recognition of the high affinity binding site in rev-response element

© 1992 Oxford University Press Nucleic Acids Research, 1992, Vol. 20, No. 24 6465-6472

Recognition of the high affinity binding site in rev-responseelement RNA by the Human Immunodeficiency Virustype-1 rev protein

Shigenori Iwai, Clare Pritchard, Derek A.Mann, Jonathan Karn and Michael J.Gait*MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, UK

Received October 26, 1992; Revised and Accepted November 22, 1992

ABSTRACT

The Human Immunodeficiency Virus type-1 rev proteinbinds with high affinity to a bubble structure locatedwithin the rev-response element (RRE) RNA in stem-loop II. After this initial Interaction, additional revmolecules bind to the RRE RNA in an ordered assemblyprocess which requires a functional bubble structure,since mutations in the bubble sequence that reduce revaffinity block multiple complex formation. We haveused synthetic chemistry to characterize the interactionbetween rev protein and its high affinity binding site.A minimal synthetic duplex RNA (RBC6) carrying thebubble and 12 flanking base pairs is able to bind revwith 1 to 1 stoichiometry and with high affinity. Whenthe bubble structure is inserted into synthetic RNAmolecules carrying longer stretches of flanking double-stranded RNA, rev forms additional complexesresembling the multlmers observed with the RRE RNA.The ability of rev to bind to RBC6 analogues containingfunctional group modifications on base and sugarmoieties of nucleoside residues was also examined.The results provide strong evidence that the bubblestructure contains specific configurations of non-Watson - Crick G : G and G : A base pairs and suggestthat high affinity recognition of RRE RNA by revrequires hydrogen bonding to functional groups in themajor groove of a distorted RNA structure.

INTRODUCTION

The Human Immunodeficency Virus (HIV) trans-activator proteinrev is expressed early during infection and is required for theproduction of the late HTV mRNAs (for reviews see refs. 1 and2). In the absence of rev, mRNAs which are produced by singlesplicing events, such as the env and w/mRNAs, and the unsplicedvirion mRNA, which is also the mRNA for the gag-pol gene,are not expressed in a translatable form (3-5) . Although it hasbeen suggested that rev activity is coupled to splicing (6—8), itnow seems most likely that rev either stimulates the export ofpartially spliced viral mRNAs from the nucleus (9,10) orstabilizes these mRNAs in the cytoplasm of infected cells(3-5,11).

Rev operates through an RNA target sequence located in theenv gene called the rev-response element (RRE). Mutagenesisexperiments have shown that the RRE RNA is at least234-residues long and has an elaborate secondary structure (9,12, 13). RNA transcripts containing the RRE are specificallybound by rev in vitro (14-17). The binding reaction is complexand involves an initial interaction with a high affinity site (15)followed by the addition of further rev molecules to lower affinitysites on the flanking RNA sequences. Rev initially formsoligomers on the RRE RNA (7, 14, 15, 18-21), but at highprotein concentrations rev is able to package the RRE RNA intorod-like ribonucleoprotein filaments (19, 22).

We have recently used site-directed mutagenesis to map thehigh affinity rev binding site to a purine-rich 'bubble' containingbulged GG and GUA residues on either side of a double-helicalRNA stem-loop structure (19). The precise location and sequencerequirements of the high affinity binding site have recently beenconfirmed by chemical footprinting data (18, 21) as well as bythe sequencing of high affinity binding sites for rev selected frompools of large numbers of randomly-generated mutants (23).

In this paper we describe the preparation of a series of syntheticRNA duplexes containing the bubble structure. Rev is able tobind to a minimal RNA bubble structure, carrying only 12flanking base pairs, with a 1 to 1 stoichiometry and nearly wild-type affinity. The bubble structure is believed to be stabilizedby non-Watson-Crick G : A (19, 23) and G : G (23) base-pairsformed between the bulged residues. Using synthetic RNAscarrying functional group modifications on either the base orsugar moieties of nucleoside residues, we provide evidence forthe formation of specific configurations of the G : G and G :A base pairs in the bubble and suggest that, as in the case oftat binding to TAR RNA (24, 25), specific recognition of theRRE RNA by rev may involve the formation of hydrogen-bondsin the major groove of a distorted RNA duplex.

RESULTSOligomerization of rev requires the high affinity binding siteThe genetically defined rev-response element contains six stem-loops arranged as a cruciform structure (7, 9, 12, 15, 18, 19).Figure 1 shows a predicted folding pattern for the RRE sequence

* To whom correspondence should be addressed

Downloaded from https://academic.oup.com/nar/article-abstract/20/24/6465/1114240by gueston 12 February 2018

6466 Nucleic Acids Research, 1992, Vol. 20, No. 24

which is consistent with nuclease-protection and chemical-probingdata (7, 18). The RRE sequence has been drawn to emphasize-the symmetry of the structure. The high affinity rev binding site,defined by the bubble structure, is located towards the base ofa stem-loop near a 3-way junction (18, 19, 21, 23).

Packaging of RRE RNA into ribonucleoprotein filaments isan ordered assembly process (7, 15, 19, 20). Figure 2a showsa gel-retardation assay performed with a transcript carrying theRRE (R540.1) RNA sequence (Figure 1). In agreement withprevious results (7, 15, 20), a series of 6 to 8 complexes ofincreasing size is formed as the rev protein concentration isincreased. The gel retardation patterns are consistent with a modelwhereby at low rev concentrations binding to the RRE takes placespecifically at the high affinity site. As the rev concentration isincreased, additional rev molecules can bind to neighbouringregions of double-stranded RNA with lower affinity as long asthe length of neighbouring double strand is sufficient to allowadjacent packing. Similarly, a Scatchard analysis showed that revbinding to the RRE is non-linear and involves both high and lowaffinity binding reactions (19). It seems likely that each of thebands seen in Figure 2a arises from the additon of a single revmonomer, since quantitative analysis of the stoichiometry of thereaction shows that 6 to 8 rev monomers can bind to the234-residue RRE RNA (7, 14, 19).

The assembly model predicts that mutations in the high affinitybinding site should block both monomer and oligomer formationon the RRE RNA. To test this hypothesis, gel mobility shiftassays were performed using an RRE transcript carrying theAG35_36 mutation, a 2-base deletion of adjacent G residueswithin the bubble (RRE R10.1). The AG35_35 mutation was

c uA C

AU

130-AU -140

Jo1

chosen since it reduces rev affinity by more than 20-fold in thecontext of the R33 sequence (19). In the context of the 276-residueRRE, the AG35_36 mutation (RRE R10.1) blocks both highaffinity binding and the subsequent and progressive assemblyreaction. Rev is unable to form the characteristic ladder of RNA-protein complexes seen when rev associates with wild-type RRER540.1 RNA (Figure 2). At high rev concentrations, highmolecular weight aggregates between rev and RRE RNA are seenwith both the wild-type and mutant transcripts. Since thesecomplexes are formed in the absence of high affinity binding tothe bubble sequence, we consider these to be due to non-specificbinding.

Structure of short synthetic RNAs carrying the bubblestructureWe have shown previously that high affinity rev binding ismaintained when the bubble is placed in heterologous stem-loopstructures such as R33 (19). In order to find a minimal RNAsequence capable of binding rev with high affinity, a series ofRNA duplex structures was prepared by annealing one (RBC5L),two (RBC6) or three (TWJ6) chemically synthesizedoligoribonucleotides (Figure 1).

Nuclease digestion experiments were performed to confirm thateach of these synthetic molecules carries a bubble structure. Thebubble structure is unexpectedly resistant to ribonucleasedigestion. Figure 3a shows the RNase digestion pattern obtainedusing RBC5L RNA, a single 29-mer oligoribonucleotide thatfolds to give a stable stem-loop structure. RBC5L showed onlythree primary cleavage sites for RNase T1; with only one ofthese sites located in the bubble sequence. Digestion of RBC5Lwith RNase T2 led to a primary cleavage in the apical loop,which is not part of the bubble structure. At high nucleaseconcentrations, some secondary cleavages were observed at sitesadjacent to the primary cleavage sites. The bubble structure in

RRE (R540.1) RNACAG A

GCAUGC '

C

(a)RRER540.1 RNA (b) RRE R10.1 RNA

"OUCUGGGGCCGGACCUCG.

U G *AAUUUGCUG*U~u-GCUGu'CAAGACGAC CGACGA jJJUCUUGGG-UUCC "

100 A * 2 0 " 0 ^ , 0 1 I

3AAGAUACCUAAGGGAUCAACAGCUCCUAGG(U ICU G0

{<£* AO35-36 RRE(R10.1)RNA

U A U Q G Q C Q -CAGUGUC*R33 RNA

AGAC. gQCAGUCGCAGu " - » . *G*CCGGAAUUCUQ "CQCAGUGUC*

iiS " 50 3 > C GGCCUUAAGAC^ nQCGUCGCAGu

BO- UA 70GCUAUA

A UU TWJ6RNA

5 tr3

RBCSL RNA

5 GUCUQ G Q CQCAC U U

3 "OAC^^aCGUGeC

RBC6 RNA

5CGUGUQQaCQCAGC3

jGCACAC^aQCGUCGs

Figure 1. Structure of RRE RNA and synthetic RNAs carrying the bubblestructure, the high affinity binding site for rev. Residues previously found essentialto rev recognition (19) are shown in highlighted characters.

_ 22 88 440 2210 22 88 440 2210Rev Cone (nM) o 44 220 880 0 44 220 880

Non-SpecificComplexes

SpecificComplexes

Free RNA -

Figure 2. Gel mobility shift assays showing that multiple complex formation byrev on RRE RNA requires a functional bubble. Binding reactions (20 /J) contained25 nM 32P-labelled RRE R7 RNA (approx. 5000 cpm) and up to 2.2 /M revprotein in 10 mM Tris-HCl (pH 7.4), 50 mM NaCl, 1 mM DTT, 1% TritonX-100, 13 units RNasin (Promega). After incubation for 2 h on ice, 5 pH of dyemix (0.25% bromophenol blue, 40% sucrose, 10 mM Tris-HCl (pH 7.4)) wasadded and aliquots (12 ^1) applied to a 6% non-denaturing polyacrylamide gel(1.5x 180 mm) which was electrophoresed in a recirculating buffer of 3.3 mMsodium acetate, 6.7 mM Tris-HCl (pH 7.9) at 4°C at 8mA for 12h and the gelsubjected to autoradiography. (a) Wildtype RRE R540.1 RNA. (b) AG35_36mutation, RRE R10.1 RNA.


Nucleic Acids Research, 1992, Vol. 20, No. 24 6467

(•) RBCSLRNA

UnlB A o

AC.

IQ—c—u—u—c _A—C -G -C -O -

U—

c-

ii

51 (b) TWJ8RNA

CG=AUG?U Strand I

QCAGCCGUCG

Strand II

Labaled RNA StrandII HI

Nucleate

Unn

x

the RBC6 duplex is also highly resistant to RNase T, and T2

digestion (data not shown). The RBC6 duplex (^ = 62°) issomewhat less stable than the RBC5L hairpin (t™ = 77°).

Figure 3b shows the RNase T| and T2 digestion patterns forthe 3-stranded RNA TWJ8, which is slightly larger and morestable than TWJ6 (Figure 1). The ^ of TWJ8 is 58°C,approximately 20°C higher than the ^ for TWJ6. The bubblestructure in TWJ8, which is close to a 3-way junction, appearsto be slightly more accessible to ribonucleases than in RBC5LRNA. Three sites of primary RNase Ti cleavage were observedfor TWJ8 (Figure 3b). There were two cleavage sites on strandn, the first site at an unpaired G residue located at the 3-wayjunction and the second site between a G and U residue in thebubble structure. A Ti cleavage occurred on strand I betweentwo G residues but this was weaker and probably only occurredafter primary cleavage on strand n. Only one major she of RNaseT2 cleavage was present in each of strands I and II. As in thecase of T, cleavage, the strongest T2 cleavage site was foundon strand II in the region of the bubble structure. Two weakRNase T2 cleavages also occurred on strand IE, at sites locatedat the 3-way junction and near the 3' end of the strand.

The nuclease data is consistent with the proposed structuresfor the RBC5L, RBC6 and TWJ8 RNAs and support oursuggestion (19) that in the RRE the bubble structure is maintainedclose to a 3-way junction. It seems likely that base pairs areformed between the 4 residues located between the bubble andthe 3-way junction, since no RNase cleavages were observed atthese positions. Kjems et al. in their studies of the full lengthRRE (7) and a stable RNA hairpin loop structure carrying thebubble (18) also found that the bubble sequence is highly nucleaseresistant.

Rev binds as a monomer to short synthetic RNAs carryingthe bubbleThe ability of the synthetic RNAs described above to bind revwas examined using gel mobility shift assays. RBC5L RNA wasfound to form only a single ribonucleoprotein complex even in

(a) RBC5L (b)R33

Rev Cone. (nM) 0 1 1 22 3 3 4 4 5 5 0 1 1 2 2 3 3 4 4 55

. .. — Complex 2Complex-. _ _ _ • • > — — — — Complex 1

- Free RNA

Free RNA - .

(c) TWJ81 38 192 515 '

Rev Cone. (nM) 0 96 383 766

Non-specific Complex —

Complex 3 —

Complex 2 —Complex 1 —

Free RNA

Figure 3. Ribonuclease T, and T2 digestion assays of synthetic RNA structures.RNA was labelled with [-v-32P]ATP at the 5' end, and digested as described inthe Experimental Section. Open arrows show sites of primary ribonuclease T,cleavage. Solid arrows show sites of primary ribonuclease T2 cleavage, (a)RBC5L RNA. (b) TWJ8 RNA.

Figure 4. Gel mobility shift assay of rev binding to chemically synthesized RNAsReaction and electrophoresis conditions arc as shown in Figure 2 except thatelectrophoresis was at 80V for 4h (a) RBC5L RNA (b) R33 RNA, or at 100Vfor 6h (c) TWJ8 RNA



the presence of a large excess of rev (Figure 4a). By contrast,when the bubble structure was incorporated into the 56 residuestem-loop R33 RNA, a second complex was seen at high revconcentrations (Figure 4b). Complex 1, which occurs from highaffinity binding of rev to the bubble sequence, appears to be aprecursor to complex 2. As rev concentration was increased, theamount of complex 1 decreased and there was a concomitant risein the level of complex 2. TWJ8 RNA, which carries a 3-wayjunction structure, was able to form a third complex at high revconcentrations (Figure 4c). Thus it appears that short RNAstructures such as RBC5L contain a single high affinity revbinding site, whereas significantly longer RNAs such as R33 andTWJ8 RNA carry sufficient flanking RNA sequences to allowthe binding of more than one rev molecule.

Filter binding assays were performed to measure the affinityof rev for the synthetic RNAs more precisely. Figure 5a showsa competition filter binding assay where a 32P-labelled241-residue transcript containing the RRE RNA (R7) (19) iscompeted for rev binding against increasing amounts of unlabelledR7 transcript or against a synthetic RBC6 duplex RNA. Theresults show that the D,/2 (the concentration of competitorrequired to reduce binding to the filter by 50%) for RBC6 RNAis only about 2-fold increased compared to that of the R7 RNA(Figure 5a). TWJ6 RNA competes for rev binding with the sameaffinity as RBC6 (Figure 5a). By contrast, when strand HI wasomitted from the annealing reaction for TWJ6 RNA, a stablebubble structure could not be formed and this RNA failed tocompete for rev binding (Figure 5a). Shorter 2-stranded duplexRNAs containing the bubble structure, but having only 4 or 5flanking base pairs on each side, competed considerably morepoorly than RBC6 (data not shown).

Figure 5b shows a Scatchard analysis of data obtained froma self-competition binding assay of 32P-labelled RBC6 against

unlabelled RBC6. The plot is linear and the intercept gives a valuefor the stoichiometry, v, of approximately 1, while the slope ofthe line indicates a Kj of approximately 5 nM (Figure 5b). Thefilter binding results are consistent with the data of Cook et al.(26) who showed by a dual-labelling experiment that rev bindsto its high affinity site as a monomer and the gel mobility shiftassays shown in Figure 7 (see below), which show that only asingle complex is formed between rev and the RBC5L or RBC6RNAs.

Rev binding to chemically modified RNA duplexesSince RBC6 represents the minimum 2-stranded RNA that canbind a single molecule of rev with high affinity, it is a usefulmodel for the more precise delineation of the requirements forspecific recognition of the high affinity rev binding site. A seriesof functional group alterations or replacements at specificnucleoside residues were introduced into RBC6 by annealing anoligonucleotide strand containing one or more functional groupmodifications together with an unmodified oligoribonucleotidestrand (Figure 6). Binding of rev to the modified duplex RNAswas then analysed by a competition filter binding assay, similarto that described in Figure 5a, where increasing concentrationsof modified unlabelled duplex RNA were competed for revbinding against 32P-labelled 241-residue RRE R7 RNA.

The affinity of the modified RBC6 RNAs for rev could beclassified into 3 broad categories: those which exhibited wild-

, . 35 365- ^ Q Q 3-CQUGUQ CGCAGCfRBC6RNA GCACAC

60

QCQUCGfi161

0 20 40 60Competitor RNA (nM)

Figure 5. (a) Nitrocellulose filter binding assay for rev. Binding reactions containedrev, 32P-labelled RRE R7 RNA, and unlabelled synthetic RNA competitors asdescribed in the Experimental Section. ( • ) RRE R7, (O) RBC6, (A) TWJ,(A) TWJ6 lacking strand 01 (rUCUGGCAUAGUGC). (b) Scatchard analysisof rev binding to RBC6 RNA. The intercept shows a 1 to 1 stoichiometry (e).

Wlld-typ* affinity (D 1 / 2 •> 10 to 20 nil)

RRE R7 (transcript)RBC6 (unmodified)dG3s«?36

^Br-Ueo

InMnnadlatt affinity (D 1 / 2 = 20 to 100 nil)

Non-apactflc Wndlng (D 1 / 2 > >100 nil)

A35

RNA (15-mer) + DMA (14-nwr)DNA (15-m8f) + DNA (14-mer)

5151215102015201015

3050604025

»100»100»100»100»100»100

Figure 6. Affinity of modified RBC6 RNAs for rev. Top, structure of RBC6RNA. The bases in the bubble are highlighted and numbered according to Heaphyetal. (31). Bottom, summary of competition filter binding assays results. UnlabelledRBC6 RNA carrying functional group alterations was used as a competitor forrev binding to 32P-labelled RRE R7 RNA. The data is expressed as D1/2, theconcentration of competitor RNA required to reduce the binding of 32P-labelledRRE RNA to the filter by 50%.



type affinity similar to that of unmodified RBC6 RNA, those ofintermediate affinity, and those showing only non-specific binding(Figure 6). Similar results were obtained when the affinities ofthe modified duplexes were examined by gel mobility shift assay(data not shown). A representative gel mobility shift assay forsome deoxyinosine-substituted duplexes is shown in Figure 7.

Configurations of non-Watson—Crick base pairs in thebubble

The unusually high degree of ribonuclease protection of thebulged residues within these synthetic duplexes provides strongevidence for the presence of non-Watson-Crick base pairs thatadd additional stability to the bubble structure. Bartel et al. (23)showed recently that G^ and G39 could be simultaneouslyreplaced by A residues and still maintain wild-type binding ofrev. They therefore proposed that the two G-residues form a non-Watson-Crick base pair using each of their O6 and NH1

positions respectively (Figure 8), since this type of G : G basepair is isosteric with an A : A pair. Similarly, we have proposedthat G35 forms a non-Watson-Crick base pair with A^. Wehave used synthetic chemistry to distinguish between the variouspossible pairings in the bubble.

We first examined the effect of deoxynucleoside substitutionat each of the bulged nucleotides, since several important modifiedbases are currently only available as deoxynucleosides.Deoxynucleoside substitution at any of positions G^,had no effect on rev binding. Even the double mutantbound rev with wild-type affinity. However, deoxynucleosidesubstitutions at positions G59 and Ag] were deleterious andproduced a 2 to 4 fold reduction in afffinity for rev. The effectsof deoxynucleoside substitutions either side of Ueo were

(a)RBC6

(b) (c) <d)

88 88 8.8 88 8.8 88 8.8 88Rev Cone (nM) 0 44 180 0 44 180 0 44 180 0 44 180

Complex —». — _ • w «g ' Wtm •• • •»

additive; rev did not bind specifically to the triple mutantdGsgdUeodAe,. Rev also did not bind specifically to RBC6derivatives where the 14 mer strand was replaced with anoligodeoxyribonucleotide or to a dU-substituted DNA duplex withthe same sequence as RBC6.

The effect of the dl (hypoxanthine deoxyriboside) substitutionis to remove the exocyclic amino group of G. If rev is able tobind to deoxyinosine-substituted RNA duplex, then this mustcontain configurations of the G : G and G : A base pairs whichdo not require hydrogen bonding to the exocyclic amino groupof G. As shown in Figures 6 and 7, deoxyinosines are well-tolerated at each of the G positions in the bubble. Rev boundwith wild-type affinity to the dl^ mutant and to the dl35dl36

double mutant. Similarly, replacement of G59 with either dG^or disg resulted in a comparable loss of binding. To test whetherrev could bind to an RBC6 derivative carrying a dl : dl basepair, the binding of rev to the d^sdl^dl^ triple mutant wasanalysed by a gel mobility shift assay (Figure 7). Rev boundequally well to molecules carrying either the dl j9 : dl^ basepair, the &G& : dl36 base pair or the G59 : d l^ base pair. Outof the four types of G : G pair that are theoretically possible,only the and : syn pair shown in Figure 8 is consistent with thisdata, since this would allow isosteric I : I pairing whereas theother three possible G : G base pairs would require involvementof one or other of the exocyclic amino groups.

A similar approach was used to study the configuration of theG35 : Ag, base pair. Rev affinity was greatly reduced when Ag)was replaced by dl or when G3J was replaced by A. No furtherloss of affinity was seen for either the dl59 substitution or forthe N^-methyl-dAg! substitution. There are three possibleconfigurations for the proposed G35 : A6l pair that aretheoretically possible. Since inosine is tolerated at position 35,one of these structures, which requires bonding through theexocyclic amino group of the G residue, can now be eliminated.The two remaining structures (Figure 8) are consistent with thesynthetic mutants so far studied and experiments to distinguishthese two possibilities are in progress.

Although deletion of the U^ residue causes a dramatic lossof rev affinity (19), binding is not affected by P^-methylationor by 5-bromination of \JM Similarly, substitution of Ugoby dUor replacement by C (19), does not affect rev binding. Thus,it is probable that the Ugo residue merely acts as a single-stranded spacer which helps to accommodate the distortions ofthe RNA helix introduced by the G : G and G : A pairs.

Free Duplex RNA -

Single Stranded RNA -

Figure 7. Complex formation between rev protein and deoxyinosine-substitutedRBC6 RNA. Binding reactions (20 p\) contained 0.5% glycerol, 25 nM 32P-labelled duplex RNA and 0, 8.8, 44, 88 or 180 nM rev protein. After incubationon ice for 15 min, 5 jd of dye was added and electrophoresis carried out at 12W for 1 h at 4°C in a running buffer of 0.5XTB (TB •= 44.5 mM Tris base,44.5 mM boric acid, adjusted to pH 8.3 with HC1), 0.1% Triton X-100, 1%glycerol. The gel was dried and the RNA-protein complexes were detected byautoradiography. (a) RBC6 RNA (b) dG^dl j^ I^ (c) dl59dl35dl36 and (d)Gy/i^jdl^. Note that a dl59dl36 pair is tolerated without loss of rev bindingability.

Rev binding in the major groove

Mutagenesis and chemical modification experiments havesuggested that recognition of specific bases in the stem flankingthe bubble sequence is critical for high affinity rev binding (18,19, 21, 23). In a preliminary experiment, designed to determinewhether the recognition of the critical GM residue by revinvolves hydrogen bond contacts in the major groove, G^ wasreplaced by N 7-deaza-dG (24). Substitution of G^ by l^-deaza-dG abolished specific rev binding (D(/2 > 100 nM, Figure 6),whereas substitution by dG had only a modest 3-fold effect (D1/2

=40-50 nM). In similar experiments, substitution of G35 byN7-deaza-dG had an intermediate effect on rev bindingcompared to the dG control substitution which showed wild-typebinding. By contrast, substitution of G^ by N7-deaza-dG hadno effect.



DISCUSSIONStructure of the 'bubble'The high affinity binding site for rev appears to be a compactdouble-stranded RNA helix containing a distortion introduced bynon-Watson-Crick base pairs and a bulged U residue. Thenuclease protection results together with the functional groupsubstitution studies described here provide strong evidence forthe presence of both the G^ : G59 and the G35: A^ base pairs.Whereas the G : G base pair must be in the anti : synconfiguration (Figure 8), the G : A base pair may be in eitherthe anti : syn or in the anti : anti configuration.

Non-Watson—Crick base pairs have also been found in otherRNA structures. A : A and G : A pairs are found in one stemof Xenopus laevis 5S RNA (27). Recent nmr data suggests thatin the context of this quite different RNA duplex, the G : A andA : A pairs are both in an anti : anti configuration (28).

Rev recognition of the high affinity binding siteThe minimal synthetic RNA duplex (RBC6) which can bind revwith high affinity consists of 12 Watson-Crick base pairsenclosing a bubble structure of 5 nucleotides. From our earlierdata (19), specific base contacts with rev lie within the regioncovering the bubble and two base pairs on either side. However,since short RNA duplexes with less than 6 flanking base pairsare unable to bind rev with high affinity, further non-specificcontacts must extend the region of duplex RNA covered by rev.The footprinting data of Kjems et al. (18) on a minimal stem-loop carrying the bubble structure support the view that a totalof 10 to 14 base pairs, including the non-Watson-Crick basepairs in the bubble, are covered by rev. The footprinting datasuggests also that coverage of the high affinity site is asymmetricwith respect to the number of pairs covered on each side of thebubble, with fewer pairs covered on the side of the 3-wayjunction.

Our results to date are strongly reminiscent of the binding oftat to TAR RNA (24, 25, 29-31). Base-specific recognition of

TAR RNA by tat occurs at positions flanking a U-rich bulge.It is the bulged residues in TAR RNA that create a severelydistorted major groove. Similarly in the rev-RRE RNAinteraction, since N7-deaza-substitution at G34 or G35 leads tosubstantial loss of rev binding ability, it seems likely thatrecognition of the bubble by rev takes place in the major grooveof the RNA duplex. Major groove binding was very recentlyproposed by Kjems et al. (18) based on the protection affordedby a rev-related short peptide to N7-modification bydiethylpyrocarbonate (DEPC) of G-residues in the bubble region.One disadvantage of the DEPC reaction is that it introduces abulky carboxyethyl group which may give rise to steric clashblocking rev binding. Our chemical approach rules out thispossibility since functional groups, such as the nitrogen atom atN7, can be selectively removed. However, neither the chemicalmodification nor the chemical synthesis approach can fullydiscriminate between direct hydrogen-bonding contacts betweenrev and RNA and internal RNA-RNA hydrogen-bondinginteractions, since the loss of either type of contact couldpotentially disrupt rev binding.

Progressive assembly of rev-RRE complexesFollowing high affinity binding of rev at the bubble structure,subsequent lower affinity binding requires a stretch ofneighbouring duplex RNA, such as is presented in the linear R33RNA and in the 3-way junction TWJ8 RNA. Multiple revcomplex formation on the RRE requires the initial binding to thehigh affinity bubble site since mutations such as the AG^--^mutation can block both processes. The regular nature of theproposed secondary structure for the RRE, consisting of two setsof 3-armed duplexes (each set containing a 3-way junction)symmetrically placed on either side of a long duplex stem (stemI) (Figure 1), suggests that after initial recognition of the bubbleon one arm, there is an ordered recognition of the other 5 arms,but the precise details of rev assembly on the RRE are not yetunderstood.

(a) Anti

H v H

Syn

Anti

Syn

(C)Anti

(d)

Anti

Anti rlr

Figure 8. Structures of non-Watson-Crick base pairs found in the bubble, (a) The configuration of the GM : G59 pair in the bubble, (b) the stucture of the isostcricI36 : I w pair, (c and d) the two possible configurations for the G33 : A^ pair.



Mutagenesis studies strongly suggest that nucleation at the highaffinity rev binding site and oligomerization at flanking sites alsotakes place in vivo. Rev activity is abolished by deletion ordisruption of the high affinity binding site as well as by mutationsthat disrupt flanking double-stranded regions in the RRE (12,13, 16, 32 -34). Preliminary results suggest that complexesbetween rev and HTV mRNAs carrying RRE sequences can beimmunoprecipitated from infected cells (35). Thus, the assemblyof rev protein on viral mRNAs carrying RRE sequencesrepresents an essential step in the HTV life-cycle. A detailedbiochemical understanding of the assembly process should provehelpful in the development of screens for small molecules thatinterfere with either high affinity RNA recognition or thesubsequent oligomerization of rev and thereby act as specific anti-HTV therapeutic agents.

EXPERIMENTAL SECTIONChemical synthesis of modified oligoribonudeotidesOligoribonucleotides were synthesised by the phosphoramiditemethod on a 1 /tmol scale using an ABI 380B DNA/RNASynthesizer programmed for 10 minute coupling times essentiallyas previously described (36). N,N-diisopropyl-2-cyanoethylphos-phoramidites were obtained from Millipore (uridine, N4-benz-oylcytidine, r-P-isobutyrylguanosine and N^benzoyladenosine)or from ABN (uridine, N4-benzoylcytidine, N^-phenoxyacetyl-guanosine and N6-phenoxyacetyladenosine). Oligoribonucleo-tides containing single residue modifications were synthesizedusing ABN ribo amidites and phosphoramidite derivatives of thefollowing modified nucleosides: hP-isobutyryl^-deaza^'-de-oxyguanosine, N6-methyl-2'-deoxyadenosine, 2'-deoxyinosine(Glen Research via Cambio), N6-benzoyl-2'-deoxyadenosine,NMsobutyryl^'-deoxyguanosine, 2'-deoxyuridine (Cruachem).5-bromouridine phosphoramidite was prepared by the route ofTalbot et al (37) except that silylation was carried out as describedby Green et al. (38). N3-methyluridine phosphoramidite wasprepared by 5'-dimethoxytritylation, 2'-silylation and3'-phosphitylation of N^methyluridine (39) similarly to thereactions used by Green et al. for synthesis of an inosinephosphoramidite (38). Oligonucleotides were cleaved from thesupport and base-deprotected by one of the following methods:(1) for oligoribonucleotides containing dA, dl, N3-methyl-U, or5-bromo-U; saturated methanolic ammonia at room temperaturefor 24 h. (2) for oligoribonucleotides containing dG orN7-deaza-dG; ethanol/30% aqueous ammonia solution (1/3) at55° for 16 h. (3) for oligoribonucleotides containing N6-Me-dA;ethanol/ethanolamine (1 : 1) at room temperature for 48 h.followed by 55° for 12 h. (40) (4) for oligoribonucleotidesprepared using Millipore unmodified ribo-amidites: ethanol/30%aqueous ammonia solution (1 : 3) at room temperature for 2 hfollowed by 55° for 16 h.

The support was removed by centrifugation or by filtration andthe solution was evaporated to dryness (Savant Speed Vac foraqueous ammonia samples, rotary evaporator for methanolicsamples). 2'-O-t-butyldimethylsilyl groups were removed byresuspension and treatment with 1 M tetrabutylammoniumfluoride (TBAF) dissoved in tetrahydrofuran (1 ml, Aldrich) atroom temperature for 24 h. Aliquots (0.2 ml) were quenchedwith 0.8 ml of 0.1 M triethylammonium acetate solution (pH7) and desalted on a Sephadex G25 NAP10 column (Pharmacia).Alternatively after TBAF treatment, most of the tetrahydrofuranwas removed by brief rotary evaporation, the residue dissolved

in water (1 ml) and desalted on a Sephadex G25 NAP10 column.Yields of crude oligonucleotides ranged between 50 and 100A2«) units. Oligonucleotides were purified by strong anionexchange HPLC using a Partisil 10 SAX (Whatman) semi-preparative column (Hichrom) or by reversed phase HPLC(/t-Bondapak C18, Waters) as previously described (36).

The base composition of the oligonucleotides was assayed bydigestion of an aliquot of oligonucleotide (500 pmol) in 0.3 MTris-HCl buffer (pH 8.9) with snake-venom phosphodiesterase(0.25 /tg) and calf alkaline phosphatase (0.25 /tg) for 18h at 37 °C.The resulting nucleosides were separated by reversed phaseHPLC separation using a buffer of 0.1 M triethylammoniumacetate (pH 6.3) and a gradient of 0 to 15% acetonitrile run for20 minutes. Elution times (minutes) were: C (6.1), U (7.9), G(15.7), A (20.0). Modified nucleosides were eluted at thefollowing times with respect to the elution time of A: dU (—8.9),dl (-4.0), 5-Br-U (-3.4), dG (-3.0), ISP-Me-U (-2.9), dT(-2.1), dA (+1.6), N6-Me-dA ( + 5.8). N7-deaza-dG coelutedwith A.

Oligonucleotides were labelled at their 5' ends by treatmentwith [7-32P]ATP and T4 polynucleotide kinase as previouslydescribed (41). Thermal denaturation analysis was carried outusing a Perkin-Elmer X-15 uv melting apparatus. Oligonucleotideswere dissolved in 0.1 M sodium phosphate (pH 7.2) buffer andmelting points were recorded at 260 run (42) at a heating rateof 1 ° per minute over a temperature range of 20 to 90°C.

Duplexes and 3-stranded complexes were formed by heatingequimolar quantitities of two oligonucleotides together to 90° andallowing the mixture to cool slowly to 4°.

Ribonuclease digestion of synthetic RNAsA solution (1 /tl) of annealed oligonucleotides forming RBC5Lor TWJ8 where only one strand was 32P-labelled (10 /tM,4x 105 cpm//tl) was mixed with a solution (2.5/tl) containing 60mM Tris-HCl (pH 7.8), 40 mM MgCl2and 600 mM KC1, anda solution (1.5 /tl) of RNase T, (0.067 to 0.67 units//il) orRNase T2 (0.017 to 0.67 units//tl) was added. After 30 minuteson ice, 0.5 M EDTA (15 /tl) and formamide containing xylenecyanol and bromophenol blue (60 /tl) were added and the mixtureswere denatured at 75° for 2 minutes and cooled rapidly inice/water. Aliquots (2 /tl) of each sample were applied to a 20%polyacrylamide gel containing 7 M urea (0.5x360 mm) andelectrophoresis carried out at 20 W for 2.5 h.

Preparation of transcript RNAs32P-labelled RRE R7 RNA was prepared by T7 RNApolymerase transcription of HirvSR cut pGEM plasmids aspreviously described (15, 19). RRE (R7) RNA is a 241-mercontaining 225 residues (7786—8010) of HTV-lARvand contains15 extra residues at the 5' end and a single A residue at the 3'end derived from the pGEM vector.

RRE (R540.1) RNA and RRE (R10.1) RNA were preparedfrom RRE sequences cloned into pBluescript vectors (Stratagene).RRE R540.1 (Figure 1) is a 276-mer containing 225 residues(7786-8010 of HTV-IARV together with an extra 50 residues atthe 5'-end and a single U residue at the 3'-end derived from thepBluescript vector. RRE R10.1 is identical to RRE R540.1 exceptthat it carries the AG3J_36 mutation (a deletion of the G residues7826 and 7827). To prepare these plasmids, PCR reactions werecarried out on RRE7 plasmid DNA (1 /tg) using 0.5 /tMoligonucleotide primers, 80 /xM dNTPs, 0.1 mg/ml BSA and 2units Vent DNA polymerase in 200 /tl of Vent buffer (New



England Biolabs). The PCR reactions were performed using amaximum of 30 cycles of incubation at 94°C for 1 minute, 55°Cfor 1 minute and 72°C for 2 minutes. Oligonucleotide primers,fully matched for R540.1 or containing the AG35_36 mutationfor R10.1, also contained Clal or Xbal linker ends to permitsubsequent cloning. PCR products were digested with Clal andXbal and purified by electrophoresis on 2% agarose gels. Thepurified fragments were cloned into pBluescript which had beenpredigested with Clal and Xbal. The resultant plasmid DNAs(DM540.1 and DM10.1) were digested with Xbal and transcribedusing T3 RNA polymerase as previously described (43).

Rev binding assaysRev protein was obtained essentially as previously described (19)except that it was chromatographed on Heparin-Sepharose andSuperose 12 after refolding. The rev protein binds tightly toHeparin and was eluted in 2 M NaCl. Rev protein stocks werestored in aliquots in liquid nitrogen in a buffer containing 50 mMTris-HCl (pH8.0), 200 mM NaCl, 0.1% Triton X-100, 1 mMDTT, 0.1 mM EDTA.

Filter binding reactions (0.5 ml) contained TK buffer (50 mMTris-HCl buffer (pH 7.9), 20 mM KC1), 10 nM rev protein, 1.5nM 32P-labelled RRE R7 RNA, 12 units RNasin (Promega),0.375 ng tRNA, 0.75 ng DNA, and 0 to 100 nM unlabelledcompetitor duplex RNA and incubated on ice for 15 minutes.The binding reactions were filtered through 25 mm GS filters(0.22 /xl pore size, Millipore), washed with ice cold TK buffer,dried and counted by liquid scintillation, as previously described(19).

Scatchard analysis of rev binding to RBC6 RNA was performedin 0.5 ml reactions in TK buffer which included 1.5 nM 32P-labelled RBC6 RNA duplex (approximately 20,000 cpm), 25 nMrev protein, 40 units RNasin (Promega), 0.1 % Triton X-100 andvarying concentrations of unlabelled RBC6 RNA duplex. Afterbinding for 15 minutes on ice, the solutions were filtered throughGS filters and counted as described above.

Gel mobility shift assays were performed essentially asdescribed (15, 29). Binding and electrophoresis conditions aregiven in the Figure legends.

ACKNOWLEDGEMENTS

We thank M.J.Churcher for advice on gel mobility shift assays,A.D.Lowe, S.M.Green, and M.Singh for technical assistance,and our colleagues at LMB for advice and helpful discussions.S.Iwai is very grateful to the Japan Society for the Promotionof Science and to the Ministry of Education, Science and Culture,Japan, for fellowship awards.

REFERENCES1. Cullen, B.R. and Malim, M.H. (1991) Trends in Biochemical Sciences, 16,

346-350.2. Karn, J., Dingwall, C , Gait, M.J., Heaphy, S. and Skinner, M.A. (1991)

in Eckstein, F. and Lilley, D.M.J. (eds.) Nucleic Acids and MolecularBiology, Springer-Verlag, Berlin, Vol 5, 194-218.

3. Arrigo, S.J. and Chen, I.S.Y. (1991) Genes & Devei. 5, 808-819.4. D'Agostino, D.M., Felber, B.K., Harrison, J.E. and Pavlakis, G.N. (1992)

Mol. Cell Bioi, 12, 1375-1386.5. Lawrence, J.B., Cochranc, A.W., Johnson, C.V., Perkins, A. and Rosen,

C.A. (1991) New Biol.. 3, 1220-1232.6. Malim, M.H., Hauber, J., Fenrich, R. and Cullen, B.R. (1988) Namre,

335, 181-183.

7. Kjems, J., Brown, M., Chang, D.D. and Sharp, P.A. (1991) Proc. Nail.Acad. Sci. USA, 88, 683-687.

8. Chang, D.A. and Sharp, P.A. (1989) Cell, 59, 789-795.9. Malim, M.H., Hauber, J., Le, S.-Y., Maizel, J.V. and Cullen, B.R. (1989)

Nature, 338, 254-257.10. Emerman, M., Vazeaux, R. and Peden, K. (1989) Cell, 57, 1155-1165.11. Felber, B.K., Hadzopoulou-Cladaras, M , Cladaras. C , Copeland, T. and

Pavlakis, G.N. (1989) Proc. Nail. Acad. Sci. USA, 86, 1495-1499.12. Dayton, E.T., Konings, D.A.M., Powell, D.M., Shapiro, B.A., Butini, L.,

Maizel, J.V. and Dayton, A.I. (1992) J. Virol., 66, 1139-1151.13. Holland, S.M., Chavez, M., Gerstberger, S. and Venkatesan, S. (1992)7.

Virol., 66, 3699-3706.14. Daly, T J., Cook, K.S., Gary, G.S., Maione, T.E. and Rusche, J.R. (1989)

Namre, 342, 816-819.15. Heaphy, S., Dingwall, C , Emberg, I., Gait, M.J., Green, S.M., Kam,

J., Lowe, A.D , Singh, M. and Skinner, M.A. (1990) Cell, 60, 685-693.16. Malim, M.H., Tiley, L.S., McCam, D.F., Rusche, J.R., Hauber, J. and

Cullen, B.R. (1990) Cell, 60, 675-683.17. Zapp, M.L. and Green, M.R. (1989) Nature, 342, 714-716.18 Kjems, J., Calnan, B.J., Frankel, A.D. and Sharp, P.A. (1992) EMBOJ..

11, 1119-1129.19. Heaphy, S., Finch, J.T., Gait, M.J., Karn, J. and Singh, M. (1991) Proc.

Natl. Acad. Sci. USA, 88, 7366-7370.20. Malim, M.H. and Cullen, B.R. (1991) Cell, 65, 241-248.21. Tiley, L.S., Malim, M.H., Tewary, H.K., Stockley, P.G. and Cullen, B.R.

(1992) Proc. Natl. Acad. Sci. USA, 89, 758-76221. Wingfield, P.T., Stahl, S.J , Payton, M.A., Venkatesan, S., Misra, M. and

Steven, A.J. (1991) Biochemistry, 30, 7527-7534.23. Bartel, D.P , Zapp, M.L., Green, M.R. and Szostak, J.W. (1991) Cell, 67,

529-536.24. Hamy, F., Asseline, U., Grasby, J., Iwai, S., Pritchard, C , Slim, G., Butler,

P.J.G., Kam, J. and Gait, M.J. (1992) J. Mol. Biol., in press.25. Weeks, K.M. and Crothers, D.M. (1991) Cell, 66, 577-588.26. Cook, K.S., Fisk, G.J., Hauber, J., Usman, N., Daly, T.J. and Rusche,

J.R. (1991) Nucl. Acid Res., 19, 1577-1583.27. Westhof, E., Romby, P., Romaniuk, P., J.-P., E., Ehresmann, C. and

Ehresmann, B. (1989) J. Mol. Biol., 207, 417-431.28. Wimberly, B., Varani, G. and Tinoco, I. (1992) Biochemistry, in press .29. Churcher, M., Lamont, C , Dingwall, C , Green, S.M., Lowe, A.D., Butler,

P.J.G., Gait, M.J. and Karn, J. (1992) J. Mol. Biol., in press.30. Puglisi, J.D., Tan, R., Calnan, B.J., Frankel, A.D. and Williamson, J.R.

(1992) Science, 257, 76-80.31. Delling, U., Reid, L.S., Bamett, R.W., Ma, M.Y.-X., Climie, S., Sumner-

Smith, M. and Sonenberg, N. (1992) / Virol., 66, 3018-3025.32. Olsen, H.S., Nelbrock, P., Cohrane, A.W. and Rosen, C.A. (1990) Science,

247, 845-848.33. Holland, S.M., Ahmad, N., Maitra, R.K., Wingfyeld, P. and Venkatesan,

S. (1990) J. Virol., 64, 5966-5975.34. Cochrane, A.W., Chen, C.-H. and Rosen, C.A. (1990) Proc. Natl. Acad.

Sci. USA, 87, 1198-1202.35. Arrigo, S.J., Heaphy, S. and HainesJ.K. (1992)/. Virol., 66, 5569-5575.36. Gait, M.J., Pritchard, C. and Slim, G. (1991) in Eckstein, F.

(ed.),Oligonucteotides and analogues: a practical approach, IRL Press:Oxford, UK pp 25-48.

37. Talbot, S.J., Goodman, S., Bates, S.R.E., Fishwick, C.W.G. and Stockley,P.G. (1990) Nucleic Acids Res., 18, 3521-3528.

38. Green, R., Szostak, J.W., Benner, S.A., Rich, A. and Usman, N. (1991)Nucl. Acids Res., 19, 4161-4166.

39. Zemlkka, J. (1970) Collect. Czech. Chem. Commun.. 35, 3572-3583.40. Polushin, N.N., Pashkova, I.N. and Efimov, V.A. (1991) Nucl. Acids Res.

Symp. Series, 24, 49-50.41. Slim, G. and Gait, M.J. (1991) M/d. Acids Res. 19, 1183-1188.42. Brown, T., Leonard, G.A., Booth, E.D. and Kneale, G. (1990) J. Mol.

Biol., 212, 437-44O.43. Dingwall, C , Ernberg, I., Gait, M.J., Heaphy, S., Kam, J. and Skinner,

M.A. (1991) in Kumar, A. (ed.), Advances in Molecular Biology andTargetedTreatment for AIDS, Plenum: New York, pp 133-143.


recognition of the high affinity binding site in rev-response element

Documents