induced nuclear accumulation of the recognized CRH tran-scriptional regulators, phospho-CREB and transducer of regulated CREB activity 2 (TORC2). Thedata show minor inhibition of CRH transcription by physiological glucocorticoids in vitro, and thatdirect interaction of GR with DNA in the proximal CRH promoter may not be a major mechanismof CRH gene repression. While GR interaction with distal promoter elements may have a role, thedata suggest that transcriptional repression of CRH by glucocorticoids involves protein-proteininteractions or/and modulation of afferent inputs to the PVN.

Normal activity of the hypothalamic pituitary adrenalaxis (HPA) leading to adrenal glucocorticoid pro-

duction is essential for homeostasis and for survival dur-ing severe stress situations. Activation of the HPA axis isinitiated by release of corticotropin releasing hormone(CRH) produced in the hypothalamic paraventricular nu-cleus (PVN) into the pituitary portal circulation (1, 2).Episodes of CRH release during stress are usually associ-ated with increases in CRH transcription, as evidenced byrapid and transient increases in primary transcript or het-eronuclear RNA (hnRNA). Inappropriate transcriptionalregulation with consequent deficient or excessive CRHexpression can lead to HPA axis dysregulation and pa-

thology, such as depression, immune and metabolic dis-orders (3–5). A major mechanism for limiting HPA axisactivation is negative feedback by glucocorticoids at thepituitary corticotroph and several sites in the brain, in-cluding hypothalamic CRH neurons in the PVN (6, 7).

A body of evidence indicates that glucocorticoids neg-atively regulate CRH expression. Removal of endogenousglucocorticoids by adrenalectomy increases CRH expres-sion in the PVN and potentiates responses to stress (8–11). Glucocorticoid administration, systemic or directlyin the PVN region, has the converse effect (12–15). Inaddition, glucocorticoid receptor (GR) deficiency in-creases CRH release into the median eminence (16), and

ISSN Print 0888-8809 ISSN Online 1944-9917Printed in U.S.A.Copyright © 2013 by The Endocrine SocietyReceived April 4, 2013. Accepted September 16, 2013.

Abbreviations:

O R I G I N A L R E S E A R C H

doi: 10.1210/me.2013-1095 Mol Endocrinol mend.endojournals.org 1

Molecular Endocrinology. First published ahead of print September 24, 2013 as doi:10.1210/me.2013-1095

Copyright (C) 2013 by The Endocrine Society

the presence of GRs in CRH neurons (17, 18) furthersupports a direct inhibitory effect of glucocorticoids at theCRH neuron level.

A number of in vitro studies using cell lines transfectedwith CRH promoter reporter genes have shown directeffects of glucocorticoids on CRH promoter activity (19–21). There is no classical glucocorticoid response element(GRE) in the CRH promoter, but conserved and function-ally defined negative GRE half-sites have been described(20, 22–24). However, others have shown that none ofthe GR interacting sites in the proximal CRH promoterhave functional activity, and that the repressor effect ofglucocorticoids requires the CRH promoter cyclic AMPresponsive element (CRE) (19, 21, 25), suggesting an ef-fect through protein–protein interactions. The aim of thedescribed in vivo and in vitro studies was to further char-acterize the molecular mechanisms mediating glucocorti-coid suppression of CRH gene transcription, by examin-ing the effects of altering glucocorticoid levels within thephysiological range on the interaction of GRs with theCRH promoter and on the activation of transcriptionfactors involved in CRH gene expression. Our resultsdemonstrate that in vivo elevation of circulating gluco-corticoids does not increase GR binding to the proximalCRH promoter, including the region containing putativenegative GRE sites (-278 to –249) and additional regionsup to –2000 bp. Furthermore, corticosterone does notinhibit in vitro forskolin-induced nuclear accumulation ofthe CRH transcriptional regulators phospho-CREB(pCREB) and transducer of regulated CREB activity 2(TORC2) in hypothalamic 4B cells, suggesting that glu-cocorticoids suppress CRH transcription primarilythrough indirect pathways such as modulation of CRHneuron function.

Materials and Methods

Animals and in vivo procedures. Adult male Sprague-Dawleyrats weighing 275–325g were housed three per cage on a 14–10h light-dark cycle with food and water available ad libitum,for at least one week prior to experimentation. To determinewhether interaction of GR with the proximal CRH promoter ispart of the negative feedback by glucocorticoids on CRH tran-scription, we performed chromatin immunoprecipitation assaysin hypothalamic chromatin of intact or 4-day adrenalectomizedrats subjected to restraint stress or a single injection of cyclo-dextrin encapsulated corticosterone (HBC corticosterone,Sigma, San Louis MO) at 1 or 10 mg per rat, i.p., dissolved in300 �l of sterile saline. Rats were subjected to adrenalectomyunder ketamine/xylazine anesthesia by the dorsal route andgiven tap water and normal saline ad libitum as drinking fluid.Restraint stress was performed by placing rats into plastic re-strainers (2.5 � 6 ines) for up to 1h. Groups of rats were killed

by decapitation at 0.5 or 1h restraint, or 0.5 or 2h after HBC-corticosterone injection. These time points were chosen basedon the observed time course of changes in plasma corticosteronefollowing stress and corticosterone injection, and the fact thatstress–stimulated CRH hnRNA return to basal levels by 60 min-utes restraint stress. Control rats were removed from the cagesand killed within 30 seconds. Brains were immediately removedand the hypothalamic region microdissected from coronal sec-tions between the optic chiasma and 1 mm rostral from themammillary bodies. Sections were placed flat on a chilled rubbercork and cut at the top and 1 mm lateral at each side of the thirdventricle. After removing an additional 1 mm from the bottom,hypothalamic sections were frozen in 1.5 ml microtubes on dryice. The whole procedure from decapitation to freezing of thetissue was performed in about 3 minutes.

Trunk blood was collected in ice-chilled plastic tubes con-taining 5 mg EDTA and 500 TIU aprotinin. Plasma was sepa-rated by centrifugation and stored at –80°C for corticosteronedetermination. Corticosterone levels were measured using theRat Corticosterone Coat-A-Count kit (Diagnostic ProductsCorporation (DPC), Los Angeles,CA) according to the manu-facturer’s instructions. All experiments were performed in themorning with rats killed between 9 and 11 AM. All proceduresand experimental protocols were performed according to NIHguidelines and approved by the NICHD Animal Care and UseCommittee.

Cell culture. The hypothalamic cell line, 4B, was provided byDr. John Kasckow (Cincinnati, OH). This cell line containsendogenous GR and it was originally described as expressingCRH mRNA and immunoreactive peptide. However, 4B cellsdo not show rapid regulation of CRH hnRNA by cyclic AMP, asseen in vivo or in primary cultures of hypothalamic neurons(26), and therefore they are not suitable to study endogenousCRH transcription. On the other hand, 4B cells have beenproven useful for studies using reporter gene assays (26–29).Cells were cultured in DMEM (Invitrogen) supplemented with10% fetal bovine serum, 10% horse serum, and 100U/ml pen-icillin and 100 �g/ml streptomycin (26).

