reciprocal relationship between dietary...
TRANSCRIPT
RECIPROCAL RELATIONSHIP BETWEEN DIETARY IRON AND COPPER AND WHOLE-BODY METABOLISM OF BOTH MINERALS
By
JUNG-HEUN HA
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2016
© 2016 Jung-Heun Ha
To Lord and my family
4
ACKNOWLEDGMENTS
Although only my name is written in this dissertation, however, there are
abundant people involved in this publication. I have debts to all of these great people
who supported to fabricate this dissertation.
My first and important gratitude is to my major mentor, Dr. James F. Collins. I
have huge fortunate to have an advisor who gave me a chance to learn science with
sincere guidance for every step. Dr. Collins showed unlimited patience, gentleness and
support and these are direct reasons to finish this dissertation. I want to learn his
excellence in academia and personality, so if I have a chance to become a principal
investigator later, I would like to manage my lab in his ways.
Besides my advisor, I would like to thank the rest of my thesis committee: Dr.
Mitchell D. Knutson, Dr. Bobbi Langkamp-Henken and Dr. Volker Mai, for detailed
discussion, insightful comments, technical supports and encouragement to widen my
research to variety perspectives.
Dr. Caglar Doguer was the most helpful friend in this dissertation. He gave me
numerous helpful comments when I transferred to Dr. Collins lab and also helped to
generate significant amount of data in this dissertation. Also, I owed to Min-Hyun Kim,
Martin Alla, Shireen R. Flores and Xiaoyu Wang since they helped me in many aspects.
My sincere thanks also go to Dr. Myoung-Sool Do, Department of Life Sciences
in Handong University. He sparked my research interest in molecular nutrition. His life
challenged me how to live a disciple in this world as a scientist.
I am also grateful to Dr. Vernon Rayner, worked in the Rowett Research Institute.
Dr. Rayner's insightful comments and constructive philosophies in science of my
5
previous research were positively affected my research career. He also gave me helpful
comment for this dissertation.
I am also indebted to Dr. Chang-Woo Song, Korea Institute of Toxicology. His life
showed me the sincere responsibility to lab members as a principle investigator and a
Christian. I am able to writing this dissertation with his responsible sacrifice in the
Institute.
Most importantly, none of this work would be accomplished without love and
patience of my family. My family showed me everlasting love, devotional praying,
unselfish sacrifice and support all these years. I cannot express my grateful heart with
just few words to my family. My parents showed me unconditional love and support. I
am proud since I am your son and appreciate to give me a chance to prove and improve
myself. Though I cannot see my grandmother again, I want to appreciate for her
dedicated attitude for me. I had a huge appreciation to my wife, Sun Young Jeong, who
has thoughtful enough to understand my filibuster to housework with variety supports for
this degree. Also, I would like to appreciate to my sons, Ijoon (John) and Isan (Joesph)
since they are good news makers during my degree. I would like to congratulate my
brother Dr. Dongheon Ha received a PhD degree in this spring and wish to bless his
new life.
Thank you God it is graduation. Now I know there are no higher mountains and
waves as long as you are my side.
6
TABLE OF CONTENTS page
ACKNOWLEDGMENTS .................................................................................................. 4
LIST OF TABLES ............................................................................................................ 9
LIST OF FIGURES ........................................................................................................ 10
ABSTRACT ................................................................................................................... 16
CHAPTER
1 LITERATURE REVIEW .......................................................................................... 18
Iron-Related Disorders: Iron Deficiency .................................................................. 18 Iron-Related Disorders: Iron Overload .................................................................... 19
Intestinal Iron Absorption: Heme Iron ..................................................................... 20 Intestinal Iron Absorption: Nonheme Iron................................................................ 21 Main Functions of Copper ....................................................................................... 21
Copper Related Disorders: Copper Deficiency ....................................................... 22 Copper Related Disorders: Copper Overload ......................................................... 23
Intestinal Copper Absorption ................................................................................... 24 Iron and Copper Interactions .................................................................................. 25 Copper Metabolism in Dietary Iron-Deficiency and Iron-Overload Models ............. 26
Iron Metabolism During Dietary Copper-Deficiency ................................................ 27
2 MATERIALS AND METHODS ................................................................................ 30
Animal Experiments ................................................................................................ 30 Determination of Iron Status and Hepatic Mineral Concentrations ......................... 31
Serum Erythropoietin Measurement ....................................................................... 32 para-Phenylenediamine (pPD) Assay ..................................................................... 32
Cell Culture and Development of Atp7a KD IEC-6 and Caco-2 Cells ..................... 32
Iron Transport Studies ............................................................................................ 34 Mineral Analysis ...................................................................................................... 35
Atomic Absorption Spectrometry ...................................................................... 35 Inductive-Coupled Plasma Mass Spectrometry ................................................ 35
qRT-PCR ................................................................................................................ 35
FOX Activity Assay ................................................................................................. 36 Ferrireductase Activity Assay .................................................................................. 36 Protein Isolation and Immunoblotting ...................................................................... 36 Determination of Copper Absorption and Distribution ............................................. 37
Statistical Analysis .................................................................................................. 38
3 HIGH-IRON CONSUMPTION IMPAIRS GROWTH AND CAUSES COPPER-DEFICIENCY ANEMIA IN WEANLING SPRAGUE-DAWLEY RATS ..................... 46
7
Introduction ............................................................................................................. 46
Results .................................................................................................................... 48 Growth Rates and Organ Weights Differed Among Experimental Groups ....... 48
Low- and High-Iron Consumption Altered Hematological Parameters ............. 48 Renal Epo Expression Was Induced by Copper Deprivation in Iron-Deficient
and Iron-Loaded Rats ................................................................................... 49 The Erythroid Iron Regulator, Erfe, Was Induced by Copper Deprivation in
the Spleens of Iron-Deficient Rats ................................................................. 49
Hepatic Nonheme Iron Loading Increased in the HFe/HCu Group ................... 50 High-Iron Feeding Increased Tissue Iron Levels .............................................. 51 High-Iron Feeding Caused Systemic Copper Deficiency .................................. 51
Discussion .............................................................................................................. 52
4 DIETARY IRON OVERLOAD CAUSES COPPER DEFICIENCY IN WEANLING C57BL/6 MICE BUT INTESTINAL COPPER ABSORPTION IS NORMAL ............. 65
Introduction ............................................................................................................. 65 Results .................................................................................................................... 68
High-Iron Consumption Caused Mortality, Growth Retardation and Cardiac Hypertrophy ................................................................................................... 68
Dietary Iron and Copper Concentrations Affected Hematological Parameters and Transferrin Saturation ......................................................... 69
High-Iron Intake Induced Hepatic Hepcidin Expression with increased Hepatic Iron Accumulation ............................................................................ 69
High-Iron and Copper Affects Iron Homeostasis-Related Gene Expression .... 69 Dietary Iron and Copper Altered Renal Erythropoietin Expression ................... 70
Hepatic Copper Distribution and Cp Activity ..................................................... 70 64Cu Absorption and Distribution Were Not Altered by High-Iron Feeding ....... 71
Discussion .............................................................................................................. 71
5 LACK OF COPPER-TRANSPORT ATPASE 1 (ATP7A) IMPAIRS IRON FLUX IN FULLY DIFFERENTIATED RAT INTESTINAL EPITHELIAL (IEC-6) AND HUMAN COLORECTAL ADENOCARCINOMA (CACO-2) CELLS ......................... 82
Introduction ............................................................................................................. 82
Results .................................................................................................................... 83 Atp7a Knockdown Perturbs Iron and Copper Homeostasis in IEC-6 Cells ....... 83 Atp7a Knockdown Impairs Vectorial Iron Uptake and Efflux in IEC-6 and
Caco-2 Cells .................................................................................................. 84
Atp7a Knockdown Changes Iron Homeostasis Related Gene and Protein Expression .................................................................................................... 85
Atp7a KD Alters Iron Homeostasis Related Transcription Rates and mRNA Stability.......................................................................................................... 86
Atp7a KD Enhances Cell-Surface Ferrireductase and Feroxidase Activity in IEC-6 Cells .................................................................................................... 87
Discussion .............................................................................................................. 88
8
6 CONCLUSION AND FUTURE DIRECTIONS ....................................................... 102
Conclusion ............................................................................................................ 102 Further studies ...................................................................................................... 106
APPENDIX
A SUPPLEMENTARY FIGURES ............................................................................. 111
B SUPPLEMENTARY TABLES ............................................................................... 115
C OCULAR INFLAMMATION AND ENDOPLASMIC RETICULUM STRESS ARE ATTENUATED BY SUPPLEMENTATION WITH GRAPE POLYPHENOLS IN HUMAN RETINAL PIGMENTED EPITHELIUM CELLS AND IN C57BL/6 MICE .. 122
Abstract ................................................................................................................. 122
Introduction ........................................................................................................... 123
Materials and Methods.......................................................................................... 124 Chemical Reagents ........................................................................................ 124 Muscadine Grape Phytochemicals ................................................................. 125
Cell Culture and MGP Treatment ................................................................... 125 Endotoxin-Induced Ocular Inflammation ........................................................ 125
Histology and Analysis of Infiltrated Leukocytes into Eyes ............................. 126 Real-Time qPCR ............................................................................................ 126 Western Blot Analysis .................................................................................... 126
Measurement of Transepithelial Electrical Resistance ................................... 127 VEGFα Secretion ........................................................................................... 128
Intracellular Calcium Release ......................................................................... 128 Flow Cytometric Analysis of Apoptosis ........................................................... 128
Statistical Analysis .......................................................................................... 129 Results .................................................................................................................. 129
MGPs Reduced NF-κB Activation in ARPE-19 Cells ...................................... 129 MGPs Attenuated Acute Ocular Inflammation in vivo ..................................... 130
MGPs Protected Inflammation-induced Retinal Permeability ......................... 131
MGPs Decreased ER Stress in ARPE-19 Cells ............................................. 131 Discussion ............................................................................................................ 133
LIST OF REFERENCES ............................................................................................. 146
BIOGRAPHICAL SKETCH .......................................................................................... 164
9
LIST OF TABLES
Table page 2-1 Iron and copper concentrations in experimental diets ........................................ 39
2-2 Constant ingredients in the 9 experimental diets ................................................ 39
2-3 Variable ingredients in the 9 experimental diets ................................................. 40
2-4 Negative control and Atp7a-specific shRNA sequences ..................................... 41
2-5 Negative control and Atp7a-specific shRNA in lentiviral GFP vector sequences (transfected into IEC-6 cells) ............................................................ 42
2-6 Negative control and Atp7a-specific shRNA in lentiviral GFP vector sequences (transfected into Caco-2 cells) .......................................................... 43
2-7 List of rat qRT-PCR primers (in vivo) .................................................................. 44
2-8 List of mouse qRT-PCR primers (in vivo) ........................................................... 44
2-9 List of rat qRT-PCR primers (in vitro) ................................................................. 45
B-1 Statistical summary (rat study) ......................................................................... 115
B-2 Estimated average daily calorie intake (rat study) ............................................ 116
B-3 Relative spleen and kidney weights (rat study) ................................................. 116
B-4 Tissue iron levels (rat study) ............................................................................. 117
B-5 Tissue copper levels (rat study) ........................................................................ 118
B-6 Relative tissue weights (mouse study) ............................................................. 118
B-7 Statistical summary (mouse study) ................................................................... 119
B-8 Statistical summary (mouse study - 64Cu gavage) ............................................ 120
B-9 Dietary Iron overload studies ............................................................................ 121
C-1 List of qRT-PCR primers .................................................................................. 145
10
LIST OF FIGURES
Figure page 3-1 HFe feeding impaired growth and caused cardiac hypertrophy .......................... 59
3-2 Consumption of the LFe and HFe diets altered hematological parameters ........ 60
3-3 Renal Epo and splenic Erfe levels increased in rats consuming the LFe/LCu diet ...................................................................................................................... 61
3-4 HFe diets increased Hepc expression ................................................................ 62
3-5 HFe feeding resulted in severe tissue copper depletion and reduced Cp activity ................................................................................................................ 63
4-1 HFe feeding caused toxicity, growth retardation and cardiac hypertrophy in C57BL/6 mice ..................................................................................................... 75
4-2 Hematological parameters and Tf saturation in C57BL/6 mice ........................... 76
4-3 Hepatic Hepc expression and hepatic iron distribution in C57BL/6 mice ............ 77
4-4 Hepatic iron related gene expressions in C57BL/6 mice .................................... 78
4-5 HFe feeding induced splenic Epo expression in C57BL/6 mice ......................... 79
4-6 HFe feeding decreased hepatic copper distribution and Cp activity in C57BL/6 mice ..................................................................................................... 80
4-7 Copper absorption and distribution in C57BL/6 mice .......................................... 81
5-1 Atp7a knockdown attenuates iron and copper flux in IEC-6 cells ....................... 92
5-2 Atp7a knockdown impairs tranepithelial iron flux in IEC-6 and Caco-2 cells ...... 93
5-3 Atp7a knockdown alters iron-copper homeostasis related gene expression in IEC-6 cells .......................................................................................................... 95
5-4 Atp7a knockdown changes iron transport related protein expression in IEC-6 cells .................................................................................................................... 97
5-5 Atp7a knockdown alters iron-transport related heteronuclear RNA and transcriptional rate .............................................................................................. 98
5-6 Atp7a knockdown enhances cell surface ferrireductase activity in IEC-6 cells . 100
5-7 Atp7a knockdown increases membrane and cytosolic ferroxidase activity in IEC-6 cells ........................................................................................................ 101
11
A-1 Serum Total Iron-Binding Capacity (TIBC) and expression of hepatic IL-6 and BMP6 ................................................................................................................ 111
A-2 Copper absorption and distribution in C57BL/6 mice ........................................ 112
A-3 Verification of Atp7a knockdown in IEC-6 and Caco-2 cells ............................. 113
A-4 Atp7a knockdown in IEC-6 cells cells alters expression of iron transport-related proteins ................................................................................................. 114
C-1 TNFα–induced proinflammatory gene expression, MAPK, and NF-κB activation in MGP-treated ARPE-19 cells ......................................................... 138
C-2 Ocular inflammation and leukocyte infiltration in control and MGP-supplemented C57BL/6 mice ........................................................................... 139
C-3 Ocular tight junction expression and retinal permeability in MGP-supplemented C57BL/6 mice and ARPE-19 cells............................................. 140
C-4 ER stress-induced VEGFα gene expression and protein secretion in MGP-treated ARPE-19 cells ...................................................................................... 141
C-5 Tg-induced [Ca2+]i and ER stress markers expression in MGP-treated ARPE-19 cells ............................................................................................................. 142
C-6 Effect of MGP against thapsigargin-inducible retinal apoptosis ........................ 143
C-7 A proposed mechanism by which MGPs attenuate ocular inflammation and ER stress .......................................................................................................... 144
12
LIST OF ABBREVIATIONS
[Ca2+]i Intracellular calcium
AAS Atomic absorbance spectrometry
Acy Anthocyanin
AdCu Adequate copper
AdFe Adequate iron
AMD Age-related macular degeneration
ARPE-19 Human retinal pigmented epithelial cells
ATF4 Activating transcription factor 4
Atp7a Copper-transporting ATPase 1
Atp7b Copper-transporting ATPase 2
BBM Brush-border membrane
BiP Binding of immunoglobulin protein
BLM Basolateral membrane
Bmp6 Bone morphogenetic protein 6
Caco-2 Human colorectal adenocarcinoma cells
CDA Copper-deficiency anemia
CHOP CCAAT/enhancer binding protein
CKD Chronic kidney disease
Cp Ceruloplasmin
Ctr1 Copper transporter 1
Ctrl Negative control
Dcytb Duodenal cytochrome B
DFO Desferoxamine
DMEM Dulbecco’s modified eagle’s medium
13
Dmt1 Divalent metal-ion transporter 1
DR Diabetic retinopathy
DTT Dithiothreitol
EA Ellagic acid
EDTA Ethylenediaminetetraacetic acid
Epo Erythropoietin
Epor Erythropoietin receptor
ER Endoplasmic reticulum
Erfe Erythroferrone
FOX Ferroxidase
Fpn1 Ferroportin 1
H & E Hematoxylin and eosin
Hb Hemoglobin
HBSS Hank's Balanced Salt Solution
HCu High copper
Hct Hematocrit
Hepc Hepcidin
HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
Heph Hephaestin
HFe High iron
HH Hereditary hemochromatosis
Hif2α Hypoxia inducible factor 2 alpha
hnRNA Heteronuclear RNA
HRP Horseradish peroxidase
ICP-MS Inductively coupled plasma mass spectrometry
14
Id1 Inhibitor of DNA binding 1
IDA Iron-deficiency anemia
IEC-6 Rat intestinal epithelial cells
IgG Immunoglobin G
IκBα NF-κB inhibitor α
IRP Iron-regulatory protein
IRE Iron-responsive element
Jak Janus kinase
KD Knockdown
KO Knockout
LCu Low copper
LFe Low iron
LPS Lipopolysaccharide
MCP-1 Monocyte chemo-attractive protein 1
MGPs Muscadine grape polyphenols
mRNA Messenger RNA
Mt1a Metallothionein 1A
NAcy Non-anthocyanin
NF-κB Nuclear factor kappa B
Ocln Occludin
PAGE Polyacrylamide gel electrophoresis
p-eIF2α Phosphorylated-eukaryotic translation initiation factor 2 alpha
p-JNK Phosphorylated c-Jun N-terminal kinase
SD Standard deviation
SDS Sodium dodecyl sulfate
15
shRNA Small hairpin RNA
Smad7 SMAD family member 7
Stat Signal transducer and activator of transcription
TEER Transepithelial electrical resistance
Tf Transferrin
Tfr Transferrin receptor
Tg Thapsigargin
TIBC Total iron binding capacity
UPRs Unfolded protein responses
VEGF Vascular endothelial growth factor
16
Abstract of Dissertation Presented to the Graduate School of the University of Floridain Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
RECIPROCAL RELATIONSHIP BETWEEN DIETARY IRON AND COPPER AND
WHOLE-BODY METABOLISM OF BOTH MINERALS
By
Jung-Heun Ha
August 2016
Chair: James F. Collins Major: Nutritional Sciences
Iron absorption in the upper gastrointestinal tract is tightly regulated because
there is no active excretory pathway. Iron-copper interactions in humans were reported
more than a century ago; however, the molecular mechanism(s) underlying the
physiologic links between iron and copper are unclear. My dissertation research was
intended to test the hypothesis that changes in dietary iron/copper intake would have
differential influences on copper/iron homeostasis in rodents. Further studies were
performed in an in vitro model of the mammalian intestinal epithelium, and were
intended to elucidate the mechanistic link between iron and copper at the level of the
intestinal enterocyte.
For the in vivo studies, male, weanling Sprague-Dawley rats and C57BL/6 mice
were housed in overhanging cages with wire-mesh bottoms and were fed one of 9
different AIG-93G-based diets for 5 weeks, containing low, adequate or high iron in
combination with low, adequate or high copper. Unexpectedly, several homeostatic
perturbations were noted in rodents consuming the high-iron diets with low or adequate
copper levels, including the following: growth retardation; anemia; low copper
concentrations in blood, liver, heart and bone; cardiac hypertrophy; and low serum
17
ferroxidase activity. Interestingly, none of these symptoms developed in the rodents fed
the high-iron diets with higher copper content. Moreover, erythropoietin production was
enhanced in the high-iron-fed rodents with low copper content, but increasing dietary
copper concentrations prevented erythropoietin induction. Furthermore, studies in mice
provided evidence that high-iron consumption does not impair intestinal copper
absorption, but rather that copper distribution to tissues was perturbed. I thus conclude
that high-iron feeding causes systemic copper deficiency.
Additional in vitro experiments were performed in rat IEC-6 and human Caco-2
cells and were designed to test the hypothesis that the Atp7a copper transporter
influences intestinal iron transport. Accordingly, this copper transporter was silenced by
stable transfection of plasmid-derived Atp7a-specific shRNAs. Notably, silencing Atp7a
in fully-differentiated cells significantly attenuated vectorial 59Fe transport by altering
expression/activity of intestinal iron transporters and accessory proteins. Overall, these
in vivo and in vitro findings provide unique mechanistic insight into how copper
influences iron metabolism (and vice versa), thus providing the impetus for further
investigation.
18
CHAPTER 1 LITERATURE REVIEW
Iron is the fourth most common metal in the earth’s crust and is required by most
forms of life1,2. The adult human body contains ~3 g of iron, the majority of which is
found in hemoglobin (Hb) (~67%) and myoglobin (~10%)3. Iron, a metal, exists in
several oxidation states, the most stable of which are ferric and ferrous iron in biological
systems. The ability of iron to participate in reduction-oxidation reactions makes iron a
crucial element in many vital physiological processes4. Iron is an essential nutrient
critical for many cellular functions including cellular proliferation, energy production, and
DNA synthesis5. As a result, the maintenance and control of cellular iron homeostasis is
critical to prevent the occurrence of significant adverse health conditions.
Iron-Related Disorders: Iron Deficiency
Iron deficiency occurs when body iron stores become depleted. Iron-deficiency
anemia (IDA) is a severe form of iron deficiency in which body iron levels are too low to
support normal erythropoiesis. Iron deficiency is the most abundant nutritional
deficiency in the world, affecting more than 30% of the world’s population (~2 billion
people)6. In general, iron deficiency is most prevalent in developing countries; however,
it is also observed in industrialized areas. In the United States, the number of those
affected by iron deficiency has significantly increased over the last few decades7. Iron
deficiency affects >7% of infants (aged 1-2 years) and >11% of females (aged 12-49
years) in the US while IDA occurs in >2% of infants and >3% of females in the US7. The
primary causes of iron deficiency include inadequate iron intake, reduced bioavailability
from the diet, or increased iron demand due to bleeding, infection, or rapid growth (e.g.
19
during pregnancy and adolescence)6,8,9. Iron deficiency may impair cognitive
development10, immune function11 and work capacity12.
Iron-Related Disorders: Iron Overload
The most common iron-overload disorders in humans, collectively referred to as
hereditary hemochromatosis (HH), are caused by genetic mutations. Interestingly, the
mutant genes in HH all encode proteins involved in the regulation of expression of
hepcidin (Hepc), a liver-derived hormonal regulator of iron homeostasis. Hepc is
synthesized as an 84 amino acid propeptide. The biologically-active form of the peptide
released by the liver into the blood has 25 amino acids with several disulfide
bridges13,14. Hepc functions to regulate serum iron levels by blocking absorption of
dietary iron and iron release from body storage sites (mainly macrophages of the liver,
spleen and bone marrow). It accomplishes this by binding to the only known mammalian
iron exporter, ferroportin 1 (Fpn1) and causing its internalization and degradation15,16.
Characteristic symptoms of iron overload include, hepatomegaly, cirrhosis,
cardiomyopathy, diabetes mellitus, chronic abdominal pain, fatigue, hypopituitarism,
hypogonadism, and increased risk of infection17.
There are several types of HH, each caused by mutations in different iron
metabolism-related genes. The most common form of iron overload, HH Type I, is the
result of a mutation in the gene encoding the high-iron protein (HFE) in which a single
tyrosine is substituted for a cysteine at amino acid position 282 of the unprocessed
protein. About 10% of the Caucasian population carries the C282Y HFE mutation18. The
HFE protein is involved in the regulation of expression of Hepc. The C282Y HFE
mutation impairs Hepc expression and thus leads to excessive intestinal iron absorption
and tissue iron accumulation in some individuals19. Juvenile hemochromatosis, also
20
known as HH Type IIA or Type IIB, is the result of a mutation in either hemojuvelin
(Hjv)20 or Hepc itself21, respectively. Hjv is also involved in regulating the expression of
Hepc in the liver. In Hjv knockout (KO) mice, there was a reduction of hepatic Hepc
mRNA expression, but increased Fpn1 expression in enterocytes and
macrophages22,23. In these mice, iron loads in liver, pancreas and heart. In Hepc KO
mice, iron accumulates in multiple organs in early life24,25. Furthermore, HH Type 3,
caused by a mutation in the gene encoding transferrin receptor 2 (Tfr2), also triggers
iron overload26,27. HH Type 4 is related to a missense mutation of the SLC40A1 gene
that encodes Fpn1; there are two types of mutations in the SLC40A1 gene28,29. HH
Type 4A also called Fpn disease, caused by loss-of-function mutation in Fpn1, triggers
reduced localization of Fpn1 on the cell surface and reduced iron export30. HH Type 4B
is caused by a gain-of-function mutation of Fpn which prevents Fpn degradation by
Hepc31. In all forms of HH, except HH Type 4A, iron accumulation in organs is triggered
by elevated iron efflux from enterocytes and macrophages due to attenuated hepatic
Hepc expression and enhanced Fpn1 expression29.
Intestinal Iron Absorption: Heme Iron
Intestinal iron absorption is tightly regulated because no active excretory pathway
exists in humans. As discussed above, perturbations in iron homeostasis can have
significant pathological consequences. There are two major types of dietary iron in food
sources; heme and nonheme iron. In some food sources, such as legumes, ferritin-
bound iron, a slow-release form, is present32. Heme and nonheme iron are absorbed by
different mechanisms. Heme iron is found in animal foods, such as meat and fish33.
Heme iron is more efficiently absorbed than nonheme iron34,35, but the mechanism by
which this occurs is not well understood36. Mean bioavailability of heme iron is ~20 -
21
30%; however, this can increase to as much as 50% with increased body
requirements37.
Intestinal Iron Absorption: Nonheme Iron
More is known about the mechanism of nonheme iron absorption. Nonheme iron
exists in nuts, vegetables, grain products and meat33. A majority of dietary nonheme
iron exists in the ferric form; however, iron in this form cannot be directly taken up by
enterocytes. Fe3+ must first be reduced to the Fe2+ form by a ferrireductase. Most likely
duodenal cytochrome B (Dcytb), located on the brush-border membrane (BBM) of
enterocytes, is responsible for this reduction38. However, Gunshin et. al showed that
Dcytb KO mice not only absorb iron properly but also have normal body iron levels,
which suggests the existence of other apical ferrireductase39. Reduced Fe2+ is then
imported into the enterocyte via divalent metal-ion transporter 1 (Dmt1), located on the
apical membrane40. Intestine-specific Dmt1 KO mice display severe IDA, demonstrating
that Dmt1 may be crucial for normal iron absorption41. Absorbed iron can be stored by
ferritin, an intracellular iron binding protein, or effluxed via Fpn1 on the basolateral
membrane (BLM)42 of duodenal enterocytes. Iron efflux is functionally coupled to an
oxidase, Hephaestin (Heph)43, and Fe2+ is converted to Fe3+ and subsequently bound to
transferrin (Tf) for distribution to the liver in the portal circulation.
Main Functions of Copper
Copper is the third most abundant trace element in the liver after iron and zinc44.
The total body copper content in an average adult male is about 100 mg, with the
recommended daily intake being established at 0.9 mg/day45,46. Similar to iron, copper
exhibits oxidation-reduction activity that may lead to potential toxicity if not properly
managed by cells and tissues. As a result, copper uptake, storage and export are tightly
22
regulated47. Excess free copper may increase reactive oxygen species in the body48.
The essentiality of copper is due to its involvement as an allosteric component and
participation as a cofactor for vital enzymes. These cuproenzymes include amine
oxidase (signal transduction and leukocyte adhesion), cytochrome c oxidase (energy
production), dopamine-β-monooxygenase (norepinephrine synthesis), extracellular
superoxide dismutase (superoxide scavenging), lysyl oxidase (connective tissue cross
linking), peptidylglycine α-amidating monoxygenase (neuropeptide maturation),
superoxide dismutase 1 (superoxide scavenging), tyrosinase (melanin production),
ceruloplasmin (Cp) (iron mobilizer), Heph (intestinal iron efflux), and zykopen (placental
iron efflux)49. Perturbations in copper homeostasis trigger defects in several copper-
requiring metalloenzymes that can ultimately lead to severe pathological consequences
in humans50.
Copper Related Disorders: Copper Deficiency
Severe copper deficiency in humans causes anemia (low Hb levels), but the
developmental process of copper-deficiency anemia (CDA) remains unclear49. It is
perhaps most likely that copper deficiency impairs the ability of developing erythrocytes
to utilize iron for heme synthesis, since copper deficiency is not typically associated with
hypoferremia51. In addition, the development of copper deficiency in humans is rare
which makes the condition difficult to study49, and no well-accepted biomarkers for mild
or moderate copper deficiency have been identified. Only a few recent reports have
reported copper deficiency in gastric bypass surgery patients52 or in those with
excessive zinc exposure from denture cream53.
More commonly, copper deficiency is attributed to a genetic defect in a copper
homeostasis-related gene. Menkes Disease is a recessive, X-linked genetic disease
23
caused by various mutations in the gene encoding the copper transporter, Atp7a54.
Atp7a is expressed ubiquitously in all organs except the liver55. Atp7a has two major
roles in copper homeostasis: 1) delivery of copper to the trans-Golgi for cuproenzyme
synthesis, and 2) copper export from enterocytes into the circulation56-58. In Menkes
Disease, intestinal copper absorption is impaired and there is subsequent copper
accumulation in enterocytes59. Also, dietary copper efflux from enterocytes is impaired
in Menkes Disease, causing systemic copper deficiency60. Patients suffering from
neurological abnormalities are a hallmark of Menkes Disease and patients also exhibit
pale skin, micrognathia (undersized jaw), failure to thrive, poor eating, vomiting, and
diarrhea60.
Copper Related Disorders: Copper Overload
Copper toxicity is fairly rare, although previously, copper exposure occurred from
kitchen utensils61. Nowadays, acute copper toxicity has been shown to occur by
consumption of contaminated food or water62. Moreover, acute copper toxicity is
observable from suicide attempts in patients in developing countries63,64. Symptoms of
acute copper overload include acute renal failure with hemoglobinuria, hemolytic
anemia, hepatic failure, and respiratory failure63.
Copper overload may also result from genetic factors. Wilson’s disease is an
autosomal recessive disorder, characterized by copper toxicity as a result of mutations
in the gene encoding copper-transporting ATPase 2 (Atp7b). The primary role of Atp7b
is not only exporting copper from the liver but also transferring copper to the trans-Golgi
network for the metalation of ceruloplasmin (Cp)65. Atp7b is also expressed in placenta,
brain and kidney65. In Wilson’s disease, copper accumulates in the liver, brain, kidney,
and heart. This global tissue accumulation of copper can lead to hepatitis or cirrhosis of
24
the liver, Parkinson disease-like symptoms, kidney damage, and cardiomyopathy66.
