regulation of fgf10 by pou transcription factor brn3a in the developing trigeminal ganglion

Regulation of FGF10 by POU Transcription FactorBrn3a in the Developing Trigeminal Ganglion

Eric Cox, Jason Lanier, Lely Quina, S. Raisa Eng, Eric E. Turner

Department of Psychiatry, University of California, San Diego and VA San DiegoHealthcare System, La Jolla, California 92093

Received 16 September 2005; accepted 14 February 2006

ABSTRACT: The POU-domain transcription fac-

tor Brn3a is expressed in specific neurons of the cau-

dal CNS and peripheral sensory nervous system. The

sensory neurons of mice lacking Brn3a exhibit marked

defects in axon growth and extensive apoptosis in

late gestation. Here we show that expression of

the developmental regulator FGF10 is approximately

35-fold increased in the developing trigeminal ganglia

of Brn3a-null mice. In order to determine whether

FGF10 regulates other changes in gene expression

observed in Brn3a knock-out ganglia, we have used a

sensory-specific enhancer to over-express FGF10 in

transgenic mice. Microarray analysis of trigeminal

ganglia from individual transgenic founders effec-

tively excludes the cell-autonomous activity of FGF10

as a mechanism for mediating the downstream effects

of the loss of Brn3a, probably because developing

sensory neurons lack the appropriate type of FGF

receptor. ' 2006 Wiley Periodicals, Inc. J Neurobiol 66: 1075–

1083, 2006

Keywords: FGF10; FGFR2; Brn3; Brn3a; POU-

domain; microarray; trigeminal ganglion

INTRODUCTION

Development of the vertebrate nervous system re-

quires the orchestrated expression of a very large

number of genes, controlled primarily at the level of

transcription. Naturally occurring and induced muta-

tions in numerous transcription factors are associated

with profound defects in neural development, yet in

most cases the alterations in downstream gene ex-

pression that produce these phenotypes are unknown.

Recently the application of microarrays to the devel-

oping nervous system has revealed programs of gene

expression regulated by specific transcription factors,

including regulators of retinal, sensory, and cerebellar

development (Gold et al., 2003; Eng et al., 2004; Mu

et al., 2004). However, gene expression assays cannot

distinguish between direct regulatory targets and

downstream changes in gene expression that may

occur due to the altered expression of other transcrip-

tion factors or cellular signaling pathways. New

approaches to these problems will be required to fully

understand the regulatory networks that govern neu-

rodevelopment.

We have been engaged in studies of the POU-do-

main transcription factor Brn3a, which is expressed

throughout the sensory peripheral nervous system

(PNS), and in specific neurons of the caudal central

nervous system (CNS). Targeted deletion of Brn3a in

mice results in extensive death of sensory neurons in

late gestation, and neonatal lethality (McEvilly et al.,

1996; Xiang et al., 1996; Huang et al., 1999). Prior to

sensory neural death, trigeminal neurons in Brn3a-

null mice exhibit marked defects in axonal growth,

and fail to correctly innervate their central and pe-

ripheral targets (Eng et al., 2001).

Recently, microarray analysis of the developing

trigeminal ganglia of Brn3a-null mice has revealed a

program of neural-specific gene expression regulated

Correspondence to: E. E. Turner ([email protected]).Contract grant sponsor: Department of Veterans Affairs.Contract grant sponsor: NIH; contract grant numbers: H033442

and MH065496 (E. E. T.).

' 2006 Wiley Periodicals, Inc.Published online 12 June 2006 in Wiley InterScience (www.interscience.wiley.com).DOI 10.1002/neu.20277

1075

by Brn3a, leading to the identification of downstream

genes including transcription factors, neurotransmit-

ters and their receptors, and axon components (Eng

et al., 2004). Both increased and decreased expression

of specific genes are observed in Brn3a-null mice.

However, mutagenesis studies of the Brn3a sensory

enhancer indicate that Brn3a is a negative regulator

of its own expression in vivo (Trieu et al., 2003), sug-

gesting that it may be a repressor of all of its direct

targets. Thus it is likely that some of the genes with

increased expression, and perhaps all of those with

decreased expression in Brn3a-null mice are regu-

lated by indirect or secondary mechanisms.

Here we show that the expression of the develop-

mental regulator FGF10 is profoundly increased in

the developing trigeminal ganglion in the absence of

Brn3a. Using a sensory-specific enhancer derived

from the Brn3a locus (Trieu et al., 2003), we have

misexpressed FGF10 in the trigeminal ganglia of

transgenic founders at a level similar to that observed

in Brn3a-null ganglia. Despite the established role of

FGF10 in neurodevelopment (Alvarez et al., 2003;

Pauley et al., 2003; Wright and Mansour, 2003;

Alsina et al., 2004), microarray assays of trigeminal

ganglia from transgenic embryos misexpressing

FGF10 do not reveal consistent changes in gene ex-

pression, and clearly do not reproduce any of the

principal molecular changes observed in Brn3a

knock-out mice. A likely explanation for the lack of

cell-autonomous effects of FGF10 misexpression is

the absence of the appropriate FGF receptor in the

developing trigeminal ganglion.

METHODS

Analysis of Endogenous FGF10 andFGFR2 Expression

For the microarray or in situ analysis of FGF10 expression

in Brn3a mutant mice, timed matings of Brn3a heterozygote

animals were performed, and the embryos were harvested

at embryonic day 13.5 (E13.5), as staged by the system of

Theiler (1972). Similar matings of nontransgenic C57bl/6

mice were performed to provide wild-type embryos for the

analysis of FGFR2 expression. For microarray analysis of

Brn3a-null mice, embryonic trigeminal ganglia were micro-

dissected from five embryos of each genotype, and RNA

was prepared from the pooled ganglia as previously

described (Eng et al., 2004). Microarray data for FGF10

expression in Brn3aþ/�, Brn3a�/�, and control littermates

were obtained from the further analysis of a previously

described microarray data set (Eng et al., 2004).

For in situ hybridization studies, embryos were fixed

overnight in 4% paraformaldehyde, and cryostat sectioned

at 20 �m. Nonisotopic in situ hybridization was performed

as previously described (Birren et al., 1993). The in situprobe for FGF10 spanned positions 350–980 of the FGF10

cDNA, including the entire FGF10 open reading frame.

The in situ probe for FGFR2 (gift of Dr. David Ornitz)

encompassed positions 1725–2764 of the FGF2R cDNA

(NM_201601), and recognized all splice forms of the

FGF2R receptor (Yu et al., 2003).

Quantitative Analysis of Gene Expressionin FGF10 Transgenic Founders

For transgenic misexpression of FGF10, a cDNA including

the complete open reading frame of FGF10 was generated

by RT-PCR from Brn3a�/� trigeminal ganglion RNA. Oli-

gonucleotides for the amplification of FGF10 cDNA were

sense: GCGCAAGCTTATGTGGAAATGGATACTGAC-

ACATTG, and antisense: GCGCGAATTCCTATGTTT-

GGATCGTCATGTGGG. The sequence of the FGF10 cod-

ing region generated by RT-PCR was shown to be identical

to the published sequence (GenBank NM_008002.3). The

FGF10 coding sequence was linked to a previously

described Brn3a sensory enhancer (Brn3a/11kb-mut; Trieu

et al., 2003) and a IRES-GFP reporter cassette. Pronuclear

injection was performed in CB6F1 oocytes, and founder

embryos were harvested at E13.5. Embryos were genotyped

for the FGF10 transgene using a sample of tail or hindlimb

tissue collected at the time of ganglion harvest. Genotyping

by real-time PCR and SYBR green detection was per-

formed with oligonucleotides recognizing the sequence

encoding GFP included in the expression construct. Sense:

AGCAAAGACCCCAACGAGAA, and antisense: GGC-

GGCGGTCACGAA.

For each embryo resulting from oocyte injection, pairs

of trigeminal ganglia were dissected and pooled for the

extraction of RNA. Typical RNA yield was 1–2 �g per gan-

glion pair, of which 1 �g was reserved for microarray anal-

ysis. An aliquot of the remaining sample was used for quan-

titative RT-PCR of FGF10 expression. All Brn3a/FGF10

transgenic embryos and a sample of transgene-negative

embryos were analyzed for FGF10 expression. For RT-

PCR assays, cDNA synthesis was performed using the

ThermoScript RT-PCR system for first-strand cDNA syn-

thesis (Invitrogen) according to the manufacturer’s proto-

col, and a control was performed without reverse transcrip-

tase to ensure the absence of contaminating genomic DNA.

Quantitative PCR assays for FGF10 and the endogenous

control transcript tau were performed using an Applied Bio-

systems 7300 thermocycler and Taqman Universal PCR

master mix with Taqman Gene Expression Assay prede-

signed probe and primer sets (FGF10: Mm00433275_ml,

tau: Mm00521988_ml). Tau was selected as a control

because it is highly expressed in the developing trigeminal

ganglion and its expression does not change in the absence

of Brn3a. Probe and primer sets spanned exon-exon junc-

tions to avoid amplifying genomic DNA. Absolute thresh-

old cycle (Ct) values were determined using the SDS soft-

ware v1.2 (Applied Biosystems). Relative expression of

FGF10 was calculated by the comparative Ct method

1076 Cox et al.

Journal of Neurobiology. DOI 10.1002/neu

(Livak and Schmittgen, 2001), using RNA from the trigem-

inal ganglia of a Brn3aþ/� mouse as a reference sample.

Microarray Analysis

Methods for the microarray analysis of E13.5 trigeminal

ganglion RNA using U74 microarrays (Affymetrix) have

been previously reported (Eng et al., 2004). RNA samples

from trigeminal ganglion pairs of individual Brn3a/FGF10

transgenic embryos were amplified and labeled according

to manufacturer’s protocols using the Message-Amp II sys-

tem (Ambion) for cDNA synthesis and aRNA labeling.