Primary cultures of hypothalamic neurons were obtainedfrom fetal Sprague Dawley rats, embryonic day 18. Fetal ratswere rapidly removed from 18-day pregnant rats after CO2

sedation and decapitation. Fetuses were decapitated, and hypo-thalamic tissue dissected and collected in ice-cold buffer (pH7.4, containing 137 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4,25 mM HEPES buffer, and 100 �g/ml gentamicin). Tissues werethen digested for 1.5h with collagenase type 2 (1 mg/ml) (Wor-thington, Lakewood, NJ) dissolved in the above buffer, supple-mented with 1 mg/ml glucose, 4 mg/ml BSA, and 0.2 mg/mlDNase. After filtration through a 40 �m cell strainer (BD Fal-con), cells were pelleted by centrifugation at 200 x g for 10minutes. Cells were washed in plating media (D-MEM/F12, 100�g/ml gentamicin, and 10% heat inactivated fetal bovine se-rum), and plated at a density of 1 � 106 cells per well in 6-wellplates coated with poly-L-lysine. After 48 hours culture, mediawas changed to Neurobasal Media (Gibco/Invitrogen) supple-mented with B27 (Invitrogen) to support neuron growth, and100 �g/ml gentamicin. From days 5 to 9 (ie, for 5 days), 5 �Mcytosine arabinoside (Sigma), a selective inhibitor of DNA syn-thesis, was added in order to prevent glial proliferation. On day10, neuronal cultures were changed into Neurobasal medium

2 Glucocorticoids and CRH transcription Mol Endocrinol

containing 10 mM HEPES and 100 �g/ml gentamicin, supple-mented with a glucocorticoid and progesterone free mixture(Site-3 supplement (Sigma); 0.5 mM L-glutamate, 100 mM so-dium pyruvate, 25 mM glucose, 60 pM triodo-L-thyronine, 10�M putrescine and 0.2%BSA). On day 11, cells were incubatedin supplement-free Neurobasal medium containing 0.1% BSAfor 2h before treatment with forskolin. HBC corticosterone at aconcentration of 100 nM was added to duplicate wells either 18hours or 30 minutes prior to stimulation with forskolin. After45 minutes incubation with forskolin, medium was removedand cells lysed for RNA preparation by addition of 1ml TRIzol(Invitrogen, Hopkinton, MA, USA). Content of the wells wastransferred to 1.5 microfuge tubes and frozen at –80°C or im-mediately processed for RNA isolation.

RNA Isolation and real time PCR for CRH hnRNA. Total RNAwas extracted from primary cultures of hypothalamic neuronsusing TRIzol reagent (Invitrogen, Hopkinton, MA, USA), fol-lowed by purification using RNeasy mini kit reagents and col-umn DNase digestion (Qiagen, Valencia, CA, USA) to removegenomic DNA contamination. Complementary DNA was re-verse transcribed from 0.3–0.75 �g of total RNA, and CRHprimary transcript levels (hnRNA) measured using primer se-quences designed to amplify the intron as previously described(26). Power SYBR green PCR mix (Applied Biosystems, FosterCity, CA, USA) was used for the amplification mixture witheach primer at a final concentration of 200 nM and 1.5 �l ofcDNA for a total reaction volume of 12.5 �l. PCR reactionswere performed on spectrofluorometric thermal cycler7900 HTFast Real-Time PCR System (Applied Biosystems) as previouslydescribed (29). Levels of hnRNA were normalized to glyceral-dehyde 3-phosphate dehydrogenase (GAPDH) mRNA as deter-mined in separate qRT-PCR reactions. The absence of RNAdetection when the reverse transcription step was omitted indi-cated the lack of gDNA contamination in the RNA samples. Thesequence of the PCR primers for CRH hnRNA were: forward:5�-tcaatccaatctgccactca-3� and reverse5�-taagctattcgcccgctcta-3�.

Luciferase assays. Cultures of 4B cells were transfected by elec-troporation using a Nucleofector (Amaxa, Gaithersburg, MD)and Solution V purchased from the manufacturer. The CRHpromoter-driven luciferase reporter gene (pGL3-CRHp) was a613-bp restriction fragment containing the CRH promoter(-498 to �115 bp relative to the proximal transcription startpoint) of the CRH gene clone prCRHBglII (provided by Dr.Audrey Seasholtz, Ann Arbor, MI), cloned into pGL3Basic (Pro-mega Corp., Madison, WI) (28). Aliquots of 5 million 4B cellswere transfected with 2.5 �g pGL3-CRHp plasmid and 75ng ofrenilla luciferase construct to normalize for transfection effi-ciency. After transfection, cells were resuspended in DMEMcontaining 10% horse serum and 10% fetal bovine serum andplated into 48-well culture plates, at a density of 50,000 cells perwell. Six hours later when cells had become adherent, media waschanged to culture medium supplemented with 10% charcoal-dextran stripped fetal bovine serum. After overnight culture,cells were preincubated for 1h in serum free medium containing0.1% BSA before addition of 3 �M forskolin or vehicle. Onehundred nM corticosterone (HBC-corticosterone, Sigma, StLouis, MO) was added 18 hours or 30 minutes prior to additionof forskolin. After 6 hours incubation, media was removed and

cells lysed by addition of 100�l of passive lysis buffer (Promega,Madison, WI). Luciferase activity in cell lysates was determinedusing reagents from Promega (Dual Luciferase Assay System,Promega, Madison, Wisconsin).

ChIP assays. To determine whether GR is recruited by the prox-imal CRH promoter during increases in circulating glucocorti-coids, we performed chromatin immunoprecipitation (ChIP) as-says using kit reagents from the ChIP-IT Express kit (ActiveMotif, Carlsbad, CA), according to the manufacturers protocolwith some modifications. Briefly, pooled hypothalamic tissuefrom 3–4 rats was homogenized in 1ml of 4% formaldehydeusing a hand-held motorized homogenizer Bio-Gen Pro200 (ProScientific, Oxford, CT), for 10sec, setting 2, and incubated for10 minutes at room temperature in order to cross-link theDNA–protein complexes. After terminating the cross-linkingreaction with glycine, homogenates were centrifuged andwashed three times in cold PBS containing protease and phos-phatase inhibitors. Pellets were then resuspended in 300 �l oflysis buffer (50 mM Tris-HCl, pH 8.1, 10 mM EDTA, 0.5%SDS) with protease/phosphatase inhibitors, incubated on ice for10 minutes, and sonicated by 10 cycles (30 seconds on and 30seconds off) at high level output in a Bioruptor, Diagenode,Belgium to generate 0.2–1 kb DNA fragments of chromatin.After 2h preclearing using Protein A/G plus beads (Santa CruzBiotech, Santa Cruz, CA), immunoprecipitation was performedusing 13–15 �g of chromatin and an anti-GR antibody cocktail(3 �g each of GR PA1–511A and GR MA-510 from Thermo/Pierce, Rickford, IL; GR M-20 from Santa Cruz Biotech, SantaCruz, CA), or phospho-CREB antibody, (Millipore/ Upstate,Temecula, CA), or rabbit IgG for negative control in the pres-ence of ChIP-IT Protein G Magnetic beads (Active Motif) at 4°Cunder rotation, in a total volume of 200�l following the man-ufacturer’s protocol (Active Motif). Prior to addition, Protein GMagnetic beads were preincubated with 1 �g of herring spermDNA per immunoprecipitation reaction in order to reduce thebackground. After overnight incubation Protein G magneticbeads containing the DNA-protein immuno-complexes wereseparated, and washed consecutively once in 800 �l of ChIPbuffer 1 and twice in ChIP buffer 2. Beads were then resus-pended in 50 �l of elution buffer and reverse cross-linked withproteinase K according to the kit’s protocol. Immunoprecipi-tated DNA fragments were quantified by real-time PCR usingprimers designed to amplify different regions of the CRH pro-moter or the Period 1 (Per1) promoter as shown in Table 1. Theamplification efficiency of the primers was usually about 100%,ranging from 90 to 110%.

Western blot. Cytosolic and nuclear proteins from 4B cells, fol-lowing incubations with forskolin, with and without glucocor-ticoids, were prepared using kit reagents from NE-PERTM Nu-clear and Cytoplasmic Extraction Reagent (Thermo/Pierce,Rockford, IL) as previously described (26). Protein concentra-tion was quantified by spectrophotometry using the BCA Pro-tein Assay (Thermo/Pierce, Rockford, IL). For Western Blot, 15�g of cytoplasmic or nuclear extract was loaded and separatedin a 10% Tris-Glycine gel (Invitrogen, Hopkinton, MA) forglyceraldehyde-3-phosphate dehydrogenase (GAPDH) and his-tone deacetylase 1 (HDAC1) (Santa Cruz Biotech, Santa Cruz,CA, USA), or a 6% Tris-Glycine gel (Invitrogen) for TORC 2and GR. Proteins were transferred to a PVDF membrane (GE

doi: 10.1210/me.2013-1095 mend.endojournals.org 3

Amersham Biosciences), incubated with 5% nonfat milk in 1 xTBST (TBS plus 0.05% Tween-20) for 1h and incubated over-night at 4°C with rabbit antibodies against TORC 2 (Calbio-chem/EDM Chemicals, Gibbstown, NJ), at 1:6000 dilution, orGR (H-300, Santa Cruz Biotech, Santa Cruz, CA, USA) at a1:1000 dilution. After washing in 1 x TBST, membranes wereincubated for 1h at room temperature with a horseradish per-oxidase-conjugated donkey antirabbit IgG at a dilution of1:10,000. Detection of immunoreactive bands was performedusing ECL Plus TM reagents (GE Amersham Biosciences) fol-lowed by exposure to BioMax MR film (Eastman Kodak, Roch-ester, NY, USA). After film exposure, blots were stripped andassayed for HDAC1 in the nucleus and GAPDH in cytoplasm asa loading control. The intensity of the bands was quantifiedusing the computer image analysis system, ImageJ. Results areexpressed as fold-change over the values in control rats aftercorrection for protein loading using HDAC1 for the nucleus andGAPDH for cytoplasm.