Excess copper deposition in the brain may cause a Parkinson’s disease-like
syndrome67. Kayser-Fleisher rings are a good indicator of copper accumulating in the
endothelial layer of the cornea and gold or greenish gold rings may appear at the outer
margin of the cornea68. In Wilson’s disease, copper accumulation in the kidney may
cause hypercalciuria and calculi in the kidneys69,70. Also, cardiomyopathy may be
caused by Wilson’s Disease71.
Intestinal Copper Absorption
Similar to iron, dietary copper must be reduced before uptake into the enterocyte
by a cupric reductase. Possible reductase candidates include Dcytb located on the
brush-border membrane (BBM) of the enterocyte or a six-transmembrane epithelial
antigen of the prostate (Steap) protein72,73. Once reduced, copper is brought through the
apical membrane into the cell via copper transporter 1 (Ctr1)74. Ctr1 KO mice suffer
from severe copper deficiency, with subsequent copper accumulation in enterocytes74.
Once in the enterocyte, copper is carried to designated organelles by various
chaperone proteins. For example, cytochrome c oxidase (CCO) copper chaperone
carries copper to the mitochondria for synthesis of cytochrome C oxidase75. Another
chaperone protein, antioxidant protein 1 (Atox1) delivers copper to Atp7a in the trans-
Golgi network to support cuproenzyme synthesis76. When cytosolic copper levels
increase, Atp7a translocates to the BLM to mediate copper efflux into the blood58. Thus,
Atp7a has two major roles; 1) pumping copper into the trans-Golgi network, and 2)
effluxing copper into the circulation56-58. Unlike iron, the interstitial fluid may contain
sufficient oxygen to allow spontaneous oxidation of cupric copper, and thus an oxidase
may not be mandatory77.
25
Copper exported from enterocytes is delivered to the liver bound to albumin or
α2-macroglobulin. Hepatic copper is delivered to peripheral tissues, in part, bound to Cp
which is a glycoprotein produced in the liver78,79. Cp carries over 95% of the serum
copper in healthy human subjects79 and Cp has a role as a ferroxidase (FOX)80, which
promotes iron release from some tissues. In a genetic disorder involving Cp, hereditary
aceruloplasminemia, malfunction of iron homeostasis is observed, but copper
metabolism is apparently normal. Perturbation of iron homeostasis consequently causes
iron overload, anemia, neural and retinal degeneration and diabetes81-83. In Cp KO
mice, iron accumulates in macrophages, such as Kupffer (liver) and sinusoidal lining
(kidney) cells82.
Iron and Copper Interactions
During the mid-1800s, chlorosis or the “greening sickness” was abundant in
young women of industrial Europe84. Although specific clinical information is limited,
chlorosis may have been IDA77. However, women who worked in copper factories were
unaffected by chlorosis 85 (reviewed in 86), which implies that copper exposure has the
potential to affect iron homeostasis77. In the last century, studies were initiated to
understand the interactions of iron and copper since both metals play crucial roles in
normal red blood cell production. Hart et al. demonstrated that not iron but copper
supplementation prevented anemia with elevated hemoglobin level87. In another study,
copper feeding positively increased hemoglobin synthesis in dogs and roosters88 (reviewed
in 86). The close relationship between iron and copper may be attributed to their chemical
similarities. First, dietary iron and copper are both absorbed in the proximal small
intestine77. Second, iron and copper must be reduced for intestinal uptake and oxidized
26
for efflux, respectively. Also, both metals are involved in redox chemistry and can be
toxic when in excess.
There are identified co-players involved in intestinal iron and copper
homeostasis. Dcytb located on the BBM of enterocytes, has the ability to reduce both
iron and copper72. In states of iron deprivation, Dcytb transcription is upregulated by
hypoxia-inducible factor 2 alpha (Hif2α)89. Intestinal Hif2α reduction attenuated
expression of iron transporters (Dmt1 and Fpn1)90 and a copper transporter (Ctr1)91.
Also, intestinal Atp7a expression is regulated by Hif2α92. Dmt1 may also mediate both
iron and copper uptake. Several reports involving in vitro and ex vivo approaches, have
indicated that Dmt1 may transport copper93-95; however, further research is necessary to
elucidate the mechanism by which Dmt1 transports copper77,96.
Copper Metabolism in Dietary Iron-Deficiency and Iron-Overload Models
Low-iron feeding is widely accepted to create iron deficiency in rodents. Low-iron
feeding decreases tissue iron accumulation and causes anemia, growth retardation,
anorexia and decreases physical activities12,97,98. Anorexia caused by iron deprivation is
corrected by increasing food (and iron) intake (down-regulation of leptin secretion)99.
Intriguingly, during iron deficiency, copper levels are elevated in liver and serum
of rodents100-102 and humans103. Elevated copper concentrations during iron deficiency
may enhance copper absorption via stimulation of intestinal copper homeostasis104,105.
Increased copper during iron-deficiency may also enhance the utilization of iron by
increasing FOX activities. Cp and Heph are strong candidates for the inducible FOX
activities in iron-deficiency. Cp is a circulating protein from the liver and contains serum
copper. However, Cp has an important role in iron homeostasis as a multi-copper FOX,
27
but lack of Cp does not perturb copper homeostasis. Lack of Cp in humans can,
however, lead to iron-overload106.
High-iron feeding is also widely used in iron research field. High-iron
consumption by rodents causes iron accumulation in blood and tissues107-114, mimicking
the iron loading that occurs in HH. Very few studies have, however, considered how
high dietary iron may influence copper metabolism. Two such studies showed that high-
iron feeding to rats decreased hepatic copper concentrations112,115; however, a
mechanistic explanation for such was not provided nor were more extensive follow up
studies performed.
Iron Metabolism During Dietary Copper-Deficiency
Low dietary copper (<0.4 µg/g) feeding to rodents is widely accepted to study
copper deprivation. Dietary copper deprivation caused lower copper tissue
accumulation, growth retardation and anemia116-120. Copper deprivation also affected
iron homeostasis. In copper-deprived rodents, serum iron121 concentration was
decreased with attenuated iron absorption116, but intestinal119 and hepatic117 iron
concentration was elevated. Copper-depletion also attenuated expression of the master
iron regulator, Hepc120,122. The role of Hepc is to bind to and cause degradation of Fpn1;
however, Fpn1 induction in copper deprivation by Hepc suppression has not been
clearly established. Fpn1 is currently the only known mammalian iron exporter, but it
may respond to intracellular copper concentrations. In copper-deficient mice, Fpn1
mRNA expression was significantly increased and possibly regulated in a transcriptional
manner by induction of Hif2α89. However, in other study, Fpn1 expression was normal in
copper-deficient rodents123. In a comparison study using mice and rats, copper
deprivation attenuated hepatic Hepc expression in rats, but not in mice122. Heph may be
28
another candidate for iron-copper interactions. Copper-deprived mice exhibited
significantly lower FOX activity of Heph and Cp124. In rats, dietary copper deficiency
attenuated iron absorption concomitant with decreased Heph protein expression117.
However, repletion of copper to the copper-deprived rats corrected iron absorption and
increased Heph protein expression118. Dietary limitation of copper may thus decrease
iron absorption due to impaired Heph expression and reduced FOX activity. Moreover,
Cp may have a role in intestinal FOX activities77 since intestinal iron absorption was
significantly attenuated in bled Cp KO mice125.
In conclusion, previous literature indicates that iron and copper absorption and
distribution have a reciprocal relationship: 1) copper accumulates in enterocytes and in
the liver during iron deprivation, but levels decrease in iron overload; and 2) copper
deprivation impairs iron absorption, but increases intestinal copper absorption.
To elucidate the novel relationships between iron and copper, dietary studies
were performed for specific aim 1 (chapters 3 and 4) by feeding various concentrations
of iron and copper to rodents.
AIM I – To examine how varying dietary copper levels influences iron
homeostasis using iron-deprived, control and iron-loaded wild-type rodents.
Hypothesis: High or low dietary copper will alter iron metabolism.
1. Determine the effect of various dietary iron and copper levels on growth and
hematological parameters.
2. Investigate the effect of various dietary iron and copper levels on erythropoietic
signals.
29
3. Assess the effect of various dietary iron and copper levels on intestinal copper
absorption and distribution.
Alteration of copper homeostasis during iron deprivation is well known (i.e.
induction of Atp7a expression and copper accumulation in enterocytes). However, there
is limited information regarding the molecular role of Atp7a in iron homeostasis. To
understand the role of Atp7a in intestinal iron metabolism including absorption and
efflux at the molecular level, Atp7a knockdown (KD) rat intestinal epithelial (IEC-6) and
human colorectal adenocarcinoma (Caco-2) cells were used.
AIM II – To elucidate the role of Atp7a in iron transport in rat IEC-6 and human
Caco-2 cells.
Hypothesis: Atp7a is necessary for normal intestinal iron homeostasis.
1. Determine the role of Atp7a in iron transport in rat IEC-6 and human Caco-2 cells.
2. Investigate the effect Atp7a knockdown (KD) on the expression of iron transport-
related genes and proteins.
3. Assess the effect of Atp7a KD on functional ferrireductase and FOX in intestinal cells.
30
CHAPTER 2 MATERIALS AND METHODS
Animal Experiments
All animal experiments were approved by the University of Florida Institutional
Animal Care and Use Committee. Three-week-old, male Sprague-Dawley rats (Harlan;
Indianapolis, IN) or C57BL/6 mice (Jackson Laboratory, Bar Harbor, ME) were housed
in overhanging, wire mesh-bottom cages for 5 weeks until sacrifice. These rodents (one
or two animal(s)/cage) had ad libitum access to food and purified water. Diets were
fabricated based on the AIN-93G formulation126,127 (Dyets Inc.; Bethlehem, PA) (Tables
2-1 and 2-2) and contained high (HFe), adequate (AdFe) or low iron (LFe) in
combination with high (HCu), adequate (AdCu) or low copper (LCu) (Table 2-3). We
increased iron in the AdFe diet (from 50 ppm to 80) to ensure normal growth of these
weanling rodents. The HFe diets were modeled after published studies128,129. The HCu
diets contained ~20 times more copper than the adequate level. Moreover, all diets
contained extra sucrose (100 g/kg), as high carbonyl iron diets are otherwise
unpalatable. All LFe and AdFe diets were isocaloric (3760 kcal/kg); however, the HFe
diets contained slightly less energy (3724 kcal/kg; <1% less) since 10 g/kg of carbonyl
iron was added (in place of a small amount of corn starch). Furthermore, animals were
weighed weekly and estimated food consumption ((weekly calorie intake [weekly food
consumption- weekly left food])/animal number in cage/7 days) was recorded. Growth
rate was calculated using linear regression by Pearson’s test (gained body weight
during 5 weeks [Δbody weight/Δweek]).
31
Determination of Iron Status and Hepatic Mineral Concentrations
To measure Hb levels, about 10 µL of whole blood was loaded into a
microcuvette (HemoCue; Brea, CA) and read using a HemoCue 201 (HemoCue). To
measure hematocrit (Hct), blood was loaded into heparinized micro-hematocrit capillary
tubes (Thermo Fisher Inc., Waltham, MA) and separated using a Readacrit centrifuge
for 2 mins (Clay Adams, Franklin Lakes, NJ).
Tissue samples were digested in acid solution (3 mol/L HCl and 10%
trichloroacetic acid) and nonheme iron levels were determined using a previously
described colorimetric method130. In brief, ~50 mg of tissue was placed into a 1.5 mL
centrifugation tubes. 1.0 mL of acid solution was added, followed by incubation at 65 °C
for 20 hr. Digested samples (10 µL) were loaded into 96-well plates and reacted with a
chromagen reagent (200 µL; 0.1% bathophenanthroline disulphate and 1% thioglycolic
acid) for at least 10 min at room temperature. Nonheme iron levels in tissue were
determined at 535 nm using a Synergy H1 plate reader (BioTek, Winooski, VT) and
normalized by measured tissue weight.
Serum iron levels were determined using a colorimetric method131. Briefly, 110
µL of serum was mixed with same amount of protein precipitation solution (1 mol/L HCl,
10% trichloroacetic acid, 3% thioglycolic acid) with 45 sec vortexing, incubated at room
temperature for 5 min and then centrifuged at 1,500 g for 15 min. 110 µL of supernatant
was loaded into a 96-well plate and mixed with 110 µL of a chromagen solution (1.5
mol/L C2H3NaO2, 0.025% ferrozine) and incubated at room temperature for 10 min.
Serum iron levels were determined at 562 nm using a Synergy H1 plate reader.
For measurement of total iron-binding capacity (TIBC), a previously described
colorimetric method132,133 was used. Briefly, 110 µL of serum was saturated with iron by
32
adding the same volume of ferric chloride solution (0.2 mmol/L ferric chloride, 5 mmol/L
HCl) and incubated at room temperature for 15 min. Unbound iron was removed by
adding magnesium carbonate and shaking vigorously for 30 min and then centrifuging
at 3,000 g for 15 min and the supernatant was collected. TBIC was measured by the
same procedure described above for serum iron measurement. Tf saturation was
calculated by the following formula: serum iron/ TIBC X 100.
Serum Erythropoietin Measurement
Serum erythropoietin (Epo) levels were determined by ELISA (LS-F10511:
LifeSpan BioSciences Inc: Seattle, WA).
para-Phenylenediamine (pPD) Assay
To assess Cp activity, pPD assay was performed according to a previously
reported method134,135. In brief, 100 μL of 0.5 mol/L CH3COONa-CH3COOH buffer, pH
5.0 and 250 μg of serum protein from each animal (~10 μL) was mixed and brought to a
total volume of 450 μL. 180 μL of this mixture was loaded into 96-well plate and reacted
with 20 μL of freshly made 1.5% pPD in 0.1 mol/L CH3COONa-CH3COOH buffer, pH
5.0. Absorbance was recorded at 530 nm every 15 min for 3 hrs at 37 °C using a
Synergy H1 plate reader.
Cell Culture and Development of Atp7a KD IEC-6 and Caco-2 Cells
IEC-6 (American Type Culture Collection, Manassas, VA; #CRL-1592) cells were
cultured in Dulbecco’s modified eagle’s medium (DMEM; Corning; New York, NY)
media with 10% FBS (Sigma, St. Louise, MO), 10 U/mL insulin and 100U/mL
penicillin/streptomycin (Corning) at 37 oC in a 5% CO2 atmosphere. Both negative-
control and Atp7a-specific shRNA-expressing plasmids (Invitrogen, Carlsbad, CA) were
transfected into IEC-6 cells using polyjet (SignaGen Laboratories, Gaithersburg, MD).
33
Four unique Atp7a-specific shRNA-expressing plasmids were mixed in equal amounts
for transfection (sequences are listed in Table 2-4). Subsequent cultures were
maintained with 250 µg/mL of zeocin (Thermo Fisher Scientific, Waltham, MA) in the
culture media to allow selective pressure. Two clonal subpopulations, with the most
significant Atp7a KD (called KD1 and KD2), were chosen for further experiment.
Also, another method was applied to confirm Atp7a KD; negative-control and
Atp7a targeted shLentiviral plasmids (OriGene, Rockville, MD; sequences are listed in
Table 2-5) were transfected in IEC-6 cells using the transfection kit provided from the
vendor (OriGene). As in the previous transfection method, four different Atp7a targeting
shLentiviral plasmids were mixed equally, transfected and maintained with antibiotic
pressure using 100 µg/mL of puromycin (Research Products International Corp., Mt
Prospect, IL) with selection of 2 sub-clones. To confirm Atp7a KD in human Caco-2
(American Type Culture Collection; #HTB-37, Manassas, VA) cells were cultured in
15% FBS (Sigma) and 100 U/mL penicillin/streptomycin containing Eagle's minimum
essential media (Corning) media at 37 oC in 5% CO2. Both negative-control and Atp7a
targeting shLentiviral plasmids for human species (SantaCruz, Dallas, TX; sequences
are listed in Table 2-6) were transfected into Caco-2 cells using polyjet and selectively
maintained with 100 µg/mL of puromycin. Like IEC-6 cell models, three different Atp7a
targeted shRNAs were mixed equally with selection of 2 sub-clones. All cells were fully
differentiated (IEC-6, 8 days and Caco-2, 21 days) in tissue culture-treated polystyrene
dishes (Corning, Corning, NY). In some experiments, to mimic iron-deficient conditions,
200 µmol/L deferroxamine (DFO; iron chelator, Sigma) were added to the relevant
34
media for 24 hr. For mRNA decay experiment, 1 μg/mL Actinomycin D (ActD, Sigma)
was added to media for 0-24 hr.
Iron Transport Studies
IEC-6 or Caco-2 cells (~100,000) were plated on 0.4-μm pore-size, collagen-
coated, trans-well inserts (Corning) in 12-well plates and allowed to grow for 8 (IEC-6)
or 21 days (Caco-2) post-confluence. Cell monolayer integrity was assessed by
measuring transepithelial electric resistance (TEER) with an evom meter (World
Precision Instruments). 59Fe uptake into cells (transport) and efflux to the basolateral
chamber (transfer) were determined by the following methods: Briefly, cells were pre-
incubated with Krebs-Ringer (uptake) buffer (130 mmol/L NaCl, 10 mmol/L KCl, 1
mmol/L MgSO4, 5 mmol/L glucose, and 50 mmol/L HEPES; pH 7.0) in a cell culture
incubator for 1h at 37 °C. Cells were then incubated with 0.5 μmol/L 59Fe -ferric citrate
in uptake buffer for 90 min in a cell culture incubator at 37 °C followed by rinsing 3 times
with a chelating wash buffer (150 mmol/L NaCl2, 10 mmol/L HEPES; pH 7.0; 1 mmol/L
EDTA) to remove any surface-bound 59Fe. Cells were then lysed with 0.2 N NaOH
containing 0.2% sodium dodecyl sulfate (SDS). Radioactivity was subsequently
quantified in lysates and in transport buffer collected from the lower chamber using a
WIZARD2 Automatic Gamma Counter (Perkin Elmer, Waltham, MA). Protein
concentrations of cell lysates were determined by a standard protein assay. Uptake and
efflux of 59Fe are expressed as counts per minute/mg of protein.
35
Mineral Analysis
Atomic Absorption Spectrometry
Samples were digested with HNO3 (95 °C) for 3 hrs and diluted in MiliQ® water
and analyzed by flame atomic absorption spectroscopy (AAS). Data were normalized by
protein concentration for in vitro experiments or tissue weight for in vivo experiments.
Inductive-Coupled Plasma Mass Spectrometry
Inductively-coupled plasma mass spectrometry (ICP-MS) analysis was
performed by the Department of Soil and Water Sciences, at the University of Florida.
Diets and tissue samples were digested with HNO3/H2O2 using the US Environmental
Protection Agency Method 3050B136 on a hot block (Environmental Express, CA).
Samples were filtered (0.45 µm) and analyzed by ICP-MS (Perkin-Elmer Corp.). Each
sample was measured three times and standard deviation (SD) was calculated.
qRT-PCR
Total cellular RNA was isolated with RNAzol® RT reagent (Molecular Research
Center, Inc., Cincinnati, OH) following the manufacturer’s protocol as previously
described137. SYBR-Green (Bio-Rad Laboratories, Hercules, CA) qRT-PCR was
performed according to a well-established protocol138. Oligonucleotide primers were
designed to span large introns to avoid amplification from genomic DNA (listed in
Tables 2-7 - 2-9). Standard-curve reactions validated each primer pair, and melt curves
routinely showed single amplicons. Expression of experimental genes was normalized
to expression of cyclophilin. Mean fold changes in mRNA expression were calculated by
the 2−ΔΔCt analysis method. Total RNA was treated with DNase I (Thermo Fisher
Scientific Inc.) to eliminate possible genomic DNA contamination. Heteronuclear RNA
(hnRNA) primer sequences are available in the Table 2-9.
36
FOX Activity Assay
IEC-6 cells were grown in 100-mm plates for 8 days post-confluence. Fully
differentiated IEC-6 cells were then harvested and fractionated into membrane and
cytosolic fractions138. FOX activity was assessed using a Tf-coupled assay with 100 µg
of membrane and 200 µg of cytosolic fractions following a previously reported
method138. FOX activity was determined by measuring enzymatic velocities from 5 to
120 sec using a spectrophotometer (Nanophotometer®, Implen GmbH, Müchen,
Germany) at 460 nm as previously reported139.
Ferrireductase Activity Assay
Fully-differentiated IEC-6 cells were incubated with Krebs-Ringer buffer for 30
min at 37 °C in a 5% CO2/95% O2 environment. The Krebs-Ringer buffer was discarded
and replaced with 200 µmol/L nitrotetrazolium blue chloride for 90 mins to analyze cell-
surface ferrireductase activity. Then, cells were washed three times with Krebs-Ringer
buffer and photographs were taken (EVOS XL Core Cell Imaging System, Invitrogen,
Carlsbad, CA). After acquisition of photos, nitrotetrazolium blue chloride was discarded
and replaced with 1 mL of isopropanol for 1 hr and ferrireductase activity (i.e. color
intensity) was measured in the isopropanol elution by reading absorbance at 560 nm
using a Synergy H1 plate reader.
Protein Isolation and Immunoblotting
Total protein lysates from IEC-6 or Caco-2 cells were obtained using ice-cold
radioimmune precipitation assay buffer with protease inhibitors (Thermo Fisher
Scientific). Proteins were separated using 7.5% SDS-polyacrylamide gel electrophoresis
(SDS-PAGE) and transferred to polyvinylidene difluoride membranes (Merck Millipore,
Billerica, MA) using a wet transfer equipment (Bio-Rad). Subsequently, blots were
37
incubated with primary and secondary antibodies, developed with enhanced
chemiluminoscence reagent and detected via a FluorChem E imaging system (Cell
Biosciences, San Jose, CA). Polyclonal primary antibodies were against Atp7a (1:1,000;
in-house), Dmt1 (1:1,000; sc-30120; Santa Cruz), Fpn1 (1:100; sc-49668; Santa Cruz),
Heph (1:100; sc-49970; Santa Cruz), Hif2α (1:1,000; NB100-122; Novus Biologicals,
Littleton, CO) and α-tubulin (1:5,000; ab6046; Abcam, UK) and incubated overnight at 4
oC. Then, blots were incubated with anti-immunoglobin G (IgG) rabbit secondary
antibody (1:3,000; A120-101P; Bethyl Laboratories, Montgomery, TX) or donkey anti-
goat IgG (1:2,000; sc-2020; Santa Cruz) diluted in 5% milk containing Tris-Buffered
saline and Tween 20 for 1 hr at room temperature. The optical density of
immunoreactive bands was determined by using the free software ImageJ
(http://imagej.nih.gov/ij/download.html) and band intensity was normalized to the
intensity of α-tubulin.
Determination of Copper Absorption and Distribution
To determine copper absorption, mice were fasted overnight (~12 hr), with ad
libitum access to water. 20 µCi 64Cu was diluted into phosphate-buffered saline
containing 0.1 N HCl and gavaged orally. In the 64Cu study, the mice were provided the
diets right after oral gavage. Mice were sacrificed ~9 hrs later for the 64Cu gavage
procedures. Whole carcass and tissue radioactivity were measured using a WIZARD2
Automatic Gamma Counter. 64Cu radioactivity was corrected based on half-life (12.7
hrs). Blood and tissue distribution was normalized by total blood volume or tissue
weight.
38
Statistical Analysis
All results were expressed as means ± SDs or Box-and-Whiskers plot (except
correlation data). For chapter 3 and 4, the homogeneity of variances was determined by
the Fligner-Killeen test. If there was not homogeneity of variance in the data set, then
data were transformed as a log10 scale prior to performing the statistical analyses. All
statistical analyses were thus performed on data with equal variances. All results are
expressed as means ± SDs or Box-and-Whisker plots except correlation data. Fligner-
Killeen tests were performed in R (version 3.3.2) and the remaining analyses were
performed using GraphPad (version 6.0.4 for Windows). The trends in data were
analyzed using a 2-factor ANOVA test. If this analysis showed significant iron X copper
interactions (p<0.05), Tukey’s multiple comparisons post hoc test was utilized to identify
groups which varied significantly for a given parameter. Furthermore, linear regression
analysis was used to derive correlations between some measured experimental
parameters. Pearson’s correlation coefficient (r) was calculated to clarify relationships
between two variables. For chapter 5, 1-factor ANOVA followed by Tukey’s multiple
comparisons test was used for comparing multiple groups. Relative FOX activity in IEC-
6 cells was compared between experimental groups by 2-factor ANOVA followed by
Tukey’s multiple comparisons test.
39
Table 2-1. Iron and copper concentrations in experimental diets
Diet Fe (ppm)≠ Cu (ppm) ≠
LFe/LCu* 12.0 0.83
LFe/AdCu 8.84 6.65
LFe/HCu 12.4 182
AdFe/LCu 93.7 0.92
AdFe/AdCu 71.9 8.96
AdFe/HCu 71.8 183
HFe/LCu 9036 0.94
HFe/AdCu 8707 9.18
HFe/HCu 8718 184
*H, high; Ad, adequate; L, low ≠determined by ICP-MS.
Table 2-2. Constant ingredients in the 9 experimental diets
Ingredient Amount (g/kg)
Casein 200
Sucrose 100
Soybean oil 70
t-Butyhydroquinone 0.014
Dyetose 132
Cellulose (micro) 50
Mineral Mix 35
Vitamin Mix 10
Choline Bitartrate 2.5
L-Cystine 3
40
Table 2-3. Variable ingredients in the 9 experimental diets
Ingredient LFe/ LCu
LFe/ AdCu
LFe/ HCu
AdFe/ LCu
AdFe/ AdCu
AdFe/ HCu
HFe/ LCu
HFe/ AdCu
HFe/ HCu
Cornstarch (g/kg)
397.486 397.486 397.486 397.486 397.486 397.486 387.486 387.486 387.486
Fe Premix (10 mg/g)
1 1 1 8 8 8 - - -
Carbonyl Fe (g/kg)
- - - - - - 10 10 10
Cu Premix (1 mg/g)
0.5 - - 0.5 - - 0.5 - -
Cu Premix (5 mg/g)
- 1.6 40 - 1.6 40 - 1.6 40
kcal/kg 3760 3760 3760 3760 3760 3760 3724 3724 3724
41
Table 2-4. Negative control and Atp7a-specific shRNA sequences
Gene shRNA sequences
Negative control
Top oligo 5’-CACCGTCTCCACGCGCAGTACATTTCGAAAAATGTACTGCGCGTGGAGA-3’
Bottom oligo 3’-AAAAGTCTCCACGCGCAGTACATTTTTCGAAATGTACTGCGCGTGGAGA-5’
Atp7a shRNA1
Top oligo 5’-CACCGCAACGAACAAAGCACATATTCGAAAATATGTGCTTTGTTCGTTGC-3’
Bottom oligo 3’-AAAAGCAACGAACAAAGCACATATTTTCGAATATGTGCTTTGTTCGTTGC-5’
Atp7a shRNA2
Top oligo 5’-CACCGGACGAGTCTATGATTGAACACGAATGTTCAATCATAGACTCGTC-3’
Bottom oligo 3’-AAAAGGACGAGTCTATGATTGAACATTCGTGTTCAATCATAGACTCGTCC-5’
Atp7a shRNA3
Top oligo 5’-CACCGCCTCTGACCCAAGAAGTTGTCGAAACAACTTCTTGGGTCAGAGG-3’
Bottom oligo 3’-AAAAGCCTCTGACCCAAGAAGTTGTTTCGACAACTTCTTGGGTCAGAGG-5’
42
Table 2-5. Negative control and Atp7a-specific shRNA in lentiviral GFP vector sequences (transfected into IEC-6 cells)
Gene shLentiviral plasmid sequences
Negative
control 5’-GCACTACCAGAGCTAACTCAGATAGTACT-3’
Atp7a
shRNA1 5’-GGAATGACCTTCTGGATGTTGTGGCAAGT-3’
Atp7a
shRNA2 5’-GCTCGGTCTATTGCTTCTCAGGTTGGCAT-3’
Atp7a
shRNA3 5’-TTCCAAGCGTCTATCACAGTTCTGTGTAT-3’
Atp7a
shRNA4 5’-GCACAGGAGTAGGTGCTCAGAATGGCATA-3’
43
Table 2-6.Negative control and Atp7a-specific shRNA in lentiviral GFP vector sequences (transfected into Caco-2 cells)
Gene shLentiviral plasmid sequences
Hairpin sequence
5’- GATCCCAAGTTGGACTCTAAGTTATTCAAGAGATAACTTAGAGTCCAACTTGTTTTT-3’
Corresponding siRNA1
Sense 5’-CAAGUUGGACUCUAAGUUAtt-3’
Antisense 5’-UAACUUAGAGUCCAACUUGtt-3’
Corresponding siRNA2
Sense 5’-GAAGAGGACUCAUAAGUAAtt-3’
Antisense 5’-UUACUUAUGAGUCCUCUUCtt-3’
44
Table 2-7. List of rat qRT-PCR primers (in vivo)
Primer Forward Reverse
Cyclophilin 5’-CTTGCTGCAATGGTCAACC-3’ 5’-TGCTGTCTTTGGAACTTTGTCTGC-3’
Bmp6 5’-CTTACGACAAGCAGCCCTTCATG-3’ 5’-AGCTGTTTTTAACTCACTGCTGTTGTA-3’
Epo 5’-AGTCGCGTTCTGGAGAGGTA-3’ 5’-ACTTTGGTATCTGGGACGGTAA-3’
Erfe 5’-ACTCACCAAGCAGCCAAGAA-3’ 5’-TTCTCCAGCCCCATCACAGT-3’
IL-6 5’-GCCCTTCAGGAACAGCTATG-3’ 5’-ACTGGTCTGTTGTGGGTGGT-3’
Table 2-8. List of mouse qRT-PCR primers (in vivo)
Primer Forward Reverse
Bmp6 5’-CCAATGACGACGAAGAGGATGG-3’ 5’-GTAGACGCGGAACTCAGCAGC-3’
Cyclophilin 5’-CTTACGACAAGCAGCCCTTCATG-3’ 5’-AGCTGTTTTTAACTCACTGCTGTTGTA-3’
Epo 5’-ATGAAGACTTGCAGCGTGGA-3’ 5’-AGGCCCAGAGGAATCAGTAG-3’
Epor 5’-ACCTATGACCACCCACATCC-3’ 5’-AGACCAGGCACTCCAGAATC-3’
Erfe 5’-TGGCATTGTCCAAGAAGACA-3’ 5’-ATGGGGCTGGAGAACAGC-3’
Hepc 5’-TGGAGATGAATCTGTAGGACGAGTC-3’ 5’-CTCCACCCTGGATCATGAAGTC-3’
Id1 5’-ACCCTGAACGGCGAGATCA-3’ 5’-TCGTCGGCTGGAACACATG-3’
IL-6 5’-CTCTGCAAGAGACTTCCATCCAGT-3’ 5’-CGTGGTTGTCACCAGCATCA-3’
Smad7 5’-GACTCCAGGACGCTGTTGGT-3’ 5’-CCATGGTTGCTGCATGAACT-3’
45
Table 2-9. List of rat qRT-PCR primers (in vitro)
Gene Forward/Revers
e
Primer sequence
Atp7a F 5’-TGAACAGTCATCACCTTCATCGTC-3’ R 5’-GCGATCAAGCCACACAGTTCA-3’
Cyclophilin F 5’-CTTGCTGCAATGGTCAACC-3’
R 5’-TGCTGTCTTTGGAACTTTGTCTGC-3’
Ctr1 F 5’-AGAAGTCCAGACCTGGTTAGGGATC-3’
R 5’-TGTGGTTCATCCTCAGGTCC-3’
Dcytb F 5’-CGTGTTTGATTATCACAATGTCCG-3’
R 5’-CACCGTGGCAATCACTGTTCC-3
Dmt1 F 5’-GCATCTTGGTCCTTCTCGTCTGC-3’
R 5’-AACACACTGGCTCTGATGGCTCC-3’
Epo F 5’-AGTCGCGTTCTGGAGAGGTA-3’
R 5’-ACTTTGGTATCTGGGACGGTAA-3’
Fpn1 F 5’-TCGTAGCAGGAGAAAACAGGAGC-3’
R 5’-GGAACCGAATGTCATAATCTHGC-3’
Heph F 5’-ACACTCTACAGCTTCAGGGCATGA-3’
R 5’-CTGTCAGGGCAATAATCCCATTCT-3’
Tfr1 F 5’-ATTGCGGACTGAGGAGGTGC-3’
R 5’-CCATCATTCTCAGTTGTACAAGGGAG-3’
*hnDcytb F 5’-CCTCTTTGGAACAGTGATTGCC-3’
R 5’-GAAGAAGGCTACAGACTTACAGGACA-3’
*hnHeph F 5’-TGGACCATTTCAAGACAGCA-3’
R 5’-GGATGTGCTGACCCCAAATA-3’
*hnFpn1 F 5’-TGCAGTGTCTGTGTTTCTGGTGG-3’
R 5’-ATGTAACTGCACTCACCTTTAAGTCTGG-3’
*hn: Heteronuclear.