Samples were hybridized to 430A microarrays (Affyme-

trix), and analyzed using MAS 5.0 software according to

established protocols. Global scaling with a scale factor of

500 was used in all analyses.

RESULTS

FGF10 Exhibits Markedly IncreasedExpression in Brn3a Knock-Out Mice

In prior work we have reported a global analysis of

altered gene expression in the E13.5 trigeminal ganglion

of Brn3a knock-out mice using the Affymetrix expres-

sion arrays U74Av2 and U74Bv2 (Eng et al., 2004).

Analysis was also performed with the U74Cv2 array,

but at the time of the analysis, few of the probe sets on

this array, consisting entirely of ESTs, were correlated

with identified genes. Subsequently, annotation of the

mouse genome has allowed the identification of a larger

proportion of the ESTs represented on the U74Cv2

array. In a reanalysis of the E13.5 trigeminal data, two

of the U74Cv2 array probe sets showing the greatest

change in expression were mapped to the FGF10 locus.

Table 1 summarizes FGF10 expression data for the

trigeminal ganglion as assayed by the U74 array set. In

two experiments, the U74Cv2 probe sets showed an av-

erage increase of 35-fold in FGF10 mRNA levels in the

ganglia of Brn3a knock-out mice compared to those of

wild-type or heterozygous embryos. However, a probe

set for FGF10 on the U74Av2 array reported the FGF10

transcript to be absent in all genotypes, explaining why

altered expression of FGF10 was missed in our previ-

ously reported analysis.

In order to reconcile these results, we examined the

location of the oligonucleotide probes present on the

array in the context of the structure of the FGF10

mRNA [Fig. 1(A)]. Both of the probe sets present on

the U74Cv2 array are complementary to the distal 30

untranslated region of the FGF10 mRNA, while the

probe set present on the U74Av2 array corresponds to

the FGF10 open reading frame. The probe sets from the

two arrays are separated by a minimum of 2200 bases

of intervening sequence. Thus one possible explanation

for the discordant results is that cDNA synthesis is

blocked in FGF10 3’-untranslated region, perhaps due

to secondary structure, and that only sequences close to

the poly-A tail of the transcript were efficiently assayed

by the arrays. Selective detection of sequences close to

the 3’ end of transcripts in microarray assays can also

result from global degradation of the mRNA sample.

However, in these assays, the 3’/5’ detection ratio for a

set of transcripts represented on the microarrays for the

purpose of quality control demonstrated that the overall

samples were intact.

In order to confirm FGF10 regulation by Brn3a

in the embryonic trigeminal, we performed in situhybridization in E13.5 Brn3a�/� embryos and con-

trols, using probes designed to the FGF10 open read-

ing frame, encompassing the region represented on

the U74Av2 array. In situ hybridization showed

markedly increased expression of FGF10 in the tri-

geminal ganglion in the absence of Brn3a [Fig.

1(B,C)], confirming that the microarray probes target-

ing the FGF10 open reading frame do not adequately

Table 1 Microarray Assays of FGF10 Expression in the Trigeminal Ganglia of Brn3a Knock-Out Mice

Probe Set

Experiment 1 Experiment 2y

WT HT KO KO�WT Dp KO/WT Ratio WT HT KO KO�HT DpKO/HT

Ratio

U74A array

95976_at 21* 13* 22* 0.056{ 1.05 19* 12* 11* 0.1194{ 1.62

U74C array

141051_at 155* 134* 9026 0.000 58.3 n/a 333 8812 0.000 26.4

170410_at 190* 137* 1785 0.000 9.4 n/a 48* 1783 0.000 37.2

*Absent call.y Partial replication, only heterozygote and knock-out samples were analyzed using the U74C array.

{Not significant. Six total comparisons between wild-type vs. knock-out and heterozygote vs. knock-out ganglia using the U74Cv2 array

probe sets yielded an average 35-fold increase in FGF10 mRNA. A large variability in the fold change is observed because baseline expression

in Brn3a wild type and heterozygote ganglia is below the threshold of statistically significant detection (absent call).

Brn3a Regulates FGF10 1077


assay FGF10 mRNA expression and that FGF10 is a

downstream target of Brn3a. In addition, FGF10

expression in the cranial nerve 9/10 ganglion com-

plex also appeared to be increased from nearly unde-

tectable expression at baseline. In contrast, the nor-

mal pattern of FGF10 expression in the infundibular

region of the ventral diencephalon and the hindbrain

did not appear to be affected by the loss of Brn3a.

Misexpression of FGF10 Does Not MimicMolecular Changes Seen in the Brn3aNull Mutant

The increased expression of FGF10 in the developing

trigeminal ganglion raises the possibility that some of

the genes with altered expression in Brn3a-null mice

are regulated indirectly by FGF10 activity, possibly

via an autoreceptor mechanism. In order to assess

the effect of increased FGF10 expression in the tri-

geminal ganglion on downstream gene expression,

we employed a well-characterized sensory enhancer

from the Brn3a (Eng et al., 2001) gene to misexpress

FGF10 in the developing trigeminal. To achieve high

levels of FGF10 expression in transgenic embryos in

the presence of endogenous Brn3a, an altered form

of the enhancer was used in which autoregulatory

repression by Brn3a has been eliminated (Brn3a-mut;

Trieu et al., 2003). A Brn3a- mut/FGF10 transgene was

constructed using a cDNA that included the complete

FGF10 coding region, as illustrated in Figure 2(A).

Transgenic mice were generated by oocyte injection

of this construct, the resulting founder embryos wereFigure 1 Increased sensory expression of FGF10 in mice

lacking Brn3a. (A) Map of the FGF10 mRNA, GenBank

accession number NM_008002, showing the location of

the target sequences for probe sets from the Affymetrix

U74Av2 (95976_at), U74Cv2 (141051_at, 170410_at), and

430 (1420690_at) arrays. Only the U74 arrays were used in

the analysis presented here. It is problematic that the suc-

cessor to the U74 murine array, designated 430, contains a

probe set targeting the same 50 region of the FGF10 tran-

script as the U74A array, which will probably also be inef-

fective in detecting the transcript. In situ hybridizations

were performed with a probe corresponding to the FGF10

open reading frame, as shown. (B,C) In situ hybridization

for FGF10 in horizontal sections of E13.5 control (B) and

Brn3a�/� (C) embryos. Increased expression is noted in the

trigeminal ganglion, sensory neurons within the auditory

system, and the 9/10 ganglion complex. Greater hybridiza-

tion signal in the area of the infundibulum in C is due to a

slightly more ventral plane of section and is not related to

genotype. 5g, trigeminal ganglion; 9g, 9/10 ganglion com-

plex; HB, hindbrain; hyp, hypothalamus (developing); inf,

infundibulum; ot, otic region. Scale bar ¼ 200 �m.

Figure 2 Misexpression of FGF10 in the developing tri-

geminal ganglion. (A) FGF10 misexpression construct con-

taining the full coding sequence of FGF10 under regulation

of the Brn3a sensory enhancer Brn3a-mut. An IRES-GFP

expression cassette was included to potentially allow visual

genotyping of the transgenic embryos, but the GFP signal

was not sufficient for this purpose. Instead, trigeminal gan-

glia were harvested from all founder embryos blind to ge-

notype, and the embryos were subsequently genotyped by

PCR. (B) Quantitative RT-PCR assay of FGF10 mRNA

expression in the trigeminal ganglia of 14 E13.5 transgenic

founder embryos plus Brn3aþ/� and Brn3a�/� controls.

Lines 2, 11, and 47 were negative for the presence of the

transgene, and expressed FGF10 at levels equivalent to the

Brn3aþ/� specimens. Error bars represent SD of three deter-

minations. Relative values are normalized to Brn3aþ/� ¼ 1.

The samples used for microarray analysis appear in blue.

1078 Cox et al.


harvested at E13.5, and pairs of transgenic ganglia

were harvested from each embryo. Samples of em-

bryonic tail tissue were used to assay for the presence

of the FGF10 transgene, and RNA was prepared from

the harvested ganglia of transgenic and control

embryos for further analysis.

Prior to microarray analysis of global gene expres-

sion in the transgenic ganglia, the extent of misex-

pression of FGF10 was assessed by quantitative RT-

PCR [Fig. 2(B)]. Because the purpose of the experi-

ment was to express FGF10 at a level similar to that

observed in Brn3a�/� trigeminal ganglia, parallel

assays were conducted on ganglia from Brn3a�/�

embryos and heterozygous littermates. In addition,

control ganglia were assayed from nontransgenic lit-

termates of the FGF10-expressing embryos. As

expected from the microarray results, the background

expression of FGF10 mRNA in control embryos was

very low. Of 11 founder embryos that genotyped pos-

itive for the transgene, six showed expression of

FGF10 mRNA that was significantly above back-

ground, and four of these showed expression within

twofold of the FGF10 mRNA levels observed in

Brn3a-null ganglia.

Two trigeminal samples with transgenic expres-

sion of FGF10 that approximated expression in the

Brn3a knock-out and two controls were selected for

microarray analysis. In our prior microarray analysis

of the trigeminal ganglion (Eng et al., 2004), five

pairs of ganglia provided a sample of sufficient size

(�5 �g) for analysis using standard labeling proto-

cols. Consistent with these results, pairs of ganglia

from single transgenic founder animals yielded RNA

samples of approximately 1 �g. For array analysis of

the FGF10 transgenic and control ganglia, 1 �g of

total RNA from each sample was used for cDNA syn-

thesis, followed by one round of T7-mediated ampli-

fication and labeling, using a commercial protocol

specifically designed for small samples (Methods).

Microarray analysis was performed using the Af-

fymetrix 430A murine array, containing 22,600 probe

sets, followed by standard analysis using MAS

5.0 software (Methods). Microarray analysis of two

transgenic samples and two controls permitted four

cross- comparisons between experimental and control

samples, as well as comparison between the control

samples to test the reproducibility of the method. Fig-

ure 3 shows a global comparison of gene expression

in the control samples, in which the large majority of

the points lie on or near the diagonal, indicating equal

Figure 3 Microarray assays of trigeminal gene expres-

sion from single transgenic founders. Global gene expres-

sion was compared between control embryos 2 and 47,

revealing nearly equivalent expression of the large majority

of transcripts in the two samples. Only probe sets yielding a

‘‘present’’ call in both samples are displayed.

Figure 4 Expression of FGFR2 in the E13.5 embryo. (A)

Overview. (B) Expression of Brn3a mRNA in the trigemi-

nal ganglion and neuronal component of the developing

inner ear. (C,D) In situ hybridization with a probe common

to the major splice forms of FGFR2. As expected, strong

signal was observed in the ventricular regions of the gangli-

onic eminences (C), and in the developing otic epithelium

(D). Hybridization signal in the trigeminal ganglion was at

or near background. 5g, trigeminal ganglion; Di, diencepha-

lon; FB, forebrain; LGE, lateral ganglionic eminence;

MGE, medial ganglionic eminence; ot, otic region. Scale

bar ¼ 500 �m (A), 200 �m (B–D).



expression in the two samples. This result indicates

that the reproducibility of the dissection, amplifica-

tion, and hybridization procedures is sufficient to per-

mit the comparison of trigeminal samples from single

embryos, without further pooling of samples.

We then compared each of the four possible exper-

imental/control sample pairs for altered gene expres-

sion in the presence of FGF10 misexpression. Two

measures were used to compare expression between

samples, the ‘‘probability of change’’ (change-p) pa-

rameter, and the fold change in the intensity of the

hybridization signal. The change-p value was calcu-

lated with proprietary data analysis software (Affy-

metrix MAS 5.0) using the Wilcoxon’s signed rank

test applied to the hybridization signals for the 11

matched and mismatched oligonucleotide probe pairs

representing each transcript in the array. Change-p

values <0.003 (increased expression in the experi-

mental sample) or >0.997 (decreased in the experi-

mental sample) are considered highly significant.

Each of the four semi-independent comparisons

between Brn3a-mut/FGF10 and control ganglia gave

similar numbers of changed transcripts. For example,

comparison of Brn3a-mut/FGF10 embryo 39 and

control embryo 2 yielded 715 increased and 1615

decreased transcripts by the change-p criterion alone.

Of these, 76 increased and 310 decreased transcripts

were changed by more than twofold. However, when

these results were aligned with the independent com-

parison between Brn3a/FGF10 embryo 51 and control

embryo 47, only five increased and six decreased

transcripts were replicated by both the change-p and

twofold change criteria. Table 2 shows the expression

array data for the transcripts that exhibited replicable

changes in these comparisons. The lack of a signifi-

cant number of replicated differences between two

Brn3a-mut/FGF10 embryos and littermate controls

indicates that there is probably little effect of FGF10

misexpression on downstream mRNA levels in the

trigeminal ganglia of these embryos.

To test whether misexpression of FGF10 in the

developing trigeminal altered the expression of any

of the known Brn3a target genes, we also examined

the expression of transcripts previously shown to

have changed expression in Brn3a knock-out mice

(Eng et al., 2004). Table 3 summarizes the expression

of Brn3a targets in Brn3a-mut/FGF10 and control

ganglia. Although some fluctuation between samples

in the expression level of these transcripts is observed

in these assays, no systematic increases or decreases

in expression are evident, and FGF10 misexpression

clearly does not mimic the molecular phenotype of

Brn3a-null mice.

Developing Trigeminal ExpressesNegligible Levels of FGFR2

In light of the significant known developmental

effects of FGF10, it is somewhat surprising that no

Table 2 Transcripts Altered by Misexpression of FGF10

Probe Set Gene

Controls

Brn3a/

FGF10

39�2Dp39/2

Fold: 51�47 Dp51/47

Fold: Gene Description2 47 39 51

Increased transcripts:

1419327_at EST 38 57 787 723 0.0000 20.4 0.0000 12.7 EST AA415817

1417956_at Cidea 4.7 3.1 94 61 0.0000 20.0 0.0001 19.6 Cell death-inducing

DNA fragmentation factor

1419179_at Txnl4 77 83 321 253 0.0000 4.2 0.0001 3.1 Thioredoxin-like 4

1425050_at Isoc1 94 98 305 302 0.0000 3.3 0.0000 3.1 Isochorismatase domain

containing 1

1453752_at Rpl17 179 99 515 361 0.0000 2.9 0.0000 3.6 Ribosomal protein L17

Decreased transcripts: Fold; Fold;1421163_a_at Nfia 155 285 36 135 0.9979 4.3 0.9999 2.0 Nuclear factor I/A

1422444_at Itga6 550 326 171 152 0.9999 3.2 1.0000 2.1 Integrin alpha 6

1437545_at Rcor1 323 633 120 258 1.0000 2.7 0.9999 2.4 REST corepressor 1

1456120_at EST 278 380 106 147 0.9998 2.6 1.0000 2.3 RIKEN 3110001120

1424657_at Taok1 210 307 86 131 1.0000 2.4 1.0000 2.3 TAO kinase 1

1449101_at Ebf2 123 522 56 220 0.9999 2.2 1.0000 2.4 Early B-cell factor 2

Two independent comparisons were made between Brn3a-mut/FGF10 transgenic and control E13.5 trigeminal ganglia using Affymetrix

430A arrays. Criteria for inclusion were change p <0.003 (increased) or >0.997 (decreased) in both comparisons, and at least two-fold change

in the expression level.

1080 Cox et al.


consistent major effects on gene expression result

from the misexpression of this factor in the trigeminal

ganglion. One possible explanation is the lack of a re-

ceptor system for cell-autonomous FGF10 effects in

developing trigeminal neurons. Because FGF10 is

known to act via the FGF receptor FGFR2 (Yeh

et al., 2003), we examined the trigeminal ganglia of

E13.5 embryos for FGFR2 receptor expression using

microarray analysis and in situ hybridization, using a

probe common to the alternately spliced forms of the

receptor (FGF10 IIIc TM; Yu et al., 2003).

Microarray assays for FGFR2 using the 430A

array (probe set 1420847_a_at) were negative (absent

call) in all samples of E13.5 trigeminal ganglion

mRNA tested (data not shown). Consistent with pre-

vious studies, FGFR2 mRNA was detected by in situhybridization in the ventricular region of the gangli-

onic eminences [Fig. 4(C)], where it is known to be

expressed in radial glia, and in the epithelium of the

developing inner ear [Fig. 4(D), and Pirvola et al.,

2004]. However, the hybridization signal in the tri-

geminal ganglion was at or near background. These

results suggest that the misexpression of FGF10, ei-

ther in the Brn3a knock-out embryo or in FGF10

transgenic animals, has little effect on downstream

gene expression due to the lack of an appropriate

autoreceptor to mediate tissue-intrinsic effects.

DISCUSSION

In the current study, we have demonstrated markedly

up-regulated expression of FGF10 in the developing

trigeminal ganglion of mice lacking the transcription

Table 3 Effect of FGF10 Misexpression on Brn3a-Regulated Transcripts

Gene

Brn3a KO Control Brn3a/FGF10

Fold: 2 47 39 51

Increased transcripts

Ankyrin repeat domain 1 Ankrd1 34.3 A A A A

GATA3 Gata3 33.0 A A A A

AP-2 beta Tcfap2b 28.1 110 89 63 106

Somatostatin Sst 25.7 A A A A

Homeobox protein Iriquois 2 Irx2 18.4 A A A A

Calbindin 2 (Calretinin) Calb2 10.5 A A A A

C-fos-induced growth factor Figf 9.0 115 67 59 78

HLH transcription factor Math3 Neurod4 7.8 64 39 8 100

HLH transcription factor Musculin/MyoR Msc 7.0 307 358 221 335

Homeobox protein Iriquois 1 Irx1 6.5 169 183 114 212

LIM and cysteine-rich domains 1 Lmcd1 6.1 A A A A

Serotonin receptor 3A Htr3a 4.7 544 614 979 300

Connexin 43 Gja1 3.9 387 350 318 262

ART3 Art3 3.2 60 49 171 37

Neuroserpin Serpini1 3.2 1619 2043 1413 1582

Thrombospondin Thbs1 3.2 64 89 57 68

HLH transcription factor NeuroD1 Neurod1 2.8 1672 1954 871 2052

Decreased transcripts Gene Fold;NPY-1 receptor Npy1r 21.4 212 245 250 278

Regulator of G-protein signaling 10 Rgs10 13.6 2923 3415 3095 3067

HoxD1 Hoxd1 11.6 1334 1688 1210 1202

Naþ channel Scn7a Scn7a 8.6 128 131 54 84

Advillin Avil 7.9 2716 3203 3610 2432

Basonuclin Bnc1 6.6 675 840 866 540

Homeobox transcription factor Hmx1 Hmx1 6.6 1573 1529 1078 1284

Phospholipase A2 group VII Pla2g7 6.0 546 677 550 796

Transcription factor Runx1 Runx1 5.3 73 129 57 168

Adenylate cyclase activating polypeptide 1, PACAP Adcyap1 5.1 578 407 559 328

Downstream of tyrosine kinase 4, Dok4 Dok4 4.8 904 1167 1514 858

Kþ channel Kcnab2 Kcnab2 4.8 2096 2305 2675 1843

Insulin-like growth factor 1 Igf1 4.6 1753 2229 1889 1575

Expression of the most changed transcripts in a prior study of Brn3a�/� E13.5 trigeminal ganglia (Eng et al., 2004) was examined in Brn3a-

mut/FGF10 and control ganglia. No consistent changes in gene expression replicating those observed in Brn3a-null ganglia were detected.



factor Brn3a. Although FGF10 is one of the most

changed transcripts in Brn3a knock-out mice, altered

expression was not detected in a prior study (Eng

et al., 2004) because of anomalies in the design of

the oligonucleotide microarrays used in the analysis.