Statistical analysis. Data are represented as mean � SEM fromthe values in the number of experiments indicated in the legendof the figures. In vivo experiments were repeated at least 3 times,using pooled hypothalamic tissue of 3 rats per experimentalgroup. Differences between groups were analyzed by one- ortwo-way ANOVA followed by Fisher’s least-significant differ-ence (LSD) post hoc test when appropriate. Statistical signifi-cance was set at P � .05.

Results

Effect of restraint stress on GR and phospho-CREB re-cruitment by the CRH promoter. To determine whetherthe increases in plasma glucocorticoid levels during re-straint stress are associated with GR recruitment by theproximal CRH promoter, GR ChIP assays were per-formed in hypothalamic chromatin of intact and adrena-lectomized rats subjected to restraint stress. As shown inFigure 1-A, plasma corticosterone levels increased mark-edly, from 30.1 � 9.2 to 545 � 55 ng/ml, at 30 minutes(P � .001, n � 12) and remained significantly elevated at60 minutes restraint stress (280 � 45 ng/ml; P � .01). Asexpected in adrenalectomized rats, plasma corticosterone

levels were barely detectable and remained unchangedduring restraint (Figure 1-D).

ChIP assays showed no effect of restraint stress onCRH promoter pull down in hypothalamic chromatinimmunoprecipitated with GR antibody either at 30 or at60 minutes, in intact or adrenalectomized rats (Figure 1-B

Table 1. Primers used for qPCR detection of the CRH and Per 1 promoters.

Primer sequence product Promoter and regionF: 5�- tcagtatgttttccacacttggat-3� 112 bp CRHp � 206 to 318R: 5�- tttatcgcctccttggtgac-3�F: 5�- taatgcacacagctcaccgt-3� 257 bp CRHp � 593 to-850R: 5�- agctccttagtcttcccaagagca-3�F: 5�- cccaggcacttccctttctt �3� 107 bp CRHp � 1692 to-1798R: 5�- tctaaccccttctctgccca �3�F: 5�- ccaaggctgagtgcatgtc �3� 67 bp Per1p � 3391

to � 3458R: 5�- gcggccagcgcacta �3�

FIGURE 1. Effect of restraint stress on GR and phospho-CREBrecruitment by the CRH and Per 1 promoters in intact (A,B and C) andadrenalectomized (D,E,and F) rats. Plasma corticosteronemeasurements (A and D) and chromatin immunoprecipitation assayson hypothalamic chromatin for GR (B and E) and phospho-CREB (Cand F) were performed in basal conditions (time 0), 30 and 60 minutesduring stress. Data points are the mean and SE of the results of 4 and3 experiments (using pooled hypothalamic tissue from 3 rats perexperimental group) for intact and adrenalectomized rats, respectively.The dashed lines correspond to the Per1 promoter, and solid linesshow different regions of the CRH promoter as indicated by the key atthe bottom of the Figure. The restraint stress period is shown by thehorizontal boxes above the x axis. **, P � .001 vs respective basal; *,P � .05 vs. respective basal.


and E). In basal conditions, levels of CRH promoter as-sociated with GR were similar in intact and adrenalecto-mized rats. The percent of input pulled down by the GRantibody was 0.05 � 0.03% and 0.06 � 0.04% for intactand adrenalectomized rats respectively (not shown). Sim-ilarly, qPCR using primers directed to upstream regionsof the CRH promoter (-593 to-850 and –1692 to-1798)yielded very low levels, which were unchanged by stress(Figure 1-B and E). In contrast, Per 1 promoter immuno-precipitated with GR antibody increased by 1.9 � 0.15-fold at 30 minutes (P � .01) and 2.5 � 0.35-fold (P � .01)by 1h restraint in intact (Figure 1-B) but not in adrena-lectomized rats (Figure 1-E). Basal levels of Per1 promoterassociated with GR in hypothalamic chromatin were sig-nificantly higher in intact than in adrenalectomized rats,with percent of input pull downs of 0.32 � 0.08 (n � 4)and 0.17 � 0.03%, (n � 3), respectively (P � .05).

In contrast to the lack of CRH promoter associationwith GR during restraint, ChIP using phospho-CREB an-tibody showed significant increases in CRH promoterpull down 2.3 � 0.5 –fold the basal levels at 30 minutes(P � .03) and 1.9 � 0.3-fold at 1h (P � .05, n � 3)restraint stress in intact rats (Figure 1-C). Similar changesin phospho-CREB recruitment by the CRH promoterwere found in adrenalectomized rats with increases of2.7 � 0.4- and 2.9 � 0.75-fold the basal levels at 30minutes and 1h, respectively (P � .03, n � 3 at both timepoints, Figure 1-F). No significant differences were foundbetween the percent CRH promoter pull down with phos-pho-CREB antibody in hypothalamic chromatin from in-tact and adrenalectomized rats (0.05 � 0.01- and 0.06 �0.02% of the input in intact and adrenalectomized rats,respectively). Levels of Per-1 promoter pull-down by thephospho-CREB antibody were low and did not changeduring restraint (Figure 1-C and F).

Effect of glucocorticoid injection on GR andphospho-CREB recruitment by the CRH promoter

Injection of HBC corticosterone (1 mg per rat, ip) inintact rats increased plasma corticosterone from basallevels of 24.4 � 17.6 ng/ml to 350.4 � 3.4 ng/ml by 30minutes (P � .001, n � 4). Similar changes from 6.4 � 3.4to 379 � 4.6 by 30 minutes were observed in adrenalec-tomized rats (P � .01, n � 3). At 2 hours levels haddecreased markedly but remained significantly higherthan basal values in both intact and adrenalectomized rats(56.7 � 8.7 and 59.7 � 7.1, respectively) (Figure 2-A andD).

Similar to the observations during restraint stress, ele-vations of plasma corticosterone levels induced by HBCcorticosterone injection had no significant effect on CRHpromoter pull down by the GR antibody either in intact

(Figure 2-B) or adrenalectomized rats (Figure 2-E). Aswith restraint stress, primers directed to CRH promoterregions –593 to-850 and –1692 to-1798 also failed todetect significant changes following corticosterone injec-tion (Figure 2-B and E). Again, elevations in plasma cor-ticosterone increased Per1 promoter pull down by the GRantibody. In 4 experiments in intact rats Per-1 promoterpull down increased by 2.9 � 0.4-fold basal values at 30minutes (P � .05) and had returned to near basal levels by2h (1.2 � 0.16-fold the basal levels). More marked Per-1promoter pull down by the GR antibody following HBC-corticosterone injection was observed in adrenalecto-mized rats, with a 4.9 � 1.3-fold increase at 30 minutes(P � .03), and remaining 3.4 � 1.1-fold the basal valuestwo hours after injection (P � .05). ChIP using the phos-

FIGURE 2. Effect of corticosterone injection on GR and phospho-CREB recruitment by the CRH and Per 1 promoters in intact (A,B andC) and adrenalectomized (D,E,and F) rats. Intact and adrenalectomizedrats received an ip injection of 1 mg of cyclodextrine encapsulatedcorticosterone (HBC corticosterone) and were killed in basal conditions(time 0), 30 minutes and 2 hours after injection for measurement ofplasma corticosterone (A and D) and chromatin immunoprecipitationassays on hypothalamic chromatin for GR (B and E) and phospho-CREB(C and F). Data points are the mean and SE of the results of 4 and 3experiments (using pooled hypothalamic tissue from 3 rats per groupin each experiment) for intact and adrenalectomized rats, respectively.The dashed lines correspond to the Per1 promoter, and solid linesshow different regions of the CRH promoter as indicated by the key atthe bottom of the Figure. The time of injection is indicated by thearrow. ***, P � .001 vs respective basal; **, P � .01 vs respectivebasal; *, P � .05 vs respective basal.


pho-CREB antibody showed no significant changes inCRH or Per1 promoter pull down following 1 mg HBCcorticosterone injection (Figure 2-C and F).

Since previous reports showing marked decreases instress-induced CRH hnRNA used higher doses of corti-costerone in intact rats (12), we examined GR interactionwith the CRH promoter in groups of intact rats receivinginjections of 10 mg HBC-corticosterone. In these rats,plasma corticosterone levels increased from basal levels of12.2 � 2.3 to 1389.7 � 143 and 87.0 � 39.4 ng/ml, at 30minutes and 2 hours after injection, respectively (Figure3-A). As shown in Figure 3-B, these larger increases inplasma corticosterone were equally ineffective in increas-ing CRH promoter pull down by the GR antibody, usingeither primers against the GRE/CRE region (1.2-fold thebasal levels, P � .07, n � 2) or against the –1692 to-1798region. However, similar to our findings from the stressand lower corticosterone dose experiments, 10 mg HBCcorticosterone induced marked increases in Per1 pro-moter pull down (4.8 � 0.8 at 30 minutes, P � .01, n �

2). Two hours after corticosterone injection Per1 pro-moter pull down values had returned near to basal levels.

Similar to the results with the low dose of corticoste-rone, ChIP using phospho-CREB antibody in chromatinfrom rats receiving 10 mg HBC corticosterone injectionshowed no significant changes in CRH or Per1 promoterpull down either at 30 minutes or 2 hours after injection(Figure 3-C).

Effect of glucocorticoids on endogenous CRH transcrip-tion in primary cultures of hypothalamic cells. To deter-mine whether glucocorticoids can inhibit CRH transcrip-tion directly in CRH neurons, we examined the effect ofglucocorticoid exposure for 18h or 30 minutes on theincreases of CRH hnRNA production induced by the ad-enylate cyclase stimulator, forskolin, in primary culturesof hypothalamic neurons. Incubation of control cultureswith 1 �M forskolin for 45 minutes increased CRH hn-RNA production by 3.82 � 0.5-fold the basal levels (Fig-ure 4, P � 0. 001, n � 4). Addition of 100 nM cortico-sterone 30 minutes prior to forskolin addition caused a32.3 � 8.6% decrease in forskolin-stimulated CRH hn-RNA production, which was statistically significant onlyafter log transformation of the data (P � .05, n � 4).Addition of corticosterone 18 hours before forskolin hadno significant effect on the increase in CRH hnRNA stim-ulated by forskolin. Analysis by two-way ANOVA afterlog transformation of the data showed a significant effectof forskolin (F � 56.9; P � .001) and an interactionbetween glucocorticoids and forskolin (F � 4.2; P � .05).

FIGURE 3. Effect of a supra-physiological dose of corticosterone onGR and phospho-CREB recruitment by the CRH and Per 1 promoters inintact rats Rats received an ip injection of 10 mg of cyclodextrineencapsulated corticosterone (HBC corticosterone) and were killedeither in basal conditions (time 0), or 30 minutes and 2 hours afterinjection, for measurement of plasma corticosterone (A) and chromatinimmunoprecipitation assays on hypothalamic chromatin for GR (B) andphospho-CREB (C). Data points are the mean and SE of the results of 2experiments using pooled hypothalamic tissue from 3 rats per group ineach experiment. The dashed lines correspond to the Per1 promoter,solid lines show two regions of the CRH promoter; black, CRE/GREregion (-206 to 318) and gray –1692 to-1798. The time of injection isindicated by the arrow. ***, P � .001 vs respective basal; **, P � .01vs respective basal.

FIGURE 4. Effect of corticosterone on forskolin-stimulated CRHhnRNA in primary cultures of hypothalamic neurons. At day 10 ofculture, fetal rat hypothalamic neuronal cultures were exposed to 100nM corticosterone for 18h or 30 minutes before addition of forskolin(Fsk) for an additional 45 minutes before RNA preparation. Data pointsare the mean and SE of CRH hnRNA levels, normalized to GAPDHmRNA in 4 experiments. ***, P � .001 compared with basal; # P �.05 lower than Fsk at 0min. Significance was calculated following logtransformation of the data (only the effect of Fsk was significantwithout log transformation).


Effect of glucocorticoids on CRH promoter activity andCREB signaling in 4B cells. As shown in Figure 5-A, en-dogenous GR were clearly detectable by western blot incytoplasmic and nuclear proteins from 4B cells. In basalconditions, GR levels were very low in the nucleus andincreased markedly after 30 minutes incubation with 100nM corticosterone (P � .001, n � 3). Incubation withcorticosterone for 18h tended to decrease GR levels in thecell, but nuclear levels were still elevated (P � .001) andnot significantly different than nuclear levels at 30 min-utes. Forskolin treatment for 30 minutes had no signifi-cant effect on GR trafficking in the presence or absence ofglucocorticoids.

In 4B cells transfected with the CRH promoter-drivenluciferase construct, incubation of the cells with forskolincaused marked increases in CRH promoter activity (6.1 �0.9-fold the basal values, P � .001, n � 4). Addition of100 nM corticosterone at 30 minutes prior to forskolinresulted in a 36.3 � 7.4% decrease in forskolin-stimu-lated CRH promoter activity (3.9 � 0.7-fold the basalvalues), which was statistically significant only after logtransformation or the data (P � .05, n � 4). Incubation ofthe cells with corticosterone for 18h prior to addition offorskolin had no effect on the stimulatory action of fors-kolin or basal CRH promoter activity (Figure 5-B). Two-way-ANOVA analysis of the log transformed datashowed a marked effect of forskolin (F � 76.9; P � .001)

and significant interaction between forskolin and cortico-sterone (F � 3.9; P � .04).

To determine whether glucocorticoids can alter the ac-tivation of key proteins required for CRH transcription,nuclear accumulation of CREB and TORC2 was mea-sured by western blot in 4B cells stimulated with forskolinin the presence or absence of 100 nM corticosterone. Inbasal conditions, phospho-CREB levels were undetect-able in the cytoplasm (not shown) and very low in thenucleus (Figure 6). Incubation of the cells with forskolinresulted in a marked increase (31.7 � 7.9-fold) in nuclearphospho-CREB levels (P � .001, n � 3). Phospho-CREBlevels remained barely detectable in the cytoplasm (notshown). Exposure to corticosterone either for 30 minutesor 18h prior to forskolin addition had no significant effecton forskolin induced phospho-CREB accumulation in thenucleus (Figure 6). Two-way-ANOVA showed a strongeffect of forskolin increasing nuclear phospho-CREB (F �18.7; P � .002), and no effect of corticosterone (F � 0.4,P � .05).

Similarly, 100 nM corticosterone had no effect on nu-clear translocation of the CREB coactivator, TORC2. Inbasal conditions, the typical two bands corresponding tothe phosphorylated and dephosphorylated forms ofTORC2 were observed in the cytoplasm (Figure 7-A).Following incubation with forskolin for 30 minutes, the

upper band (phosphorylatedTORC2) decreased to near unde-tectable levels. While in nuclear pro-teins the intensity of both TORC2bands was weak in basal conditions,30 minutes incubation with forsko-lin induced marked increases in thefastest migrating band, correspond-ing to dephosphorylated TORC2(Figure 7-B; P � .001, n � 3). Expo-sure of the cells to 100 nM cortico-sterone 30 minutes or 18h prior toaddition of forskolin had no signifi-cant effect on the changes in cyto-plasmic or nuclear levels of TORC2induced by forskolin (Figure 7-Aand B). Two-way-ANOVA showeda strong effect of forskolin increas-ing nuclear dephospho-TORC2(F � 15.1; P � .002), and no effectof corticosterone (F � 0.3, P � .05).

FIGURE 5. Effect of corticosterone on glucocorticoid receptor (GR) translocation (A) and CRHpromoter activity (B) in 4B cells transfected with a CRH promoter driven luciferase reporter geneCells were incubated with 100 nM corticosterone for 18 hours or 30 minutes (0.5h) with andwithout forskolin for 30 minutes prior to protein extraction for western blot, or treatment withforskolin for 6 additional hours for luciferase assays. Western blot images are representative of 3experiments. Data are expressed as fold-change after normalization for GAPDH in the cytoplasmor HDAC in the nucleus. Data points are the mean and SE of values obtained in 4 experiments.After log transformation of the data, ***, P � .001 vs basal at time 0. #, P � .05 compared withFsk no corticosterone control (time 0) or 18h preincubation with corticosterone. Only the effectof Fsk was significant without log transformation of the data.


Discussion

Although it is well accepted that a key component ofnegative glucocorticoid feedback on HPA axis activity isthe inhibition of CRH transcription, the molecular mech-anisms mediating this inhibition are still unclear (1, 30).Since current knowledge of the molecular mechanisms ofrepression of CRH transcription by glucocorticoids de-

rive mostly from in vitro studies in heterologous systems,we aimed to study the effect of increases in circulatingglucocorticoids within the physiological range on the in-teraction of the GR with the proximal CRH promoter aswell as the activation of transcription factors essential fortranscriptional activation. The major findings of thisstudy are that association of GR with the proximal CRHpromoter does not appear to be a component of the mech-anism for glucocorticoid repression of CRH gene tran-scription in vivo, and further that glucocorticoids do notaffect either nuclear accumulation of the CRH transcrip-tional regulators phospho-CREB and TORC2, or the re-cruitment of phospho-CREB to the CRH promoter.

While the proximal CRH promoter does not containclassical paired and palindromic consensus GRE sites, it isgenerally accepted that GR interacts with the CRH pro-moter acting as a transcriptional repressor. GRE half siteshave been identified in the CRH promoter and DNase Iprotection assays in promoter fragments incubated withrecombinant GR DNA-binding domain (DBD) have re-vealed several potential GR binding sites (19). Of theseputative sites, Malkoski et al (20) identified a highly con-served region between –278 and –249 bp of the CRHpromoter, which was shown to be essential for glucocor-ticoid dependent repression. Deletion of this nGRE regiondecreased both cAMP stimulation and glucocorticoid re-pression of CRH promoter activity in AtT-20 cells (22).The same region of the CRH promoter in Xenopus laeviswas shown to bind GR, in gel shift assays (24). However,the role of these putative GREs in transcriptional repres-

sion of the CRH gene is unclear. Forexample, mutagenesis of none of thesites identified by GR-DBD DNase Iprotection assays was found to me-diate negative glucocorticoid regula-tion of CRH-reporter gene expres-sion in AtT-20 cells (19). Similarly,deletion or mutation of the negativeGRE did not affect GR-dependentglucocorticoid suppression of CRHpromoter activity in the human neu-ronal cell line BE (2)C (21).

The effects of glucocorticoids onCRH promoter activity using wildtype promoter are variable depend-ing on the cell line and experimentalconditions used. In this regard, theinhibitory effect of glucocorticoidson CRH promoter activity in the hy-pothalamic cell line 4B in the presentexperiments, using a reporter genecontaining the putative negative

FIGURE 6. Effect of corticosterone on nuclear accumulation ofphospho-CREB in 4B cells Cells were exposed to 100 nMcorticosterone for 30 minutes (0.5h) or 18 hours before treatment withforskolin (Fsk) for 30 additional minutes before protein extraction forwestern blot. Image is representative of 3 experiments. Bars representthe mean and SE of data obtained from 3 experiments. Data areexpressed as fold-change after normalization for histone deacetylase(HDAC) levels. ***, P � .001 compared with vehicle

FIGURE 7. Effect of corticosterone on nuclear translocation of TORC2 in 4B cells Cells wereexposed to 100 nM corticosterone for 30 minutes (0.5h) or 18 hours before treatment withforskolin (Fsk) for 30 additional minutes before protein extraction for western blot. Images arerepresentative of 3 experiments. The arrows indicate the two TORC2 bands corresponding tophospho-TORC (slower migrating band evident in the cytoplasm in the absence of forskolin) anddephospho-TORC. Bars represent the mean and SE of data obtained from 3 experiments. Dataare expressed as fold-change after normalization for GAPDH in the cytoplasm or HDAC in thenucleus. ***, P � .001 compared with vehicle


GRE, and previous reports using a larger promoter frag-ment (31), is much smaller than the consistent inhibitionreported in the pituitary cell line AtT-20 (19, 20, 32).Since the aim of the present work was to understand thephysiological effects of glucocorticoids on endogenousCRH transcription, AtT-20 cells, which do not expressCRH, were not used in this study. Although reporter geneassays and in vitro DNA binding assays are useful toolsfor characterizing the promoter region of a gene, conclu-sions concerning physiological regulation can be ques-tionable due to the lack of context of the reporter genewith the chromatin landscape. On the other hand, the useof intronic qRT-PCR to measure changes in primary tran-script in primary cultures of hypothalamic neurons pro-vides a useful tool to evaluate the effects of glucocortico-ids on endogenous hypothalamic CRH transcription.Nevertheless, similar to the results in 4B cells, corticoste-rone was a weak inhibitor of cyclic AMP-stimulated en-dogenous CRH transcription in primary cultures of hy-pothalamic neurons. This minor effect (statisticallysignificant only after log transformation of the data) wasevident solely after short term (30min) exposure to corti-costerone. Previous studies showing decreased expressionof CRH mRNA following exposure of hypothalamic neu-ronal cultures to micromolar concentrations of the syn-thetic corticosteroid dexamethasone (33), or long-term(24h) hypothalamic organotypic cultures to dexametha-sone or corticosterone (34) have suggested that glucocor-ticoids have a direct repressor effect on CRH transcrip-tion. However, these long term effects of glucocorticoidson CRH mRNA levels could be influenced by mRNAdegradation and do not necessarily reflect changes intranscription. The lack of significant inhibition of CRHprimary transcript production in hypothalamic neuronsby physiological concentrations of the natural glucocor-ticoid, corticosterone, in the present experiments, isagainst the view that glucocorticoids directly repressCRH gene transcription. While not assessed in primaryneuronal cultures, the concentrations of corticosteroneused were highly effective in causing marked GR translo-cation to the nucleus both at 30 minutes and 18 hoursexposure in 4B cells.

An additional approach to address this problem was toexamine the interaction of the GR with the endogenousCRH promoter following in vivo changes in circulatingglucocorticoids. In contrast to the DNA-GR interactionsobserved in gel shift and DNase I protection assays onCRH promoter fragments, in the present study usingchromatin immunoprecipitation, ex vivo, there was noincrease in recruitment of GR by the endogenous proxi-mal CRH promoter following increases in circulating cor-ticosterone in any of the experimental conditions used

(adrenalectomized and intact rats, physiological and su-pra-physiological doses of glucocorticoids). These ChIPexperiments were performed at time points showing thatthe marked elevations in circulating corticosterone andCRH hnRNA observed during stress had already de-clined. Since it can be assumed that occupancy of theCRH negative GRE by the GR precedes transcriptionalrepression, it is unlikely that the examination of addi-tional time points beyond those in the current studywould have shown association of the GR with the CRHpromoter. In addition, genome wide studies show thatGR interaction with chromatin is very rapid with sitesbeing occupied by 1h (35). The lack of increased CRHpromoter binding was consistently observed in spite ofusing a cocktail of GR antibodies designed to recognizedifferent epitopes of the GR. The immunoprecipitation ofchromatin was clearly effective as seen by marked in-creases in Per 1 promoter, a recognized GR regulated gene(36), following stress in intact rats or glucocorticoid ad-ministration in intact or adrenalectomized rats. Consis-tent with a previous report in prefrontal cortex chromatin(37), immunoprecipitation with the GR antibody yieldeddetectable CRH promoter compared with the negativecontrols. However, the significance of this in vivo associ-ation of GR to the CRH promoter in the absence of datashowing changes following increased circulating gluco-corticoids is unclear. Recent in vitro reports show in-creases in GR recruitment by the endogenous or tran-siently transfected CRH promoter in 4B cells, followingadministration of the synthetic corticosteroid dexameth-asone (38, 39). However, current passages of these cells inour laboratory do not exhibit regulated endogenous CRHexpression (26, 40). While the effects of dexamethasoneon GR binding to the CRH promoter in 4B cells mayreflect a mechanism for regulation of CRH expression insome physiological or pathological conditions, examina-tion of the interaction of the GR with the endogenousCRH promoter in vivo was a primary goal of the currentstudy, and therefore we did not assess the effects of cor-ticosterone on GR recruitment by the CRH promoter inthis cell line. The 112 bp PCR product amplified by theCRH promoter primers used in the present study includedboth the CRE and negative GRE, and thus the lack of anincrease of this fragment after GR immunoprecipitationsuggests that direct interaction of the GR with the chro-matin at this site does not mediate repression of CRHtranscription by glucocorticoids. Since chromatin frag-mentation prior to immunoprecipitation was pro-grammed to yield 500 to 1000bp fragments and ourprimer sets covered up to –1800, it is unlikely that thereare active in vivo GR binding sites within 2000 bp up-stream of the transcription start site.


On the other hand, based on the observation that an18-bp fragment containing the CRE was sufficient forregulation by both cAMP and glucocorticoids, and theinability of mutagenesis of the GRE like sites in the prox-imal CRH promoter to alter glucocorticoid repression,Guardiola-Diaz et al (19) suggested that transcriptionalrepression by glucocorticoids involves protein-protein in-teractions of the GR with a transcriptional complex bind-ing the CRE. This possibility cannot be ruled out in thepresent immunoprecipitation experiments, since a short-arm crosslinker, formaldehyde, was used to stabilize GR-DNA interactions prior to sonication and immunopre-cipitation. It is also possible that GR interacts with sitesupstream of the 2000 bp scanned in the present experi-ments, resulting in changes in chromatin configurationand interaction with the CRE region in the proximal pro-moter. This kind of interaction of GR with distant ele-ments has been described for a number of genes, including54 kDa progesterone receptor-associated immunophilin(FKBP5), Lipocalin2 (Lcn2), and others (41–43).

In addition it is likely that indirect mechanisms play arole in glucocorticoid induced repression of CRH expres-sion observed in vivo. This could involve alteration ofsignaling pathways and/or the activation of transcriptionfactors essential for CRH transcription. Consistent withprevious reports and the recognized importance of CREBin the activation of CRH transcription, activation of neu-ral circuitry by restraint stress induced CREB recruitmentby the CRH promoter irrespective of the presence of glu-cocorticoids (intact and adrenalectomized rats). While ithas been reported that glucocorticoid administrationabolishes stress-induced increases in phospho-CREB im-munoreactivity in the PVN (44), this effect could reflectinhibition of afferent pathways to the PVN, rather thandirect effects on the CRH neuron. The present demon-stration that glucocorticoids do not inhibit nuclear accu-mulation of phospho-CREB is consistent with previousstudies (31, 33) and suggests that glucocorticoids do notinterfere with CREB phosphorylation. Most importantly,the similar basal and stress-stimulated phospho-CREB re-cruitment by the CRH promoter observed in intact andadrenalectomized rats shown in this study indicates thatglucocorticoids do not impede CREB access to the CRE inthe CRH promoter.

We have previously shown that CREB is essential butnot sufficient for activation of CRH transcription, whichalso requires the coactivator transducer of regulatedCREB activity (TORC), also known as CREB regulatedtranscription coactivator (CRTC) (29, 45). There are 3TORC isoforms (46), all of which are present in CRHneurons (47), but TORC2 appears to be the most impor-tant (29). Glucocorticoids upregulate mRNA levels of salt

inducible kinase 1 (SIK1), the enzyme responsible forTORC inactivation via phosphorylation of Ser 171 (48,49). Therefore, it is conceivable that glucocorticoids pre-vent TORC activation and nuclear translocation by in-creasing SIK1 activity. However, in this study incubationof hypothalamic cells with corticosterone had no effect onTORC2 translocation to the nucleus, suggesting that glu-cocorticoids do not affect TORC2 activation directly inthe cell. On the other hand, mice with GR-targeted dele-tion in the PVN have decreased cytoplasmic phosphory-lated TORC in PVN CRH neurons (33). The same studyshows a reduction in nuclear TORC2 6h after adminis-tration of high doses of dexamethasone (10 mg/kg) inwild type mice but not in PVN GR knockouts. A numberof possibilities, including lack of specificity of the Sim1-Cre mouse for CRH neurons, long-term GR knockdown,the use of supraphysiological doses of a synthetic gluco-corticoid and species differences could explain these dis-parate results. Additional factors are known to positivelyregulate CRH expression in the PVN, including biogenicamines, cytokines and the protein kinase A and C path-ways (for review, see (50)), and these factors may be tar-gets for negative regulation by glucocorticoids. Proteinkinase A (PKA) has been implicated as a target for gluco-corticoid regulation of CRH based on known protein-protein interactions between GR and PKA (51) and theinability of dexamethasone to inhibit CRH expressioninduced by overexpression of the PKA catalytic subunit(21). Kageyama et al (31), on the other hand, have shownthat dexamethasone increased rather than decreased cy-clic AMP production and protein kinase A activity in 4Bcells. Based on the present experiments in vivo, it is un-likely that activated GR significantly suppressed thecAMP/ PKA pathway, as we observed no effects on therecruitment of phospho-CREB to the CRH promoter.

An additional mechanism for glucocorticoid inhibitionof CRH transcription could involve afferent pathways tothe PVN. Against this possibility are reports showing afailure of glucocorticoids to block stress-induced c-fosactivation in the PVN (52, 53), though others have shownopposite findings (54) and there is evidence supportingmodulatory effects of glucocorticoids at sites distal fromthe CRH neuron. For example, microdialysis studies haveshown that glucocorticoids inhibit stress-induced norepi-nephrine release from the PVN (55). More recently, tox-in-induced lesions of catecholaminergic innervation ofthe PVN were shown to abolish the inhibitory effect ofcorticosterone on CRH expression (56). Modulation ofcatecholaminergic receptors could also contribute to glu-cocorticoid inhibition of CRH neuron function, as sug-gested by the converse effects of adrenalectomy and glu-cocorticoid administration, with respective increases and


decreases of alpha adrenergic receptor content in the PVN(57). Also, in vitro studies have shown switching in ad-renergic receptor �1–�2 in hypothalamic sections afterincubation with glucocorticoids (58). Additional evi-dence for extra-PVN sites for feedback is provided byexperiments in mice bearing deletion of GR in the limbicforebrain but preserved GR in the PVN (59). No data onthe effect of glucocorticoids on hypothalamic CRH tran-scription is available in these mice but they have delayedinhibition of HPA axis responses to psychogenic stres-sors, and deficient suppression of the increases in circu-lating corticosterone by dexamethasone (60).

The current study indicates that negative glucocorti-coid feedback on CRH gene expression is mediated nei-ther via direct interaction between GR and DNA responseelements in the CRH proximal promoter nor by interfer-ing with the activation of transcriptional proteins essen-tial for CRH transcription, such as phospho-CREB andTORC2. While GR interaction at distal promoter sites orwith other transcriptional proteins may play a role in theminor inhibition of CRH transcription observed in vitro,the data suggest that the repressor effects of glucocorti-coids on CRH expression in vivo are predominantly in-direct, through modulation of pathways regulating CRHneuron function.

Acknowledgments

This work was supported by the Intramural Research Program,National Institute of Child Health and Human Development

Received April 4, 2013. Accepted September 16, 2013.Address all correspondence and requests for reprints to:

Greti Aguilera, Section on Endocrine Physiology, Eunice Ken-nedy Shriver Institute of Child Health and Human Develop-ment, NIH, Bldg 10/CRC, Rm 1E-3330, Bethesda, MD 20892,Telephone: 301 496 6964, Fax: 301 402 6163,Greti [email protected].

Disclosure summary: The authors have nothing to discloseThis work was supported by the Intramural Research Pro-

gram, National Institute of Child Health and HumanDevelopment.

References

1. Aguilera G, Liu Y. The molecular physiology of CRH neurons.Front Neuroendocrinol. 2012;33:67–84.

2. Antoni FA. Hypothalamic control of adrenocorticotropin secre-tion: advances since the discovery of 41-residue corticotropin-re-leasing factor. Endocr Rev. 1986;7:351–378.

3. Claes S. Corticotropin-releasing hormone (CRH) in psychiatry:from stress to psychopathology. Annals Medicine (Helsinki). 2004;36:50–61.

4. McEwen BS. Protective and damaging effects of stress mediators.N Engl J Med. 1998;338:171–179.

5. Munck A, Naray-Fejes-Toth A. Glucocorticoids and stress: permis-sive and suppressive actions. Ann N Y Acad Sci. 1994;746:115–130.

6. Dallman MF. Fast glucocorticoid actions on brain: Back to thefuture. Frontiers in Neuroendocrinology. 2005;26:103–108.

7. Myers B, McKlveen J, Herman J. Neural Regulation of the StressResponse: The Many Faces of Feedback. Cell Mol Neurobiol. 2012;32:683–694.

8. Dallman MF, Akana SF, Levin N, Walker C-D, Bradbury MJ, Sue-maru S, Scribner KS. Corticosteroids and the control of function inthe hypothalamo- pituitary-adrenal (HPA) axis. Ann N Y Acad Sci.1994;746:22–28.

9. Lightman SL, Young WS, III. Corticotrophin-releasing factor, va-sopressin and pro-opiomelanocortin mRNA responses to stress andopiates in the rat. J Physiol. 1988;403:511–523.

10. Ma XM, Aguilera G. Differential regulation of corticotropin-re-leasing hormone and vasopressin transcription by glucocorticoids.Endocrinology. 1999;140:5642–5650.

11. Makino S, Smith MA, Gold PW. Increased expression of cortico-tropin-releasing hormone and vasopressin messenger ribonucleicacid (mRNA) in the hypothalamic paraventricular nucleus duringrepeated stress: association with reduction in glucocorticoid recep-tor mRNA levels. Endocrinology. 1995;136:3299–3309.

12. Aguilera G, Kiss A, Liu Y, Kamitakahara A. Negative regulation ofcorticotropin releasing factor expression and limitation of stressresponse. Stress. 2007;10:153–161.

13. Harbuz MS. Glucocorticoid inhibition of stress-induced changes inhypothalamic corticotrophin-releasing factor messenger RNA andproenkephalin A messenger RNA. Neuropeptides. 1989;14:17–20.

14. Kovacs KJ, Makara GB. Corticosterone and dexamethasone act atdifferent brain sites to inhibit adrenalectomy-induced adrenocorti-cotropin hypersecretion. Brain Res. 1988;474:205–210.

15. Sawchenko PE. Evidence for a local site of action for glucocortico-ids in inhibiting CRF and vasopressin expression in the paraven-tricular nucleus. Brain Res. 1987;403:213–223.

16. Kretz O, Reichardt HM, Schutz G, Bock R. Corticotropin-releasinghormone expression is the major target for glucocorticoid feed-back-control at the hypothalamic level. Brain Res. 1999;818:488–491.

17. Fenoglio KA, Brunson KL, Vishai-Eliner S, Chen Y, Baram TZ.Region-Specific Onset of Handling-Induced Changes in Corticotro-pin-Releasing Factor and Glucocorticoid Receptor Expression. En-docrinology. 2004;145:2702–2706.

18. Liposits Z. Ultrastructural localization of glucocorticoid receptor(GR) in hypothalamic paraventricular neurons synthesizing corti-cotropin releasing factor (CRF). Histochemistry. 1987;87:407–412.

19. Guardiola-Diaz HM, Kolinske JS, Gates LH, Seasholtz AF. Nega-tive glucorticoid regulation of cyclic adenosine 3�, 5�-monophos-phate-stimulated corticotropin-releasing hormone-reporter expres-sion in AtT-20 cells. Mol Endocrinol. 1996;10:317–329.

20. Malkoski SP, Handanos CM, Dorin RI. Localization of a negativeglucocorticoid response element of the human corticotropin releas-ing hormone gene. Mol Cell Endocrinol. 1997;127:189–199.

21. Yamamori E, Iwasaki Y, Taguchi T, Nishiyama M, Yoshida M,Asai M, Oiso Y, Itoi K, Kambayashi M, Hashimoto K. Molecularmechanisms for corticotropin-releasing hormone gene repressionby glucocorticoid in BE(2)C neuronal cell line. Mol Cell Endocri-nol. 2007;264:142–148.

22. Malkoski SP, Dorin RI. Composite glucocorticoid regulation at afunctionally defined negative glucocorticoid response element ofthe human corticotropin-releasing hormone gene. Mol Endocrinol.1999;13:1629–1644.

23. Van LP, Spengler DH, Holsboer F. Glucocorticoid Repression of3�,5�-Cyclic-Adenosine Monophosphate-Dependent Human Corti-


mailto:Greti [email protected]

cotropin-Releasing-Hormone Gene Promoter Activity in a Trans-fected Mouse Anterior Pituitary Cell Line. Endocrinology. 1990;127:1412–1418.

24. Yao M, Schulkin J, Denver RJ. Evolutionarily Conserved Gluco-corticoid Regulation of Corticotropin-Releasing Factor Expression.Endocrinology. 2008;149:2352–2360.

25. Nicholson RC, King BR, Smith R. Complex regulatory interactionscontrol CRH gene expression. Front Biosci. 2004;9:32–39.

26. Liu Y, Kamitakahara A, Kim A, Aguilera G. Cyclic Adenosine 3�,5�-Monophosphate Responsive Element Binding Protein Phosphory-lation Is Required But Not Sufficient for Activation of Corticotro-pin-Releasing Hormone Transcription. Endocrinology. 2008;149:3512–3520.

27. Kageyama K, Suda T. Transcriptional Regulation of HypothalamicCorticotropin-Releasing Factor Gene. Vitamins, Hormones. 2010;82:301–317.

28. Nikodemova M, Kasckow J, Liu H, Manganiello V, Aguilera G.Cyclic Adenosine 3�-5� Monophosphate Regulation of Corticotro-pin-Releasing Hormone Promoter Activity in AtT-20 Cells and in aTransformed Hypothalamic Cell Line. Endocrinology. 2003;144:1292–1300.

29. Liu Y, Coello AG, Grinevich V, Aguilera G. Involvement of Trans-ducer of Regulated cAMP Response Element-Binding Protein Ac-tivity on Corticotropin Releasing Hormone Transcription. Endo-crinology. 2010;151:1109–1118.

30. Watts AG. Glucocorticoid regulation of peptide genes in neuroen-docrine CRH neurons: A complexity beyond negative feedback.Front Neuroendocrinol. 2010;26:109–130.

31. Kageyama K, Akimoto K, Suda T. Corticotrophin-releasing factorgene transcription is directly activated after deprivation of gluco-corticoids in hypothalamic cells. Journal of neuroendocrinology.2010;22:971–978.

32. Adler GK, Smas CM, Majzoub JA. Expression and dexamethasoneregulation of the human corticotropin-releasing hormone gene in amouse anterior pituitary cell line. J Biol Chem. 1988;263:5846–5852.

33. Jeanneteau FD, Lambert WM, Ismaili N, Bath KG, Lee FS, Gara-bedian MJ, Chao MV. BDNF and glucocorticoids regulate cortico-trophin-releasing hormone (CRH) homeostasis in the hypothala-mus. Proc Natl Acad Sci. 2012;109:1305–1310.