46
CHAPTER 3 HIGH-IRON CONSUMPTION IMPAIRS GROWTH AND CAUSES COPPER-
DEFICIENCY ANEMIA IN WEANLING SPRAGUE-DAWLEY RATS
Introduction
Iron is an essential trace element that is required for oxygen transport and
storage, energy metabolism, antioxidant function and DNA synthesis. Abnormal iron
status, as seen in iron deficiency and iron overload, perturbs normal physiology. Copper
is also an essential nutrient for humans, being involved in energy production, connective
tissue formation and neurotransmission. Copper, like iron, is required for normal
erythropoiesis; copper deficiency causes an iron-deficiency-like anemia77. Moreover,
copper homeostasis is closely linked with iron metabolism, since iron and copper have
similar physiochemical and toxicological properties. Physiologically-relevant iron-copper
interactions were first described in the mid-1800s, when chlorosis or the “greening
sickness” was abundant in young women of industrial Europe86. Although specific
clinical information is lacking, chlorosis likely resulted from IDA77, a condition which was,
and still is, common in this demographic group. Women who worked in copper factories
were, however, protected from chlorosis86, suggesting that copper positively influences
iron homeostasis77.
Iron-copper interactions in biological systems may be attributed to their positive
charge and similar atomic radii, and common metabolic fates. For example, dietary iron
and copper are both absorbed in the proximal small intestine77. Also, iron and copper
must be reduced before uptake into enterocytes and further, both metals are oxidized
after (or concurrent with) being exported into the extracellular fluids (enzymatic iron
oxidation occurs while copper oxidation is likely spontaneous). Moreover, both metals
are involved in redox chemistry in which they function as enzyme cofactors, and both
47
can be toxic when in excess. Also, a reciprocal relationship between iron and copper
has been established in some tissues. For example, copper accumulates in the liver
during iron deficiency, and iron accumulates during copper deficiency77,86. Copper levels
also increase in the intestinal mucosa and blood during iron deprivation86,105. Despite
these intriguing past observations, the molecular bases of physiologically-relevant iron-
copper interactions are yet to be elucidated in detail. The aim of this investigation was
thus to provide additional, novel insight into the interplay between iron and copper.
We have been investigating how copper influences intestinal iron absorption
during iron deficiency for the past decade. It was noted that an enterocyte copper
transporter, Atp7a, was strongly induced during iron deficiency in rats104,105 and mice140.
Additional experimentation demonstrated that the mechanism of Atp7a induction was
via Hif2α induction95,141. Importantly, this transcriptional mechanism is also invoked to
increase expression of the intestinal iron importer Dmt1, a ferrireductase Dcytb in BBM,
and the BLM iron exporter Fpn1. Moreover, it was suggested that the principle intestinal
iron importer, Dmt1, could transport copper during iron deficiency95. In the current
investigation, we sought to broaden our experimental approach by testing the
hypothesis that dietary iron will influence copper metabolism during iron deficiency and
iron overload (both being conditions that cause significant homeostatic perturbations in
humans). The study design was to feed male, weanling, Sprague-Dawley rats one of 9
different diets, varying only in iron and copper content (low, adequate or high), for 5
weeks. After the dietary treatments, iron- and copper-related phenotypical parameters
were analyzed to assess the impact of variable copper levels on iron homeostasis.
48
Results
Growth Rates and Organ Weights Differed Among Experimental Groups
Rats consuming the LFe diets grew slower than controls (i.e. the AdFe/AdCu
group), irrespective of copper content. Unexpectedly, rats fed the HFe diets also
showed a significant reduction in growth rate (Fig. 3-1A) and final body weight (Fig. 3-
1B), but increasing copper content (from low to high) progressively restored these
parameters. Alterations in growth were probably not the result of changes in energy
intake as the amount of food provided to the different experimental groups was similar
(Table B-2). Moreover, liver weights generally were lower in the LFe groups, while
consumption of the HFe/HCu diet increased liver weights (as compared to all AdFe and
the HFe/LCu groups) (Fig. 3-1C). Heart weights were higher in the LFe/LCu, HFe/LCu
and HFe/AdCu groups (Fig. 3-1D), but adding extra copper to these diets normalized
heart weights. Spleens were larger only in rats consuming the LFe/LCu diet, while
kidney weights did not vary among groups (Table B-3). In sum, these data suggest that
high-iron feeding impairs copper homeostasis, given that cardiac hypertrophy is a
hallmark of severe copper deficiency and that this was prevented by higher copper
intake. Further supporting this possibility are the noted anemia and growth impairment
(in the absence of iron deficiency), which also typify copper deprivation.
Low- and High-Iron Consumption Altered Hematological Parameters
Hb levels were depressed in rats consuming the LFe diets with copper content
not having any affect (Fig. 3-2A). Hb levels were also lower in rats fed the HFe/LCu and
HFe/AdCu diets, but consumption of the HFe/HCu diet prevented deficits in Hb. A
similar trend was noted in Hct levels (Fig. 3-2B). Moreover, nonheme serum iron was
low in the LFe groups, while HFe feeding did not alter this parameter except for in the
49
HFe/HCu group, in which it was increased significantly (Fig. 3-2C). Tf saturation was
also depressed in the LFe groups, and values were significantly increased in the
HFe/AdCu and HFe/HCu groups (Fig. 3-2D). Furthermore, TIBC trended higher in the
LFe groups (Fig. A-1A). These observations further support the postulate that high-iron
feeding perturbs copper homoeostasis, since copper deficiency causes an iron
deficiency-like anemia. Prevention of the anemia by increasing the copper content of
the HFe diet is also congruent with this supposition.
Renal Epo Expression Was Induced by Copper Deprivation in Iron-Deficient and Iron-Loaded Rats
Since hematological parameters were altered, unexpectedly, in rats consuming
the HFe diets, we next assessed levels of the erythroid hormone, erythropoietin (Epo).
Renal Epo mRNA expression and serum Epo protein levels were significantly increased
in rats consuming the LFe/LCu and HFe/LCu diets (Fig. 3-3A-B). Moreover, linear
regression analysis showed a strong correlation between renal Epo mRNA and serum
Epo protein levels (Fig. 3-3B, inset). Increased Epo levels only in rats consuming the
LFe/LCu and HFe/LCu diets suggests that copper deprivation increases Epo
expression, independent of hypoxia or anemia, since some anemic, presumably
hypoxic, rats (e.g. the LFe/AdCu, LFe/HCu and HFeAdCu groups) did not show such
dramatic increases in Epo expression.
The Erythroid Iron Regulator, Erfe, Was Induced by Copper Deprivation in the Spleens of Iron-Deficient Rats
Recently, an erythropoietic stress-related hormone, erythroferrone ([Erfe])142,
was discovered. Erfe is expressed in developing erythrocytes and spleen (which is an
erythropoietic organ in rodents). Erfe was reported to be induced by circulating Epo and
it functions to suppress hepatic Hamp (the gene encoding hepcidin [Hepc]) expression.
50
Given that serum Epo protein levels increased in some of our experimental rats, we
next assessed splenic Erfe mRNA expression. Quantification of mRNA levels is of
relevance, since Erfe is regulated at the transcript level by erythropoietic stress143. Erfe
expression was dramatically increased only in rats consuming the LFe/LCu diet (Fig. 3-
3C). Surprisingly, Erfe expression was, however, not increased in the HFe/LCu group,
despite significant anemia/hypoxia and strong induction of Epo expression in these
animals. Therefore, since Erfe was only induced in anemic rats in the setting of low
splenic iron (Fig. 3-3D), we speculate that induction of Erfe expression by Epo may be
inhibited by iron accumulation. This would be a logical supposition since suppression of
Hepc expression during iron loading would only exacerbate tissue iron accumulation.
This is also consistent with the noted suppression of Hepc expression (as described
below) in only the low iron-fed rats.
Hepatic Nonheme Iron Loading Increased in the HFe/HCu Group
Hepc is a liver-derived, peptide hormone that is considered the master regulator
of iron homeostasis. Given that Hamp expression is controlled predominantly at the
level of transcription, we next quantified hepatic Hepc mRNA levels. As expected, Hepc
mRNA expression was essentially nil in all rats consuming the LFe diets (Fig. 3-4A).
Consumption of the HFe diet increased Hepc mRNA expression, with higher copper
content leading to a trend towards a more dramatic increase (but it did not quite reach
statistical significance). Since one driver of Hamp gene expression is serum Tf
saturation144,145, linear regression analysis was utilized to relate Hepc mRNA expression
with Tf saturation. Results showed a strong correlation (Fig. 3-4B). Moreover, hepatic
iron levels paralleled changes in Hepc mRNA expression (Fig. 3-4C). There was also a
strong correlation between Hepc mRNA levels and hepatic iron stores (total and
51
nonheme) (Fig. 3-4C, insets). Furthermore, given that interleukin 6 (Il-6) and bone
morphogenetic protein 6 (Bmp6) are regulators of hepatic Hamp expression, we also
quantified the expression of these genes by qRT-PCR; both were generally lower in the
LFe groups as compared to others (Fig. A-1B-C). These data did not correlate with
Hepc mRNA levels, however, so their significance is unclear.
High-Iron Feeding Increased Tissue Iron Levels
Iron in bone (tibia) was increased in only the HFe groups (Table B-4). Iron
content of heart did not vary, while kidney iron levels were higher in only the HFe/AdCu
and HFe/HCu groups. The iron content of isolated enterocytes139 was higher in the
HFe/LCu group; other differences were apparent, but due to large variation, they did not
achieve statistical significance.
High-Iron Feeding Caused Systemic Copper Deficiency
Results described above suggested that, predictably, rats consuming the low-iron
diets developed iron-deficiency anemia (IDA). What was unexpected, however, was the
development of anemia in rats consuming the HFe diets. Since anemia did not occur
when the HFe diet contained extra copper, we postulated that decrements in Hb and
Hct likely reflected copper-deficiency anemia (CDA). To directly address this possibility,
we measured copper content in various tissues and blood as well as circulating levels of
Cp, which is an accepted marker of severe copper deficiency134,146. Liver copper content
was lowest in the rats consuming the LCu diets, irrespective of iron content (Fig. 3-5A).
Hepatic copper content was also similarly diminished in the rats consuming the
HFe/AdCu diet, but copper levels were similar to control levels in the HFe/HCu group.
Moreover, significant hepatic copper loading occurred in the LFe/HCu group, which is
consistent with previous observations that liver copper content increases in iron
52
deficiency147. In general, this same pattern was also seen in regards to serum and heart
and bone copper content (Fig. 3-5B-D). Furthermore, serum Cp (i.e. amine oxidase)
activity was depressed in all LCu groups, with increasing copper content in the HFe
diets leading to increments in Cp activity (Fig. 3-5E). Cp activity correlated with liver
copper content (Fig 3-5F), which supports the previous postulate that hepatic copper
loading promotes biosynthesis of the holo (copper-containing) form of the Cp
enzyme102. Moreover, kidney and enterocyte copper levels showed only minor
variations with limited significance (Table B-5). Overall, these data further support our
postulate that the anemia caused by feeding a high-iron diet to weanling rats is the
result of systemic copper deficiency.
Discussion
This investigation tested the hypothesis that varying dietary copper intake would
influence iron metabolism during disturbances of iron homeostasis. Weanling rats were
used since they are susceptible to developing IDA upon dietary iron deprivation. We
chose a dietary approach in which groups of rats, housed in overhanging cages, so as
to avoid coprophagia, were fed diets with variable iron and copper content. LFe diets
were used to induce IDA, while HFe diets were utilized to induce dietary iron overload.
This latter approach has been commonly used to induce iron overload in rodents.
Presumably, when luminal iron is very high, it is able to pass non-specifically through
the epithelial barrier, presumably via tight-junctions between enterocytes (which would
be impermeable to iron at normal intake levels). Furthermore, the HFe diets contained
carbonyl iron, which is less reactive and less likely to be oxidized, as compared to, for
example, ferric citrate (which is typically used in rodent diets).
53
As the feeding protocol proceeded, we noted that rats consuming the AdFe/LCu
diets developed mild copper deficiency. AdFe/LCu feeding lead to decreased tissue
copper concentrations (serum, heart and bone) and Cp activity, but there was no
significant alteration in growth, Hb, Hct, heart size or hepatic copper concentration. Mild
copper deficiency in AdFe/LCu-fed rats may due to the dietary copper concentration (~
1 µg/g) which is higher than previously reported low copper feeding studies (< 0.4
µg/g)116-119. We also noted that rats consuming the LFe diets grew slower than controls,
as was anticipated. Unexpectedly, however, the same phenomenon was observed in
the HFe groups. The fact that adding extra copper to the HFe diets partially normalized
growth suggested to us that disturbances of copper homeostasis might underlie the
growth deficits. Other data from the HFe/LCu and HFe/AdCu groups supporting this
contention include: 1) cardiac hypertrophy, consistent with severe copper deficiency; 2)
anemia in the presence of adequate (or elevated) iron stores; 3) robust induction of Epo
in iron-replete animals; and 4) decreased tissue copper levels and reduced serum Cp
activity. Importantly, these physiologic perturbations were prevented by adding extra
copper to the HFe diets. High-iron feeding of rapidly growing rats thus causes copper-
deficiency anemia. These findings support an earlier study which demonstrated that
higher iron intake was associated with increased dietary copper requirements115.
Moreover, a reasonable postulate is that growth was impaired as a result of iron toxicity,
but the observation that final body weights were not different in the high-iron fed rats
that also consumed excess copper does not support this supposition. Moreover, it is
puzzling that impaired growth was not associated with reduced food consumption.
However, considering the critical roles of iron and copper in energy metabolism, where
54
they function as electron carriers in the mitochondrial electron transport chain, it is a
logical postulate that impaired nutrient utilization (i.e. ATP synthesis) underlies growth
defects.
The mechanism by which HFe feeding impairs copper homeostasis occurs is
unknown. One seemingly likely possibility is that high iron levels in the intestinal lumen
impair copper absorption. To test this postulate, however, would require additional
experimentation (beyond the scope of the current investigation). Precedence for such
mineral interactions has been established, as, for example, high zinc intake induces
severe copper deficiency in humans148,149. Moreover, previous investigations have
provided evidence that iron, when in excess, can antagonize copper metabolism112,115.
Other investigators have measured growth and Hb levels in rodents fed HFe
diets108,109,113, including some studies that have used weanling SD rats112,114. In general,
most studies documented decrements in body weight after HFe feeding. A mechanistic
explanation for altered growth rates was, however, not provided. A few studies also
measured Hb levels after HFe feeding and showed no changes108,114 or an increase112.
Differences between these previous studies and the current investigation could relate to
the diets used, the length of feeding, the specific strain of mouse or rat used, or to
rodent housing methods. The observations reported here thus appear to be novel, as
we have established that HFe feeding causes physiologic disturbances that can be
directly linked with perturbations in copper homeostasis.
In designing this investigation, we anticipated that copper would influence iron
homeostasis during LFe states; how copper might alter the iron-overload phenotype
was perhaps less predictable. Specifically, in regards to iron deficiency, based upon our
55
extensive previous work with iron-deficient SD rats, we hypothesized that extra copper
would lessen the severity of iron deficiency. The rationale for this was that copper
accumulates in tissues important for iron homeostasis during iron deprivation (e.g. the
intestinal mucosa, liver and blood). Varying dietary copper, however, did little to
influence parameters of iron homeostasis in the LFe groups. Given these findings, it
occurred to us that copper may instead be important for iron repletion after development
of iron deficiency. This postulate could be tested in future studies with a different
experimental design.
We further noted that, interestingly, renal Epo mRNA expression and serum Epo
protein levels were increased only in rats consuming the LFe/LCu and HFe/LCu diets.
Given that Epo expression is induced by hypoxia (HIF signaling)150,151, it was surprising
that renal Epo levels were not increased in the LFe/AdCu and LFe/HCu groups, as rats
consuming these diets had significant anemia (likely with concurrent hypoxia, although
this was not directly assessed). The main difference between the anemic/hypoxic rats
that showed robust Epo expression and those that showed lesser or no induction was
thus dietary copper deprivation. Since copper deficiency causes anemia, it is a logical
postulate that copper deprivation can induce Epo expression (although we identified no
reports of such in the scientific literature). It thus appears that CDA is a stronger driver
of renal Epo expression than iron deprivation. Elucidating the mechanism by which this
occurs is an experimental imperative for future investigation.
When body iron stores are low and erythropoietic demand increases (due to
anemia/hypoxia), the Hamp gene is effectively silenced. A recently discovered peptide
hormone, called erythroferrone (Erfe)142, released by erythrocytes and the spleen, has
56
been proposed as an erythroid regulator of iron homeostasis. It was further suggested
that Epo induces Erfe expression, and that Erfe then downregulates hepatic Hamp
expression thus allowing robust intestinal iron absorption and iron release from stores.
The Fam132b gene (encoding Erfe) is regulated at the level of transcription, so we
therefore quantified Erfe mRNA expression levels in the spleens of our experimental
rats. As described above, we noted robust Epo expression in only 2 groups of rats,
those consuming the LFe/LCu and the HFe/LCu diets. We thus expected that Erfe
expression would be increased in these groups. This prediction was correct in regards
to the rats consuming the LFe/LCu diets, but conversely, Erfe expression was very low
in the rats consuming the HFe/LCu diet. This is consistent with hepatic Hepc mRNA
levels in these groups (i.e. low in the LFe/LCu group and much higher in the HFe/LCu
group), since Erfe is proposed to downregulate Hamp expression. To understand why
Erfe would be differentially expressed in these dietary groups, in spite of significant
anemia and robust Epo expression in both, it is necessary to identify differences in the
pathological phenotypes. Further, since Fam132b did not respond to circulating Epo in
the HFe/LCu group, it is logical to consider changes in the spleen. Notably, splenic
nonheme iron was low in the LFe/LCu group but >45 times higher in the HFe/LCu
group. It could thus be that high splenic iron inhibits transactivation of the Fam132b
gene by Epo. The physiologic signals associated with high systemic iron in the HFe/LCu
group may trump the anemia (which relates to low copper in these rats), so Erfe
expression remains low and Hepc expression remains high.
In summary, this investigation has revealed heretofore unrecognized interactions
between the essential trace minerals iron and copper. HFe feeding with low or adequate
57
copper levels was shown to induce CDA in growing rats. Although the precise
mechanism by which copper deficiency causes anemia is unknown, it likely relates to an
unidentified copper-dependent step in mitochondrial heme synthesis in developing
erythrocytes86. The phenotype of CDA in rats is more severe than that associated with
IDA, as exemplified by the more significant growth retardation seen in the copper-
deprived rats. Adding extra copper to the HFe diet prevented the development of CDA,
essentially proving that the noted physiologic perturbations directly related to copper.
These findings raise the question of whether iron supplementation in humans could,
over the long term, induce deficiencies in copper. Although this investigation used a
very high level of iron, there are examples of humans who, for clinical reasons,
consume large quantities of iron. For example, patients with chronic kidney disease
(CKD) are often treated with phosphate binders152, since hyperphosphatemia is
common in CKD153. One such phosphate binder is ferric citrate154,155. Patients with end-
stage disease (stage 4 or 5) may thus receive 0.21 grams of iron up to 3 times per day
(as ferric citrate) for long periods of time156. This is up to >35 times more iron than the
typical human consumes from a normal varied diet (average ~18 mg/day). Other groups
which are likely to require iron supplementation are pregnant women, women of
childbearing age, those chronically consuming proton-pump inhibitors for gastric acid
reflux, and those suffering from malabsorptive disorders (e.g. Crohn’s disease, colitis) or
after gastric bypass surgery. An interesting question relates to whether extra copper
should be added to iron supplements to avoid any untoward effects of high iron intake
on copper homeostasis. One future goal is to define the minimum amount of dietary iron
58
that is required to induce copper deficiency in rats, so as to be able to better extrapolate
results to humans.
59
Figure 3-1. HFe feeding impaired growth and caused cardiac hypertrophy. Weanling
rats were fed one of 9 diets differing only in iron and copper content for 5 weeks ad libitum. Rats were weighed weekly, and A) growth rates were calculated. B) Final body weights, and C) liver and D) heart weights at sacrifice are also shown. Organ weights were normalized by body weight. Values are means ± SDs. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). LFe, low iron, AdFe, adequate iron; HFe, high iron; LCu, low copper; AdCu, adequate copper; HCu, high copper. n values were as follows: LFe/LCu (9), LFe/AdCu and LFe/HCu (6), AdFe/AdCu (11) and all others (10). These same n values apply to all data presented in this chapter (which will not be repeated in subsequent figure legends).
60
Figure 3-2. Consumption of the LFe and HFe diets altered hematological parameters. A)
Hb and B) Hct were determined from whole blood collected from experimental animals at sacrifice. C) Nonheme iron and D) Tf saturation in serum were also quantified. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). Values represented as a Box-and-Whisker plot as five quartiles (the minimum value (the lower whisker), the lower quartile, the median, the upper quartile and the maximum value (the upper whisker)). n values and abbreviations used are the same as in Figure 3-1.
61
Figure 3-3. Renal Epo and splenic Erfe levels increased in rats consuming the LFe/LCu
diet. A) Renal Epo mRNA expression and serum B) Epo protein levels were assessed in experimental rats. The correlation between these 2 parameters in noted in the inset of panel B. C) Splenic Erfe mRNA expression was quantified by qRT-PCR and D) splenic nonheme iron levels were measured using a commonly used technique. Panel A, B and D was plotted based on raw data, however, for the equal variation of data, statistical analysis was performed from log10 transformed data. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). Values are means ± SDs. n values and abbreviations used are the same as in Figure 3-1.
62
Figure 3-4. HFe diets increased Hepc expression. A) Hepc mRNA expression was
quantified in experimental rats, and B) correlation between Hepc mRNA expression (log10) and Tf saturation was calculated using linear regression analysis. The line of best fit is shown along with the correlation (r) coefficient. C) Hepatic total (left side) and nonheme (right side) iron was also measured. C) Correlations were also calculated between Hepc mRNA expression (log10) and liver iron levels (log10; r values are shown as insets). D) Erfe mRNA expression in spleen and E) splenic nonheme iron levels are also shown. Panel A, B and D was plotted based on raw data, however, for the equal variation of data, statistical analysis was performed from log10 transformed data. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). Values are means ± SDs. n values and abbreviations used are the same as in Figure 3-1. a.u., arbitrary units.
63
Figure 3-5. HFe feeding resulted in severe tissue copper depletion and reduced Cp activity. The distribution of copper in A) liver, B) serum, C) heart and D) bone was determined by ICP-MS. E) Cp (i.e. amine oxidase) activity was also measured in serum samples. F) Correlation between Cp activity and liver copper concentrations (log10) was calculated using linear regression analysis. The line of best fit is shown along with the correlation (r) coefficient. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). Values represented as a Box-and-Whisker plot as five quartiles (the minimum value (the lower whisker), the lower quartile, the median, the upper quartile and the maximum value (the upper whisker)). n values and abbreviations used are the same as in Figure 3-1.
64
65
CHAPTER 4 DIETARY IRON OVERLOAD CAUSES COPPER DEFICIENCY IN WEANLING
C57BL/6 MICE BUT INTESTINAL COPPER ABSORPTION IS NORMAL
Introduction
The ability of iron to participate in reduction-oxidation reactions makes iron a
crucial element in many vital physiological processes4. Iron is an essential nutrient for
many cellular functions including cellular proliferation, energy production and DNA
synthesis5. As a result, the maintenance and control of cellular iron homeostasis is
critical to prevent the occurrence of significant adverse health conditions. There are two
significant iron-related pathologies; iron deficiency and iron overload. Iron deficiency is
the most abundant nutritional disease in the world, affecting ~30% of the world’s
population6. The primary causes of iron deficiency include inadequate iron intake,
reduced bioavailability from the diet, or increased iron demand due to bleeding,
infection, or rapid growth6,8,9. Meanwhile, iron overload is mainly due to genetic
mutations in iron metabolism-related genes that regulate hepcidin expression (the
hepatic iron-regulatory hormone).
Iron homeostasis is closely intertwined with copper metabolism. The close
relationship between iron and copper may be attributed to their chemical similarities77.
First, dietary iron and copper are both absorbed in the proximal small intestine. Second,
iron and copper must be reduced and oxidized before intestinal uptake and efflux,
respectively. Also, both metals are involved in redox chemistry and can be toxic when it
excess. There are potential players in both iron and copper absorption. Dcytb on the
BBM has a reductase role for both iron and copper72. Dmt1 may transport copper93-95,
but future research is necessary to clarify copper transport via Dmt177.
66
Iron and copper metabolism may have a reciprocal relationship. In iron
deficiency, copper levels are increased in liver and serum of rodents100,101 and
humans103. Copper may enhance intestinal iron flux in iron-deficiency by influencing the
expression or activity of iron transport-related genes/proteins104,105. Increased tissue
copper levels during iron-deprivation may enhance the utilization of iron by increasing
FOX activity. In iron-deprivation, FOX activity is induced to compensate for iron
depletion and Cp is a strong candidate for the inducible serum FOX activity. Cp is a
circulating protein derived from the liver and it contains most of the serum copper. It has
an important role in iron metabolism as a multicopper FOX. Cp expression/activity has a
positive correlation with hepatic copper concentrations102. Lack of Cp in humans could
lead to iron-overload106 by altering iron metabolism without disturbing copper
homeostasis.
Systemic copper homeostasis also influences iron metabolism. Fpn1 is the only
known mammalian iron exporter identified to date, but it may respond to intracellular
copper concentrations. In copper-deprived mice, Fpn1 mRNA expression was
significantly induced and possibly regulated at a transcriptional level by Hif2α89. This
observation, however, requires further investigation because of a contradictory report123.
Heph may be another potential candidate for iron-copper interactions. Copper-deprived
mice exhibited significantly lower FOX activity of Heph and Cp124. Copper deprivation in
rats also attenuated iron absorption with decreased Heph protein expression117.
However, repletion of copper to copper-deprived rats corrected iron absorption and
increased Heph protein expression118. Dietary limitation of copper may thus decrease
iron absorption due to impaired Heph expression and reduced FOX activity. Moreover,
67
Cp may have a role in intestinal FOX activity77. In Cp KO mice, intestinal iron absorption
was significantly attenuated125. Cp shifted from the duodenal epithelium to the lamina
propria upon phlebotomy of wild-type mice125.
Carbonyl iron feeding is a widely accepted method to develop dietary iron-
overload110,114,157. Some dietary iron-overload rodent studies have shown reductions in
body weight compared to adequate iron fed control groups110,114. The reduction in body
weight in HFe feeding may due to: 1) adverse effects of tissue iron accumulation; 2)
insufficient consumption of nutrients in HFe feeding condition (i.e. reduced appetite);
and/or 3) specific nutrient deprivation. Copper may be a strong candidate to cause body
weight reduction in HFe feeding since dietary iron and copper share similar
characteristics. The proper dietary copper concentration in dietary iron-overload models
is not clear to date in the iron research field though there is some evidence that high-
iron feeding caused copper depletion in rodents112,115. To address this practical
research issue, we utilized this dietary iron-overload model in a mouse feeding study in
which we also altered the dietary copper content. This study was intended to test the
hypothesis that dietary copper would influence intestinal iron absorption during iron
overload. Weanling, male C57BL/6 mice were housed in overhanging, wire mesh-
bottomed cages and fed one of 6 different AIN-93G-based diets for 5 weeks containing
adequate (79 ppm) or extra (8820 ppm) iron in combination with low (0.9 ppm),
adequate (8 ppm) or extra (183 ppm) copper. Diets were otherwise identical. To test our
hypothesis, growth rate, organ weights, hematological parameters, tissue iron and
copper accumulation, iron-related gene expression and 64Cu absorption and distribution
were measured. Results showed that HFe feeding caused copper deprivation in
68
C57BL/6 mice, exemplified by slower growth, severe anemia, cardiac hypertrophy,
decreased tissue copper levels and reduced Cp activity. To test whether HFe blocks
intestinal copper absorption and distribution, 64Cu was gavaged orally. In 64Cu gavage
experiments, 64Cu absorption was unaltered in the HFe feeding groups.
Results
High-Iron Consumption Caused Mortality, Growth Retardation and Cardiac Hypertrophy
Mice fed a HFe diet showed a significant reduction in body weight, but elevation
of dietary copper concentration normalized body weight (Fig. 4-1A). In parallel to the
reduced body weight, there was a reduction in growth rate after 5 weeks feeding with
the HFe/LCu diet (Fig. 4-1B). The reduced growth rate in the HFe group was prevented
by increasing dietary copper concentrations (Fig. 4-1B). However, food consumption did
not vary significantly among the 6 groups over the 5 weeks (data not shown). Relative
heart weights were measured since perturbations of iron/copper homeostasis have
been associated with alterations in heart size and function96,158,159. Heart weights
differed according to dietary copper concentrations in HFe fed mice (Fig. 4-1C).
HFe/LCu fed mice had enlarged hearts; however, cardiac hypertrophy was prevented
by elevation of dietary copper concentration in conjunction with HFe feeding (Fig. 4-1C).
Hepatomegaly was also observed in HFe consuming mice (Table B-6). To our surprise,
HFe feeding also caused pre-mature mortality; ~30% and ~10% in HFe/LCu and
HFe/AdCu fed mice were found dead during the feeding studies, respectively (Fig. 4-
1D). AdFe/LCu fed mice did not display growth retardation or cardiac hypertrophy (as
might have been anticipated), probably since mice were fed ~1 µg/g of dietary copper
which is higher than previous reports (which used levels <0.4 µg/g)116-119.
69
Dietary Iron and Copper Concentrations Affected Hematological Parameters and Transferrin Saturation
LCu feeding reduced Hb levels in both AdFe (mild anemia) and HFe (severe
anemia) fed mice (Fig. 4-2A). Severe anemia in HFe/LCu fed mice was prevented in a
stepwise manner by increasing dietary copper concentrations (Fig. 4-2A). Hct results
mirrored the Hb data. HFe/LCu and HFe/AdCu fed mice showed extremely low Hct (Fig.
4-2B). Again, elevation of dietary copper feeding prevented the reduction of Hct levels in
the HFe groups (Fig. 4-2B). There were increases in serum nonheme iron
concentrations (Fig. 4-2C) in HFe/LCu and HFe/AdCu fed mice. TIBC was increased in
HFe/LCu fed mice (Fig. 4-2D). Tf saturation (%) was also increased in all HFe fed mice
regardless of dietary copper concentrations (Fig. 4-2E).
High-Iron Intake Induced Hepatic Hepcidin Expression with increased Hepatic Iron Accumulation
To understand whether dietary copper affected iron homeostasis, the expression
of a key iron homeostasis regulator, Hepc, was determined. Regardless of dietary
copper concentration, HFe feeding uniformly elevated hepatic Hepc mRNA expression
significantly compared to AdFe fed mice (Fig. 4-3A). Hepc expression correlated with Tf
saturation (Fig. 4-3B). In parallel to the Hepc induction in HFe fed groups, hepatic iron
accumulation (total iron: Fig. 4-3C and nonheme iron: Fig. 4-3D) was uniformly elevated
in the HFe fed groups. In sum, HFe feeding elevated hepatic Hepc expression with
accumulation of liver iron, but dietary copper had no significant effect in Hepc
expression or hepatic iron accumulation.
High-Iron and Copper Affects Iron Homeostasis-Related Gene Expression
To understand the molecular initiator of the elevated hepatic Hepc expression,
IL-6 and Bmp6 mRNA expression was also assessed. Generally, HFe/LFe diet elevated
70
IL-6 (Fig. 4-4A) and Bmp6 (Fig. 4-4B), but, not all of these changes reached statistical
significance. Thus, Hepc induction in the HFe fed groups may be due to the
combination of Tf saturation (%), and IL-6 and Bmp6 induction. Also, other markers of
hepatic iron loading, inhibitor of DNA binding 1 (Id1) (Fig. 4-4C) and SMAD family
member 7 (Smad7) (Fig. 4-4D) mRNA expression was induced in parallel to the
induction of Hepc mRNA expression in HFe fed mice.
Dietary Iron and Copper Altered Renal Erythropoietin Expression
Erythropoietic signals are induced when the demand for Hb synthesis is
elevated160. In this study, HFe/LCu or HFe/AdCu feeding elevated erythopoietic demand
since Hb (Fig. 4-2A) and Hct (Fig. 4-2B) levels decreased, although systemic iron was
high (Fig. 4-3C-D). To understand the influence of dietary copper on erythropoietic
signaling, renal Epo and Epo receptor (Epor) and splenic Erfe mRNA expression was
analyzed. Renal Epo mRNA expression was elevated in HFe/LCu or HFe/AdCu fed
mice, which were extremely anemic (Fig. 4-5A); however, in HFe/HCu fed mice, renal
Epo mRNA expression was normalized (Fig. 4-5A). Moreover, there was no statistical
alteration in renal Epor (Fig. 4-5B) and splenic Erfe mRNA expression (Fig. 4-5C).
Hepatic Copper Distribution and Cp Activity
Iron and copper distribution in liver was determined by ICP-MS. Intriguingly,
significantly attenuated hepatic copper accumulation was observed in HFe/LCu and
AdCu fed mice (Fig. 4-6A). However, decreases in hepatic copper concentrations were
prevented in HFe/HCu fed mice (Fig. 4-6A). pPD amine oxidase activity was used to
determine Cp activity in serum. In low-copper fed groups, Cp activity was significantly
lower (Fig. 4-6B). To our surprise, HFe/AdCu fed mice had lower Cp activity, but Cp
activity was same as control values in HFe/HCu fed mice (Fig. 4-6B). A significant
71
correlation (r=0.7024) was observed between hepatic copper levels and Cp activity (Fig.
4-6C). HFe feeding significantly thus decreased hepatic copper levels and depressed
Cp activity.
64Cu Absorption and Distribution Were Not Altered by High-Iron Feeding
Previous findings suggested that the HFe intake with LCu or AdCu caused
severe CDA. Thus, we postulated that the HFe content blocked intestinal copper
absorption, which then resulted in systemic copper deficiency. To test this hypothesis,
mice were again fed the same diets for 5 weeks, fasted overnight and 64Cu was then
administered to mice by oral gavage. Results showed that mice fed the AdFe/LCu had
elevated copper absorption (>50% of administered dose; Fig. 4-7A). Mice fed the
HFe/LCu or HFe/AdCu, however, failed to upregulate copper absorption (Fig. 4-7A),
which would have been anticipated due to systemic copper deficiency. Further, although
mice fed the HFe/LCu and HFe/AdCu suffered CDA, copper distribution in blood did not
change (Fig. 4-7B). Additionally, in general, 64Cu accumulation in liver (Fig. 4-7C) and
multiple other tissues (Fig. A-2A-F) in HFe fed mice was lower 64Cu than in the
AdFe/LCu group.
Discussion
In vivo studies in my dissertation research were executed to elucidate the
intertwined relationship between dietary iron and copper. AdFe/LCu feeding caused
only mild copper deficiency, likely since dietary copper concentrations that I used were
higher than in previous studies116-119. Surprisingly, HFe consumption in male, Sprague-
Dawley rats and C57BL/6 mice perturbed copper homeostasis. HFe feeding in rodents
caused CDA, growth retardation, cardiac hypertrophy, low Cp activity and low tissue
copper levels. However, copper deficiency caused by high-iron feeding was prevented
72
by consuming extra copper. Therefore, we considered the possibility that HFe
consumption blocks intestinal copper absorption. However, the mechanism by which
HFe feeding perturbs copper homeostasis is not clear. Therefore, we logically
postulated that dietary HFe would influence intestinal copper absorption and tissue
copper distribution during iron overload. We thus utilized AdFe and HFe diets with
variable copper levels in a mouse feeding study. Weanling, male C57BL/6 mice were
housed in overhanging, wire mesh-bottomed cages to prevent coprophagia and fed one
of 6 different AIN-93G-based diets for 5 weeks. Although, mice fed the HFe/LCu and
HFe/AdCu suffered CDA, intestinal 64Cu absorption was unaltered and copper
accumulated in tissues at a lower level than in the AdFe/LCu group.
After studying rats, we decided to perform a 64Cu absorption study in mice for two
reasons: 1) to increase significance by examining another species; and 2) mice are a
suitable size to quantify whole body 64Cu absorption and distribution in our available
gamma counter. Prior to our 64Cu absorption study, we postulated that HFe
consumption would block intestinal copper absorption since HFe fed rats and mice
showed CDA. We also expected that copper absorption would be increased in HFe fed
mice to compensate for systemic copper deficiency. 64Cu absorption was, however,
normal in HFe fed mice, but 64Cu distribution to most tissues was decreased. This result
may have a technical limitation since mice were fasted before 64Cu gavage. Prior to
64Cu oral gavage mice were fasted for ~ 12 hr to ensure that the stomach was empty
and to eliminate variations in the amount of food in the stomach (which could influence
nutrient absorption). However, fasting may affect intestinal iron and copper absorption
and homeostasis. Possibly, fasting may deplete enterocyte copper which may have
73
allowed 64Cu absorption to appear normal. In the future, we may have to find a more
physiologically relevant method to perform 64Cu gavage studies. For any prospective
study, we have to assure that an identical amount of food is in the stomach of the mice.
Therefore, ad libitum feeding before gavage may not be optimal since the circadian
rhythm and individual variation may affect the results. One possible suggestion is
fasting mice for ~ 12 hr first, and then give diets for a short time and in the same
amounts (should be verified by follow up experiment) to allow normal (i.e. more
physiologic) dietary iron and copper absorption.
Dietary iron overload is a widely utilized accepted method in iron research since
iron loads systemically. Previous investigators also measured growth and hematological
parameters after feeding HFe diets to rodents. Intriguingly, in many studies, dietary HFe
feeding caused growth retardation; however, a mechanistic explanation was not
provided108-114 (Table B-9). In some studies, Hb levels are documented, but, HFe
feeding did not change108,114 or elevated Hb112 compared to control groups (Table B-9).
The discrepancy between previous findings and the current investigation (described in
Chapter 3 and 4) may due to: 1) dietary variations (i.e. iron source, palatability, copper
concentration, and/or other ingredients); 2) the length of feeding; 3) housing methods;
and/or 4) strain of rat or mouse used. However, a key point that we have to consider is
the appropriate dietary copper concentration in these HFe rodent diets. Higher amounts
of dietary copper may prevent HFe diet triggered copper deficiency.
Our future goal is to understand whether high-iron supplementation will cause
copper depletion in adult rodents, so as to be able to extrapolate my findings to humans
who may consume excessive amounts of iron supplements. Rat and mouse studies
74
suggested that HFe consumption may cause CDA, but, this protocol only focused on
iron demanding (rapid growth) periods. Also, the concentration of HFe is not in the
physiologically achievable range for humans. To understand whether HFe consumption
causes copper depletion in the adult period, in the future, we may utilize fully grown
rodents to better model physiologically achievable iron supplementation levels. To test
the hypothesis that HFe would cause copper depletion in adulthood rodents, we could
measure not only iron and copper metabolism related parameters but also 64Cu
absorption and distribution (although there are limitations in this regard with respect to
rats, as described above).
75
Figure 4-1. HFe feeding caused toxicity, growth retardation and cardiac hypertrophy in
C57BL/6 mice. Weanling C57BL/6 mice were fed one of 6 diets containing various iron and copper levels for 5 weeks ad libitum. A) Final body weights were measured at sacrifice. B) Body weights were measured every week and growth rates were calculated. C) Relative heart weights were normalized by final body weights. D) Pre-mature toxicity was observed daily in HFe groups. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). Values are means ± SDs; Growth rate and final body weight (n=12/group) and organ weights (n=4/group). AdFe, adequate iron; HFe, high iron; LCu, low copper; AdCu, adequate copper; HCu, high copper. Opened, striped and solid bar indicates CuD, CuA and CuE, respectively. These abbreviations apply to all data presented in this chapter (which will not be repeated in subsequent figure legends).
76
Figure 4-2. Hematological parameters and Tf saturation in C57BL/6 mice. Weanling
C57BL/6 mice were fed one of 6 diets containing various iron and copper levels for 5 weeks ad libitum. A) Hb and B) Hct were determined from whole blood. C) Serum nonheme iron, D) TIBC and E) Tf saturation (%) were measured from serum. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). Values are represented as a Box-and-Whisker plot as five quartiles; the minimum, the lower quartile, the median, the upper quartile and the maximum of the ranked sample; Hb (n=9-11/group) and others (n=4/group). Opened, striped and solid bar indicates CuD, CuA and CuE, respectively. Abbreviations used are the same as in Figure 4-1.
77
Figure 4-3. Hepatic Hepc expression and hepatic iron distribution in C57BL/6 mice.
Weanling C57BL/6 mice were fed one of 6 diets containing various iron and copper levels for 5 weeks ad libitum. A) Hepatic Hepc mRNAs were assessed by qRT-PCR analysis. B) correlation between Hepc mRNA expression (log10) and Tf saturation was calculated using linear regression analysis. The line of best fit is shown along with the correlation (r) coefficient (inset). C) Hetatic total iron and D) nonheme iron were measured by AAS and spectrophotometer, respectively. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). Values are means ± SDs; n=4/group. Opened, striped and solid bar indicates CuD, CuA and CuE, respectively. Abbreviations used are the same as in Figure 4-1.
78
Figure 4-4. Hepatic iron related gene expressions in C57BL/6 mice. Weanling C57BL/6
mice were fed one of 6 diets containing various iron and copper levels for 5 weeks ad libitum. Hepatic A) IL-6, B) Bmp6, C) Id1 and D) Smad7 mRNA expressions were determined by qRT-PCR. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). Values are means ± SDs; n=4/group. Opened, striped and solid bar indicates CuD, CuA and CuE, respectively. Abbreviations used are the same as in Figure 4-1.
79
Figure 4-5. HFe feeding induced splenic Epo expression in C57BL/6 mice. Weanling
C57BL/6 mice were fed one of 6 diets containing various iron and copper levels for 5 weeks ad libitum. A) Renal Epo, B) Epor and C) splenic Erfe mRNA was determined by qRT-PCR. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). Values are means ± SDs; n=4/group. Opened, striped and solid bar indicates CuD, CuA and CuE, respectively. Abbreviations used are the same as in Figure 4-1.
80
Figure 4-6. HFe feeding decreased hepatic copper distribution and Cp activity in
C57BL/6 mice. Weanling C57BL/6 mice were fed one of 6 diets containing various iron and copper levels for 5 weeks ad libitum. A) Hepatic copper concentration was measured by AAS. B) Cp activity was measured by amine oxidase assay. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). Values are represented as a Box-and-Whisker plot as five quartiles; the minimum, the lower quartile, the median, the upper quartile and the maximum of the ranked sample; n=4/group. C) Correlation of hepatic copper concentration (log10) and Cp activity was determined using linear regression analysis. The line of best fit is shown for each plot. Opened, striped and solid bar indicates CuD, CuA and CuE, respectively. Abbreviations used are the same as in Figure 4-1.
81
Figure 4-7. Copper absorption and distribution in C57BL/6 mice. Weanling C57BL/6
mice were fed one of 6 diets containing various iron and copper levels for 5 weeks ad libitum. To determine copper absorption and distribution, 64Cu was gavaged orally. 64Cu absorption and distribution was measured by a gamma counter and normalized volume or weight. Copper absorption study has performed. A) 64Cu absorption, B) 64Cu in blood and C) 64Cu distribution in liver. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). Values are means ± SDs; n=7-8/group. AdFe/LCu (n=7), AdFe/AdCu (n=8), AdFe/HCu (n=8), HFe/LCu (n=7), HFe/AdCu (n=7) and HFe/HCu (n=8). Opened, striped and solid bar indicates CuD, CuA and CuE, respectively. Abbreviations used are the same as in Figure 4-1.
82
CHAPTER 5 LACK OF COPPER-TRANSPORT ATPASE 1 (ATP7A) IMPAIRS IRON FLUX IN FULLY DIFFERENTIATED RAT INTESTINAL EPITHELIAL (IEC-6) AND HUMAN
COLORECTAL ADENOCARCINOMA (CACO-2) CELLS
Introduction
Iron is an essential trace mineral that is required for numerous biological
functions in mammals. Absorption of iron occurs in the proximal small intestine.
Regulation of this process is critical since no active iron excretory systems exist in
humans. The intestine thus plays a major physiologic role in overall body iron
homeostasis. Numerous recent investigations have contributed to our knowledge of the
mechanisms by which dietary iron is absorbed. Although adult humans derive some iron
from animal foods as heme iron, most dietary iron is in the form of inorganic (or
nonheme) iron. Nonheme iron is derived from animal and plant foods, and this is also
the form typically found in supplements and used for fortification of refined grain
products. Details of heme iron absorption are still unclear77, but the process of nonheme
iron absorption has been recently clarified161-163. Dietary nonheme iron is in the ferric
state, yet ferrous iron enters duodenal enterocytes. Iron reduction occurs via the action
of a cell surface ferrireductase, possibly Dcytb, but other such proteins may also exist.
Ferrous iron is then transported into enterocytes by Dmt1. Iron not used for cellular
metabolism or stored in ferritin can be transported out of enterocytes by the iron
exporter Fpn1. Ferrous iron effluxed by Fpn1 then requires oxidation for interaction with
transferrin in the interstitial fluids. This is likely mediated, at least in part, by the FOX
Heph, which is present on the basolateral membrane.
Our previous studies noted that an intestinal copper transporter (Atp7a) was
strongly induced in duodenal enterocytes isolated from iron-deprived rats104,105. Atp7a
83
functions to pump copper into the trans-Golgi network to support cuproenzyme
synthesis and it also mediates copper efflux from when copper is in excess.
Interestingly, Atp7a induction paralleled increases in the expression of genes encoding
iron transporters (e.g. Dmt1and Fpn1); in fact, the mechanism of induction was shown
to be the same, involving a hypoxia-inducible trans-acting factor, Hif2α90,92,141,164,165.
Given these facts, it was a logical to postulate that copper influences intestinal iron
transport. This would, in fact, not be surprising, given the well-established iron-copper
interactions that have been noted previously77,86,166. Exactly how, and if, dietary copper
effects intestinal iron absorption has, however, not been definitively established. The
current investigation was thus undertaken to test the hypothesis that the Atp7a copper
transporter is required for optimal intestinal iron flux. The experimental approach was to
utilize minimalistic models of the mammalian small intestine, namely cultured intestinal
epithelial cells (IECs) derived from rat and human, in which Atp7a expression was
silenced by siRNA technology. After confirmation of significant knockdown of Atp7a
mRNA and protein, the effect on vectorial iron flux was quantified in fully-differentiated
cells grown on cell culture inserts. Complementary molecular and functional studies
were also performed, allowing us to draw mechanistic conclusions regarding the
biologic role of Atp7a (and thus copper) in iron metabolism.
Results
Atp7a Knockdown Perturbs Iron and Copper Homeostasis in IEC-6 Cells
To understand the role of Atp7a in iron homeostasis, Atp7a expression was
silenced in two IEC-6 cells with independent methods and also in different species,
human Caco-2 cells. Atp7a KD attenuated Atp7a mRNA (>70%; Fig. 5-1A) and protein
levels (>60%; Fig. 5-1B) significantly in IEC-6 cells. Other Atp7a KD methods were also
84
verified in both IEC-6 (Fig. A-3A) and Caco-2 cells (Fig. A-3B). To mimic physiological
conditions in the intestine, Ctrl and Atp7a KD IEC-6 cells were cultured and fully
differentiated in the collagen coated trans-well system. Then, intracellular iron and
copper concentrations were assessed by AAS. Fully differentiated Atp7a KD cells
contained lower amounts of intracellular iron and copper (Fig. 5-1C) than Ctrl under
basal conditions. These data indicate that Atp7a has a significant function not only in
copper but also in iron metabolism.
Atp7a Knockdown Impairs Vectorial Iron Uptake and Efflux in IEC-6 and Caco-2 Cells
To determine the role of Atp7a in iron uptake and efflux, Ctrl and Atp7a KD cells
were cultured and fully differentiated in collagen-coated, trans-wells for 8 (IEC-6) or 21
(Caco-2) days and iron flux was assessed using 59Fe. 59Fe uptake into cells and efflux
from cells was determined by assessing uptake of radioactivity in cells using a gamma
counter and in the basolateral chamber after a 90 min transport period. Data were
normalized to protein concentrations. Atp7a KD in IEC-6 cells decreased 59Fe uptake
significantly in basal (~70%), and in iron-deficient (~70%) conditions created by DFO
treatment for 24 hr (Fig. 5-2A). Also, 59Fe efflux was significantly attenuated in basal
(~70%), and in iron-deficient (~85%) conditions (Fig. 5-2B); furthermore, additional iron
transport studies in IEC-6 and Caco-2 cells with silencing Atp7a using lentiviral shRNA
plasmids confirmed these observations: These confirmatory Atp7a KD IEC-6 and Caco-
2 cells decreased iron intake ~50% (Figs. 5-2C-D) and efflux ~30% (Figs. 5-2E-F),
respectively. In the absence of Atp7a expression, 59Fe uptake into and efflux from cells
was significantly impaired. These data suggest that Atp7a is required for optimal iron
85
flux in fully differentiated intestinal epithelium cell lines. Reduced iron uptake is reflected
by the lower intracellular iron concentration in Atp7a KD (see Fig. 5-1).
Atp7a Knockdown Changes Iron Homeostasis Related Gene and Protein Expression
Atp7a KD in IEC-6 cells perturbs intracellular iron and copper homeostasis and
also impairs vectorial iron flux. Additional experiments were thus designed to support
the molecular understanding of impaired iron and copper homeostasis. We first
assessed iron-transporter related gene expression located in using qRT-PCR. Atp7a KD
attenuated Dcytb and Dmt1 mRNA expression in under basal conditions (Fig. 5-3A-B).
Dcytb expression was also significantly low under iron-deprived conditions, while Dmt1
mRNA expression was normalized to Ctrl levels by DFO treatment. Atp7a KD also
diminished expression of Fpn1, the sole mammalian iron exporter, under basal and
DFO treated conditions (Fig. 5-3C). Conversely, Atp7a KD significantly induced Heph
mRNA expression in both basal and iron-deprived conditions (Fig. 5-3D). Moreover,
consistent with reduced intracellular copper concentrations in Atp7a KD cells (Fig. 5-
1C), a BLM copper transporter, Ctr1, expression was attenuated significantly in Atp7KD
cells (Fig. 5-3E). Also, Tfr1 expression was induced significantly in DFO treated cells
regardless of Atp7a KD or not, confirming the iron-deprived condition since the Tfr1
transcript is stabilized by low intracellular iron (Fig. 5-3F).
To confirm observations relating to mRNA levels in Atp7a KD cells, we next
assessed protein expression by immunoblot analysis. Dmt1 (Fig. 5-4A) and Fpn1 (Fig.
5-4B) protein expression levels were decreased significantly in Atp7a KD cells,
confirming the mRNA expression data. Also, Heph protein levels were higher in KD cells
(Fig. 5-4C), again, confirming the mRNA data. Moreover, since several intestinal genes
86
related to iron transport are induced by a hypoxia-inducible factor (Hif2α) during iron
deficiency, we also quantified Hif2α protein levels in control and Atp7a KD cells. Hif2α
protein expression was diminished by Atp7a KD, possibly providing a mechanistic
explanation for the decrease in Dcytb, Dmt1 and Fpn1 expression, given that all of
these genes are known to be regulated by this transcription factor. Reductions in Dmt1,
Fpn1 and Hif2α and increases in Heph protein expression were also confirmed in the
other IEC-6 Atp7a KD cell lines (using lentiviral technology) (Fig. A-4). Overall, these
data demonstrate that lack of Atp7a leads to decreased expression of BBM and BLM
iron and copper transport-related proteins, likely contributing to the decreases in
intracellular iron and copper concentration and impaired transepithelial iron flux in IEC-6
and Caco-2 cells. Moreover, it is a logical assumption that increases in Heph expression
represent a compensatory response to maximize iron flux.
Atp7a KD Alters Iron Homeostasis Related Transcription Rates and mRNA Stability
To elucidate the transcriptional regulatory mechanism which alters expression of
iron homeostasis related genes by Atp7a KD, we next performed experiments to
assess: 1) gene transcription rates and 2) mRNA decay rates by treatment of ActD
(indicative of mRNA stability). Unspliced, nuclear RNA (or heteronuclear RNA [hnRNA])
represents an immature single strand of mRNA, therefore, hnRNA levels represent
initial transcription rates. Experiments were thus designed to directly compare iron
homeostasis related hnRNA and mRNA levels in Ctrl and Atp7a KD cells. As previously
described in Fig. 5-3, Dcytb and Fpn1 mRNA levels were again attenuated significantly
in Atp7a KD cells (Fig. 5-5A, C). Interestingly, Dcytb and Fpn1 hnRNA expression was
also decreased significantly, but to a less extent as compared to mRNA reduction (Fig.
87
5-5A, C). This observation suggests that reduction in mRNA levels may relate to
transcriptional and post-transcriptional regulatory mechanisms. This may be due in-part
to instability of mRNA in Atp7a KD cells. Therefore, transcription was inhibited for 0-24
hr with ActD, and mRNA expression was quantified by qRT-PCR. The half-lives (t1/2; the
time when the initial transcript degraded 50%) of Dcytb and Fpn1 transcripts were
identical in Ctrl and Atp7a KD cells (Fig. 5-5B, D). Message stability of Dcytb and Fpn1
were unaltered in Atp7a KD cells, thus this is unlikely to contribute to the further
attenuation in mRNA levels as compared to hnRNA levels. Furthermore, Heph mRNA
levels were confirmed to significantly increase in Atp7a KD cells, yet there was no
siginificant change of Heph hnRNA levels in Ctrl and KD cells (Fig. 5-5E). These data
suggested that post-transcriptional mechanisms may contribute to the enhanced Heph
mRNA expression in the Atp7a KD cells. Again, however, there was no significant
change in t1/2 of Heph mRNA transcripts in Ctrl and KD cells (Fig. 5-5F). Thus, Heph
transcription rates and transcript stability were not altered in the KD cells, so other post-
transcriptional mechanisms would have to be invoked to explain the dramatic increase
in transcript levels (e.g. alterations in pre-mRNA splicing of nuclear export). In sum,
these data demonstrate that lack of fully functional Atp7a causes complex molecular
changes in cells that lead to alterations in the expression of the Dcytb, Fpn1 and Heph
genes.
Atp7a KD Enhances Cell-Surface Ferrireductase and Feroxidase Activity in IEC-6 Cells
Dietary nonheme iron is in the ferric state, yet ferrous iron is imported into
duodenal enterocytes by Dmt1. Iron must thus be reduced, which is likely mediated by
one or more cell-surface ferrrireductases. In Atp7a KD cells, Dcytb mRNA expression
88
was diminished significantly, so it was a logical next step to assess reductase activity in
this model. Unexpectedly, ferrireductase activity was significantly enhanced in
bothAtp7a KD IEC-6 cell populations (Fig. 5-6). Moreover, since Heph mRNA and
protein expression was induced in Atp7a KD IEC-6 cells, we measured membrane and
cytosolic FOX activity. We previously demonstrated that Heph and non-Heph FOXs
exist in the membranes and cytosolic fractions of cultured IECs and also in rat duodenal
enterocytes139,167. Consistent with Heph mRNA and protein expression data, FOX
activity was enhanced in membrane and cytosolic fractions of Atp7a KD cell lines (Fig.
5-7). Increases in ferrireductase and FOX activity may thus represent compensatory
mechanisms to maximize iron flux when expression of iron transporters is attenuated.
Discussion
Previous studies provided rationale for considering whether the Atp7a copper
transporter, and by inference copper, is involved in the regulation of intestinal iron
transport. For example, we demonstrated that the Atp7a gene is induced by Hif2α
during iron deprivation/hypoxia in IEC-6 cells92,141. Importantly, this same regulatory
mechanism induces expression of several genes encoding proteins involved in intestinal
iron transport. Furthermore, it is well established that body copper is redistributed during
iron deprivation, with hepatic and serum copper levels being notably higher. These
increases in copper result in accelerated biosynthesis and secretion of Cp by
hepatocytes and higher serum FOX activity102, which potentiates iron release from
stores. What is not known, however, is the molecular mechanism(s) responsible for
altering copper flux. One logical postulate is that intestinal copper absorption is
enhanced by iron deficiency, and further that increased Atp7a expression/activity plays
89
a key role in this process. The current investigation was thus designed to directly test
the role of Atp7a in vectorial iron transport.
Diminution of Atp7a expression and (presumably) activity impaired iron flux in
fully-differentiated IEC-6 and Caco-2 cells. Lack of Atp7a also prevented the increase in
iron transport caused by iron deprivation in IEC-6 cells. Reduced iron transport was
associated with decreases in Dcytb, Dmt1 and Fpn1 mRNA and protein expression.
Moreover, Hif2α protein levels were lower in Atp7a KD cells. Whether Hif2α plays a
direct role in transcription of these genes under basal conditions is not known, it is well
established that Hif2α is required for induction of intestinal iron transport during iron
deficiency. Lack of Hif2α could thus conceivably be responsible for the decrease in
expression of Dcytb, Dmt1 and Fpn1. It was further experimentally established that at
least part of the decrease in Dcytb and Fpn1 mRNA levels related to perturbed gene
transcription, supporting a possible role for Hif2α.
In the setting of decreased Dcytb mRNA and protein expression in Atp7a KD
cells, surprisingly, there was an induction of cell-surface ferrireductase activity. This
observation supports the notion that additional ferrireductases exist in IECs and is also
consistent with the lack of a notable phenotype in the Dcytb KO mouse39, including no
noted defect in intestinal iron absorption. The increase in reductase activity could
represent a compensatory mechanism to maximize iron intake via Dmt1. Furthermore,
Heph mRNA and protein levels were increased significantly in Atp7a KD cells. This was
associated with enhanced FOX activity in cytosolic and membrane fractions of the cells.
Like the noted increase in ferrireductase activity, this may be a compensatory response
90
to increase iron efflux, since iron oxidation is thought to be functionally coupled to export
by Fpn1.
The data presented in this paper are in contrast with a previous study published
by our group168. We originally reported a modest increase in iron transport in Atp7a KD
IEC-6 cells. We intended to pursue additional, mechanistic studies with this established
cell line, but due to an unfortunate laboratory mishap, the cells were lost. This motivated
us to regenerate the cells using the original shRNA-expressing plasmids. Once this was
accomplished, much to our surprise, the originally reported phenotype of the cells could,
inexplicably, not be reproduced. We, in fact, noted just the opposite, namely that the
expression of iron transporters went down in concert with diminished iron flux. Given
this discrepancy, we designed experiments to definitively establish how lack of Atp7a
influences iron transport. This included: 1) using two clonal populations derived from a
small number of transfected cells to minimize possible confounding influences of
genomic insertion sites; 2) developing additional Atp7a KD IEC-6 cell lines using
complementary technology (lentiviral plasmid transfection); and 3) knocking down Atp7a
in human Caco-2 cells. Using all of these additional experimental approaches led us to
the same conclusion: Atp7a is required for optimal iron transport. We are confident that
our previous data are indeed scientifically sound given that the experiments were
conducted using strict ethical guidelines, but we cannot explain these discrepant
findings. Any attempt to do so would be purely speculative.
The final important point relates to the in vivo significance of the current data.
Our original observation was that Atp7a was one of the most strongly induced genes in
the duodenal epithelium of iron-deficient rats at several different post-natal ages104.
91
Atp7a protein is also hugely induced under these condition105. In rats, induction of Atp7a
correlates nicely with increases in tissue copper levels during iron deprivation, perhaps
representing one mechanism by which copper is redistributed. Our hypothesis is that
Atp7a function in enterocytes promotes vectorial iron flux, a supposition which is
supported by the current investigation. A predictable mechanism by which this could
occur relates to the possible potentiation of the biosynthesis of the multi-copper FOX
Heph, given that Atp7a function supports the production of cuproenzymes. The current
data, do not, however, support this contention as Heph expression and FOX activity
was enhanced by Atp7a KD. Furthermore, Atp7a KO rats are not currently available to
test the in vivo significance of Atp7a in iron metabolism. An intestine-specific Atp7a KO
mouse was, however, recently developed169. In this model, no changes in iron
metabolism were noted, but this was not the specific hypothesis being tested.
Nonetheless, we are not surprised by this observation since copper redistribution in
response to changes in iron metabolism has not been reported in mice, as it has in
numerous other mammalian species and also in humans86. Mice may thus be outliers in
regards to the influence of copper on iron metabolism77. Lastly, the current data in the
Caco-2 cell model is consistent with the noted alterations in copper homeostasis during
perturbations of iron metabolism in humans.
92
Figure 5-1. Atp7a knockdown attenuates iron and copper flux in IEC-6 cells. IEC-6 cells
were transfected with a negative-control (Ctrl; scrambled) or Atp7a-targeted, shRNA- expressing plasmids. Two clonal KD cell subpopulations were selected (KD1 or KD2). Atp7a KD was verified at the mRNA A) and protein B) levels in fully-differentiated cells. Atp7a mRNA levels were normalized to cyclophilin expressions A). A representative blot image was shown and quantitative data of Atp7a was normalized to α–tublin expression B, inset). Intracellular iron and copper concentrations C) were quantified by AAS in fully-differentiated Ctrl and Atp7a KD IEC-6 cells and normalized to protein concentrations. Values are means ± SDs. Labeled means without a common letter differ, p<0.05 (1-factor ANOVA followed by Tukey’s analysis). n = 3 independent experiments with 3 technical replicates per experiment.
93
Figure 5-2. Atp7a knockdown impairs tranepithelial iron flux in IEC-6 and Caco-2 cells. Ctrl and Atp7a KD cells grown on collagen-coated, cell-culture inserts for 8 (IEC-6) or 21 days (Caco-2). Fully differentiated Ctrl and Atp7a KD IEC-6 cells were incubated with 0.5 μmol/L 59Fe-citrate uptake for 90 mins at 37 oC in the apical side. 59Fe accumulation A) uptake for shRNA transfected IEC-6 cells, C) uptake for shLentiviral plasmid transfected IEC-6 cells and E) uptake for shLentiviral plasmid transfected Caco-2 cells and efflux B) efflux for shRNA transfected IEC-6 cells, D) efflux for shLentiviral plasmid transfected IEC-6 cells and F) efflux for shLentiviral plasmid transfected Caco-2 cells to the basolateral chamber in the IEC-6 and Caco-2 cells were determined in basal and iron deficient created by treatment of 200 μmol/L of deferoxamine (DFO) 24 hr in both apical and basolateral chambers. 59Fe uptake and efflux were normalized to protein concentrations of total cell lysates. Values are means ± SDs. Labeled means without a common letter differ, p<0.05 (1-factor ANOVA followed by Tukey’s analysis). n = 3 independent experiments with 3 technical replicates per experiment.
94
95
Figure 5-3. Atp7a knockdown alters iron-copper homeostasis related gene expression in IEC-6 cells. Ctrl or Atp7a KD IEC-6 cells were fully grown and differentiated for 8 days and then qRT-PCR was performed to analyze iron-copper homeostasis related gene expressions: A) Dcytb, B) Dmt1, C) Fpn1, D) Heph, E) Ctr1 and F) Tfr1. Ctrl or Atp7a KD IEC-6 cells were cultured under basal or iron deprived condition by treatment of 200 μmol/L of DFO for 24 hr. Values are means ± SDs. Labeled means without a common letter differ, p<0.05 (1-factor ANOVA followed by Tukey’s analysis). n = 3 independent experiments with 3 technical replicates per experiment.
96
97
Figure 5-4. Atp7a knockdown changes iron transport related protein expression in IEC-6
cells. Ctrl or Atp7a KD IEC-6 cells were fully grown and differentiated for 8 days then total lysates were harvested for western blot analysis. Quantitative data from 3 independent experiments is shown in each panel, with representative western blot shown as an inset for A) Dmt1, B) Fpn1, C) Heph and D) Hif2α. α-tubulin was used as an internal standard. Each blot was cut into strips and probed with different antibodies therefore, α-tubulin presented once in panel A. Values are means ± SDs. n = 3 independent experiments.
98
Figure 5-5. Atp7a knockdown alters iron-transport related heteronuclear RNA and transcriptional rate. Ctrl or Atp7a KD IEC-6 cells were fully grown and differentiated for 8 days and then mRNA and hnRNA expression was measured by qRT-PCR. A) Dcytb, C) Fpn1 and E) Heph mRNA and hnRNA expression was determined. ActD was treated to fully differentiated in Ctrl or Atp7a KD IEC-6 cells for 0 – 24 hr. B) Dcytb, D) Fpn1 and F) Heph transcriptional rate was determined by qRT-PCR. The mRNA half-life for each transcript is indicated with an “x”, which has been placed at the approximate position where the starting mRNA levels were reduced by 50% (actual times [t1/2] are indicated as insets in each panel). Values are means ± SDs. Labeled means without a common letter differ, p<0.05 (1-factor ANOVA followed by Tukey’s analysis). n = 6 (mRNA and hnRNA quantification) or n =3 (mRNA decay) independent experiments with 3 technical replicates per experiments.
99
100
Figure 5-6. Atp7a knockdown enhances cell surface ferrireductase activity in IEC-6
cells. Ctrl or Atp7a KD IEC-6 cells were grown and fully differentiated then treated with nitrotetrazolium blue chloride. Color intensity was determined by colorimetric measurement by isopropanol elution. Representative pictures are shown from A) Ctrl, B) KD1 or C) KD2 cells along with D) color intensity quantification from all experiments. Labeled means without a common letter differ, p<0.05 (1-factor ANOVA followed by Tukey’s analysis). n = 4 independent experiments.
101
Figure 5-7. Atp7a knockdown increases membrane and cytosolic ferroxidase activity in
IEC-6 cells. Membrane and cytosolic proteins were fractionated from fully differentiated Ctrl or Atp7a KD IEC-6 cells. FOX activity was determined by using apo-Tf-coupled assay from A) membrane and B) cytosolic part of proteins for 5-120 seconds. KD1 and KD2 were statistically identical. Asterisks indicate statistical differences from Ctrl values (*p<0.05; **p<0.01) (2-factor ANOVA followed by Tukey’s analysis). n = 3 independent experiments.
102
CHAPTER 6 CONCLUSION AND FUTURE DIRECTIONS
Conclusion
Both Sprague-Dawley rats and C57BL/6 mice are widely accepted models in the
iron research field. Dietary feeding of LFe and HFe was chosen to develop IDA and iron
overload in rodents, respectively. After feeding LFe and HFe, we noted that rats
consuming LFe diets grew slower than AdFe fed rodents, as was our expectation. To
our surprise, growth retardation was also observed in HFe fed rodents. Consuming
extra copper in the HFe diet attenuated growth retardation significantly. This
observation indicates that HFe consumption perturbs copper homeostasis in rodents.
Other data also support that HFe caused copper deficiency since HFe consumption
caused: 1) cardiac hypertrophy; 2) severe anemia; 3) Epo induction; and 4) decreased
tissue copper accumulation and Cp activity. These perturbations caused by HFe
consumption were prevented by elevating dietary copper concentrations. Thus, HFe
feeding in the rapid postnatal growth period caused severe copper deficiency.
Therefore, we postulated that HFe would block intestinal copper absorption. To
test this hypothesis, a 64Cu absorption study was performed in C57BL/6 mice. 64Cu
tissue accumulation was very low with HFe feeding; however, intestinal 64Cu absorption
was normal in the HFe diet fed groups. To understand the exact mechanisms by which
HFe caused systemic copper deficiency, in the future, expression of intestinal iron and
copper transporters should be assessed. There are possibilities that: 1) HFe may inhibit
copper transporters (Ctr1 or Atp7a); 2) HFe may perturb the function of copper
chaperones which carry copper; 3) HFe may totally occupy iron transporters which may
103
carry copper (Dmt1); and/or 4) HFe may interfere with copper oxidation function in the
BLM region.
Epo is a circulating glycoprotein that regulates red blood cell production. Epo is a
specific growth factor in hematopoiesis for development and differentiation of erythroid
progenitor cells170-172. Unexpectedly, in our experiments, CDA was caused by feeding
HFe diet. HFe consumption also increased erythropoietic demand (as exemplified by
increases in renal Epo expression and serum Epo protein levels). Though there were
four groups in which Hb and Hct level were similarly depressed (all LFe and the
HFe/LCu groups), Epo was differentially expressed. In the LFe group, Epo expression
was induced significantly, but in the LFe/LCu group it was further elevated as compared
to the LFe/AdCu or LFe/HCu groups. In the HFe groups, Epo expression was the
highest in HFe/LCu group, but by elevating dietary copper concentration, Epo induction
was attenuated gradually. These data indicate that dietary copper plays a significant
role in regulation of Epo expression. Consistent with this, in a previous study, dietary
copper deficiency induced Epo expression89. Our study scrutinized relationships
between dietary copper and Epo expression in greater depth. There are two important
findings: 1) that LCu combined with LFe or HFe induced Epo expression; 2) that extra
copper consumption may attenuate Epo induction. Also, we found that hypoxia (as
indicated by reduced blood Hb levels) may not be a straightforward marker for
erythropoietic demand.
Erfe is a hormone produced by erythroblasts and spleen that increases systemic
iron bioavailability by suppression of hepatic Hepc production. Efre was identified as a
transcript from mouse bone marrow that was induced when erythropoietic demand was
104
increased. Erfe is encoded by the Fam132b gene142. In the described canonical
signaling pathway, elevated Epo expression caused by erythropoietic stress induced the
janus kinase (Jak) 2/ signal transducer and activator of transcription (Stat) 5 pathway.
Then, Epo/Jak2/Stat5 induction elevated Erfe expression, and elevated circulating Erfe
enhances iron availability by suppression of Hepc142. In our experiments, Epo and Erfe
expression mirrored each other in the LFe groups. However, with the HFe feeding, Erfe
expression was not induced despite Epo induction in the HFe/LCu and HFe/AdCu
groups. As mentioned, previous findings outlined the signaling path from elevated Epo
to suppress Hepc (Epo/Jak2/Stat5/Erfe/Hepc). However, our study may suggest the
existence of a feedback pathway that initiates from hepatic Hepc expression. In our HFe
fed rodents, Hepc expression has induced significantly with elevated systemic iron
accumulations. Hepc may act as a negative regulator of Erfe expression. However, this
reciprocal relationship may only exist between Erfe and Hepc since Epo was induced by
anemia in the HFe/LCu and HFe/AdCu groups.
Extrapolating our data to the clinical field, high iron supplementation of humans
may cause copper depletion. Some humans in high-risk groups take high-iron
supplements to prevent development of IDA. However, in general, people do not
consider their systemic mineral status when taking iron supplements. Our findings raise
a question related to whether taking high iron supplementation in pregnant women and
adolescents in the rapid growth period could deplete body copper levels. If iron
supplementation could deplete copper, then we may have to consider whether iron and
copper supplementation simultaneously should be recommended to prevent possible
CDA from high-iron intake.
105
When we designed our in vivo study, we expected that there would be severe
anemia and growth retardation in LFe/LCu rats since both iron and copper are required
for red blood cell production and growth. However, to our surprise, LFe/LCu fed rats did
not exhibit further decreases in the levels of Hb, Hct or growth rate as compared to the
other LFe fed groups. But, Epo and Erfe expression was induced significantly in
LFe/LCu fed rats compared to the other LFe fed rat groups. This observation possibly
indicates that different dietary copper concentrations may affect iron repletion after
feeding LFe diets since LFe fed rats have variable expression of erythropoietic markers
which vary according to dietary copper concentrations.
In vitro experimental evidence presented in this paper strongly supports a role for
copper in intestinal iron transport. This is important since the intestine plays a central
role in the control of overall body iron homeostasis. The Atp7a copper transporter,
which we show is required for expression of iron transporters and for functional iron
transport, is emerging as a potential mediator of iron metabolism. The significance of
the current investigation is, however, limited by the in vitro models used, but is
supportive of in vivo observations made in rats and humans. A definitive test of the role
of Atp7a in intestinal iron homeostasis will thus await the development of an Atp7a
mutant rat line (since we feel that rats may better model humans in this regard).
In our in vitro study, we noted that Atp7a expression is required for optimal iron
transport in fully differentiated IEC-6 and Caco-2 cells. Attenuated iron flux was
paralleled by reduced iron transport-related gene and protein expression (Dcytb, Dmt1
and Fpn1). Alterations of Dcytb and Fpn1 mRNA expression were mediated by
transcriptional mechanisms since hnRNA levels were also attenuated by Atp7a KD.
106
However, hnRNA reduction was smaller than mRNA reduction and this may indicate
that another mechanism exists, such as the further reduction of Dcytb and Fpn1 mRNA
expression post-transcriptionally. Also, we observed that Atp7a KD decreased Hif2α
protein expression significantly. Hif2α may be a possible mechanism to explain the
further reduction of Dcytb, Dmt1 and Fpn1 mRNA expression by Atp7a KD. Hif2α
expression is induced in IECs during iron deprivation164,173. Attenuation of intestinal
Hif2α expression during iron deficiency is able to diminish iron transporters (Dcytb,
Dmt1 and Fpn1) in mice90. Moreover, decreased intracellular copper concentrations
were matched by reduction of Ctr1 mRNA expression. Hif2α is a possible regulator of
Ctr1 expression since diminished Hif2α reduces Ctr1 expression91. Taken together,
reduced expression of iron transporters in Atp7a KD cells may relate to decreased
transcription rates as a result of low Hif2α expression.
Further studies
In the canonical pathway, elevated Epo expression induces Erfe to increase
serum iron by suppression of Hepc. In LFe groups (rat study), Epo and Erfe expression
had a reciprocal relationship with dietary copper concentrations. However, HFe feeding
(mouse and rat study) did not induce Erfe expression despite dramatic changes in Epo
expression. We can logically postulate a new research question from observations
made in this dissertation research that hepatic Hepc or increased iron loading may
function as a negative regulator of Erfe induction during iron overload. To test this
hypothesis, we may design two animal feeding protocols. 1) Rats will be fed HFe/LCu
diet to induce Epo and Hepc expression, but basal level of Erfe will persist (same as in
the animal studies in this dissertation), and then Hepc antibody would be administered
to reduce elevated Hepc expression. By performing this study, we may determine
107
whether Hepc could regulate Erfe expression as a negative regulator. If Hepc antibody
administration elevated Erfe expression, we would conclude that Erfe/Hepc has a
feedback loop. 2) Hepc KO rats will be fed the AdFe/LCu diet to induce Epo and
increase systemic iron concentration, and then Erfe expression will be assessed.
Through this study, whether Erfe expression is regulated by Hepc or systemic iron level
could be determined. If Erfe expression is induced in the AdFe/LCu consuming Hepc
KO rats, then elevated iron level would be a negative regulator, but Hepc would not be
involved.
Moreover, we may find which concentration of HFe will start to trigger copper
deficiency. To find which concentration of iron causes copper depletion, rats could be
fed various iron concentrations from normal to very high (i.e. 80, 400, 800, 2000, 4000
and 8000 µg/g Fe), but dietary copper concentration should be held constant at a
normal level. This trial will be meaningful since this trial will be applicable: 1) to human
clinical study; or 2) to guide a new dietary iron overload model. For normal red blood
cell production, people take iron supplementation; however, in general, humans do not
pay attention to their dietary copper consumption or systemic copper levels. In my
dissertation, we noted that higher iron consumption may cause copper depletion;
however, HFe concentration of the diets I used is not a practically achievable
concentration in humans by diet consumption. Therefore, this study will guide whether
iron supplementation would alter copper homeostasis, but, it requires further iron-dose
dependent study.
Furthermore, we may think about the validity of dietary iron overload methods in
iron research since HFe caused copper deficiency in my dissertation research. To find a
108
better dietary iron overload model, we need two types of trials: 1) We may try the
aforementioned dietary iron dose-dependent study to find the appropriate iron
concentration to ensure iron overload but less severe copper deficiency; and 2) We can
set up an experiment which we feed various copper concentrations to rats but, iron
concentration is constant (i.e. 1% carbonyl Fe; ~10,000 µg/g Fe) to understand which
dietary copper concentration will prevent HFe triggered copper deficiency. Data
acquired from this experiment will guide which dietary iron and copper concentrations
are suitable to induce systemic iron overload without causing copper deficiency.
In LFe feeding, we noticed an interesting observation that all LFe fed rats had the
same growth rates, Hb and Hct levels. But, Epo and Erfe expression were not identical
in all LFe groups; elevating dietary copper concentrations gradually decreased Epo and
Erfe expression. This observation may imply that different dietary copper concentrations
may affect iron repletion after LFe feeding since changes in erythropoietic demand were
apparent. There are two possible experimental designs to understand the role of copper
in iron repletion from dietary IDA models: 1) Rats will be made IDA with LFe diet plus
LCu, AdCu and HCu. Then, AdFe/AdCu diet will be repleted to LFe fed rats with various
copper levels; and 2) In another approach, first LFe/AdCu diet will be fed to rats to
induce IDA, and then, diets will be switched to AdFe/LCu, AdFe/AdCu and AdFe/HCu.
Both trials will elucidate the role of dietary copper in iron repletion in IDA models.
In my dissertation, various dietary concentrations of iron and copper were used
for feeding. Lack or excess of iron or copper likely alters duodenal/hepatic metabolites
and microbiota populations. To understand how dietary iron and copper alters
duodenal/hepatic metabolites and microbiota populations, the 9 combination dietary
109
study should be repeated. By executing this feeding study, we will have a better
understanding of how dietary iron and copper affect duodenal/hepatic metabolites and
fecal microbiota populations. After acquiring microbiota data, we may find significantly
different microbiota populations and change microbiota populations by feeding other
groups of microbiota (with, for example, prebiotics). Microbiota alteration may affect not
only iron and copper homeostasis but also duodenal/hepatic metabolites.
One cause of iron overload is genetic mutations in iron metabolism-related
genes. In my dissertation, HFe feeding caused copper deficiency, but there is limited
information whether this observation is due to: 1) dietary or 2) systemic effects of iron
overload. To answer this research question, various dietary copper levels will be
combined and fed with AdFe to genetic iron-overload mice (i.e. Hepc KO). If AdFe/LCu
feeding to genetic iron-overload mice caused copper deprivation symptoms similar to
those in this dissertation (i.e. growth retardation, anemia, cardiac hypertrophy, lower
tissue copper accumulation and Cp activity), we may conclude that systemic iron
loading is the cause of copper deficiency. If AdFe/LCu consumption to genetic iron-
overload mice does not cause the same type of copper deficiency observed in this
dissertation, then we may conclude that HFe triggered copper deficiency is due to
dietary (i.e. intestinal) effects.
Significant differences in body weight in both rats and mice were noted after
feeding various iron and copper mixed diets for 5 weeks. However, there was no
difference in energy intake since animals ate statistically the same amount of diet. In
other words, animals took equal levels of glucose or other macronutrients, but growth
was significantly decreased in some rodents. This observation implies that HFe fed
110
rodents may not utilize glucose properly and it could be a potential cause of growth
retardation. Improper glucose utilization is directly related to insulin sensitivity and
glucose tolerance. To understand whether HFe feeding causes insulin resistance,
fasting glucose and glucose tolerance tests should be performed. Another possible
explanation is related to heart energy source. In general, the fetal heart uses glucose as
a primary energy source, but, the mature heart uses fat as a primary energy
source174,175. However, in cardiac failure, the heart switches energy sources from fat to
glucose176. Because HFe feeding caused copper deficiency and cardiac hypertrophy,
the demand of glucose in heart may be increased. If utilization of glucose by the heart is
defective, then growth could be impaired and this may support our postulate. To confirm
this possibility, we may orally gavage and trace 14C-deoxyglucose in experimental
animals since it is not metabolized due to its structure.
The in vitro study in this dissertation was designed to understand the role of
Atp7a in iron homeostasis. Atp7a was required for robust iron homeostasis since Atp7a
KD cells decreased iron flux and expression of iron and copper transporters (Ctr1,
Dcytb, Dmt1 and Fpn1). The reduction of iron transporters might occur transcriptionally
via a Hif2α-dependent pathway. To understand the role of Hif2α in iron homeostasis, we
can pursue experiments that silence or overexpress Hif2α in intestinal cell lines (i.e.
IEC-6 or Caco-2). Alteration of Hif2α levels will elucidate the role of Hif2α not only in
iron but also in copper homeostasis.
111
APPENDIX A SUPPLEMENTARY FIGURES
Figure A-1. Serum Total Iron-Binding Capacity (TIBC) and expression of hepatic IL-6
and BMP6. A) TIBC was determined from serum. B) IL-6 and C) Bmp6 mRNA expression was quantified in experimental rats. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). TIBC values represented as a Box-and-Whisker plot as five quartiles; the minimum, the lower quartile, the median, the upper quartile and the maximum of the ranked sample. IL-6 and Bmp6alues are means ± SDs. n values and abbreviations used are the same as in Figure 3-1.
112
Figure A-2. Copper absorption and distribution in C57BL/6 mice. Weanling C57BL/6
mice were fed one of 6 diets containing various iron and copper levels for 5 weeks ad libitum. To determine copper absorption and distribution, 64Cu was gavaged orally. 64Cu absorption and distribution was measured by a gamma counter and normalized weight. 64Cu distribution in A) kidney, B) spleen, C) brain, D) heart, E) muscle and F) bone. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). Values are means ± SDs; n=2-4/group. AdFe/LCu (n=4), AdFe/AdCu (n=4), AdFe/HCu (n=4), HFe/LCu (n=2), HFe/AdCu (n=4) and HFe/HCu (n=4). Opened, striped and solid bar indicates CuD, CuA and CuE, respectively. Abbreviations used are the same as in Figure 4-1.
113
Figure A-3. Verification of Atp7a knockdown in IEC-6 and Caco-2 cells. IEC-6 and
Caco-2 cells were transfected with negative control (Ctrl) or Atp7a-targeting, shLentiviral vectors and two clonal populations, derived from a small number of individual cells, were selected for with puromycin (KD1 or KD2). Atp7a KD was verified at the protein levels in all cell populations. In both panels, a representative western blot is shown as an inset for A) IEC-6 and B) Caco-2 cells. α-tubulin was used as an internal standard. Values are means ± SDs. n = 3 independent experiments.
114
Figure A-4. Atp7a knockdown in IEC-6 cells cells alters expression of iron transport-
related proteins. Ctrl or Atp7a KD IEC-6 cells were grown and fully differentiated for 8 days, and then, total cell lysates were isolated for western blot analysis. Quantitative data from 3 independent experiments is shown in each panel, with representative western blot shown as an inset for A) Dmt1, B) Fpn1, C) Heph and D) Hif2α. α-tubulin was used as an internal standard. Each blot was cut into strips and probed with different antibodies therefore, α-tubulin presented once in panel A. Values are means ± SDs. n = 3 independent experiments.
115
APPENDIX B SUPPLEMENTARY TABLES
Table B-1. Statistical summary (rat study)
Parameter Fe interaction Cu interaction Fe x Cu interaction
Growth rate **** p<0.0001 **** p<0.0001 *** p=0.0002
Final body weight **** p<0.0001 ** p=0.0055 *** p=0.0001
Liver/Body weight **** p<0.0001 ns p=0. 2303 * p=0.0139
Heart/Body weight **** p<0.0001 **** p<0.0001 ** p=0.0011
Spleen/Body weight *** p=0.0002 ns p=0.0688 **** p<0.0001
Kidney/Body weight ns p=0.6499 ns p=0.6246 ns p=0.2177
Hb **** p<0.0001 **** p<0.0001 **** p<0.0001
Hct (%) **** p<0.0001 **** p<0.0001 **** p<0.0001
Nonheme serum Fe **** p<0.0001 *** p=0.0001 **** p<0.0001
Nonheme liver Fe **** p<0.0001 **** p<0.0001 **** p<0.0001
Nonheme splenic Fe **** p<0.0001 **** p<0.0001 **** p<0.0001
TIBC **** p<0.0001 ns p=0.1559 *** p=0.0007
Tf saturation (%) **** p<0.0001 **** p<0.0001 *** p=0.0006
Epo (mRNA) **** p<0.0001 **** p<0.0001 **** p<0.0001
Epo (protein) **** p<0.0001 **** p<0.0001 **** p<0.0001
Hepc (mRNA) **** p<0.0001 ** p=0.0029 **** p<0.0001
Erfe (mRNA) **** p<0.0001 *** p=0.0002 **** p<0.0001
IL-6 (mRNA) **** p<0.0001 ns p=0.8187 ns p=0.4344
Bmp6 (mRNA) **** p<0.0001 ns p=0.8905 ns p=0.3551
Cp activity **** p<0.0001 **** p<0.0001 **** p<0.0001
Bone Fe **** p<0.0001 ns p=0.6337 ns p=0.1918
Enterocyte Fe *** p=0.0003 ns p=0.2844 ns p=0.4764
Liver Fe **** p<0.0001 **** p<0.0001 **** p<0.0001
Heart Fe ns p=0.1825 ns p=0.7213 ns p=0.0934
Kidney Fe **** p<0.0001 ** p=0.0068 ** p=0.0040
Serum Fe **** p<0.0001 ns p=0.3135 *** p=0.0002
Bone Cu ** p=0.0019 **** p<0.0001 ns p=0.5927
Enterocyte Cu ns p=0.0884 **** p<0.0001 ** p=0.0019
Liver Cu **** p<0.0001 **** p<0.0001 **** p<0.0001
Heart Cu **** p<0.0001 **** p<0.0001 **** p<0.0001
Kidney Cu *** p=0.0001 **** p<0.0001 ns p=0.1579
Serum Cu * p=0.0445 **** p<0.0001 ** p=0.0016
Average calorie intake
* p=0.0163 ns p=0.0734 ns p=0.5834
ns= Not significant, * p<0.005, ** p <0.0001, ** p<0.0005, **** p<0.0001.
116
Table B-2. Estimated average daily calorie intake (rat study)
Kcal/day/rat
LFe/ LCu
LFe/ AdCu
LFe/ HCu
AdFe/ LCu
AdFe/ AdCu
AdFe/ HCu
HFe/ LCu
HFe/ AdCu
HFe/ HCu
Average energy intake
25.6 ± 2.11a* (9)≠
24.6 ± 2.83a (6)
25.4 ± 1.33a (6)
27.6 ± 1.40a (6)
25.6 ± 2.91a (6)
28.7 ± 1.47a (6)
23.3 ± 0.86a (6)
23.7 ± 1.58a (6)
26.4 ± 2.04a (6)
* Values are mens ± SDs. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). ≠ Numbers in parentheses indicate n values. Table B-3. Relative spleen and kidney weights (rat study)
% of BW
LFe/ LCu
LFe/ AdCu
LFe/ HCu
AdFe/ LCu
AdFe/ AdCu
AdFe/ HCu
HFe/ LCu
HFe/ AdCu
HFe/ HCu
Spleen 0.52 ± 0.06a* (8)≠
0.32 ± 0.03b (6)
0.34 ± 0.04b (6)
0.28 ± 0.05b (6)
0.33 ± 0.02b (6)
0.36 ± 0.06b (6)
0.31 ± 0.12b (6)
0.33 ± 0.06b (6)
0.39 ± 0.11b (6)
Kidney 0.51 ± 0.10 (8)
0.46 ± 0.02 (6)
0.45 ± 0.05 (6)
0.43 ± 0.04 (6)
0.44 ± 0.04 (6)
0.48 ± 0.05 (6)
0.51 ± 0.10 (6)
0.51 ± 0.04 (6)
0.50 ± 0.04 (6)
* Values are means ± SDs. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). ≠ Numbers in parentheses indicate n values.
117
Table B-4. Tissue iron levels (rat study)
µg/g LFe/LCu LFe/ AdCu
LFe/ HCu
AdFe/ LCu
AdFe/ AdCu
AdFe/ HCu
HFe/ LCu
HFe/ AdCu
HFe/ HCu
Serum 3.62 ± 2.97a* (8) ≠
5.29 ± 2.31a (5)
7.22 ± 6.66a (6)
24.05 ± 15.37b
(5)
14.14 ± 7.29a (6)
8.17 ± 2.52a (6)
10.94 ± 6.39a (4)
10.81 ± 4.86a (5)
25.16 ± 6.78b (6)
Heart 905 ± 226 (9)
745 ± 437 (6)
610 ± 66 (6)
1282 ± 897 (6)
860 ± 209 (6)
920 ± 365 (6)
620 ± 85 (6)
918 ± 436 (6)
1037 ± 503 (6)
Kidney 357 ± 140a (9)
368 ± 194a (6)
260 ± 80a (5)
403 ± 125a (6)
586 ± 269ab (6)
382 ± 47a
(6)
440 ± 197a (6)
1065 ± 647b (6)
1125 ± 201c (6)
IECs† 124 ± 73a (9)
94 ± 46a (6)
44 ± 48a (6)
113 ± 92a (6)
132 ± 140a (6)
143 ± 118a
(6)
817 ± 926b (6)
438 ± 348a (6)
377 ± 350a (6)
Bone 35 ± 15a (7)
24 ± 5.4a (4)
48 ± 38a (4)
53 ± 15a (4)
71 ± 15ac (4)
54 ± 21a (4)
158 ± 32b (4)
168 ± 50b (4)
129 ± 17bc (4)
* Values are means ± SDs. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). ≠ Numbers in parentheses indicate n values. †Intestinal epithelial cells isolated from duodenum
118
Table B-5. Tissue copper levels (rat study)
µg/g LFe/ LCu
LFe/ AdCu
LFe/ HCu
AdFe/ LCu
AdFe/ AdCu
AdFe/ HCu
HFe/ LCu
HFe/ AdCu
HFe/ HCu
Kidney 29.6 ± 16.1ac* (9) ≠
29.5 ± 5.5ac (6)
34.7 ± 2.8a (6)
20.3 ± 3.1ac (6)
30.5 ± 4.7ac (6)
40.4 ± 9.9a (6)
12.4 ± 1.1b (6)
17.3 ± 5.3abc (6)
30.8 ± 2.6ac (6)
Enterocyte 0.60 ± 0.33a (9)
2.23 ± 2.40a (6)
1.34 ± 1.08a (5)
1.08 ± 1.06a (6)
0.71 ± 0.49a (6)
6.69 ± 4.33b (6)
1.01 ± 0.87a (6)
0.90 ± 1.55a (6)
4.16 ± 1.91b (6)
* Values are means ± SDs. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). ≠ Numbers in parentheses indicate n values. Table B-6. Relative tissue weights (mouse study)
% of BW AdFe/ LCu
AdFe/ AdCu
AdFe/ HCu
HFe/ LCu
HFe/ AdCu
HFe/ HCu
Liver 5.36 ± 0.42a* (4) ≠
5.64 ± 0.61a (4)
4.96 ± 0.69a (4)
6.40 ± 0.42bc (4)
6.80 ± 0.06ac (4)
6.67 ± 0.67ac (4)
Kidney 0.79 ± 0.07a (4)
0.83 ± 0.02a (4)
0.77 ± 0.04a (4)
0.88 ± 0.10a (4)
0.80 ± 0.06a (4)
0.83 ± 0.11a (4)
Spleen 0.41 ± 0.05
a (4) 0.40 ± 0.02 a (4)
0.37 ± 0.03 a (4)
0.32 ± 0.08 a (4)
0.44 ± 0.10 a (4)
0.39 ± 0.08 a (4)
* Values are means ± SDs. Labeled means without a common letter differ, p<0.05 (2-factor ANOVA). ≠ Numbers in parentheses indicate n values.
119
Table B-7. Statistical summary (mouse study)
Parameter Fe interaction Cu interaction Fe x Cu interaction
Final body weight **** p<0.0001 * p=0.0162 **** p<0.0001
Growth rate ** p=0.0053 ** p=0.0099 *** p=0.0005
Liver/Body weight **** p<0.0001 ns p=0. 3322 ns p=0.5326
Heart/Body weight ** p=0.0012 ** p=0.0014 ** p=0.0029
Spleen/Body weight ns p=0.6568 ns p=0.2582 ns p=0.1230
Kidney/Body weight ns p=0.2289 ns p=0.5954 ns p=0.2233
Hb **** p<0.0001 **** p<0.0001 **** p<0.0001
Hct (%) **** p<0.0001 **** p<0.0001 **** p<0.0001
Nonheme serum Fe **** p<0.0001 ns p=0.4209 ** p=0.0020
Nonheme liver Fe **** p<0.0001 *** p=0.0003 **** p<0.0001
TIBC * p=0.0453 ** p=0.0088 * p=0.0217
Tf saturation (%) **** p<0.0001 ** p=0.0035 * p=0.0103
Hepc (mRNA) **** p<0.0001 ns p=0.4914 ns p=0.9923
IL-6 (mRNA) *** p=0.0004 ns p=0.1188 ns p=0.1874
Bmp6 (mRNA) **** p<0.0001 ns p=0.5193 ns p=0.5113
Id1 (mRNA) **** p<0.0001 ns p=0.3651 ns p=0.2976
Smad7 (mRNA) **** p<0.0001 ns p=0.2961 ns p=0.5396
Epo (mRNA) **** p<0.0001 * p=0.0324 * p=0.0385
Epor (mRNA) **** p<0.0001 ns p=0.9851 ns p=0.2056
Erfe (mRNA) ns p=0.3961 ns p=0.2993 ns p=0.1446
Liver Cu * p=0.0111 **** p<0.0001 **** p<0.0001
Cp activity * p=0.0434 **** p<0.0001 ** p=0.0028
ns= Not significant, * p<0.005, ** p <0.0001, ** p<0.0005, **** p<0.0001.
120
Table B-8. Statistical summary (mouse study - 64Cu gavage)
Parameter Fe interaction Cu interaction Fe x Cu interaction
Absorption ns p=0.5316 * p=0.0281 **** p<0.0001 64Cu in blood **** p<0.0001 **** p<0.0001 **** p<0.0001 64Cu in liver **** p<0.0001 *** p=0.0005 *** p=0.0008 64Cu in kidney ** p=0.0055 * p=0.0319 * p=0.0237 64Cu in spleen ns p=0.1037 * p=0.0093 ns p=0.3376 64Cu in brain * p=0.0101 * p=0.0188 * p=0.0356 64Cu in heart ** p=0.0026 * p=0.0323 * p=0.0117 64Cu in muscle ** p=0.0034 ** p=0.0051 * p=0.0167 64Cu in bone ** p=0.0083 * p=0.0109 * p=0.0304
ns= Not significant, * p<0.005, ** p <0.0001, ** p<0.0005, **** p<0.0001.
121
Table B-9. Dietary Iron overload studies
Reference Diet Start Genus Species Duration BW Hb Liver Fe Serum Fe
107 2% carbonyl
Weanling Rat Wister 8-10 W ≠ND *NA Increased Increased
108 8390 ppm Fe
Adult (20g)
Mouse C57BL/6 16 W Decreased ND NA NA
109 3% carbonyl
6-week Mouse C57BL/6 16 W Decreased NA NA Increased
110 1-2% carbonyl
NA Rat F344 5 W Decreased NA NA NA
111 1.25-2.5% carbonyl
Weanling (75g)
Rat Wistar 30 W Decreased NA Increased NA
112 2-3% carbonyl
Weanling Rat SD 3 W Decreased Increased Increased NA
113 3% carbonyl
Weanling Rat Porton 10 W Decreased NA Increased NA
114 2% carbonyl
Weanling Rat SD 3 W Decreased ND Increased NA
*NA: Not applicable, ≠ ND: No difference.
122
APPENDIX C OCULAR INFLAMMATION AND ENDOPLASMIC RETICULUM STRESS ARE
ATTENUATED BY SUPPLEMENTATION WITH GRAPE POLYPHENOLS IN HUMAN RETINAL PIGMENTED EPITHELIUM CELLS AND IN C57BL/6 MICE
(Published in 177)
Abstract
Inflammation and endoplasmic reticulum (ER) stress are common denominators
for vision-threatening diseases such as diabetic retinopathy and age-related macular
degeneration. Based on our previous study, supplementation with muscadine grape
polyphenols (MGPs) alleviated systemic insulin resistance and proinflammatory
responses. In this study, we hypothesized that MGPs would also be effective in
attenuating ocular inflammation and ER stress. We tested this hypothesis using the
human retinal pigmented epithelium (ARPE-19) cells and C57BL/6 mice. In ARPE-19
cells, tumor necrosis factor-α–induced proinflammatory gene expression of IL-1β, IL-6,
and monocyte chemotactic protein-1 was decreased by 35.0%, 68.8%, and 62.5%,
respectively, with MGP pretreatment, which was primarily due to the diminished
mitogen-activated protein kinase activation and subsequent reduction of nuclear factor
κ-B activation. Consistently, acute ocular inflammation and leukocyte infiltration were
almost completely dampened (>95%) by MGP supplementation (100–200 mg/kg body
weight) in C57BL/6 mice. Moreover, MGPs reduced inflammation-mediated loss of tight
junctions and retinal permeability. To further investigate the protective roles of MGPs
against ER stress, ARPE-19 cells were stimulated with thapsigargin. Pretreatment with
MGPs significantly decreased the following: 1) ER stress-mediated vascular endothelial
growth factor secretion (3.47 ± 0.06 vs. 1.58 ± 0.02 μg/L, P < 0.0001), 2) unfolded
protein response, and 3) early apoptotic cell death (64.4 ± 6.85 vs. 33.7 ± 4.32%, P =
123
0.0003). Collectively, we have demonstrated that MGP is effective in attenuating ocular
inflammation and ER stress. Our work also suggests that MGP may provide a novel
dietary strategy to prevent vision-threatening retinal diseases.
Introduction
Indigenous to the southeastern region of the United States, muscadine grapes
(Vitis rotundifolia) are 1 of the key agricultural products that have been widely cultivated
and consumed in the United States. Muscadine grapes contain an array of health-
promoting phytochemicals that improve symptoms of chronic diseases, such as insulin
resistance178,179 and inflammation180,181, and even cancer182,183. Recently, our group has
also reported that supplementation with MGPs reduced high-fat diet–mediated
metabolic complications and systemic markers of inflammation in C57BL/6 mice184. A
growing body of evidence suggests that MGPs exert protective roles against chronic
metabolic diseases. However, few studies have been conducted to determine if dietary
supplementation with MGPs could provide beneficial effects for vision-related retinal
diseases such as diabetic retinopathy (DR) and age-related macular degeneration
(AMD).
The pathologic development of retinal diseases and vision impairment is
associated with compounding risk factors including oxidative stress185-188 and
inflammation189,190. Recently, ER stress has been recognized as another key risk factor
that exacerbates pathogenic progression of DR191-193 and AMD194. Because of the
asymptomatic and irreversible nature of these diseases, and their poor prognosis, there
are limitations in drug therapy in treating DR195 and AMD196. Therefore, a nutritional
intervention approach could be a reasonable and preferable strategy to prevent or delay
the progression of these retinal diseases. Unexpectedly, the known antioxidant vitamins
124
(i.e., vitamins C and E) have not been successful in preventing DR progression197,198.
Dietary polyphenols are alternative candidates because many polyphenolic compounds
possess anti-inflammatory and antioxidative properties that may provide defensive
mechanisms through retinal microvasculature. Several polyphenols such as
resveratrol199-201, curcumin202,203, and ellagic acid (EA)204,205 have been investigated as
candidates to test their effectiveness in retinal diseases. However, their efficacy has not
been fully validated yet. This is possibly due to the fact that DR is caused by complex
etiologies, and thus a single phytochemical may not be sufficient to block multiple risk
factors. This led us to hypothesize that nutritional intervention through combinatory
phytochemicals could be advantageous in preventing vision-threatening retinal diseases
by blocking multiple risk factors simultaneously.
In this study, we investigated the effects of MGPs on the following: 1)
inflammation in ARPE-19 cells and C57BL/6 mice, and 2) ER stress in ARPE-19 cells.
Here, we demonstrated that MGPs proficiently attenuate retinal inflammation and ER
stress by interrupting the signal transduction to downstream targets.
Materials and Methods
Chemical Reagents
DMEM/F12, Hank's Balanced Salt Solution (HBSS), sodium pyruvate and
radioimmune precipitation assay buffer, NE-PER nuclear and cytoplasmic extraction
reagents, and a human vascular endothelial growth factor (VEGF)–α ELISA kit were
obtained from Thermo Scientific. FBS was purchased from Mediatech. The TriZol
reagent and Fluo-4 NW calcium assay kit were obtained from Invitrogen.
Lipopolysaccharide (LPS from Escherichia coli 055:B5), thapsigargin, ellagic acid (EA),
125
kaempferol, myricetin, and quercetin were purchased from Sigma-Aldrich. Human
recombinant TNFα (210-TA-020) was purchased from R&D Systems.
Muscadine Grape Phytochemicals
Previously, we have described the preparation of MGPs (the Nobel muscadine
grapes were purchased from a local vineyard)184. The composition of MGPs is also
found in Table 2 in Gourineni et al.184. MGP was further fractionated into an anthocyanin
(Acy) fraction and a non-anthocyanin (NAcy) fraction using a published method206. The
Acy fraction contained anthocyanin 3,5-diflucosides. The NAcy fraction contained EA,
kaempferol, myricetin, and quercetin.
Cell Culture and MGP Treatment
ARPE-19 (American Type Culture Collection CRL-2302) cells were cultured in
DMEM/F12 containing 10% FBS in 5% CO2 at 37°C. The stock solutions of MGP and
individual phytochemicals were prepared in DMSO, kept at −20°C, and freshly diluted
right before treatment.
Endotoxin-Induced Ocular Inflammation
C57BL/6 male mice (8-week old) were purchased from the Jackson Laboratory
and housed at the University of Florida Animal Care Services facilities with a 12-h
light/12-h dark cycle. Mice were fed a standard rodent diet (7012 Teklad LM-485; 19.1%
protein, 5.8% fat, 75.1% nitrogen-free extract; Harlan) without restriction to water. All
protocols and procedures were approved by the University of Florida Institutional Animal
Care and Use Committee. Mice were randomly assigned into 4 groups based on MGP
supplementation and LPS treatment: 1) vehicle control (5% DMSO) with ocular saline
injection (n = 3); 2) vehicle control with ocular LPS injection (n = 5); 3) 100-mg/kg body
weight MGP supplementation with LPS injection (n = 6); and 4) 200-mg/kg body weight
126
MGP supplementation with LPS injection (n = 6). The mice were gavaged with either
vehicle or MGPs for 7 d. Both eyes were injected with either saline or 25-ng LPS/eye,
based on treatment group. The mice were killed by intraperitoneal injection of ketamine
(75 mg/kg) and xylazine (5 mg/kg) followed by cervical dislocation 24 h after LPS (or
saline) injection, and both eyes were enucleated immediately. For each mouse, one eye
was processed for qPCR analysis and the other eye was processed for histologic
examination.
Histology and Analysis of Infiltrated Leukocytes into Eyes
The enucleated eyes were fixed in 4% paraformaldehyde overnight at 4°C. After
cutting 500 μm off each eye, 8 serial sections (5-μm each) were prepared using 80-μm
intervals, and then stained with hematoxylin and eosin (H&E). Using light microscopy
(Zeiss Axiovert 200 equipped with AxioCam MRC5), infiltrated leukocytes were counted
based on their distinguished appearance in H&E-stained slides.
Real-Time qPCR
Total RNA was isolated from the cell cultures or eyes using TriZol reagent.
Reverse transcription was performed using 2-μg mRNA per sample, per the
manufacturer’s protocol (iScript cDNA synthesis kit; Bio-Rad). Each 20-μL PCR reaction
contained cDNA template, SYBR green PCR master mix (Bio-Rad), and 1-μmol/L gene-
specific primer. Gene expression was determined by real-time qPCR (CFX96; Bio-Rad),
and relative gene expression was normalized by 36B4. See primer sequences in Table
C-1.
Western Blot Analysis
Total protein lysates from ARPE-19 cells were obtained using ice-cold
radioimmune precipitation assay buffer with protease inhibitors and phosphatase
127
inhibitors (2-mmol/L Na3VO4, 20-mmol/L β-glycerophosphate, and 10-mmol/L NaF). To
determine nuclear factor kappa B (NF-κB) activation, nuclear and cytosolic cellular
fractions were prepared using a commercial kit. The proteins were separated using 12%
or 15% SDS-PAGE, transferred to polyvinylidene difluoride membranes using a semi-
dry transfer unit (Hoefer), and incubated with relevant primary antibodies. Using
Western Lightning Plus ECL (Perkin Elmer), chemiluminescence was detected from
solution via a FluorChem E (Cell Biosciences) imaging system. Polyclonal antibodies
targeted to phosphorylated c-Jun N-terminal kinase (p-JNK) (#2676), phosphorylated
p38 MAPK (p-p38) (#4511), phosphorylated-extracellular-signal-regulated kinases
(#4370), total extracellular-signal-regulated kinases (#4695), NF-κB subunit p65 (p65)
(#8242), NF-κB inhibitor α (IκBα) (#4812), Lamin A/C (#4777), phosphorylated-
eukaryotic translation initiation factor 2α (p-eIF2α) (#9721), activating transcription
factor 4 (ATF4) (#11815), CCAAT/enhancer-binding protein homologous protein
(CHOP) (# 2895), and binding of immunoglobulin protein (BiP) (#3183) were purchased
from Cell Signaling Technology. Mouse monoclonal antibodies targeted to GAPDH (SC-
137179) and β-Actin (A2228) were purchased from Santa Cruz Biotechnology and
Sigma-Aldrich, respectively.
Measurement of Transepithelial Electrical Resistance
Approximately 0.6 × 105 cells/well of ARPE-19 cells were seeded in the apical
compartment of a 6-well transwell plate (pore size: 0.4 μm) and then differentiated for
21 d to develop tight junctions. To induce inflammation, ARPE-19 cells were stimulated
with either by TNFα (0.5 μg/L) alone or TNFα plus MGPs. The transepithelial electrical
resistance of the cultures on the transwell plates was measured with a volt-ohm meter
128
(Millicell ERS-2; EMD Millipore). Final resistance-area products (Ω·cm2) were obtained
by multiplying the resistance with the surface area of the apical membrane insert.
VEGFα Secretion
For VEGFα protein determination, VEGFα secretion into culture medium was
quantified using a commercial ELISA kit following the manufacturer’s instructions.
Intracellular Calcium Release
Intracellular calcium ([Ca2+]i) was measured using a Fluo-4 NW calcium assay kit
(F36206) according to the manufacturer’s protocol. Briefly, cultures of ARPE-19 cells in
96-well plates were treated with either vehicle (DMSO) or MGPs (100 μg/mL) for 12 h.
Then, cultures were preloaded with cell-permeable calcium indicator (Flow-4 AM) for 30
min before injection of either 50 μL of vehicle (HBSS) or thapsigargin (final
concentration: 5 μmol/L). Fluorescence intensity (Ex = 485 nm, Em = 528 nm) was
monitored over time using Synergy H1 (BioTek). [Ca2+]i concentrations were monitored
by a preloaded Flow-4 NW calcium indicator using a fluorometer. The ratio of calcium-
specific fluorescence (F/F0) was plotted over time.
Flow Cytometric Analysis of Apoptosis
Retinal apoptosis was assessed using an Annexin V-FITC apoptosis detection kit
(Bender Med Systems) following the manufacturer’s instructions and measured using
the Accuri C6 flow cytometer (BD). ARPE-19 cells were pretreated with either vehicle
(DMSO) or thapsigargin alone, or thapsigargin plus 100 μg/mL of MGPs before
induction of apoptosis by adding 5 μmol/L of thapsigargin for 72 h. Propidium iodide was
used for detecting necrotic cells, and Annexin V was used for detecting apoptotic cells.
129
Statistical Analysis
Results are presented as means ± SEMs. The data were analyzed statistically
using 1-factor ANOVA followed by Tukey’s post hoc analysis. For the analysis of
percentage of infiltrated cells (unequal sample sizes), a nonparametric 1-factor ANOVA
with Kruskal-Wallis test was conducted (do not assume a normal distribution of residual,
but assume an identically shaped and scaled distribution for each group). For the
measurement TEER value over time, a 1-factor ANOVA with repeated measures was
conducted. For [Ca2+]i determination, 2-factor ANOVA with repeated measures was
used. All statistical analyses were performed with GraphPad Prism 5 (version 5.04).
Results
MGPs Reduced NF-κB Activation in ARPE-19 Cells
We have previously reported that MGP supplementation reduces systemic
inflammation in vivo184. However, it is unknown whether MGPs exert an anti-
inflammatory role in the eyes. To test the hypothesis that MGPs will attenuate retinal
inflammation, ARPE-19 cells were stimulated with TNFα (0.5 μg/L) in the presence or
absence of MGPs. TNFα treatment markedly increased the proinflammatory cytokine
gene expressions of IL-1β, IL-6, and monocyte chemo-attractive protein 1 (MCP-1). As
we expected, pretreatment with MGPs (50–100 μg/mL) significantly reduced
proinflammatory gene expression (Fig. C-1A–C).
NF-κB activation plays a pivotal role in retinal dysfunction207. Next, we examined
whether MGPs reduce MAPK activation, the upstream targets of NF-κB activation. Upon
TNFα stimulation, phosphorylation levels of the 3 MAPKs (i.e., p-JNK, p-p38, and
phosphorylated-extracellular-signal-regulated kinase 1/2) were significantly increased
compared with the vehicle control, which was significantly blocked by pretreatment with
130
MGPs (Fig. C-1D). To determine the extent to which MGPs reduce NF-κB activation,
ARPE-19 cells were pre-exposed to MGPs before TNFα stimulation, and then total cell
lysates were separated into nuclear and cytosolic fractions. In response to TNFα
stimulation, inhibitory IκBα protein is rapidly degraded and NF-κB p65 is translocated
into the nucleus in ARPE-19 cells. In contrast, the majority of IκBα and NF-κB p65
proteins remained in the cytosol with the pretreatment of MGPs, which was comparable
with the vehicle control (Fig. C-1E). These data indicate that MGP treatment could
effectively attenuate MAPK/NF-κB axis activation resulting in a decreased expression of
its proinflammatory target genes in ARPE-19 cells.
MGPs Attenuated Acute Ocular Inflammation in vivo
Based on its anti-inflammatory properties on ARPE-19 cells (Fig. C-1), we
reasoned that MGP supplementation should be effective in reducing ocular
inflammation in vivo. Similarly, although acute ocular inflammation was induced in mice
by intravitreal injection of LPS, proinflammatory target genes of Il-1β, Il-6, and Mcp-1
were remarkably reduced in the eyes of MGP-fed mice compared with control mice (Fig.
C-2A). The recruitment of immune cells into inflamed regions is a hallmark of ocular
inflammation208,209. The number of infiltrated leukocytes into eyes was quantified from
the H&E-stained serial sections. LPS injection caused a massive immune cell
infiltration, both in the anterior chamber and posterior chamber compared with vehicle
control (Fig. C-2B). In accordance with the reduced chemokine Mcp-1 expression (Fig.
C-2A), leukocyte infiltration was significantly decreased with MGP supplementation in
both the anterior and posterior chamber (Fig. C-2B, C). Notably, there were no
additional advantages in supplementation of 200-mg/kg versus 100-mg/kg body weight
of MGPs in terms of reducing inflammation or immune cell recruitment.
131
MGPs Protected Inflammation-induced Retinal Permeability
Retinal inflammation and its accompanied loss of tight junctions are key culprits
for retinal dysfunction210-213. To determine whether MGPs play a protective role in retinal
integrity, we examined the effects of MGPs on tight-junction expression. The LPS
treatment reduced ∼50% mRNA expression of occludin (Ocln), a tight-junction protein,
in mice. In contrast, MGP supplementation prior to LPS treatment prevented the loss of
Ocln mRNA (Fig. C-3A). To evaluate the protective role of MGPs on retinal permeability,
we mimicked an epithelium monolayer in ARPE-19 cells by employing a transwell
system. Consistent with the in vivo experiment, TNFα treatment decreased ∼40% of
OCLN gene expression in ARPE-19 monolayers. However, MGP pretreatment
completely blocked the TNFα–mediated loss of OCLN gene expression (Fig. C-3B). In
addition, the transepithelial electrical resistance value was significantly higher in MGP-
pretreated cells than cells with TNFα simulation alone (Fig. C-3C). Taken together,
these data suggest that MGP treatment would be effective in maintaining the integrity of
the retinal monolayer by attenuating the inflammation-mediated loss of tight junctions.
MGPs Decreased ER Stress in ARPE-19 Cells
A growing body of evidence from animal and clinical investigations suggests that
ER stress in eyes is involved in various pathologic conditions such as retinopathy191-193,
AMD194, and abnormal angiogenesis214,215. Given the potent anti-inflammatory
properties of MGPs (Figs. C-1-C-3), we raised the question whether MGPs would be
effective in attenuating ER stress and VEGFα secretion. To address this question, ER
stress was induced in ARPE-19 cells by stimulating with thapsigargin (5 μmol/L) in the
presence or absence of MGPs. Although there was approximately a 5-fold increase of
132
VEGFα gene expression in response to thapsigargin stimulation, it was significantly
reduced in the presence of 25 to 100 μg/mL of MGP treatment (Fig. C-4A). In an
attempt to identify whether any single compound in MGPs was responsible for
antagonizing VEGFα expression, ARPE-19 cells were treated with either NAcy
constituents (i.e., EA, kaempferol, myricetin, and quercetin) or total Acy fraction.
Intriguingly, 10 μmol/L of EA and 3 other flavonols of kaempferol, myricetin, and
quercetin were similarly effective in reducing VEGFα expression (Fig. C-4B).
Additionally surprising, 25 μg/mL of the Acy fraction was effective in reducing VEGFα
gene expression (Fig. C-4C). Consistent with VEGFα gene expression, MGPs, NAcy
constituents (i.e., EA, kaempferol, myricetin, and quercetin), and Acy fraction effectively
blocked thapsigargin-inducible VEGFα secretion into the medium (Fig. C-4D–F).
It is well understood that thapsigargin causes ER stress by depleting calcium
from ER reservoirs216. Based on the fact that MGPs decreased thapsigargin-mediated
VEGFα secretion, we questioned whether MGPs would lower [Ca2+]i concentrations.
Thapsigargin treatment remarkably increased [Ca2+]i in ARPE-19 cells (Fig. C-5A). In
contrast, MGP treatment attenuated ∼50% of [Ca2+]i release from ARPE-19 cells
compared with thapsigargin stimulation alone (Fig. C-5B). Next, we examined the
impact of MGP treatment on ER stress signaling pathways. Thapsigargin treatment
significantly increased p-JNK/p-p38 and p-eIF2α/ATF4 axis activation as well as CHOP
and ER chaperone BiP expression. Intriguingly, MGP treatment attenuated p-JNK/p-
p38, p-eIF2α/ATF4, and BiP/CHOP activation (Fig. C-5C).
To determine whether reduction of ER stress by MGPs would decrease ER
stress–mediated retinal apoptosis217, an early apoptosis marker was assessed in the
133
presence and absence of MGPs by flow cytometry. After 72 h of thapsigargin treatment,
∼64% of ARPE-19 cells underwent early apoptosis (analyzed by annexin V positive live
cells). As we expected, 100 µg/mL of MGPs significantly reduced apoptotic cell
populations to ∼35% (Fig. C-6). Collectively, our data show that MGP supplementation
attenuates ER stress–inducible apoptotic cell death in ARPE-19 cells.
Discussion
Responsible for vision, the eyes are delicate and highly nutrition-sensitive
organs. Chronic stresses in retinal epithelium can cause irreversible damage mediating
aberrant angiogenesis, cell death, and eventually loss of eyesight194. The goal of this
study was to investigate the protective effects of MGPs against vision-threatening risk
factors, especially inflammation and ER stress. In this work, we demonstrated that
MGPs were effective in reducing inflammation-mediated cytokine expression, leukocyte
infiltration, and retinal vascular leakage, likely because of an attenuation of NF-κB
activation. In addition, MGPs reduced ER stress–mediated VEGFα secretion, ER stress,
and early apoptosis by decreasing [Ca2+]i and subsequent signal transduction
downstream. Based on these results, we proposed that MGPs might attenuate ocular
inflammation and ER stress by interrupting upstream signaling pathways (summarized
in Fig. C-7).
Inflammation is the critical etiology this causally associated with vision-
threatening retinal diseases such as DR211,218,219, AMD220, and uveitis221. There is
evidence that inflammatory cytokines are elevated in the vitreous humor in proliferative
DR222, AMD223, and uveitis224. Additionally, aberrant expression of proinflammatory
cytokines within the neural retina and up-regulation of adhesion molecules on the
134
microvasculature lead to leukostatic responses and vascular leakage; this will
eventually lead to acellular capillary formation and neurovascular dysfunction225. Key
underlining mechanisms that trigger damages to ocular tissues are likely to include
cascades of intracellular signaling for NF-κB activation226,227. Inhibition of NF-κB serves
as a useful therapeutic target to treat inflammatory retinal diseases. Indeed, blockage of
NF-κB by corticosteroids has been the most frequently prescribed medication for the
treatment of severe uveitis228. However, considering the limitation of pharmacologic
strategies and the adverse effects of steroidal anti-inflammatory drugs229, nutritional
intervention for the treatment and/or prevention of ocular inflammation would be a safe
and effective approach. To investigate the anti-inflammatory potential of MGPs in retinal
inflammation, we used well-accepted experimental models: TNFα–induced acute
inflammation in ARPE-19 cells and an endotoxin (LPS)-induced uveitis model in mice.
MGPs significantly reduced cytokine and chemokine production in vivo and in vitro
(Figs. C-1, C-2). In parallel, MGPs were competent to inhibit MAPK and NF-κB
activation as well as endotoxin-mediated leukocyte infiltration (Fig. C-2B, C). These
results clearly suggest the likelihood that supplementation with MGPs could be effective
in intervening against the prevalence of inflammatory diseases in retinal epithelium.
Retinal-pigmented epithelium constitutes the outer blood-retinal barrier, which plays
pivotal roles in the transport of nutrients and water, light absorption, phagocytosis, and
immune responses, and thereby serves as the gatekeeper for the maintenance of the
retina integrity230. Escalated concentrations of cytokines are 1 of the fundamental
causes that weaken the retinal epithelium by disrupting tight junctions210,212. Shirasawa
et al.231 have demonstrated that TNFα treatment increases retinal permeability by losing
135
tight-junction proteins. MGP supplementation could inhibit the inflammation mediated-
mediated loss of tight-junction expression and sustain epithelium integrity against
inflammation (Fig. C-2). This implies that MGP supplementation may be a beneficial and
economical source for intervention in the progression of retinopathy by assisting current
pharmaceutical approaches.
It is important to identify the individual component(s) responsible for the anti-
inflammatory effects of MGPs. The most well-studied polyphenol in retinal disease is
resveratrol (3,5,4-trihydroxystilbene). Resveratrol is apparently efficacious in
suppressing retinal inflammation by reducing leukocyte adhesion to retinal vessels and
retinal neovascularization199-201. Despite the proposed potency of resveratrol, we
excluded the possibility that resveratrol is 1 of the active components of MGPs. The
contents of resveratrol were under the lower limit of quantification. Primarily, MGPs are
composed of Acy and NAcy184. The Acy fraction did not exhibit any substantial anti-
inflammatory properties. Among the major NAcy components tested in ARPE-19 cells,
quercetin was most potent (quercetin>>EA>myricetin≈KM) in reducing TNFα–induced
proinflammatory gene expression. More notably, treatment with individual polyphenols
was not as effective as using combinations of MGPs. For example, 100 μg/mL of MGPs,
containing 0.2 μmol/L of quercetin and 6 μmol/L of EA, was more potent than a single
treatment of 10 μmol/L of quercetin or EA in decreasing proinflammatory cytokine
expression. Acy may provide synergistic roles by facilitating the NAcy uptake, protecting
polyphenols from catabolic degradation, or boosting cellular defensive enzyme systems.
Another important factor in the cause of retinal diseases, other than inflammation,
seems to be ER stress. Unlike the inflammatory inhibition pattern, total MGP (>25
136
μg/mL), the 4 major individual flavonols, and Acy (25 μg/mL) were similarly effective in
decreasing VEGF expression and secretion (Fig. C-4). It is noteworthy that the Acy
fraction of MGPs contributed to the alleviation of ER stress, although it was not potent in
decreasing inflammation per se. Although mechanistic uncertainties exist, our data
suggest that combinatory polyphenols of MGPs were more effective than individual
polyphenolic compounds in attenuating multiple risk factors in ARPE-19 cells, and
probably in vivo as well.
The decrease of VEGFα secretion by MGPs appears to be the consequence of
reduced unfolded protein responses (UPRs) corresponding to the reduced calcium
release from ER (Fig. C-5B). There are at least 3 major UPR pathways194. In our work,
MGP treatment evidently decreased ER stress–mediated activation and downstream
signaling targets. The MGP supplementation seems to be effective in attenuating at
least 2 other UPR signaling pathways (i.e., protein kinase R–like ER-localized eIF2α
kinase and inositol-requiring enzyme-1α) that are linked to CHOP activation (Fig. C-5C).
In agreement with decreased [Ca2+]i, ER stress marker proteins, and CHOP activation,
MGP treatment significantly attenuated early apoptosis (Fig. C-6). Based on data, these
results showed that MGPs sufficiently diminish ER stress signal transduction, UPRs,
and apoptosis in human ARPE-19 cells, and inflammation.
Although our data are promising in that an MGP-containing diet may prevent or
delay retinal vascular leakage and accompanying pathologic processes of vision loss,
there are some limitations in our study design for immediate clinical application. We
used 100 to 200 mg/kg body weight of MGPs, which is difficult to be achieved by regular
dietary interventions. It needs to be determined whether supplementation with a
137
physiologically attainable MGP concentration (probably within the range of 10–50 mg/kg
body weight) would produce the same effect. In a different approach, a direct delivery
system (e.g., eye drops) could be considered to increase MGP concentration within the
retinal microenvironment. Our current study also lacks information regarding MGP
metabolism in vivo. We are now analyzing the physiologically active forms of MGPs and
their metabolites in plasma. Likewise, additional efforts will be made to define the
compositional variations of polyphenols among different batches of grapes and
cultivars, which will establish the nutritional significance of MGPs in ocular health and
facilitate the development of new intervention strategies using MGPs.
Here we demonstrated that MGPs effectively attenuated at least 2 important
variables related to the development of vision-threatening retinal diseases: inflammation
and ER stress. MGPs attenuated NF-κB activation, which resulted in reduced
proinflammatory cytokine expression, leukocyte recruitment, and retinal leakage. MGPs
also effectively reduced ER stress signal transduction and apoptotic cell death.
Additional studies are required to determine signaling crosstalk among ER stress,
inflammation, and other oxidative insults and to establish optimal concentration ranges
for the translation into humans. In conclusion, this study provides new insight that
supplementation with MGPs may be beneficial to eye health by protecting retinal
epithelium from inflammation and ER stress.
138
Figure C-1. TNFα–induced proinflammatory gene expression, MAPK, and NF-κB activation in MGP-treated ARPE-19
cells. The panels show proinflammatory gene expression of IL-1β (A), IL-6 (B), and MCP-1(C). Panel (D) shows phosphorylation of MAPK JNK, p38, and ERK. Panel (E) shows nuclear translocation of NF-κB p65 and cytosolic degradation of IκBα. Values are means ± SEMs, n = 9 (A–C). Means without a common letter differ, P < 0.05. In panel (D), t-ERK and β-actin were used as references. In panel (E), GAPDH and Lamin A/C were used to validate cytosolic (C) and nuclear (N) fractionation. + and − indicate the presence or absence of TNFα and/or MGP treatment.
139
Figure C-2. Ocular inflammation and leukocyte infiltration in control and MGP-supplemented C57BL/6 mice. Panel (A)
shows proinflammatory gene expression of Il-1β, Il-6, and Mcp-1 from enucleated eyeballs. Leukocyte infiltration was visualized by hematoxylin and eosin staining (B). Representative images of the entire eyeball section (top), anterior chamber (middle), and posterior chamber (bottom) are shown. Panel (C) shows the relative leukocyte recruitment (%) into the inflamed eyeball. Values are means ± SEMs (A, C). Values without a common letter differ, P < 0.05; n = 4 for panel (A), and the number of eyes for panel (C) is denoted under the figure. + and − indicate the presence or absence of LPS and/or MGP treatment.
140
Figure C-3. Ocular tight junction expression and retinal permeability in MGP-
supplemented C57BL/6 mice and ARPE-19 cells. Panel (A) shows relative Ocln expression in LPS-injected C57BL/6 mice. Panel (B) shows relative OCLN expression and panel (C) shows changes in TEER value analyzed from the ARPE-19 cells grown in transwell. + and − indicate the presence or absence of prior treatment, either TNFα or LPS, in conjunction with given MGP concentration (100- or 200-mg/kg body weight) (A) or 100-mg/kg body weight MGP (B, C). Values are means ± SEMs; n = 6 eyes from different mice (A), and n = 3 (B, C). Means without a common letter differ, P < 0.05.
141
Figure C-4. ER stress-induced VEGFα gene expression and protein secretion in MGP-
treated ARPE-19 cells. The relative gene expression of VEGFα by qPCR (A-C) and VEGFα protein secretion into medium by ELISA (D-F) are shown. ARPE-19 cells were pretreated with 10 to 100 μg/mL of total MGP (A, D), 10 μg/mL of NAcy components of MGP (B, E), or 25 μg/mL Acy fraction of MGP (C, F) with (+) or without (−) the addition of ER stressor Tg. Values are means ± SEMs, n = 9. Means without a common letter differ, P < 0.05.
142
Figure C-5. Tg-induced [Ca2+]i and ER stress markers expression in MGP-treated
ARPE-19 cells. Changes are shown in [Ca2+]i-sensitive florescence concentrations over time in response to vehicle or Tg alone (A) and Tg with MGP treatment (B) in ARPE-19 cells. ER stress-related protein expression of p-eIF2α, ATF4, p-JNK, p-p38 MAPK, BiP, and CHOP by western blot analysis is shown in panel (C). In panels (A) and (B), values are means ± SEMs; n = 5, ****time effect, P < 0.0001; treatment effect, P < 0.0001. In panel (C), β-actin was used as a loading control. + and − indicate the presence or absence of prior treatment of Tg or MGP (100 μg/mL).
143
Figure C-6. Effect of MGP against thapsigargin-inducible retinal apoptosis. ARPE-19
cells were treated with vehicle (DMSO, 2 μL) or MGP at the described concentrations (50, 100 µg/mL) for 12 hr. After MGP pre-incubation, vehicle (DMSO, 1 μL) or 5 µM thapsigargin was treated for 72 hr in the presence or absence of MGP. (A) Figures are representative experiment after FITC Annexin V and propidiumiodide staining and flow-cytometric analysis. 1×105 cells in each experiment were analyzed. (B) Overlay of Annexin V population of vehicle (red), 5 µM thapsignargin (blue), 5 µM thapsigargin + 50 µg/mL MGP (green) and 5 µM thapsigargin + 100 µg/mL MGP (brown).
144
Figure C-7. A proposed mechanism by which MGPs attenuate ocular inflammation and
ER stress. Supplementation of MGP will reduce MAPK and NF-κB activation, which in turn decreases inflammation-mediated retinal permeability and leukocyte recruitment into eyes (A). MGPs decrease intracellular calcium release from ER and subsequent signal transduction for ER stress, including p-eIF2α, ATF4, p-JNK, p-p38, and CHOP, which in turn alleviates ER stress-mediated apoptotic cell death and VEGFα secretion (B). It remains to be identified whether MGPs could reduce other angiogenic signals such as oxidative stress or hyperglycemia, and thus diminish VEGFα secretion and angiogenesis (C). In addition, it is yet to be revealed whether MGP also mitigates signaling crosstalk among these risk factors. ATF4, activating transcription factor 4; ATF6α, activating transcription factor 6α CHOP, CCAAT/enhancer-binding protein homologous protein; ER, endoplasmic reticulum; IκB, nuclear factor κ-B inhibitor; IRE1α, inositol-requiring enzyme-1α MGP, muscadine grape polyphenol; p-eIF2α, phosphorylated-eukaryotic translation initiation factor 2α p-ERK, phosphorylated-extracellular-signal-regulated kinase; p-JNK, phosphorylated c-Jun N-terminal kinase; p-MAPK, phosphorylated MAPK; p-p38, phosphorylated p38 MAPK; p50, NF-κB subunit p50; p65, NF-κB subunit p65; PERK, protein kinase R–like ER-localized eIF2α kinase; VEGF, vascular endothelial growth factor; [Ca2+]i, intracellular calcium.
145
Table C-1. List of qRT-PCR primers
Primer Forward Reverse
IL-1β (human) 5’- CTCGCCAGTGAAATGATGGCT-3’ 5’- GTCGGAGATTCGTAGCTGGAT-3’
IL-6 (human) 5’- CTTCTCCACAAGCGCCTTC-3’ 5’- CAGGCAACACCAGGAGCA-3’
MCP-1 (human)
5’- CCCCAGTCACCTGCTGTTAT-3’ 5’- AGATCTCCTTGGCCACAATG-3’
OCLN(human) 5’- AAACTTTCACACCCCAGACG-3’ 5’- CTTCATTGCAGGAACCCAGT-3’
VEGF (human)
5’- AGGAGGAGGGCAGAATCATCA-3’ 5’- CTCGATTGGATGGCAGTAGCT-3’
36B4 (human) 5’- GAAGGCTGTGGTGCTGATG-3’ 5’- GTGAGGTCCTCCTTGGTGAA-3’
Il-1β (mouse) 5’- GTCACAAGAAACCATGGCACAT-3’ 5’- GCCCATCAGAGGCAAGGA-3’
Il-6 (mouse) 5’- CTGCAAGAGACTTCCATCCAGTT-3’ 5’- AGGGAAGGCCGTGGTTGT-3’
Mcp-1 (mouse)
5’- AGGTCCCTGTCATGCTTCTG-3’ 5’- GCTGCTGGTGATCCTCTTGT-3’
Ocln (mouse) 5’- CCTCCAATGGCAAAGTGAAT-3’ 5’- CTCCCCACCTGTCGTGTAGT-3’
36b4 (mouse) 5’- GGATCTGCTGCATCTGCTTG-3’ 5’- GGCGACCTGGAAGTCCAACT-3’
146
LIST OF REFERENCES
1. McDonough W, Sun S. The composition of the earth. Chemical Geology. 1995;120(3-4):3-4.
2. Halliwell B, Gutteridge JMC. Free radicals in biology and medicine (ed 4th). Oxford ; New York: Oxford University Press; 2007.
3. Andrews NC. Disorders of iron metabolism. N Engl J Med. 1999;341(26):1986-1995.
4. Emerit J, Beaumont C, Trivin F. Iron metabolism, free radicals, and oxidative injury. Biomed Pharmacother. 2001;55(6):333-339.
5. Lieu PT, Heiskala M, Peterson PA, Yang Y. The roles of iron in health and disease. Mol Aspects Med. 2001;22(1-2):1-87.
6. World Health Organization. Report of the WHO Informal Consultation on Hookworm Infection and Anaemia in Girls and Women. Geneva: Programme of Intestinal Parasitic Infections, Division of Communicable Diseases; 1995.
7. Centers for Disease Control and Prevention. Iron deficiency--United States, 1999-2000. MMWR Morb Mortal Wkly Rep. 2002;51(40):897-899.
8. Crompton DW, Nesheim MC. Nutritional impact of intestinal helminthiasis during the human life cycle. Annu Rev Nutr. 2002;22:35-59.
9. Larocque R, Casapia M, Gotuzzo E, Gyorkos TW. Relationship between intensity of soil-transmitted helminth infections and anemia during pregnancy. Am J Trop Med Hyg. 2005;73(4):783-789.
10. Beard JL, Connor JR. Iron status and neural functioning. Annu Rev Nutr. 2003;23:41-58.
11. Beisel WR. Single nutrients and immunity. Am J Clin Nutr. 1982;35(2 Suppl):417-468.
12. Gardner GW, Edgerton VR, Senewiratne B, Barnard RJ, Ohira Y. Physical work capacity and metabolic stress in subjects with iron deficiency anemia. Am J Clin Nutr. 1977;30(6):910-917.
13. Park CH, Valore EV, Waring AJ, Ganz T. Hepcidin, a urinary antimicrobial peptide synthesized in the liver. J Biol Chem. 2001;276(11):7806-7810.
14. Krause A, Neitz S, Mägert HJ, et al. LEAP-1, a novel highly disulfide-bonded human peptide, exhibits antimicrobial activity. FEBS Lett. 2000;480(2-3):147-150.
147
15. Bârsan L, Stanciu A, Stancu S, et al. Bone marrow iron distribution, hepcidin, and ferroportin expression in renal anemia. Hematology. 2015;20(9):543-552.
16. Canonne-Hergaux F, Donovan A, Delaby C, Wang HJ, Gros P. Comparative studies of duodenal and macrophage ferroportin proteins. Am J Physiol Gastrointest Liver Physiol. 2006;290(1):G156-163.
17. de Korwin JD. [Hereditary and acquired iron overload]. Nephrol Ther. 2006;2 Suppl 5:S304-312.
18. Gurrin LC, Bertalli NA, Dalton GW, et al. HFE C282Y/H63D compound heterozygotes are at low risk of hemochromatosis-related morbidity. Hepatology. 2009;50(1):94-101.
19. Ganz T. Hepcidin, a key regulator of iron metabolism and mediator of anemia of inflammation. Blood. 2003;102(3):783-788.
20. Papanikolaou G, Samuels ME, Ludwig EH, et al. Mutations in HFE2 cause iron overload in chromosome 1q-linked juvenile hemochromatosis. Nat Genet. 2004;36(1):77-82.
21. Roetto A, Papanikolaou G, Politou M, et al. Mutant antimicrobial peptide hepcidin is associated with severe juvenile hemochromatosis. Nat Genet. 2003;33(1):21-22.
22. Huang FW, Pinkus JL, Pinkus GS, Fleming MD, Andrews NC. A mouse model of juvenile hemochromatosis. J Clin Invest. 2005;115(8):2187-2191.
23. Niederkofler V, Salie R, Arber S. Hemojuvelin is essential for dietary iron sensing, and its mutation leads to severe iron overload. J Clin Invest. 2005;115(8):2180-2186.
24. Nicolas G, Bennoun M, Devaux I, et al. Lack of hepcidin gene expression and severe tissue iron overload in upstream stimulatory factor 2 (USF2) knockout mice. Proc Natl Acad Sci U S A. 2001;98(15):8780-8785.
25. Lesbordes-Brion JC, Viatte L, Bennoun M, et al. Targeted disruption of the hepcidin 1 gene results in severe hemochromatosis. Blood. 2006;108(4):1402-1405.
26. Camaschella C, Roetto A, Calì A, et al. The gene TFR2 is mutated in a new type of haemochromatosis mapping to 7q22. Nat Genet. 2000;25(1):14-15.
27. Roetto A, Totaro A, Piperno A, et al. New mutations inactivating transferrin receptor 2 in hemochromatosis type 3. Blood. 2001;97(9):2555-2560.
28. Fernandes A, Preza GC, Phung Y, et al. The molecular basis of hepcidin-resistant hereditary hemochromatosis. Blood. 2009;114(2):437-443.
148
29. Olynyk JK, Trinder D, Ramm GA, Britton RS, Bacon BR. Hereditary hemochromatosis in the post-HFE era. Hepatology. 2008;48(3):991-1001.
30. Pietrangelo A. The ferroportin disease. Blood Cells Mol Dis. 2004;32(1):131-138.
31. De Domenico I, Ward DM, Nemeth E, et al. The molecular basis of ferroportin-linked hemochromatosis. Proc Natl Acad Sci U S A. 2005;102(25):8955-8960.
32. Theil EC. Iron, ferritin, and nutrition. Annu Rev Nutr. 2004;24:327-343.
33. Hurrell RF. Preventing iron deficiency through food fortification. Nutr Rev. 1997;55(6):210-222.
34. Hallberg L, Björn-Rasmussen E. Determination of iron absorption from whole diet. A new two-pool model using two radioiron isotopes given as haem and non-haem iron. Scand J Haematol. 1972;9(3):193-197.
35. Layrisse M, Cook JD, Martinez C, et al. Food iron absorption: a comparison of vegetable and animal foods. Blood. 1969;33(3):430-443.
36. Fillebeen C, Gkouvatsos K, Fragoso G, et al. Mice are poor heme absorbers and do not require intestinal Hmox1 for dietary heme iron assimilation. Haematologica. 2015;100(9):e334-337.
37. Anderson GJ, Frazer DM, McKie AT, Vulpe CD, Smith A. Mechanisms of haem and non-haem iron absorption: lessons from inherited disorders of iron metabolism. Biometals. 2005;18(4):339-348.
38. McKie AT, Barrow D, Latunde-Dada GO, et al. An iron-regulated ferric reductase associated with the absorption of dietary iron. Science. 2001;291(5509):1755-1759.
39. Gunshin H, Starr CN, Direnzo C, et al. Cybrd1 (duodenal cytochrome b) is not necessary for dietary iron absorption in mice. Blood. 2005;106(8):2879-2883.
40. Fleming MD, Trenor CC, Su MA, et al. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet. 1997;16(4):383-386.
41. Gunshin H, Fujiwara Y, Custodio AO, Direnzo C, Robine S, Andrews NC. Slc11a2 is required for intestinal iron absorption and erythropoiesis but dispensable in placenta and liver. J Clin Invest. 2005;115(5):1258-1266.
42. Donovan A, Lima CA, Pinkus JL, et al. The iron exporter ferroportin/Slc40a1 is essential for iron homeostasis. Cell Metab. 2005;1(3):191-200.
43. Vulpe CD, Kuo YM, Murphy TL, et al. Hephaestin, a ceruloplasmin homologue implicated in intestinal iron transport, is defective in the sla mouse. Nat Genet. 1999;21(2):195-199.
149
44. Lewińska-Preis L, Jabłońska M, Fabiańska MJ, Kita A. Bioelements and mineral matter in human livers from the highly industrialized region of the Upper Silesia Coal Basin (Poland). Environ Geochem Health. 2011;33(6):595-611.
45. Goode CA, Dinh CT, Linder MC. Mechanism of copper transport and delivery in mammals: review and recent findings. Adv Exp Med Biol. 1989;258:131-144.
46. Prohaska JR, Gybina AA. Intracellular copper transport in mammals. J Nutr. 2004;134(5):1003-1006.
47. Scheiber IF, Mercer JF, Dringen R. Metabolism and functions of copper in brain. Prog Neurobiol. 2014;116:33-57.
48. Carrì MT, Ferri A, Casciati A, Celsi F, Ciriolo MR, Rotilio G. Copper-dependent oxidative stress, alteration of signal transduction and neurodegeneration in amyotrophic lateral sclerosis. Funct Neurol. 2001;16(4 Suppl):181-188.
49. Prohaska JR. Impact of copper limitation on expression and function of multicopper oxidases (ferroxidases). Adv Nutr. 2011;2(2):89-95.
50. Festa RA, Thiele DJ. Copper: an essential metal in biology. Curr Biol. 2011;21(21):R877-883.
51. Pyatskowit JW, Prohaska JR. Copper deficient rats and mice both develop anemia but only rats have lower plasma and brain iron levels. Comp Biochem Physiol C Toxicol Pharmacol. 2008;147(3):316-323.
52. Griffith DP, Liff DA, Ziegler TR, Esper GJ, Winton EF. Acquired copper deficiency: a potentially serious and preventable complication following gastric bypass surgery. Obesity (Silver Spring). 2009;17(4):827-831.
53. Hedera P, Peltier A, Fink JK, Wilcock S, London Z, Brewer GJ. Myelopolyneuropathy and pancytopenia due to copper deficiency and high zinc levels of unknown origin II. The denture cream is a primary source of excessive zinc. Neurotoxicology. 2009;30(6):996-999.
54. Levinson B, Gitschier J, Vulpe C, Whitney S, Yang S, Packman S. Are X-linked cutis laxa and Menkes disease allelic? Nat Genet. 1993;3(1):6.
55. Camakaris J, Petris MJ, Bailey L, et al. Gene amplification of the Menkes (MNK; ATP7A) P-type ATPase gene of CHO cells is associated with copper resistance and enhanced copper efflux. Hum Mol Genet. 1995;4(11):2117-2123.
56. La Fontaine S, Mercer JF. Trafficking of the copper-ATPases, ATP7A and ATP7B: role in copper homeostasis. Arch Biochem Biophys. 2007;463(2):149-167.
150
57. Lutsenko S, Barnes NL, Bartee MY, Dmitriev OY. Function and regulation of human copper-transporting ATPases. Physiol Rev. 2007;87(3):1011-1046.
58. Kim BE, Petris MJ. Phenotypic diversity of Menkes disease in mottled mice is associated with defects in localisation and trafficking of the ATP7A protein. J Med Genet. 2007;44(10):641-646.
59. Grimes A, Hearn CJ, Lockhart P, Newgreen DF, Mercer JF. Molecular basis of the brindled mouse mutant (Mo(br)): a murine model of Menkes disease. Hum Mol Genet. 1997;6(7):1037-1042.
60. Tümer Z, Møller LB. Menkes disease. Eur J Hum Genet. 2010;18(5):511-518.
61. Cao Y, Skaug MA, Andersen O, Aaseth J. Chelation therapy in intoxications with mercury, lead and copper. J Trace Elem Med Biol. 2014.
62. Barceloux DG. Copper. J Toxicol Clin Toxicol. 1999;37(2):217-230.
63. Oon S, Yap CH, Ihle BU. Acute copper toxicity following copper glycinate injection. Intern Med J. 2006;36(11):741-743.
64. James LP, Stowe CD, Argao E. Gastric injury following copper sulfate ingestion. Pediatr Emerg Care. 1999;15(6):429-431.
65. Prohaska JR. Role of copper transporters in copper homeostasis. Am J Clin Nutr. 2008;88(3):826S-829S.
66. Beinhardt S, Leiss W, Stättermayer AF, et al. Long-term outcomes of patients with Wilson disease in a large Austrian cohort. Clin Gastroenterol Hepatol. 2014;12(4):683-689.
67. Seniów J, Mroziak B, Członkowska A, Jedryka-Góral A. Self-rated emotional functioning of patients with neurological or asymptomatic form of Wilson's disease. Clin Neuropsychol. 2003;17(3):367-373.
68. Bandmann O, Weiss KH, Kaler SG. Wilson's disease and other neurological copper disorders. Lancet Neurol. 2015;14(1):103-113.
69. Itami N, Akutsu Y, Tochimaru H, Takekoshi Y. Hypercalciuria and nephrolithiasis in Wilson disease. Eur J Pediatr. 1989;149(2):145.
70. Milkiewicz P, Saksena S, Hubscher SG, Elias E. Wilson's disease with superimposed autoimmune features: report of two cases and review. J Gastroenterol Hepatol. 2000;15(5):570-574.
71. Hlubocká Z, Marecek Z, Linhart A, et al. Cardiac involvement in Wilson disease. J Inherit Metab Dis. 2002;25(4):269-277.
151
72. Wyman S, Simpson RJ, McKie AT, Sharp PA. Dcytb (Cybrd1) functions as both a ferric and a cupric reductase in vitro. FEBS Lett. 2008;582(13):1901-1906.
73. Ohgami RS, Campagna DR, McDonald A, Fleming MD. The Steap proteins are metalloreductases. Blood. 2006;108(4):1388-1394.
74. Nose Y, Kim BE, Thiele DJ. Ctr1 drives intestinal copper absorption and is essential for growth, iron metabolism, and neonatal cardiac function. Cell Metab. 2006;4(3):235-244.
75. Palumaa P, Kangur L, Voronova A, Sillard R. Metal-binding mechanism of Cox17, a copper chaperone for cytochrome c oxidase. Biochem J. 2004;382(Pt 1):307-314.
76. Larin D, Mekios C, Das K, Ross B, Yang AS, Gilliam TC. Characterization of the interaction between the Wilson and Menkes disease proteins and the cytoplasmic copper chaperone, HAH1p. J Biol Chem. 1999;274(40):28497-28504.
77. Gulec S, Collins JF. Molecular mediators governing iron-copper interactions. Annu Rev Nutr. 2014;34:95-116.
78. Musci G, Polticelli F, Bonaccorsi di Patti MC. Ceruloplasmin-ferroportin system of iron traffic in vertebrates. World J Biol Chem. 2014;5(2):204-215.
79. Hellman NE, Gitlin JD. Ceruloplasmin metabolism and function. Annu Rev Nutr. 2002;22:439-458.
80. Osaki S, Johnson DA, Frieden E. The possible significance of the ferrous oxidase activity of ceruloplasmin in normal human serum. J Biol Chem. 1966;241(12):2746-2751.
81. Harris ZL, Takahashi Y, Miyajima H, Serizawa M, MacGillivray RT, Gitlin JD. Aceruloplasminemia: molecular characterization of this disorder of iron metabolism. Proc Natl Acad Sci U S A. 1995;92(7):2539-2543.
82. Harris ZL, Durley AP, Man TK, Gitlin JD. Targeted gene disruption reveals an essential role for ceruloplasmin in cellular iron efflux. Proc Natl Acad Sci U S A. 1999;96(19):10812-10817.
83. Iolascon A, De Falco L, Beaumont C. Molecular basis of inherited microcytic anemia due to defects in iron acquisition or heme synthesis. Haematologica. 2009;94(3):395-408.
84. Loudon IS. Chlorosis, anaemia, and anorexia nervosa. Br Med J. 1980;281(6256):1669-1675.
152
85. Mendini L. Di un rimedio per l'amenorrea et di altro per la sordita ipostenica. Gazz Med Ital Prov Venete. 1862;5:36-37.
86. Fox PL. The copper-iron chronicles: the story of an intimate relationship. Biometals. 2003;16(1):9-40.
87. Hart EB, Steenbock H, Waddell J, Elvehjem CA. Iron in nutrition. VII. Copper as a supplement to iron for hemoglobin building in the rat. 1928. J Biol Chem. 2002;277(34):e22.
88. . !!! INVALID CITATION !!! {}.
89. Matak P, Zumerle S, Mastrogiannaki M, et al. Copper deficiency leads to anemia, duodenal hypoxia, upregulation of HIF-2α and altered expression of iron absorption genes in mice. PLoS One. 2013;8(3):e59538.
90. Mastrogiannaki M, Matak P, Keith B, Simon MC, Vaulont S, Peyssonnaux C. HIF-2alpha, but not HIF-1alpha, promotes iron absorption in mice. J Clin Invest. 2009;119(5):1159-1166.
91. Pourvali K, Matak P, Latunde-Dada GO, et al. Basal expression of copper transporter 1 in intestinal epithelial cells is regulated by hypoxia-inducible factor 2α. FEBS Lett. 2012;586(16):2423-2427.
92. Xie L, Collins JF. Transcriptional regulation of the Menkes copper ATPase (Atp7a) gene by hypoxia-inducible factor (HIF2{alpha}) in intestinal epithelial cells. Am J Physiol Cell Physiol. 2011;300(6):C1298-1305.
93. Arredondo M, Muñoz P, Mura CV, Nùñez MT. DMT1, a physiologically relevant apical Cu1+ transporter of intestinal cells. Am J Physiol Cell Physiol. 2003;284(6):C1525-1530.
94. Arredondo M, Mendiburo MJ, Flores S, Singleton ST, Garrick MD. Mouse divalent metal transporter 1 is a copper transporter in HEK293 cells. Biometals. 2014;27(1):115-123.
95. Jiang L, Garrick MD, Garrick LM, Zhao L, Collins JF. Divalent metal transporter 1 (Dmt1) mediates copper transport in the duodenum of iron-deficient rats and when overexpressed in iron-deprived HEK-293 cells. J Nutr. 2013;143(12):1927-1933.
96. Shawki A, Anthony SR, Nose Y, et al. Intestinal DMT1 is critical for iron absorption in the mouse but is not required for the absorption of copper or manganese. Am J Physiol Gastrointest Liver Physiol. 2015;309(8):G635-647.
97. Edgerton VR, Bryant SL, Gillespie CA, Gardner GW. Iron deficiency anemia and physical performance and activity of rats. J Nutr. 1972;102(3):381-399.
153
98. Knutson MD, Walter PB, Ames BN, Viteri FE. Both iron deficiency and daily iron supplements increase lipid peroxidation in rats. J Nutr. 2000;130(3):621-628.
99. Gao Y, Li Z, Gabrielsen JS, et al. Adipocyte iron regulates leptin and food intake. J Clin Invest. 2015;125(9):3681-3691.
100. Sherman AR, Moran PE. Copper metabolism in iron-deficient maternal and neonatal rats. J Nutr. 1984;114(2):298-306.
101. Yokoi K, Kimura M, Itokawa Y. Effect of dietary iron deficiency on mineral levels in tissues of rats. Biol Trace Elem Res. 1991;29(3):257-265.
102. Ranganathan PN, Lu Y, Jiang L, Kim C, Collins JF. Serum ceruloplasmin protein expression and activity increases in iron-deficient rats and is further enhanced by higher dietary copper intake. Blood. 2011;118(11):3146-3153.
103. Ece A, Uyanik BS, Işcan A, Ertan P, Yiğitoğlu MR. Increased serum copper and decreased serum zinc levels in children with iron deficiency anemia. Biol Trace Elem Res. 1997;59(1-3):31-39.
104. Collins JF, Franck CA, Kowdley KV, Ghishan FK. Identification of differentially expressed genes in response to dietary iron deprivation in rat duodenum. Am J Physiol Gastrointest Liver Physiol. 2005;288(5):G964-971.
105. Ravia JJ, Stephen RM, Ghishan FK, Collins JF. Menkes Copper ATPase (Atp7a) is a novel metal-responsive gene in rat duodenum, and immunoreactive protein is present on brush-border and basolateral membrane domains. J Biol Chem. 2005;280(43):36221-36227.
106. Miyajima H, Takahashi Y, Kamata T, Shimizu H, Sakai N, Gitlin JD. Use of desferrioxamine in the treatment of aceruloplasminemia. Ann Neurol. 1997;41(3):404-407.
107. Oates PS, Morgan EH. Effects of dietary iron loading with carbonyl iron and of iron depletion on intestinal growth, morphology, and expression of transferrin receptor in the rat. Anat Rec. 1996;246(3):364-371.
108. Yu F, Hao S, Yang B, et al. Insulin resistance due to dietary iron overload disrupts inner hair cell ribbon synapse plasticity in male mice. Neurosci Lett. 2015;597:183-188.
109. Dongiovanni P, Ruscica M, Rametta R, et al. Dietary iron overload induces visceral adipose tissue insulin resistance. Am J Pathol. 2013;182(6):2254-2263.
110. Lemmer ER, Gelderblom WC, Shephard EG, et al. The effects of dietary iron overload on fumonisin B1-induced cancer promotion in the rat liver. Cancer Lett. 1999;146(2):207-215.
154
111. Wang GS, Eriksson LC, Xia L, Olsson J, Stål P. Dietary iron overload inhibits carbon tetrachloride-induced promotion in chemical hepatocarcinogenesis: effects on cell proliferation, apoptosis, and antioxidation. J Hepatol. 1999;30(4):689-698.
112. Nam H, Knutson MD. Effect of dietary iron deficiency and overload on the expression of ZIP metal-ion transporters in rat liver. Biometals. 2012;25(1):115-124.
113. Mackinnon M, Clayton C, Plummer J, et al. Iron overload facilitates hepatic fibrosis in the rat alcohol/low-dose carbon tetrachloride model. Hepatology. 1995;21(4):1083-1088.
114. Coffey R, Nam H, Knutson MD. Microarray analysis of rat pancreas reveals altered expression of Alox15 and regenerating islet-derived genes in response to iron deficiency and overload. PLoS One. 2014;9(1):e86019.
115. Klevay LM. Iron overload can induce mild copper deficiency. J Trace Elem Med Biol. 2001;14(4):237-240.
116. Reeves PG, DeMars LC. Copper deficiency reduces iron absorption and biological half-life in male rats. J Nutr. 2004;134(8):1953-1957.
117. Reeves PG, Demars LC, Johnson WT, Lukaski HC. Dietary copper deficiency reduces iron absorption and duodenal enterocyte hephaestin protein in male and female rats. J Nutr. 2005;135(1):92-98.
118. Reeves PG, Demars LC. Repletion of copper-deficient rats with dietary copper restores duodenal hephaestin protein and iron absorption. Exp Biol Med (Maywood). 2005;230(5):320-325.
119. Reeves PG, DeMars LC. Signs of iron deficiency in copper-deficient rats are not affected by iron supplements administered by diet or by injection. J Nutr Biochem. 2006;17(9):635-642.
120. Broderius M, Mostad E, Prohaska JR. Suppressed hepcidin expression correlates with hypotransferrinemia in copper-deficient rat pups but not dams. Genes Nutr. 2012;7(3):405-414.
121. Pyatskowit JW, Prohaska JR. Multiple mechanisms account for lower plasma iron in young copper deficient rats. Biometals. 2008;21(3):343-352.
122. Jenkitkasemwong S, Broderius M, Nam H, Prohaska JR, Knutson MD. Anemic copper-deficient rats, but not mice, display low hepcidin expression and high ferroportin levels. J Nutr. 2010;140(4):723-730.
123. Prohaska JR, Broderius M. Copper deficiency has minimal impact on ferroportin expression or function. Biometals. 2012;25(4):633-642.
155
124. Chen H, Huang G, Su T, et al. Decreased hephaestin activity in the intestine of copper-deficient mice causes systemic iron deficiency. J Nutr. 2006;136(5):1236-1241.
125. Cherukuri S, Potla R, Sarkar J, Nurko S, Harris ZL, Fox PL. Unexpected role of ceruloplasmin in intestinal iron absorption. Cell Metab. 2005;2(5):309-319.
126. Reeves PG, Nielsen FH, Fahey GC. AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet. J Nutr. 1993;123(11):1939-1951.
127. Reeves PG, Rossow KL, Lindlauf J. Development and testing of the AIN-93 purified diets for rodents: results on growth, kidney calcification and bone mineralization in rats and mice. J Nutr. 1993;123(11):1923-1931.
128. Bacon BR, Brittenham GM, Tavill AS, McLaren CE, Park CH, Recknagel RO. Hepatic lipid peroxidation in vivo in rats with chronic dietary iron overload is dependent on hepatic iron concentration. Trans Assoc Am Physicians. 1983;96:146-154.
129. Park CH, Bacon BR, Brittenham GM, Tavill AS. Pathology of dietary carbonyl iron overload in rats. Lab Invest. 1987;57(5):555-563.
130. Torrance JD, Bothwell TH. A simple technique for measuring storage iron concentrations in formalinised liver samples. S Afr J Med Sci. 1968;33(1):9-11.
131. Young DS, Hicks JM. Method for the Automatic Determination of Serum Iron. J Clin Pathol. 1965;18:98-102.
132. Ramsay WN. The determination of the total iron-binding capacity of serum. Clin Chim Acta. 1957;2(3):221-226.
133. Babson AL, Kleinman NM. A source of error in an autoanalyzer determination of serum iron. Clin Chem. 1967;13(2):163-166.
134. Roeser HP, Lee GR, Nacht S, Cartwright GE. The role of ceruloplasmin in iron metabolism. J Clin Invest. 1970;49(12):2408-2417.
135. Sunderman FW, Nomoto S. Measurement of human serum ceruloplasmin by its p-phenylenediamine oxidase activity. Clin Chem. 1970;16(11):903-910.
136. US Environmental Protection Agency. Acid Digestion of Sludges, Solids and Soils. Cincinnati, OH: In SW-846 Pt 1 Office of Solid and Hazardous Wastes; 1996.
137. Chomczynski P. Reagents and methods for isolation of purified RNA: Google Patents; 2010.
156
138. Collins JF, Hu Z, Ranganathan PN, et al. Induction of arachidonate 12-lipoxygenase (Alox15) in intestine of iron-deficient rats correlates with the production of biologically active lipid mediators. Am J Physiol Gastrointest Liver Physiol. 2008;294(4):G948-962.
139. Ranganathan PN, Lu Y, Fuqua BK, Collins JF. Immunoreactive hephaestin and ferroxidase activity are present in the cytosolic fraction of rat enterocytes. Biometals. 2012;25(4):687-695.
140. Gulec S, Collins JF. Investigation of iron metabolism in mice expressing a mutant Menke's copper transporting ATPase (Atp7a) protein with diminished activity (Brindled; Mo (Br) (/y) ). PLoS One. 2013;8(6):e66010.
141. Xie L, Collins JF. Transcription factors Sp1 and Hif2α mediate induction of the copper-transporting ATPase (Atp7a) gene in intestinal epithelial cells during hypoxia. J Biol Chem. 2013;288(33):23943-23952.
142. Kautz L, Jung G, Valore EV, Rivella S, Nemeth E, Ganz T. Identification of erythroferrone as an erythroid regulator of iron metabolism. Nat Genet. 2014;46(7):678-684.
143. Kautz L, Jung G, Nemeth E, Ganz T. Erythroferrone contributes to recovery from anemia of inflammation. Blood. 2014;124(16):2569-2574.
144. Gehrke SG, Kulaksiz H, Herrmann T, et al. Expression of hepcidin in hereditary hemochromatosis: evidence for a regulation in response to the serum transferrin saturation and to non-transferrin-bound iron. Blood. 2003;102(1):371-376.
145. Wilkins SJ, Frazer DM, Millard KN, McLaren GD, Anderson GJ. Iron metabolism in the hemoglobin-deficit mouse: correlation of diferric transferrin with hepcidin expression. Blood. 2006;107(4):1659-1664.
146. Linder MC, Houle PA, Isaacs E, Moor JR, Scott LE. Copper regulation of ceruloplasmin in copper-deficient rats. Enzyme. 1979;24(1):23-35.
147. Sherman AR, Tissue NT. Tissue iron, copper and zinc levels in offspring of iron-sufficient and iron-deficient rats. J Nutr. 1981;111(2):266-275.
148. Merza H, Sood N, Sood R. Idiopathic hyperzincemia with associated copper deficiency anemia: a diagnostic dilemma. Clin Case Rep. 2015;3(10):819-822.
149. Prasad R, Hawthorne B, Durai D, McDowell I. Zinc in denture adhesive: a rare cause of copper deficiency in a patient on home parenteral nutrition. BMJ Case Rep. 2015;2015.
150. Semenza GL, Wang GL. A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation. Mol Cell Biol. 1992;12(12):5447-5454.
157
151. Wang GL, Semenza GL. Desferrioxamine induces erythropoietin gene expression and hypoxia-inducible factor 1 DNA-binding activity: implications for models of hypoxia signal transduction. Blood. 1993;82(12):3610-3615.
152. Floege J. Phosphate binders in chronic kidney disease: a systematic review of recent data. J Nephrol. 2016;29(3):329-340.
153. Delmez JA, Slatopolsky E. Hyperphosphatemia: its consequences and treatment in patients with chronic renal disease. Am J Kidney Dis. 1992;19(4):303-317.
154. Matsuo A, Iida A, Tanimoto M, Matsushita M, Miyamoto K. The utility of the phosphate binder, ferric citrate hydrate (JTT-751), about phosphorus absorption-reducing effect in normal rats. Ren Fail. 2014;36(8):1291-1297.
155. Pai AB, Jang SM, Wegrzyn N. Iron-based phosphate binders--a new element in management of hyperphosphatemia. Expert Opin Drug Metab Toxicol. 2016;12(1):115-127.
156. Van Buren PN, Lewis JB, Dwyer JP, et al. The Phosphate Binder Ferric Citrate and Mineral Metabolism and Inflammatory Markers in Maintenance Dialysis Patients: Results From Prespecified Analyses of a Randomized Clinical Trial. Am J Kidney Dis. 2015;66(3):479-488.
157. Oates PS, Jeffrey GP, Basclain KA, Thomas C, Morgan EH. Iron excretion in iron-overloaded rats following the change from an iron-loaded to an iron-deficient diet. J Gastroenterol Hepatol. 2000;15(6):665-674.
158. Mandinov L, Mandinova A, Kyurkchiev S, et al. Copper chelation represses the vascular response to injury. Proc Natl Acad Sci U S A. 2003;100(11):6700-6705.
159. Prohaska JR, Heller LJ. Mechanical properties of the copper-deficient rat heart. J Nutr. 1982;112(11):2142-2150.
160. Nemeth E. Iron regulation and erythropoiesis. Curr Opin Hematol. 2008;15(3):169-175.
161. Frazer DM, Anderson GJ. Iron imports. I. Intestinal iron absorption and its regulation. Am J Physiol Gastrointest Liver Physiol. 2005;289(4):G631-635.
162. Fuqua BK, Vulpe CD, Anderson GJ. Intestinal iron absorption. J Trace Elem Med Biol. 2012;26(2-3):115-119.
163. Mackenzie B, Garrick MD. Iron Imports. II. Iron uptake at the apical membrane in the intestine. Am J Physiol Gastrointest Liver Physiol. 2005;289(6):G981-986.
164. Shah YM, Matsubara T, Ito S, Yim SH, Gonzalez FJ. Intestinal hypoxia-inducible transcription factors are essential for iron absorption following iron deficiency. Cell Metab. 2009;9(2):152-164.
158
165. Taylor M, Qu A, Anderson ER, et al. Hypoxia-inducible factor-2α mediates the adaptive increase of intestinal ferroportin during iron deficiency in mice. Gastroenterology. 2011;140(7):2044-2055.
166. Collins JF, Prohaska JR, Knutson MD. Metabolic crossroads of iron and copper. Nutr Rev. 2010;68(3):133-147.
167. Ranganathan PN, Lu Y, Fuqua BK, Collins JF. Discovery of a cytosolic/soluble ferroxidase in rodent enterocytes. Proc Natl Acad Sci U S A. 2012;109(9):3564-3569.
168. Gulec S, Collins JF. Silencing the Menkes copper-transporting ATPase (Atp7a) gene in rat intestinal epithelial (IEC-6) cells increases iron flux via transcriptional induction of ferroportin 1 (Fpn1). J Nutr. 2014;144(1):12-19.
169. Wang Y, Zhu S, Hodgkinson V, et al. Maternofetal and neonatal copper requirements revealed by enterocyte-specific deletion of the Menkes disease protein. Am J Physiol Gastrointest Liver Physiol. 2012;303(11):G1236-1244.
170. Goodnough LT, Skikne B, Brugnara C. Erythropoietin, iron, and erythropoiesis. Blood. 2000;96(3):823-833.
171. Gabrilove J. Overview: erythropoiesis, anemia, and the impact of erythropoietin. Semin Hematol. 2000;37(4 Suppl 6):1-3.
172. Bieber E. Erythropoietin, the biology of erythropoiesis and epoetin alfa. An overview. J Reprod Med. 2001;46(5 Suppl):521-530.
173. Mukhopadhyay CK, Mazumder B, Fox PL. Role of hypoxia-inducible factor-1 in transcriptional activation of ceruloplasmin by iron deficiency. J Biol Chem. 2000;275(28):21048-21054.
174. Fisher DJ. Oxygenation and metabolism in the developing heart. Semin Perinatol. 1984;8(3):217-225.
175. Lopaschuk GD, Spafford MA, Marsh DR. Glycolysis is predominant source of myocardial ATP production immediately after birth. Am J Physiol. 1991;261(6 Pt 2):H1698-1705.
176. Moalic JM, Charlemagne D, Mansier P, Chevalier B, Swynghedauw B. Cardiac hypertrophy and failure--a disease of adaptation. Modifications in membrane proteins provide a molecular basis for arrhythmogenicity. Circulation. 1993;87(5 Suppl):IV21-26.
177. Ha JH, Shil PK, Zhu P, Gu L, Li Q, Chung S. Ocular inflammation and endoplasmic reticulum stress are attenuated by supplementation with grape polyphenols in human retinal pigmented epithelium cells and in C57BL/6 mice. J Nutr. 2014;144(6):799-806.
159
178. Park SH, Park TS, Cha YS. Grape seed extract (Vitis vinifera) partially reverses high fat diet-induced obesity in C57BL/6J mice. Nutr Res Pract. 2008;2(4):227-233.
179. Banini AE, Boyd LC, Allen JC, Allen HG, Sauls DL. Muscadine grape products intake, diet and blood constituents of non-diabetic and type 2 diabetic subjects. Nutrition. 2006;22(11-12):1137-1145.
180. Terra X, Montagut G, Bustos M, et al. Grape-seed procyanidins prevent low-grade inflammation by modulating cytokine expression in rats fed a high-fat diet. J Nutr Biochem. 2009;20(3):210-218.
181. Terra X, Pallarés V, Ardèvol A, et al. Modulatory effect of grape-seed procyanidins on local and systemic inflammation in diet-induced obesity rats. J Nutr Biochem. 2011;22(4):380-387.
182. Hudson TS, Hartle DK, Hursting SD, et al. Inhibition of prostate cancer growth by muscadine grape skin extract and resveratrol through distinct mechanisms. Cancer Res. 2007;67(17):8396-8405.
183. Yi W, Fischer J, Akoh CC. Study of anticancer activities of muscadine grape phenolics in vitro. J Agric Food Chem. 2005;53(22):8804-8812.
184. Gourineni V, Shay NF, Chung S, Sandhu AK, Gu L. Muscadine grape (Vitis rotundifolia) and wine phytochemicals prevented obesity-associated metabolic complications in C57BL/6J mice. J Agric Food Chem. 2012;60(31):7674-7681.
185. Bharathselvi M, Biswas J, Selvi R, et al. Increased homocysteine, homocysteine-thiolactone, protein homocysteinylation and oxidative stress in the circulation of patients with Eales' disease. Ann Clin Biochem. 2013;50(Pt 4):330-338.
186. El-Remessy AB, Franklin T, Ghaley N, et al. Diabetes-induced superoxide anion and breakdown of the blood-retinal barrier: role of the VEGF/uPAR pathway. PLoS One. 2013;8(8):e71868.
187. Brantley MA, Osborn MP, Sanders BJ, et al. Plasma biomarkers of oxidative stress and genetic variants in age-related macular degeneration. Am J Ophthalmol. 2012;153(3):460-467.e461.
188. Khurana RN, Parikh JG, Saraswathy S, Wu GS, Rao NA. Mitochondrial oxidative DNA damage in experimental autoimmune uveitis. Invest Ophthalmol Vis Sci. 2008;49(8):3299-3304.
189. Tomić M, Ljubić S, Kastelan S. The role of inflammation and endothelial dysfunction in the pathogenesis of diabetic retinopathy. Coll Antropol. 2013;37 Suppl 1:51-57.
160
190. Yao J, Liu X, Yang Q, et al. Proteomic analysis of the aqueous humor in patients with wet age-related macular degeneration. Proteomics Clin Appl. 2013;7(7-8):550-560.
191. Zhong Y, Li J, Chen Y, Wang JJ, Ratan R, Zhang SX. Activation of endoplasmic reticulum stress by hyperglycemia is essential for Müller cell-derived inflammatory cytokine production in diabetes. Diabetes. 2012;61(2):492-504.
192. Luo J, Zhao L, Chen AY, et al. TCF7L2 variation and proliferative diabetic retinopathy. Diabetes. 2013;62(7):2613-2617.
193. Li J, Wang JJ, Yu Q, Wang M, Zhang SX. Endoplasmic reticulum stress is implicated in retinal inflammation and diabetic retinopathy. FEBS Lett. 2009;583(9):1521-1527.
194. Salminen A, Kauppinen A, Hyttinen JM, Toropainen E, Kaarniranta K. Endoplasmic reticulum stress in age-related macular degeneration: trigger for neovascularization. Mol Med. 2010;16(11-12):535-542.
195. Fong DS, Aiello LP, Ferris FL, Klein R. Diabetic retinopathy. Diabetes Care. 2004;27(10):2540-2553.
196. Sin HP, Liu DT, Lam DS. Lifestyle modification, nutritional and vitamins supplements for age-related macular degeneration. Acta Ophthalmol. 2013;91(1):6-11.
197. Lee CT, Gayton EL, Beulens JW, Flanagan DW, Adler AI. Micronutrients and diabetic retinopathy a systematic review. Ophthalmology. 2010;117(1):71-78.
198. Millen AE, Klein R, Folsom AR, Stevens J, Palta M, Mares JA. Relation between intake of vitamins C and E and risk of diabetic retinopathy in the Atherosclerosis Risk in Communities Study. Am J Clin Nutr. 2004;79(5):865-873.
199. Kim YH, Kim YS, Roh GS, Choi WS, Cho GJ. Resveratrol blocks diabetes-induced early vascular lesions and vascular endothelial growth factor induction in mouse retinas. Acta Ophthalmol. 2012;90(1):e31-37.
200. Kubota S, Kurihara T, Mochimaru H, et al. Prevention of ocular inflammation in endotoxin-induced uveitis with resveratrol by inhibiting oxidative damage and nuclear factor-kappaB activation. Invest Ophthalmol Vis Sci. 2009;50(7):3512-3519.
201. Yar AS, Menevse S, Dogan I, et al. Investigation of ocular neovascularization-related genes and oxidative stress in diabetic rat eye tissues after resveratrol treatment. J Med Food. 2012;15(4):391-398.
161
202. Suryanarayana P, Saraswat M, Mrudula T, Krishna TP, Krishnaswamy K, Reddy GB. Curcumin and turmeric delay streptozotocin-induced diabetic cataract in rats. Invest Ophthalmol Vis Sci. 2005;46(6):2092-2099.
203. Gupta SK, Kumar B, Nag TC, et al. Curcumin prevents experimental diabetic retinopathy in rats through its hypoglycemic, antioxidant, and anti-inflammatory mechanisms. J Ocul Pharmacol Ther. 2011;27(2):123-130.
204. Larrosa M, García-Conesa MT, Espín JC, Tomás-Barberán FA. Ellagitannins, ellagic acid and vascular health. Mol Aspects Med. 2010;31(6):513-539.
205. Muthenna P, Akileshwari C, Reddy GB. Ellagic acid, a new antiglycating agent: its inhibition of Nϵ-(carboxymethyl)lysine. Biochem J. 2012;442(1):221-230.
206. Sandhu AK, Gu L. Antioxidant capacity, phenolic content, and profiling of phenolic compounds in the seeds, skin, and pulp of Vitis rotundifolia (Muscadine Grapes) As determined by HPLC-DAD-ESI-MS(n). J Agric Food Chem. 2010;58(8):4681-4692.
207. Kaarniranta K, Salminen A. NF-kappaB signaling as a putative target for omega-3 metabolites in the prevention of age-related macular degeneration (AMD). Exp Gerontol. 2009;44(11):685-688.
208. Trinh L, Brignole-Baudouin F, Labbé A, Raphaël M, Bourges JL, Baudouin C. The corneal endothelium in an endotoxin-induced uveitis model: correlation between in vivo confocal microscopy and immunohistochemistry. Mol Vis. 2008;14:1149-1156.
209. Xu H, Forrester JV, Liversidge J, Crane IJ. Leukocyte trafficking in experimental autoimmune uveitis: breakdown of blood-retinal barrier and upregulation of cellular adhesion molecules. Invest Ophthalmol Vis Sci. 2003;44(1):226-234.
210. Aveleira CA, Lin CM, Abcouwer SF, Ambrósio AF, Antonetti DA. TNF-α signals through PKCζ/NF-κB to alter the tight junction complex and increase retinal endothelial cell permeability. Diabetes. 2010;59(11):2872-2882.
211. Joussen AM, Poulaki V, Le ML, et al. A central role for inflammation in the pathogenesis of diabetic retinopathy. FASEB J. 2004;18(12):1450-1452.
212. Peng S, Gan G, Rao VS, Adelman RA, Rizzolo LJ. Effects of proinflammatory cytokines on the claudin-19 rich tight junctions of human retinal pigment epithelium. Invest Ophthalmol Vis Sci. 2012;53(8):5016-5028.
213. Vincent JA, Mohr S. Inhibition of caspase-1/interleukin-1beta signaling prevents degeneration of retinal capillaries in diabetes and galactosemia. Diabetes. 2007;56(1):224-230.
162
214. Abcouwer SF, Marjon PL, Loper RK, Vander Jagt DL. Response of VEGF expression to amino acid deprivation and inducers of endoplasmic reticulum stress. Invest Ophthalmol Vis Sci. 2002;43(8):2791-2798.
215. Yoshikawa T, Ogata N, Izuta H, Shimazawa M, Hara H, Takahashi K. Increased expression of tight junctions in ARPE-19 cells under endoplasmic reticulum stress. Curr Eye Res. 2011;36(12):1153-1163.
216. Treiman M, Caspersen C, Christensen SB. A tool coming of age: thapsigargin as an inhibitor of sarco-endoplasmic reticulum Ca(2+)-ATPases. Trends Pharmacol Sci. 1998;19(4):131-135.
217. Galehdar Z, Swan P, Fuerth B, Callaghan SM, Park DS, Cregan SP. Neuronal apoptosis induced by endoplasmic reticulum stress is regulated by ATF4-CHOP-mediated induction of the Bcl-2 homology 3-only member PUMA. J Neurosci. 2010;30(50):16938-16948.
218. Tang J, Kern TS. Inflammation in diabetic retinopathy. Prog Retin Eye Res. 2011;30(5):343-358.
219. Vagaja NN, Binz N, McLenachan S, Rakoczy EP, McMenamin PG. Influence of endotoxin-mediated retinal inflammation on phenotype of diabetic retinopathy in Ins2 Akita mice. Br J Ophthalmol. 2013;97(10):1343-1350.
220. Cao S, Ko A, Partanen M, et al. Relationship between systemic cytokines and complement factor H Y402H polymorphism in patients with dry age-related macular degeneration. Am J Ophthalmol. 2013;156(6):1176-1183.
221. Forrester JV, Klaska IP, Yu T, Kuffova L. Uveitis in mouse and man. Int Rev Immunol. 2013;32(1):76-96.
222. Demircan N, Safran BG, Soylu M, Ozcan AA, Sizmaz S. Determination of vitreous interleukin-1 (IL-1) and tumour necrosis factor (TNF) levels in proliferative diabetic retinopathy. Eye (Lond). 2006;20(12):1366-1369.
223. Cousins SW, Espinosa-Heidmann DG, Csaky KG. Monocyte activation in patients with age-related macular degeneration: a biomarker of risk for choroidal neovascularization? Arch Ophthalmol. 2004;122(7):1013-1018.
224. Takase H, Futagami Y, Yoshida T, et al. Cytokine profile in aqueous humor and sera of patients with infectious or noninfectious uveitis. Invest Ophthalmol Vis Sci. 2006;47(4):1557-1561.
225. Chibber R, Ben-Mahmud BM, Chibber S, Kohner EM. Leukocytes in diabetic retinopathy. Curr Diabetes Rev. 2007;3(1):3-14.
163
226. Ghosh S, May MJ, Kopp EB. NF-kappa B and Rel proteins: evolutionarily conserved mediators of immune responses. Annu Rev Immunol. 1998;16:225-260.
227. Kumar A, Takada Y, Boriek AM, Aggarwal BB. Nuclear factor-kappaB: its role in health and disease. J Mol Med (Berl). 2004;82(7):434-448.
228. Gilger BC, Abarca EM, Salmon JH, Patel S. Treatment of acute posterior uveitis in a porcine model by injection of triamcinolone acetonide into the suprachoroidal space using microneedles. Invest Ophthalmol Vis Sci. 2013;54(4):2483-2492.
229. Denniston AK, Dick AD. Systemic therapies for inflammatory eye disease: past, present and future. BMC Ophthalmol. 2013;13:18.
230. Simó R, Villarroel M, Corraliza L, Hernández C, Garcia-Ramírez M. The retinal pigment epithelium: something more than a constituent of the blood-retinal barrier--implications for the pathogenesis of diabetic retinopathy. J Biomed Biotechnol. 2010;2010:190724.
231. Shirasawa M, Sonoda S, Terasaki H, et al. TNF-α disrupts morphologic and functional barrier properties of polarized retinal pigment epithelium. Exp Eye Res. 2013;110:59-69.
164
BIOGRAPHICAL SKETCH
Jung-Heun Ha was born in Incheon, Korea. He entered the Department of
Biotechnology and Food Technology, Handong University in 1998 and received the
Bachelor of Engineering in bioscience and food technology (minor: computer science)
from Handong University in 2002. He attended the Master of Life Science, Handong
University and graduated in 2004 in Dr. Myoung-Sool Do’s lab. In 2004, he went to
Rowett Research Institute, Aberdeen, Scotland as a visiting scientist and joined to Dr.
Vernon Rayner’s lab.
In 2005, he started industrial works in Korea Institute of Toxicology, Daejeon,
Korea. In this period, he worked as pharmacokinetics study director and quality
assurance personnel. Also, he accredited as registered quality assurance professional
on good laboratory practice from US and Korean society of Quality Assurance. Overall
his career was highly evaluated and Minister of Education awarded Science and
Technology Award.
In 2011, he was accepted as a Ph.D. student in nutritional science at Food
Science and Human Nutrition (FSHN) Department, University of Florida and he joined
Dr. Soonkyu Chung’s lab to commence his Ph.D. degree in nutritional sciences. He
started iron and copper interactions studies from 2014 in Dr. James F. Collins’ lab and
received his Ph.D. from the University of Florida in the summer of 2016.