In the initial study a U74Av2 probe set corresponding

to the FGF10 open reading frame did not detect this

mRNA in any genotype, while in the present study

two U74Cv2 probe sets targeting the FGF10 3’-

untranslated region consistently detected high expres-

sion of this transcript in Brn3a-null ganglia. The in-

effective 5’ probe set and the effective 3’ probe sets

are separated by approximately 2 kb of intervening

sequence.

Affymetrix oligonucleotide arrays include built-in

probe sets that measure the ratio of 3’/5’ signal for

multiple transcripts, providing a control for RNA

degradation and the reverse transcription and T7

amplification process. In all of the analyses reported

here, these controls were within acceptable standards,

indicating that the 5’ ends of the control mRNAs

were effectively reverse-transcribed and labeled.

Thus the most plausible explanation for the discrep-

ancy in results between the 5’ and 3’ FGF10 probe

sets is that the region separating their targeted

sequences contained unusual secondary structure that

blocked reverse transcriptase in first strand cDNA

synthesis or inhibited subsequent amplification by T7

polymerase in the aRNA labeling step. Although the

general problem of matching probe sets across gener-

ations of oligonucleotide arrays has been addressed

(Hwang et al., 2004), relatively little attention has

been given to false negatives due to transcript-

specific problems in probe design. Future arrays de-

signed to assay expression of all exons, including

those closest to the site of polyadenylation, may cir-

cumvent this problem.

Increased expression of FGF10 in the trigeminal

ganglion of Brn3a-null mice occurs in association

with changes in numerous other transcripts identified

in a prior study of the Brn3a knock-out mouse (Eng

et al., 2004). Both increased and decreased transcripts

have been identified, and both groups include poten-

tial regulators of gene expression, such as growth fac-

tors, mediators of signal transduction, and transcrip-

tion factors. Thus it is unclear which of the down-

stream genes are regulated directly by Brn3a, and

which are one or more nodes removed from Brn3a in

a web of regulatory relationships. One substantial

clue is provided by the observation that Brn3a is

likely to be a repressor of its own expression via a

direct autoregulatory mechanism (Trieu et al., 2003).

This result strongly suggests that at least some of the

transcripts exhibiting increased expression in the ab-

sence of Brn3a, perhaps including FGF10, are directly

repressed by Brn3a in normal ganglia.

One approach to understanding the regulatory rela-

tionships between these Brn3a-regulated genes is to

examine the effects of directly manipulating the ex-

pression of specific Brn3a targets, as in the present

study. Because we have previously identified a sen-

sory-specific enhancer within the Brn3a locus (Brn3a-

mut; Trieu et al., 1999, 2003), transgenic misexpres-

sion of Brn3a target genes is fairly straightforward,

and from a technical perspective, this strategy was

quite successful. FGF10 expression was detectable

above background in 6/11 of the transgene-positive

founders, and in some of these embryos, levels of

transgenic FGF10 mRNA were achieved approximat-

ing those observed in Brn3a-null mutants. Further-

more, we were able to isolate sufficient quantities of

trigeminal RNA from single embryos to perform rep-

licable microarray assays using a one-step amplifica-

tion protocol. Overall, these results clearly demon-

strate the feasibility of using direct misexpression in

founder transgenic embryos as a method for determin-

ing regulatory pathways in the developing nervous

system.

Two observations based on the microarray data

suggest that there are no systematic changes in gene

expression induced by FGF10 misexpression in these

experiments. First, the number of replicated changes

in gene expression between Brn3a/FGF10 ganglia and

controls is very small (Table 2), and similar to the

number of changes observed in comparisons between

controls. Second, very few of the changes noted in

any of the comparisons between samples, and none of

the replicated changes, correspond to the transcripts

known to be regulated by Brn3a in our prior experi-

ments (Table 3). This negates the original hypothesis

that the actions of FGF10 mediate a subset of the

changes in gene expression observed in the sensory

ganglia of Brn3a knock-out mice.

Cellular responses to FGF10 are mediated by

FGFR2 (Yeh et al., 2003), and presumably this recep-

tor would be necessary for FGF10 to have a cell-

autonomous effect in trigeminal neurons. In fact,

FGFR2 is undetectable above background in the tri-

geminal at E13.5, both on expression arrays and by

in situ hybridization. This essentially excludes in-

creased FGF10 expression as a mechanism for the

other changes in gene expression observed in the

knock-out. However, recent work has also shown that

in addition to its effects on cell differentiation,

FGF10 and its close relatives may play a role in syn-

aptic organization (Umemori et al., 2004). Thus while

FGF10 is unlikely to regulate the marked changes in

intrinsic gene expression observed in trigeminal neu-

1082 Cox et al.


rons lacking Brn3a, it remains a candidate mediator

of the profound defects in sensory innervation ob-

served in Brn3a mutant mice.

We would like to thank Dr. David Ornitz for FGF2R

probes. Supported in part by Department of Veterans

Affairs MERIT funding. E.E.T. is a NARSAD Investigator.

REFERENCES

Alsina B, Abello G, Ulloa E, Henrique D, Pujades C, Giral-

dez F. 2004. FGF signaling is required for determination

of otic neuroblasts in the chick embryo. Dev Biol 267:

119–134.

Alvarez Y, Alonso MT, Vendrell V, Zelarayan LC, Cha-

mero P, Theil T, Bosl MR, et al. 2003. Requirements for

FGF3 and FGF10 during inner ear formation. Develop-

ment 130:6329–6338.

Birren SJ, Lo L, Anderson DJ. 1993. Sympathetic neuro-

blasts undergo a developmental switch in trophic depend-

ence. Development 119:597–610.

Eng S, Gratwick K, Rhee J, Fedtsova N, Gan L, Turner E.

2001. Defects in sensory axon growth precede neuronal

death in Brn3a-deficient mice. J Neurosci 21:541–549.

Eng SR, Lanier J, Fedtsova N, Turner EE. 2004. Coordi-

nated regulation of gene expression by Brn3a in develop-

ing sensory ganglia. Development 131:3859–3870.

Gold DA, Baek SH, Schork NJ, Rose DW, Larsen DD,

Sachs BD, Rosenfeld MG, et al. 2003. RORalpha coor-

dinates reciprocal signaling in cerebellar development

through sonic hedgehog and calcium-dependent path-

ways. Neuron 40:1119–1131.

Huang E, Zang K, Schmidt A, Saulys A, Xiang M, Reich-

ardt L. 1999. POU domain factor Brn-3a controls the dif-

ferentiation and survival of trigeminal neurons by regu-

lating Trk receptor expression. Development 126:2869–

2882.

Hwang KB, Kong SW, Greenberg SA, Park PJ. 2004. Com-

bining gene expression data from different generations of

oligonucleotide arrays. BMC Bioinformatics 5:159.

Livak KJ, Schmittgen TD. 2001. Analysis of relative gene

expression data using real-time quantitative PCR and the

2(-Delta Delta C(T)) Method. Methods 25:402–408.

McEvilly RJ, Erkman L, Luo L, Sawchenko PE, Ryan AF,

Rosenfeld MG. 1996. Requirement for Brn-3.0 in differ-

entiation and survival of sensory and motor neurons. Na-

ture 384:574–577.

Mu X, Beremand PD, Zhao S, Pershad R, Sun H, Scarpa A,

Liang S, et al. 2004. Discrete gene sets depend on POU

domain transcription factor Brn3b/Brn-3.2/POU4f2 for

their expression in the mouse embryonic retina. Develop-

ment 131:1197–1210.

Pauley S, Wright TJ, Pirvola U, Ornitz D, Beisel K,

Fritzsch B. 2003. Expression and function of FGF10 in

mammalian inner ear development. Dev Dyn 227:203–

215.

Pirvola U, Zhang X, Mantela J, Ornitz DM, Ylikoski J.

2004. Fgf9 signaling regulates inner ear morphogenesis

through epithelial-mesenchymal interactions. Dev Biol

273:350–360.

Theiler K. 1972. The house mouse; development and nor-

mal stages from fertilization to 4 weeks of age. Berlin:

Springer-Verlag. 168 p.

Trieu M, Ma A, Eng SR, Fedtsova N, Turner EE. 2003.

Direct autoregulation and gene dosage compensation by

POU-domain transcription factor Brn3a. Development

130:111–121.

Trieu M, Rhee J, Fedtsova N, Turner E. 1999. Autoregula-

tory sequences are revealed by complex stability screen-

ing of the mouse brn-3.0 locus. J Neurosci 19:6549–

6558.

Umemori H, Linhoff MW, Ornitz DM, Sanes JR. 2004.

FGF22 and its close relatives are presynaptic organizing

molecules in the mammalian brain. Cell 118:257–270.

Wright TJ, Mansour SL. 2003. Fgf3 and Fgf10 are required

for mouse otic placode induction. Development 130:

3379–3390.

Xiang M, Lin G, Zhou L, Klein WH, Nathans J. 1996. Tar-

geted deletion of the mouse POU-domain gene Brn-3a

causes a selective loss of neurons in the brainstem and

trigeminal ganglion, uncoordinated limb movement, and

impaired suckling. Proc Natl Acad Sci 93:11950–11955.

Yeh BK, Igarashi M, Eliseenkova AV, Plotnikov AN, Sher

I, Ron D, Aaronson SA, et al. 2003. Structural basis by

which alternative splicing confers specificity in fibroblast

growth factor receptors. Proc Natl Acad Sci USA 100:

2266–2271.

Yu K, Xu J, Liu Z, Sosic D, Shao J, Olson EN, Towler DA,

et al. 2003. Conditional inactivation of FGF receptor 2

reveals an essential role for FGF signaling in the regula-

tion of osteoblast function and bone growth. Develop-

ment 130:3063–3074.



regulation of fgf10 by pou transcription factor brn3a in the developing trigeminal ganglion

Documents