Jour

nal o

f Cel

l Sci

ence

RESEARCH ARTICLE

Rassf5 and Ndr kinases regulate neuronal polarity through Par3phosphorylation in a novel pathway

Rui Yang1,*, Eryan Kong1,`,§, Jing Jin1,§, Alexander Hergovich2 and Andreas W. Puschel1,3,"

ABSTRACT

The morphology and polarized growth of cells depend on pathways

that control the asymmetric distribution of regulatory factors. The

evolutionarily conserved Ndr kinases play important roles in cell

polarity and morphogenesis in yeast and invertebrates but it is

unclear whether they perform a similar function in mammalian cells.

Here, we analyze the function of mammalian Ndr1 and Ndr2 (also

known as STK38 or STK38L, respectively) in the establishment of

polarity in neurons. We show that they act downstream of the tumor

suppressor Rassf5 and upstream of the polarity protein Par3 (also

known as PARD3). Rassf5 and Ndr1 or Ndr2 are required during the

polarization of hippocampal neurons to prevent the formation of

supernumerary axons. Mechanistically, the Ndr kinases act by

phosphorylating Par3 at Ser383 to inhibit its interaction with

dynein, thereby polarizing the distribution of Par3 and reinforcing

axon specification. Our results identify a novel Rassf5–Ndr–Par3

signaling cascade that regulates the transport of Par3 during the

establishment of neuronal polarity. Their role in neuronal polarity

suggests that Ndr kinases perform a conserved function as

regulators of cell polarity.

KEY WORDS: Cell polarity, Axon formation, Ndr kinases, Par

INTRODUCTIONCell size and morphology are controlled by conserved pathways

that regulate growth, cell cycle and the polarized distributionof molecules. The nuclear Dbf2-related (Ndr) kinases act ascomponents of one of these essential pathways and are conserved

from yeast to human (Hergovich et al., 2006b; Yu and Guan,2013). Ndr kinases play important roles in cell polarity andmorphogenesis in yeast (Hergovich et al., 2006b), but theirfunction in mammalian cells is less well studied. Mammalian

Ndr1 (also known as STK38) and Ndr2 (also known as STK38L)share a conserved kinase domain with Drosophila Warts andmammalian Large tumor suppressor (Lats) 1 and 2 (Hergovich

et al., 2006a; Hergovich et al., 2006b; Yu and Guan, 2013). TheLats/Warts kinases are central components of the Hippo signalingpathway, which controls cell growth and organ size by promoting

cell death and differentiation and inhibiting proliferation (Harveyand Tapon, 2007; Pan, 2007; Yu and Guan, 2013; Zhao et al.,2011). In the mammalian Hippo pathway, Mst1 and Mst2 (also

known as STK4 and STK3, respectively), the homologs ofDrosophila Hippo, together with Mob1, activate Lats1 and Lats2,which phosphorylate the transcriptional regulators YAP andTAZ. Like the Lats kinases, Ndr1 and Ndr2 are activated

by interaction with Mob1 and by Mst-kinase-mediatedphosphorylation at conserved residues in their hydrophobicmotif (T444 and T442, respectively) (Bichsel et al., 2004;

Hergovich, 2011; Hergovich et al., 2009; Stegert et al., 2005;Stegert et al., 2004; Vichalkovski et al., 2008). Less wellunderstood is the regulation of Mst kinases themselves, which

depends not only on kinases but also on scaffolding proteins likethe tumor suppressor proteins Ras-associated domain family 1(Rassf1) and Rassf5 (Calvisi et al., 2006; Harvey and Tapon,2007; Hesson et al., 2003; Hwang et al., 2007; Khokhlatchev

et al., 2002; Pan, 2007; Praskova et al., 2004; Scheel andHofmann, 2003; Zhao et al., 2011).

Ndr1 and Ndr2 show similar substrate specificity and appear toact redundantly as suggested by the phenotype of knockout mice(Cornils et al., 2010; Hergovich et al., 2006a). The Drosophila and

Caenorhabditis elegans Ndr homologs Tricornered and SAX-1 areinvolved in patterning dendrites (Emoto et al., 2004; Emoto et al.,2006; Gallegos and Bargmann, 2004; He et al., 2005). C. elegans

SAX-1 also regulates neurite initiation but a similar function hasnot been reported for the Drosophila Tricornered or mammalianNdr kinases thus far (Zallen et al., 2000). Mammalian Ndr kinases

have been implicated in the regulation of centrosome duplicationand in dendrite arborization and spine formation during neuronaldevelopment (Hergovich et al., 2007; Ultanir et al., 2012).

A crucial step in neuronal differentiation is the transition froman unpolarized neuron with multiple short neurites to a polarizedneuron with a single axon (Barnes and Polleux, 2009). At the

molecular level, this establishment of neuronal polarity involvesan asymmetric distribution of polarity factors. