regulation and tissue-specific distribution of mrnas … physiol. (1997) 115: 273-282 regulation and...

Plant Physiol. (1997) 115: 273-282

Regulation and Tissue-Specific Distribution of mRNAs for Three Extracellular Invertase lsoenzymes of Tomato

Suggests an Important Function in Establishing and Maintaining Sink Metabolism’

Dietmute E. Godt and Thomas Roitsch*

Lehrstuhl für Zellbiologie und Pflanzenphysiologie, Universitat Regensburg, Universitatsstrasse 31, D-93053 Regensburg, Germany

The aim of the present study was to gain insight into the contribution of extracellular invertases for sink metabolism in tomato (Lycopersicon esculentum 1.). The present study shows that extracellular invertase isoenzymes are encoded by a gene family comprising four members: Lin.5, Lin6, Lin7, and Li&. The regulation of mRNA levels by internal and external signals and the distribution in sink and source tissues has been determined and compared with mRNA levels of the intracellular sucrose (Suc)-cleaving enzymes SUC synthase and vacuolar invertase. The specific regulation of Lin5, Lin6, and Lin7suggests an important function of apoplastic cleavage of Suc by cell wall-bound invertase in establishing and maintaining sink metabolism. Lin6 is expressed under conditions that require a high carbohydrate supply. The corresponding mRNA shows a sink tissue-specific distribution and the concentration is elevated by stress-related stimuli, by the growth-promoting phytohormone zeatin, and in response to the induction of heterotrophic metabolism. The expression of Lin.5 and Lin7 in gynoecia and stamens, respectively, suggests an important function in supplying carbohydrates to these flower organs, whereas the Lin7mRNA was found to be present exclusively in this specific sink organ.

Carbohydrate partitioning between photosynthetically active source tissues and photosynthetically less active or inactive sink tissues such as roots, flowers, and fruits is essential for growth and development in higher plants. The long-distance transport of assimilates, mostly in the form of SUC, occurs in the phloem and is driven by differences in solute concentrations and osmotic potentials (Evert, 1982). Since the removal of Suc steepens the gradient and thus enhances the flow toward sinks, enzymes involved in im- mediate Suc metabolism are expected to be important both for phloem unloading and for the import of SUC into sink organs (Ho et al., 1991). Suc utilization is initiated by hydrolysis, which is catalyzed by two different enzymes, invertase and Suc synthase.

Invertases catalyze the irreversible cleavage of Suc to Glc and Fru. Plants contain multiple forms of invertases, which

This paper is dedicated to Prof. Dr. Benno Parthier (Halle) on the occasion of his 65th birthday. This work was supported by the Deutsche Forschungsgemeinschft (grant no. RO 758/4-1).

* Corresponding author; e-mail [email protected] gensburgde; fax 49-941-943-3352.

have been purified from a wide variety of plant species and tissues. Plant invertases are characterized by their subcellular localization, their pH optima, and their pI (Avigad, 1982). An intracellular invertase with an acidic pH optimum and a low pI is thought to be localized in the vacuole and responsible for the regulation of the leve1 of Suc stored in this compartment (Leigh et al., 1979; Lingle and Dunlap, 1987). The function of an invertase with a neutra1 pH optimum in the cytoplasm is not known. Physiological studies indicate the importance of a cell wall-bound invertase, characterized by an acidic pH optimum and a high pI, in rapidly growing tissues (Glasziou and Gayler, 1972) and for sugar uptake of plant cells (Komor et al., 1981; Stanzel et al., 1988).

A model has been proposed for supplying carbohydrates to sink tissues via apoplastic cleavage of Suc by extracellular invertase and uptake of the resulting sugar monomers by hexose transporters (Eschrich, 1980). The importance of extracellular invertase for supplying carbohydrates to sink tissues is further supported by recent studies with maize (Zea mays) invertase mutants (Miller and Chourey, 1992; Cheng et al., 1996) and with bean (Pkaseolus vulgaris) embryos (Weber et al., 1995). In addition, specific tissues such as the embryos, stomata, and storage tissues of sugarcane (Sacckarum officinarum) are symplastically isolated and thus require apoplastic phloem unloading. Results obtained with Ckenopodium rubrum suggest a role of extracellular invertase in sink-source regulation (Roitsch et al., 1995). Although a number of extracellular invertases have been cloned in recent years, only a few studies have addressed the regulation by external and internal stimuli (Sturm and Chrispeels, 1990; Wu et al., 1993; Roitsch et al., 1995; Lin- den et al., 1996).

Suc synthase is localized in the cytoplasm and catalyzes the reversible hydrolysis of Suc to yield UDP-Glc and Fru. Under physiological conditions Suc synthase is primarily involved in the breakdown of the disaccharide (Kruger, 1990). This enzyme in particular is assumed to be important for synthesizing storage compounds (Chourey and Nelson, 1976; Weber et al., 1996) and for determining sink strength in association with symplastic phloem unloading via plasmodesmata (Sung et al., 1989; Koch and Nolte, 1995; Zrenner et al., 1995).

273 www.plantphysiol.orgon June 25, 2018 - Published by Downloaded from

Copyright © 1997 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

274 Godt and Roitsch Plant Physiol. Vol. 11 5, 1997

In tomato (Lycopersicon esculentum) most studies have concentrated on the roles of vacuolar invertase and Suc synthase in fruits. SUC synthase is assumed to be important for sink metabolism during fruit development (Wang et al., 1993). It is well established that vacuolar invertase regu- lates hexose levels in mature fruits and that the activity of this enzyme determines whether Glc or Suc is the major storage compound (Klann et al., 1993; Ohyama et al., 1995). The aim of the present study was to gain insight into the contribution of extracellular invertases for sink metabolism of tomato plants.

It has been shown that extracellular invertases are encoded by four different genes. To determine the relative contribution of the different Suc-cleaving enzymes, the expression pattern of invertase isoenzymes and SUC synthase were compared. The highly tissue-specific distribution of mRNAs and differential regulation by interna1 and externa1 stimuli suggest specific functions of the individual enzymes. This analysis indicates an important function of three of the extracellular invertase isoenzymes in establishing and maintaining sink metabolism. Specific extracellular isoenzymes seem to be important in male and female flower organs. Vacuolar invertase and extracellular invertase Lin6 were found to be inversely regulated by carbohydrates.

MATERIALS AND METHODS

Plants and Cell Cultures

Photoautotrophic suspension-culture cells of tomato (Ly- copersicon esculentum cv Moneymaker) were grown as described by Stocker et al. (1993) in the greenhouse; natural light was supplemented with additional illumination for 12 h l d .