34. Bali B, Ferenczi S, Kovacs KJ. Direct Inhibitory Effect of Glucocor-ticoids on Corticotrophin-releasing hormone gene expression inneurones of the paraventricular nucleus in rat hypothalamic orga-notypic cultures. J Neuroendocrinol. 2008;20:1045–1051.

35. Grontved L, John S, Baek S, Liu Y, Buckley JR, Vinson C, AguileraG, Hager GL. C/EBP maintains chromatin accessibility in liver andfacilitates glucocorticoid receptor recruitment to steroid responseelements. EMBO J. 2013;32:1568–1583.

36. Conway-Campbell BL, Sarabdjitsingh RA, McKenna MA, PooleyJR, Kershaw YM, Meijer OC, De Kloet ER, Lightman SL. Gluco-corticoid Ultradian Rhythmicity Directs Cyclical Gene Pulsing ofthe Clock Gene Period 1 in Rat Hippocampus. J Neuroendocrinol.2010;22:1093–1100.

37. Meng QY, Chen XN, Tong DL, Zhou JN. Stress and glucocortico-ids regulated corticotropin releasing factor in rat prefrontal cortex.Mol Cell Endocrinol. 2011;342:54–63.

38. Przybycien-Szymanska MM, Mott NN, Pak TR. Alcohol dysregu-lates corticotropin-releasing-hormone (CRH) promoter activity byinterfering with the negative glucocorticoid response element(nGRE). PlosOne. 2011;6:e26647.

39. Sharma D, Bhave S, Gregg E, Uht R. Dexamethasone Induces aPutative Repressor Complex and Chromatin Modifications in theCRH Promoter. Mol Endocrinol. 2013;27:1142–1152.

40. Liu Y, Kalintchenko N, Sassone-Corsi P, Aguilera G. Inhibition ofcorticotrophin releasing hormone transcription by induciblecAMP-early repressor (ICER) in the hypothalamic cell line, 4BJ Neuroendocrinol. 2006;18:42–49.

41. Hakim O, John S, Ling JQ, Biddie SC, Hoffman AR, Hager GL.Glucocorticoid Receptor Activation of the Ciz1-Lcn2 Locus byLong Range Interactions. J Biol Chem. 2009;284:6048–6052.

42. Paakinaho V, Makkonen H, Jaaskelainen T, Palvimo JJ. Glucocor-ticoid Receptor Activates Poised FKBP51 Locus through Long-Dis-tance Interactions. Mol Endocrinol. 2010;24:511–525.

43. So A, Chaivorapol C, Bolton E, Li H, Yamamoto K. Determinantsof cell- and gene-specific transcriptional regulation by the glucocor-ticoid receptor. PLOS Genetics. 2007;3:e94.

44. Legradi G, Holzer D, Kapcala LP, Lechan RM. Glucocorticoidsinhibit stress-induced phosphorylation of CREB in corticotropin-releasing hormone neurons of the hypothalamic paraventricularnucleus. Neuroendocrinology. 1997;66:86–97.

45. Liu Y, Knobloch S, Grinevich V, and Aguilera G. Stress inducesnuclear translocation of the CREB co-activator, transducer of reg-ulated CREB activity (TORC) in corticotropin releasing hormoneneurons. J Neuroendocrinol. 2011;23:216–223.

46. Conkright MD, Canettieri G, Screaton R, Guzman E, Miraglia L,Hogenesch JB, Montminy M. TORCs: Transducers of RegulatedCREB Activity. Molecular Cell. 2003;12:413–423.

47. Watts AG, Sanchez-Watts G, Liu Y, Aguilera G. The Distribution ofMessenger RNAs Encoding the Three Isoforms of the Transducer ofRegulated cAMP Responsive Element Binding Protein Activity inthe Rat Forebrain. J Neuroendocrinol. 2011;23:754–766.

48. Liu Y, Poon V, Sanchez-Watts G, Watts AG, Takemori H, AguileraG. Salt-Inducible Kinase Is Involved in the Regulation of Cortico-tropin-Releasing Hormone Transcription in Hypothalamic Neu-rons in Rats. Endocrinology. 2012;153:223–233.

49. Takemori H, Okamoto M. Regulation of CREB-mediated geneexpression by salt inducible kinase. J Steroid Biochem Mol Biol.2008;108:287–291.

50. Kasckow J, Mulchahey JJ, Aguilera G, Pisarska M, NikodemovaM, Chen HC, Herman JP, Murphy EK, Liu Y, Rizvi TA, Dautzen-berg FM, Sheriff S. Corticotropin-Releasing Hormone (CRH) Ex-pression and Protein Kinase A Mediated CRH Receptor Signallingin an Immortalized Hypothalamic Cell Line. J Neuroendocrinol.2003;15:521–529.

51. Doucas V, Shi Y, Miyamoto S, West A, Verma I, Evans RM. Cyto-plasmic catalytic subunit of protein kinase A mediates cross-repres-sion by NF-KB and the glucocorticoid receptor. Proc Natl Acad Sci.2000;97:11893–11898.

52. Andrews MH, Wood SA, Windle RJ, Lightman SL, Ingram CD.Acute Glucocorticoid Administration Rapidly Suppresses Basal andStress-Induced Hypothalamo-Pituitary-Adrenal Axis Activity. En-docrinology. 2012;153:200–211.

53. Ginsberg AB, Campeau S, Day HE, Spencer RL. Acute glucocorti-coid pretreatment suppresses stress-induced hypothalamic-pitu-itary-adrenal axis hormone secretion and expression of corticotro-pin-releasing hormone hnRNA but does not affect c-fos mRNA orfos protein expression in the paraventricular nucleus of the hypo-thalamus. J Neuroendocrinol. 2003;15:1075–1083.

54. Imaki T, Wang X-Q, Shibasaki T, Yamada K, Harada S, ChikadaN, Naruse M, Demura H. Stress induced activation of neuronalactivity and corticotropin releasing factor gene expression in theparaventricular nucleus is modulated by glucocorticoids in the rat.J Clin Invest. 1995;96:231–238.

55. Pacak K, Palkovits M, Kvetnansky R, Matern P, Hart C, Kopin I,Goldstein DS. Catecholaminergic inhibition by hypercortisolemiain the paraventricular nucleus of conscious rats. Endocrinology.1995;136:4814–4819.

56. Kaminski KL, Watts AG. Intact catecholamine inputs to the fore-brain are required for appropriate regulation of corticotrophin-releasing hormone and vasopressin gene expression by corticoste-rone in the rat paraventricular nucleus. J Neuroendocrinol. 2012;24:1517–1526.

57. Day H, Campeau S, Watson SJ, Akil H. Expression of alpha(1b)adrenoceptor mRNA in corticotropin-releasing hormone-contain-


ing cells of the rat hypothalamus and its regulation by corticoste-rone. J Neurosci. 1999;19:10098–10106.

58. Feuvrier E, Aubert M, Mausset AL, Alonso G, Gaillet S, Malaval F,Szafarczyk A. Glucocorticoids Provoke a Shift from alpha2- to al-pha1-Adrenoreceptor Activities in Cultured Hypothalamic SlicesLeading to Opposite Noradrenaline Effect on Corticotropin-Re-leasing Hormone Release. J Neurochem. 1998;70:1199–1209.

59. Boyle MP, Brewer JA, Funatsu M, Wozniak DF, Tsien JZ, Izumi Y,

Muglia LJ. Acquired deficit of forebrain glucocorticoid receptorproduces depression-like changes in adrenal axis regulation andbehavior. Proc Natl Acad Sci USA. 2005;102:473–478.

60. Arnett MG, Kolber BJ, Boyle MP, Muglia LJ. Behavioral insightsfrom mouse models of forebrain- and amygdala-specific glucocor-ticoid receptor genetic disruption. Mol Cell Endocrinol. 2011;336:2–5.


regulation of hypothalamic corticotropin-releasing hormone transcription by elevated glucocorticoids

Documents