Determination of lnvertase Activity

The activities of neutra1 and acidic intracellular invertase and of cell wall-bound invertase were determined as described previously (Roitsch et al., 1995). Invertase activity was localized in tissues by a histochemical stain (Miller and Chourey, 1992).

lsolation of Nucleic Acids

The isolation of total RNA and poly(A+) RNA was carried out as described previously (Godt et al., 1995). Genomic DNA was isolated from nuclei by phenol extrac- tion (Junghans and Metzlaff, 1990).

PCR Amplification

Amplification of invertase sequences from cDNA and genomic DNA using degenerate oligonucleotides as a substrate was carried out as described previously (Roitsch et al., 1995; Ehness and Roitsch, 1997a). For amplification of SUC synthase cDNA from tomato by reverse transcriptase, PCR primers TSS3 (GTCTGAGGATTTCCCATCTGC) and TSS4 (CTCCGAAGACAAATCACAAAG) were designed

based on the sequence in the EMBL sequence library (accession no. L19762). Amplification resulted in the expected product of 2500 bp and the identity was proven by sequence analysis.

Cloning, Sequencing, and Sequence Analysis

PCR products were subcloned into pUC18 according to standard procedures (Sambrook et al., 1989) and sequenced using a kit (Sequenase 2.0, Amersham). Sequence analysis was performed using the sequence analysis software package of the University of Wisconsin Genetics Computer Group (Madison, WI; Devereux et al., 1984) on a VAX microcomputer.

Northern and Southern Analyses

RNA was separated on 1.3% denaturing agarose gels, and DNA was separated on 0.8% TBE (89 mM Tris-base, 89 mM boric acid, and 2 mM EDTA) gels. Nucleic acids were transferred onto nitrocellulose by capillary transfer and DNA probes were labeled by random priming (Amersham) with [32P]dCTP. Hybridization was performed in 50% for- mamide, 5X SSC (750 mM NaCl and 75 mM sodium citrate, brought to pH 7.0 by HCl), 0.5% SDS, and 5 x Denhardt's solution (0.1% Fico11 400, 0.1% PVP, and 0.1% BSA) at 42°C for 18 h. After hybridization membranes were washed in solutions of decreasing salt concentrations and increasing temperatures. A final washing step was carried out in 0.1 X SSC at 56°C.

RESULTS

ldentification of a Family of Four Extracellular lnvertase lsoenzymes from Tomato

Degenerate oligonucleotide primers based on conserved amino acid motifs in the N-terminal part of extracellular invertase of carrot (Daucus carota) (Sturm and Chrispeels, 1990) and intracellular invertases of mung bean (Phaseolus aureus) (Arai et al., 1992) and tomato (Klann et al., 1992) were used to amplify cDNA and genomic invertase sequences from tomato. Amplification by PCR resulted in the expected product of about 750 bp. The PCR products were subcloned into pUC18 and characterized by sequence analysis.

Poly(A+) RNA isolated from red tomato fruits was used as the substrate for reverse-transcriptase PCR. Amplifica- tion of cDNAs yielded three different invertase sequences. One of the sequences, Lin4, was identical to the previously cloned vacuolar invertase TIVl (Klann et al., 1992; Elliott et al., 1993) and henceforth will be referred to as TIV1. The other two sequences, Lin5 and Lin6, represent so far un- known invertases from tomato. Using genomic DNA as a substrate for PCR amplification, we could identify two further invertase sequences, Lin7 and Lin8.

The deduced amino acid sequences of the four new invertase sequences, Lin5, Lin6, Lin7, and Lin8, are highly homologous to each other (Fig. 1) and to published invertase sequences. A number of invertases have been cloned

www.plantphysiol.orgon June 25, 2018 - Published by Downloaded from Copyright © 1997 American Society of Plant Biologists. All rights reserved.


Extracellular lnvertases of Tomato and Sink Metabolism 275

cons . LIN5 LINB LIN6 LIN7 TIVl

tons. LIN5 LINB LIN6 LIN7 TIVl

cons . LIN5 LINB LIN6

114 214 LFYQYNP.9S VWGNIYWaHS VSkDLINWI. LEPAiyPsk. fDkyGtWsGS aTILP.nkpv ilY~GivD.. .qvqNyAiP RnlSDP.Lrk WlKpdnNPll LFYQYNPKGS VWGNIIWAHS VSKDLINWIH LEPAIYPSKK FDKYGTWSGS STILPNNKPV IIYTGVVDSY NNQVQNYAIP ANLSDPFLRK WIKPNNNPLI LFYQYNPYGS VWGNIVWAHS VSTDLINWIP LEPAIYPSKV FDKYGTWSGS ATILPDNKPI ILYTGIVDAK NTQVQNYAIP ADLSDPFLRK WIKPDNNPLI LFYQYNPKGA TWGNIVWAHS VSKDLINWIP LEPAIYPSKV FDKYGTWSGS ATILPGNKPV ILYTGIWVT KHKSKNYAIP ANMSDPYLRK WIKPDNNPLI LFYQYNPNGS VWGNIVWAHS VSKDLLNWIN LEPAIYPSKP FDQFGTWSGS ATILPGNKPV ILYTGIIDAN QTQVQNYAIP ANLSDPYLRE WIKPDNNPLI LFYQYNPDSA IWGNITWGHA VSKDLINWLY LEPAMVPDQW YDINGWTGS ATILPDGQIM MLYTGDTDDY .VQVQNLAYP ANLSDPLLLD WVKFKGNPVL

215 314 vad..inkt. FhDPWaWmG .dg.wr.l.g s.....rG a i . ~ . ~ . . d f m kw.ka. pLH s..gTGNWEC pDFfPVs.k. tnGLd.sy.G ..vKyVLK.S VPDNSINRTE FhDPTTAWMG QDGLWRILIA SMRKH.RGMA LLYRS.RDPM KWIKAQHPLH SSTNTGNWEC PDFFPVLFNS TNGLDVSYRG KNVKYVLKNS DADVNINKTQ FRDPTTCWLG QDGHWRTLIG SLWGN.KGMA 1LYKS.RDLM KMTKVQQPLH SMGTGNWEC PDFFPVLLRG TNGLDASYQG ENIKYVLKVS VADKNINKIQ FRDPPTAWMG RDGYWRVLVG SVRNH.RGKV INYKSNKNFM KWTKAKHPLH SAQGTGNWEC PDFFPVSLKN ENGLDTSYDG KDVKHVLKVS IADESINKTK FhDPTTAWMG KDGHWRIVMG SLRKHSRGLA 1MYRS.KDFM KWVKAKHPLH STNGTGNWEC PDFYPVSSKG TDGLDQY..G EEHKYVLKNS VPPPGIGVKD FRDPTTAWTG PQNGQWLLTI GSKIGKTGVA LVYET.SNFT SFKLLDGVLH AVPGTGNWEC MFYPVSTKK TWGLDTSYNG PGVKHVLKAS

315 359 1DvtrfdyYt iG.Ydtkkdk y.Pdn.siDg wkGLRlDYGn . . . . . LDVARPDYYT IGMYHTKIDR YIPNNNSIDG WKGLRIDYGN F.... LDVTRFEYYT VGIYDTKKDK YIPDKTSIDG WKGLRLDYGN YYASK FDVTRFDHYT VGTYDTKKDK YFPDNTSIDG WKGLRLDYGN . . . . . ~~~ ~

lIN7 XDLTRFEYY: LGXYYKKDK WPSPDSVDS LKGLRLDYCN FYASK ..VI LDDNKQDHYA IOfYDLGYh’K WTPDNPELDC GICIRLUYGK YYASK -,

Figure 1. Alignment of the deduced amino acid sequences of vacuolar invertase TlVl (Lin4) and extracellular invertases Lin5, Lin6, Lin7, and Lin8. The amino acids are in one-letter codes and have been aligned by introducing gaps to maximize identity using the LINEUP program of the University of Wisconsin Genetics Computer Group sequence analysis software package (Devereux et al., 1984). The numbers refer to the sequence of the previously cloned vacuolar invertase (Klann et al., 1992). The conserved putative catalytic domain is marked by a double line and the position of a Val or Pro, conserved in all vacuolar or extracellular invertases, respectively, is marked by an arrow. The first line shows the consensus sequence using uppercase letters if all amino acids are identical and lowercase letters if the same amino acid occurs in three of the five sequences.

and a dendrogram based on the deduced amino acid sequences clearly shows two separate groups, representing cell wall-bound and vacuolar isoenzymes (Fig. 2). The identity of representatives of both clusters has been exper- imentally proven by purification of the corresponding proteins and by sequence analysis of tryptic peptides. The

I Carrot, soluble SI1 (1)”

Chenopodium, soluble CIN2 (2)

Tomato, vacuolar TlVI (3)”

Mung bean, acidic, intracellular (4)*

Bean, vacuolar (5)

Carrot, soluble SI (Ir

Tomato LIN5 (6)

Tomato LIN8 (6)

Tomato LIN6 (6)

Tomato LIN7 (6)

Carrot, extracellular ( 7 r

Bean, extracellular CW2 (5)

Arabidopsis, extracellular (8)

Bean, extracellular CW1 (5)

Chenopodium, extracellular ClNl (9)”

Figure 2. Phylogenetic relation of Lin5, Lin6, Lin7, and Lin8 to other cloned plant invertases. The dendrogram was generated by the PILEUP program of the University of Wisconsin Genetics Computer Group sequence analysis software package (Devereux et al., 1984). Sources: 1 , Unger et al. (1 994); 2, Ehness and Roitsch (1 997a); 3 , Klann et al. (1 992); 4, Arai et al. (1 992); 5, Weber et al. (1 995); 6 , this work; 7, Sturm and Chrispeels (1990); 8, Schwebel-Dugue et al. (1 994); 9, Roitsch et al. (1 995). Sequences for which the identity has been proven by purification of the corresponding protein are marked by an asterisk (*).

corresponding proteins are marked by an asterisk in the dendrogram.

Vacuolar isoenzymes have been cloned and purified from carrot (Unger et al., 1994), mung bean (Arai et al., 1992), and tomato (Klann et al., 1992). Cloned cell wall- bound isoenzymes have been unequivocally identified from carrot (Sturm and Chrispeels, 1990) and C. rubrum (Ehness and Roitsch, 199%). The dendrogram shown in Figure 2 demonstrates that a11 four new sequences have a significantly higher evolutionary relationship to the cluster of extracellular invertases. The four cloned tomato sequences show 61 to 71% identity with extracellular invertases, compared with 56 to 60% identity with intracellular invertases. The calculated pIs of the deduced protein sequences were 10.4, 10.4, 9.4, and 8.1, respectively. These high values are characteristic of cell wall-bound isoforms; in contrast, the intracellular invertases are characterized by an acidic pI.

Since the nucleotide sequences of the five invertase sequences are 75 to 79% identical, we wanted to determine whether they cross-hybridize. A DNA gel-blot analysis with the five invertase fragments was therefore carried out at high stringency. Figure 3 shows that each of the five invertase fragments specifically recognized only the corresponding sequence. This experiment proves that the cloned fragments are highly specific hybridization probes for the detection of the corresponding sequences by Southern and northern hybridization.

The lnvertase Cenes in Tomato

Tomato genomic DNA was digested with the restriction enzymes XbaI, HindIII, BamHI, and EcoRI and probed with the five different invertase clones. The comparison of the patterns from the Southern analysis data shown in Figure 4 demonstrates that the cloned invertase isoenzymes are encoded by five distinct genes, encoding extracellular inver-



276 Godt and Roitsch Plant Physiol. Vol. 115, 1997

I I

TIV1

LINS

LING

LIN7

LIN8

Figure 3. Southern analysis of fragments encoding invertase isoen-zymes. Fragments encoding TIV1 and LinS, Lin6, Lin7, and LinS wereused for DNA gel blots hybridized with the probes for vacuolarinvertase TIVl and extracellular invertases LinS, Lin6, Lin7, and LinS.

tases LinS, Lin6, Lin7, and LinS, and vacuolar invertaseTIVl. The patterns obtained with all of the probes wererather simple and suggest that the different invertase genesare present in only one copy or in very few copies perhaploid genome.

Differential Tissue-Specific and Developmental Regulationof mRNAs for Invertase Isoenzymes and Sue Synthase

Northern analysis was performed to gain insight into thefunction of the different invertase isoenzymes. Sue syn-thase, representing the second class of Sue-cleaving en-zymes in plants, was included in this comparison. Based onthe published Sue synthase sequence of tomato (EMBLaccession no. L19762), the corresponding cDNA was am-plified by reverse-transcriptase PCR and used as a hybrid-ization probe.

RNA was isolated from different developmental stagesof roots, flowers, and fruits, as well as from leaves andstems. Tumors induced by Agrobacterium tumefaciens are

included in this comparison and represent novel sink tis-sues induced within the plant. The northern analysisshown in Figure 5 demonstrates that each of the clonedinvertase fragments recognizes a single transcript of 2.2 kb,and the transcript detected by the Sue synthase probe is2.8 kb.

The mRNAs for the different Sue-cleaving enzymesshowed a highly specific distribution within the tissuesanalyzed. Extracellular invertase Lin6 is specifically ex-pressed in sink tissues. The concentration of the corre-sponding mRN A is high in seedling roots, flower buds, andtumors. The mRNA for Lin7 could only be detected in largeflower buds and flowers. The LinS mRNA is present inflower buds, flowers, and in green and red fruits. ThemRNA for LinS could not be detected in any of the tissuesanalyzed (data not shown). A highly abundant level ofmRNA for vacuolar invertase TIVl was present in mature,red fruits, whereas a low level was present in most othertissues. Sue synthase mRNA could be detected in all tissuesexcept source leaves and was particularly high in fruits.The concentration of this mRNA declines during fruit rip-ening and was found to be lower in mature, red fruitscompared with green fruits.

The level of the different mRNAs varies considerably.The Lin7 transcript shows the highest concentration;whereas mRNAs for TIVl, LinS, and LinS were much lessabundant.

Identification of Stamen-, Petal-, and Gynoecium-SpecificExpressed Invertase Isoenzymes

The analysis of the distribution of invertase mRNAs indifferent tissues revealed that the Lin7 transcript is flower-specific and present at high concentrations. mRNAs forintracellular invertase TIVl and extracellular invertase LinScould also be detected in flowers. To further elucidate thedistribution of these mRNAs within the different flowerorgans, RNA was isolated from petals, stamens, and gyno-ecia. The mRNAs for the different isoenzymes show anorgan-specific distribution in flowers. The northern analy-sis shown in Figure 6 demonstrates that a very high level ofLin7 mRNA is present in stamens. In contrast, the concen-tration is much lower in gynoecia and only minuteamounts are present in petals. A differential organ-specificexpression pattern was found for LinS and TIVl in flowers.

Figure 4. Southern analysis of chromosomal to-mato DNA. High-molecular-weight DNA wasdigested with: lane 1, Xbal; lane 2, H/ndlll; lane3, BamHI; and lane 4, fcoRI. DNA gel blotswere hybridized with probes for vacuolar inver-tase TIV1 and extracellular invertases LinS,Lin6, and Lin7.

kb21.2-

4.2-

TIV1 LINS LIN6 LIN7 LINS1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4

" If. «v-f <2.0-

1.3- w|f

0.8- A

I



Extracellular Invertases of Tomato and Sink Metabolism 277

TIV1

LINS

LIN6

LIN7

SuSy

Figure 5. Tissue-specific accumulation of mRNAs for invertaseisoenzymes and Sue synthase. Total RNA was isolated from thetissues indicated and used for RNA gel blots hybridized with probesfor vacuolar invertase TIV1 and extracellular invertases LinS, Lin6,Lin7, and Sue synthase (SuSy). The exposure time for autoradiogra-phy was: Lin7, 1 h; TIV1, 3 d; LinS, 4 d; Lin 6, 2 weeks; and Suesynthase, 3 d.

The highest levels of LinS and TIV1 mRNA were found ingynoecia and petals, respectively. Sue synthase mRNAshowed no preference for any specific flower organ.

The data from the northern analysis were complementedby measuring the activities of intracellular and extracellu-lar invertase isoenzymes in the different flower organs.Table I shows that the higher activity of extracellular in-vertase in gynoecia and stamens corresponds to the highmRNA levels of LinS and Lin7, respectively. In petals theintracellular acidic invertase activity was higher than theextracellular activity, which correlates with a high level ofmRNA for vacuolar invertase TIV1 in this flower organ.The cell wall-bound invertase activity in stamens was 7-and 27-fold higher compared with gynoecia and petals,respectively. Based on the data from the northern analysis,the activity in stamens represents only the Lin7 isoenzyme,whereas LinS also contributes to the activity in gynoecia.The correlation between cell wall-bound invertase activityand the distribution of Lin7 mRNA further supports theidea that this invertase is extracellular. The finding thatextracellular invertase activity is 5- to 800-fold higher thanintracellular invertase activities correlates with the corre-sponding mRNA levels, in particular the very high level ofLin7 mRNA. The enzyme activities given in Table I are themean values of two independent experiments, and the SDSwere less than 7%.

To analyze the distribution of invertase activity withinstamens, a histochemical invertase stain was performed

(Fig. 7). The activity stain further supports the highlyflower-organ-specific distribution of invertase activity. Instamens, invertase activity, which is mainly extracellular innature as shown by enzyme assays (Table I), is not evenlydistributed but is restricted to specific cell types. Invertaseactivity was detected in particular in an outer cell layer ofthe anthers, within the pollen sacks, and in mature pollen.

Differential Metabolic Regulation of mRNAs for InvertaseIsoenzymes and Sue Synthase by o-CIc

The effect of source-sink regulation on the expression ofSue-cleaving enzymes was tested with photoautotrophi-cally growing suspension-cultured cells of tomato. Hetero-trophic metabolism can be induced by the addition ofsugars such as Glc or Sue, which results in mixotrophicgrowth of the cultures (Stocker et al., 1993). A photoau-totrophically grown suspension culture was split into twoparallel cultures in the late-logarithmic growth phase. Oneof the cultures was supplied with 20 mM D-Glc, and incu-bation was continued for 12 h. Total RNA was isolatedfrom the two cultures and used for northern analysis.

Figure 8 demonstrates that the addition of Glc results indifferential changes in the concentration of mRNAs for theinvertase isoenzymes and Sue synthase. The low level ofmRNA for extracellular invertase Lin6 in autotrophicallygrown cells was highly elevated by Glc. The transcript forvacuolar invertase TIV1 was inversely regulated. The highsteady-state level of vacuolar invertase TIV1 mRNA inautotrophically grown cells was repressed in sugar-treatedcells. The level of mRNA for Sue synthase was not affectedby sugar treatment. To control for the effect of osmotica on

o^ <$• <rI I I

TIV1

LINS

LIN7

SuSy

•IIP ^p

tj ^^^HLg^^^^^

Figure 6. Flower-organ-specific accumulation of mRNAs for inver-tase isoenzymes and Sue synthase. Total RNA was isolated frompetals, stamens, and gynoecia and used for RNA gel blots hybridizedwith probes for vacuolar invertase TIV1, extracellular invertases LinSand Lin6, and Sue synthase (SuSy). www.plantphysiol.orgon June 25, 2018 - Published by Downloaded from




Table I. Intracellular and extracellular (cell wall-bound) invertaseactivity in different flower organs

Specific Invertase Activity

Tissue Intracellular

pH 4.5 pH 7.0Extracellular

\imo\ Clc min ' g 'StamensCynoeciaPetals

429109252

172.5

42

fresh wt2018

27876

mRNA levels, cell cultures were incubated in equivalentconcentrations of mannitol. The mRNA levels for Lin6 andTIV1 in the presence of 20 mM mannitol were essentiallythe same as in photoautotrophically grown cultures, sup-porting a specific effect of the sugar applied. The mRNAsfor Lin5, Lin7, and Lin8 could not be detected in autotrophiccontrol cells or in Glc- or mannitol-treated cultures (datanot shown).

Differential Regulation of Invertase mRNAs byPhytohormones

The higher carbohydrate demand of rapidly growingtissues could be satisfied by an increased flow of assimi-lates. Since it has been speculated that phytohormones areinvolved in regulating phloem unloading and carbohy-drate partitioning (Tanner, 1980; Brenner and Cheikh,

-Sue +SucFigure 7. Histochemical localization of invertase activity in stamens.Incubations were carried out in the presence ( + Suc) or absence(-Sue) of Sue. Invertase activity is visible as a dark stain.

1995), we wanted to determine whether mRNAs for Sue-cleaving enzymes of tomato are regulated by cytokininsand GAs. These experiments were carried out withhormone-treated suspension-cultured cells.

Zeatin is a naturally occurring adenine cytokinin that isknown to promote cell division. Figure 8 shows that theapplication of 2 JJLM cytokinin results in a highly elevatedlevel of mRNA for extracellular invertase Lin6. In contrast,the concentrations of mRNAs for vacuolar invertase TIV1and Sue synthase were not changed in response to cytoki-nin. GAs promote cell elongation and are important forflower induction. As shown in Figure 8, the addition ofGA3 to cultured tomato cells had no effect on the mRNAsfor Lin6, vacuolar invertase TIV1, or Sue synthase. ThemRNAs for Lin5, Lin7, and Lin8 could not be detected incontrol cells or in hormone-treated cultures (data notshown).

Differential Regulation of mRNAs for InvertaseIsoenzymes and Sue Synthase by Stress-Related Stimuli

The activation of defense reactions in plants requiresenergy and thus induces sink metabolism. Therefore, theeffect of different stress-related signals on mRNA levels ofSue-cleaving enzymes was analyzed. The stimuli testedwere elicitor treatment and mechanical injury.

Treatment of suspension-cultured cells with elicitorssuch as polygalacturonic acid mimics the effect of pathogeninfection and usually results in strong responses, since allcells are equally exposed to the stimulus. The northern blotshown in Figure 8 demonstrates that the addition of 0.2%polygalacturonic acid results in a highly elevated level ofLin6 mRNA. The high level of TIV1 mRNA in control cellsis only slightly increased by incubation in the presence ofthe elicitor, and the mRNA for Sue synthase is not affected.

To determine the effect of mechanical injury by wound-ing on mRNA levels, leaves of tomato plants were cut intostrips and shaken in sugar-free Murashige-Skoog medium.

Man Glc PGA Zeatin GAS

TIV1 flltft

iRI PLIN6

SuSy

Figure 8. Regulation of mRNAs for vacuolar invertase TIV1, extra-cellular invertase Lin6, and Sue synthase (SuSy) by different stimuli.Suspension-cultured cells were treated for 12 h with 20 mM Clc(Clc), 20 mM mannitol (Man), 2 /J,M zeatin, 2 JJ.M CAS, or 0.2%polygalacturonic acid (PGA). Total RNA was isolated from thesecultures and corresponding control cultures and used for RNA gelblots hybridized with the probes indicated. www.plantphysiol.orgon June 25, 2018 - Published by Downloaded from



Extracellular Invertases of Tomato and Sink Metabolism 279

Samples were taken at various times after wounding, andtotal RNAs were isolated and used for northern analysis.Figure 9 shows that mRNAs for vacuolar invertase TIV1,extracellular invertase Lin6, and Sue synthase are woundinducible, although the time course of induction is differ-ent. mRNAs started to accumulate after 1 h for TIV1, after3 h for Sue synthase, and after 24 h for Lin6. The mRNAsfor Lin5, Lin7, and Lin8 could not be detected in controlsamples or in response to wounding or elicitor treatment(data not shown).

DISCUSSION

The present study shows that extracellular invertasesfrom tomato are encoded by a gene family comprising fourmembers. In addition to the previously cloned vacuolarinvertase TIV1 (Klann et al., 1992), fragments encodingfour new invertase sequences have been cloned from to-mato by a PCR-based approach with first-strand cDNAand genomic DNA as substrates. The clones have beencharacterized by sequence analysis.

Several lines of evidence suggest that Lin5, Lin6, Lin7,and Lin8 represent extracellular isoenzymes. The dendro-gram shown in Figure 2, including 15 cloned invertases,clearly displays two groups, the extracellular and vacuolarinvertases. This grouping is supported by two extracellular(Sturm and Chrispeels, 1990; Ehness and Roitsch, 1997b)and three vacuolar (Arai et al., 1992; Klann et al., 1992;Unger et al., 1994) invertases that have been unequivocallyidentified by peptide sequences of the corresponding pu-rified proteins. The deduced amino acid sequences of thefour cloned invertases clearly show a higher phylogeneticrelationship to the cluster of extracellular invertases.

Invertases are characterized by variants of the conservedcatalytic domain motif WEC(V/P)D. Lin5, Lin6, Lin7, andLin8 share a Pro with all other cloned extracellular inver-tases at the variable position, whereas intracellular inver-tases possess a Val. The high pis of Lin5, Lin6, Lin7, andLin8 (between 8.4 and 10.4) are characteristic of extracellu-lar isoenzymes. The basic character of extracellular inver-tases and the resulting positive charge is thought to be

0 1 3 7 10 24 33 48h

' ilWr •TIV1

LIN6

SuSy

Figure 9. Regulation of mRNAs for vacuolar invertase TIV1, extra-cellular invertase Lin6, and Sue synthase (SuSy) by wounding. Sourceleaves were cut into strips and samples were removed at the timesindicated. Total RNA was isolated and used for RNA gel blots hy-bridized with the probes indicated.

important for binding of the enzyme to the negativelycharged plant cell wall (Unger et al., 1994). The pi ofintracellular invertases is acidic.

The identity of Lin7 as an extracellular isoenzyme isfurther supported by the finding that the distribution ofcell wall-bound invertase activity in different flower or-gans correlates with the distribution of Lin7 mRNA. Char-acteristic features of invertase isoenzymes are containedwithin the cloned sequences, and Southern analysis re-vealed that the cloned fragments represent highly specifichybridization probes. Therefore, we refrained from obtain-ing full-length clones. Genomic Southern analysis alsodemonstrated that vacuolar invertase TIV1 and extracellu-lar invertases Lin5, Lin6, Lin7, and Lin8 are encoded by fivedifferent genes that are present in only one copy or in veryfew copies per haploid genome. Although a number ofinvertases have been cloned, according to the availableliterature only as many as two different extracellular isoen-zymes have thus far been characterized from a specificplant species.

The expression pattern of extracellular invertases Lin5,Lin6, and Lin7 suggests specific functions for these isoen-zymes in sink metabolism. In contrast, mRNA for Lin8,which was cloned from genomic DNA, could not be de-tected. At present it cannot be decided whether Lin8 is apseudogene or a silent gene or whether it is induced onlyunder conditions that have not yet been tested.

The tissue-specific distribution of mRNA for Lin6 and itsregulation by internal and external stimuli suggest an im-portant function of apoplastic cleavage of Sue by extracel-lular invertase in source-sink regulation and in supplyingcarbohydrates to sink organs. This invertase gene is spe-cifically expressed under conditions that require a highcarbohydrate supply. Lin6 mRNA is present in activelygrowing sink tissues such as seedling roots, flower buds,and tumors. The mRNA for extracellular invertase Lin6 isinduced by the growth-promoting phytohormone zeatin.The physiological significance of this regulation is sup-ported by the fact that tissues with elevated activities ofextracellular invertase, such as rapidly growing tissues, arealso known to contain elevated cytokinin concentrations.Tumors induced by A. tumefaciens have been included inthe study as representatives of a novel sink tissue inducedby a exogenous factor. The cytokinin-inducible expressionof Lin6 indicates that the observed high level of Lin6mRNA in these tissues may be due to the up to 1600-foldelevated cytokinin concentrations in A. tumefaciens tumors(Kado, 1984). Based on this finding and the fact that cyto-kinin levels are high in rapidly growing tissues, one mayspeculate that cytokinin levels also determine the specificexpression of extracellular invertases in other sink tissues.

The activation of defense mechanisms requires energyand, thus, the induction of sink metabolism. Accordingly,physiological studies have indicated that photosyntheticcapacity is reduced and sink metabolism is induced bypathogens (Tecsi et al., 1994; Wright et al., 1995). Theinduction of Lin6 in response to wounding and elicitortreatment indicates that extracellular invertase is importantfor inducing heterotrophic metabolism in response tostress-related stimuli. The resulting increased supply of www.plantphysiol.orgon June 25, 2018 - Published by Downloaded from




carbohydrates will provide metabolic energy for the activation of a cascade of defense reactions.

The increased level of Lin6 mRNA in response to the induction of heterotrophic metabolism by Glc supports a function for extracellular invertase in source-sink regulation. The expression pattern of Lin6 resembles that of extracellular invertase CINl of C. rubrum. CINl is also sink- tissue-specifically expressed and induced by Glc and cytokinin (Roitsch et al., 1995; Ehness and Roitsch, 1997b), indicating that this type of extracellular invertase is present in different species and thus fulfills an important function. The expression and regulation pattern suggests a dual function of this isoenzyme: it is not only responsible for supplying carbohydrates to sink tissues but is also important for establishing sink metabolism in response to different stimuli. The biological importance of the induction of sink metabolism is further supported by increasing evi- dente that a number of sink-specific enzymes are induced by Glc, the end product of the invertase reaction (Koch and Nolte, 1995).

The data also indicate a crucial function of distinct extracellular isoenzymes in providing carbohydrates to male and female flower organs. Lin7 was shown to be exclusively expressed in flower buds and flowers. In addition, the mRNA for extracellular invertase Lin7 shows. the highest level of all Suc-cleaving enzymes analyzed in this study. The specific expression of extracellular invertases Lin5 and Lin7 in gynoecia and stamens, respectively, suggests that they have important functions in these flower organs. The important function of extracellular invertase in stamens is further supported by a recent study in wheat (Triticum aestivum), in which it was shown that the induction of male sterility by water stress is preceded by a decline in invertase activity (Dorion et al., 1996). This indicates that extracellular invertase is important for supplying carbohydrates to anthers and also important because its ability to metab- olize incoming SUC to hexose monomers determines the development of this flower organ and thus the fertility of the plant.

A gene coding for a flower-bud-specific invertase has been identified in carrot, whereas high transcript levels were also present in organs of young carrots and cultured cells (Lorenz et al., 1995). The two invertase genes expressed in flower organs are not regulated by GA, or by zeatin. Since both classes of phytohormones are involved in flower induction, this function seems to be unrelated to Suc metabolism.

The mRNAs for extracellular invertases Lin5, Lin6, and Lin7 are expressed highly tissue specifically. The identification of such specific expression patterns of individual invertase genes will provide the basis for cloning of the corresponding tissue-specific promoters. They should not only be helpful in further elucidating the function of the individual isoenzymes but will also be important in prac- tical applications such as engineering sterile male plants with respect to the anther-specific expression of Lin7.

The present study supports the specific function of SUC synthase during fruit ripening and of vacuolar invertase in regulating hexose levels in mature fruits (Klann et al., 1993; Wang et al., 1993; Ohyama et al., 1995). Although the high

level of mRNA for SUC synthase declines during fruit ripening, vacuolar invertase is exclusively expressed in red fruits.

An inverse metabolic regulation by Glc has been found for extracellular invertase Lin6 and for vacuolar invertase TIV1. Whereas the mRNA for Lin6 is induced, the mRNA for TIVl is repressed. In C. rubrum the mRNA for extracellular invertase was also shown to be induced by Glc (Roitsch et al., 1995), and in maize the mRNA for one of two intracellular invertase isoenzymes was found to be repressed by Glc (Xu et al., 1996). The inverse regulation may be explained by the function and subcellular localization of these enzymes. Vacuolar invertase is assumed to mobilize SUC, and the repression by Glc may represent an end-product inhibition, indicating a sufficiently high hexose concentration.

The observed induction of Lin6 suggests that the higher hexose concentration due to extracellular SUC hydrolysis further induces expression of cell wall-bound invertase in the sink cells by a positive feedback regulation. The mRNA for tomato SUC synthase was not affected by Glc. There seems to be no general pattern of metabolic regulation of Suc synthase genes by carbohydrates. In monocotyledon- ous species, pairs of Suc synthase isoenzymes that are inversely regulated by Glc have been identified (Koch and Nolte, 1995). In different dicotyledonous species SUC synthase transcript levels were shown to be elevated (Salanou- bat and Belliard, 1989; Heim et al., 1993; Godt et al., 1995), decreased (Martin et al., 1993), or not affected (Hesse and Willmitzer, 1996) by sugars.

Both extracellular invertase and hexose transporters are required for phloem unloading via an apoplastic pathway (Eschrich, 1980). The determined flower-organ-specific expression of extracellular invertases Lia5 and Lin7 is highly reminiscent of the distribution of hexose transporters of Arabidopsis. Different members of a hexose transporter gene family were also shown to be flower-organ- specifically expressed (Sauer and Tanner, 1993; Truernit et al., 1996). In addition, the induction of mRNAs for hexose transporters by the growth-promoting phytohormone zeatin (Ehness and Roitsch, 199%) and by wounding and elicitor treatment (Truernit et al., 1996) corresponds to elevated levels of mRNA for extracellular invertase Lin6 in response to these sink-metabolism-inducing signals.

Extracellular invertase of carrot has also been shown to be induced by wounding and pathogen infection (Sturm and Chrispeels, 1990). The up-regulation of both enzymes required for apoplastic phloem unloading should increase the flow of assimilates and thus satisfy the higher carbohydrate demand of cells during stimulated cell division in response to cytokinins and during activation of defense responses in response to wounding and pathogen attack. These observations indicate that extracellular invertase and hexose transporters are not only functionally linked but also are coordinately regulated. This provides further evidence that apoplastic phloem unloading is an important pathway for providing assimilates to specific sink tissues.



Extracellular lnvertases of Tomato and Sink Metabolism 281

ACKNOWLEDCMENTS

We are very grateful to Dr. Tanner for his continuous interest in this work, stimulating discussions, and helpful comments concern- ing the manuscript. We would like to thank Dr. Hüsemann (Uni- versity of Münster, Germany) for providing the photoautotrophically growing tomato culture established in the laboratory of Dr. Miihlbach (University of Hamburg, Germany), Margit Ecker and Philip Korber for skillful and important technical assistance during the initial stages of the project, and Giinther Peissig for taking care of the greenhouse plants. We also thank Rainer Ehness for knowledgeable advice, for help with the computer analyses, and for critically reading the manuscript.

Received February 14, 1997; accepted May 30, 1997. Copyright Clearance Center: 0032-0889/97/ 115/0273/10. The EMBL accession numbers for sequences reported in this article

are X91389 for Lin5, X91390 for Lin6, X91391 for Lin7, and X91392 for Lin8.

LITERATURE ClTED

Arai M, Mori H, Imaseki H (1992) Cloning and sequence of cDNAs of intracellular invertase from etiolated hypocotyl of mung bean and expression of the gene during growth of seed- lings. Plant Cell Physiol 33: 245-252

Avigad G (1982) Sucrose and disaccharides. In FA Lowus, W Tanner, eds, Encyclopedia of Plant Physiology. Springer-Verlag, Berlin, DP 217-347

Brenner ML, Cheikh N (1995) The role of phytohormones in photosynthate partitioning and seed filling. In PJ Davies, ed, Plant Hormones. Kluwer Academic Press, Dordrecht, The Neth- erlands, pp 649-670

Cheng W-H, Taliercio EW, Chourey PS (1996) The Miniaturel seed locus of maize encodes a cell wall invertase required for normal development of endosperm and maternal cells in the pedicel. Plant Cell 8: 971-983

Chourey PS, Nelson OE (1976) The enzymatic deficiency condi- tioned by the shrunken-1 mutation in maize. Biochem Genet 1 4

Devereux J, Haeberli P, Smithies O (1984) A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res 12:

DeWald DB, Sadka A, Mullet JE (1994) Sucrose modulation of soybean Vsp gene expression is inhibited by auxin. Plant Physiol 104 439444

Dorion S, Lalonde S, Saini HS (1996) Induction of male sterility in wheat by meiotic-stage water deficit is preceded by a decline in invertase activity and changes in carbohydrate metabolism in anthers. Plant Physiol 111: 137-145

Ehness R, Roitsch T (1997a) Cloning of additional members of the invertase gene family of Chenopodium rubrum and characterization of the differential metabolic regulation by sugars. J Plant Physiol 150: 514-519

Ehness R, Roitsch T (1997b) Co-ordinated induction of mRNAs for extracellular invertase and a glucose transporter in C. rubrum by cytokinins. Plant J 11: 539-548

Elliott KJ, Butler WO, Dickinson CD, Konno Y, Vedvick LF, Mirkov TE (1993) Isolation and characterisation of fruit vacuolar invertase genes from two tomato species and temporal differences in mRNA levels during fruit ripening. Plant Mo1 Biol 21:

Eschrich W (1980) Free space invertase, its possible role in phloem unloading. Ber Dtsch Bot Ges 93: 363-378

Evert RF (1982) Sieve-tube structure in relation to function. Bio- science 3 2 789-795

Glasziou KT, Gayler KR (1972) Storage of sugars in stalks of sugar cane. Bot Rev 38: 471-490

Godt DE, Riegel A, Roitsch T (1995) Regulation of sucrose synthase expression in Chenopodium rubrum: characterization of sugar induced expression in photoautotrophic suspension cul-

1041-1055

387-395

515-524

tures and sink tissue specific expression in plants. J Plant Physiol

Heim U, Weber H, Baumlein H, Wobus U (1993) A sucrose- synthase gene of Vicia faba L.: expression pattern in developing seeds in relation to starch synthesis and metabolic regulation. Planta 191: 394401

Hesse H, Willmitzer L (1996) Expression analysis of a sucrose synthase gene from sugar beet (Beta vulgaris L.). Plant Mo1 Biol

Ho LC, Lecharny A, Willenbrink J (1991) Sucrose cleavage in relation to import and metabolism of sugars in sink organs. l n JL Bonnemain, S Delrot, WJ Lucas, J Dainty, eds, Recent Advances in Phloem Transport and Assimilate Compartmentation. Ouest Editions, Nantes, France, pp 178-186

Junghans H, Metzlaff M (1990) A simple and rapid method for the preparation of total plant DNA. Biotechniques 8: 176

Kado CI (1984) Phytohormone-mediated tumorgenesis by plant pathogenic bacteria. In DPS Verma, T Hohn, eds, Genes In- volved in Microbe-Plant Interactions. Springer-Verlag, New York, pp 311-336

Klann E, Yelle S, Bennett AB (1992) Tomato fruit acid invertase complementary DNA. Plant Physiol 99: 351-353

Klann EM, Chetelat RT, Bennett AB (1993) Expression of acidic invertase gene controls sugar composition in tomato (Lycopersi- con) fruit. Plant Physiol 103: 863-870

Koch KE, Nolte KD (1995) Sugar modulated expression of genes for sucrose metabolism and their relationship to transport path- ways. In MM Madore, WL Lucas, eds, Carbon Partitioning and Source Sink Interactions in Plants. American Society of Plant Physiologists, Rockville, MD, pp 68-77

Komor E, Thom M, Maretzki A (1981) The mechanism of sugar uptake by sugarcane suspension cells. Planta 153: 181-192

Kruger NJ (1990) Carbohydrate synthesis and degradation. In DT Dennis, DH Turpin, eds, Plant Physiology, Biochemistry and Molecular Biology. Longman Scientific & Technical, Essex, UK,

Leigh RA, apRees T, Fuller WA, Banfield J (1979) The location of invertase activity and sucrose in the vacuoles of storage roots of beetroot (Beta vulgaris). Biochem J 178 539-547

Linden JC, Ehness R, Roitsch T (1996) Regulation by ethylene of apoplastic invertase expression in Chenopodium rubrum tissue culture cells. Plant Growth Regul 19: 219-222

Lingle SE, Dunlap JR (1987) Sucrose metabolism in netted musk- melon fruit during development. Plant Physiol 8 4 386-389

Lorenz K, Lienhard S, Sturm A (1995) Structural organization and differential expression of carrot-0-fructofuranosidase genes: identification of a gene coding for a flower bud-specific isoenzyme. Plant Mo1 Biol 28: 189-194

Martin T, Frommer WB, Salanoubat M, Willmitzer L (1993) Ex- pression of Arabidopsis sucrose synthase gene indicates a role in metabolization of sucrose both during phloem loading and in sink organs, Plant J 4: 367-377

Miller EM, Chourey PS (1992) The maize invertase-deficient miniature-l seed mutant is associated with aberrant pedicel and endosperm development. Plant Cell 4: 297-305

Ohyama A, Ito H, Sato T, Nishimura S, Imai T, Hirai M (1995) Suppression of acidic invertase activity by antisense RNA mod- ifies the sugar composition of tomato fruit. Plant Cell Physiol36:

Roitsch T, Bittner M, Godt DE (1995) Induction of apoplastic invertase of Chenopodium rubrum by o-glucose and a glucose analogue and tissue-specific expression suggest a role in sink source regulation. Plant Physiol 108: 285-294

Salanoubat M, Belliard G (1989) The steady-state leve1 of potato sucrose synthase mRNA is dependent on wounding, anaerobi- osis and sucrose concentration. Gene 84: 181-185

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Sauer N, Tanner W (1993) Molecular biology of sugar transporters in plants. Bot Acta 106: 277-286

Schwebel-Dugue N, E1 Mtili N, Krivitzky M, Jean-Jacques I, Williams JHH, Thomas M, Kreis M, Lecharny A (1994) Arabi-

146: 231-238

30: 863-872

pp 59-79

369-376



282 Godt and Roitsch Plant Physiol. Vol. 11 5, 1997

dopsis gene and cDNA encoding cell-wall invertase. Plant Physiol 104: 809-810

Stanzel M, Sjolund RD, Komor E (1988) Transport of glucose, fructose and sucrose by Streptanthus tortuosus suspension cells. 11. Uptake at high sugar concentrations. Planta 174: 210-216

Stocker S, Guitton M, Barth A, Mühlbach H-P (1993) Photosyn- thetically active suspension cultures of potato spindle tuber viroid infected tomato cells as tools for studying viroid-host interaction. Plant Cell Rep 12: 597-602

Sturm A, Chrispeels MJ (1990) cDNA cloning of carrot extracellular 0-fructosidase and its expression in response to wounding and bacterial infection. Plant Cell 2 1107-1119

Sung S-J, Xu D-P, Black CC (1989) Identification of actively filling sucrose sinks. Plant Physiol 89: 1117-1121

Tanner W (1980) On the possible role of ABA on phloem unloading. Ber Dtsch Bot Ges 93: 349-351

Técsi LI, Maule AJ, Smith AM, Leegood RC (1994) Complex, localized changes in CO, assimilation and starch content associated with the susceptible interaction between cucumber mo- saic virus and a cucurbit host. Plant J 5: 837-847

Truernit E, Schmid J, Epple P, Illig J, Sauer N (1996) The sink- specific and stress-regulated Arabidopsis STP4 gene: enhanced expression of a gene encoding a monosaccharide transporter by wounding, elicitors, and pathogen challenge. Plant Cell 8: 2169- 2182

Unger C, Hardegger M, Lienhard S, Sturm A (1994) cDNA cloning of carrot " L s carota) soluble acid P-fructosidase and its expression in response to wounding and bacterial infection. Plant Physiol 104 1351-1357

Wang F, Brenner ML, Smith A (1993) Sucrose synthase, starch accumulation, and tomato fruit strength. Plant Physiol 101: 321-327

Weber H, Borisjuk L, Heim U, Buchner P, Wobus U (1995) Seed coat-associated invertases of faba bean control both unloading and storage functions: cloning of cDNAs and cell type-specific expression. Plant Cell 7: 1835-1846

Weber H, Buchner I?, Borisjuk L, Wobus U (1996) Sucrose metabolism during cotyledon development of Vicia juba L. is controlled by the concerted action of both sucrose-phosphate synthase and sucrose synthase: expression pattern, metabolic regulation and implications for seed development. Plant J 9: 841-850

Wright DP, Baldwin BC, Shephard MC, Scholes JD (1995) Source-sink relationships in wheat leaves infected with powdery mildew. I. Alterations in carbohydrate metabolism. Physiol Mo1 Plant Pathol 47: 237-253

Wu L-L, Mitchel JP, Cohn NS, Kaufman PB (1993) Gibberellin (GA,) enhances cell wall invertase activity and mRNA levels in elongating dwarf pea (Pisum sativum) shoots. Int J Plant Sci 154:

Xu J, Avigne WT, McCarty DR, Koch KE (1996) A similar dichot- omy of sugar modulation and developmental expression affects both paths of sucrose metabolism: evidence from a maize invertase gene family. Plant Cell 8: 1209-1220

Zrenner R, Salanoubat M, Willmitzer L, Sonnewald U (1995) Evidence of the crucial role of sucrose synthase for sink strength using transgenic potato plants (Solanum tuberosum L.). Plant J 7:

280-289

97-107



regulation and tissue-specific distribution of mrnas … physiol. (1997) 115: 273-282 regulation and...

Documents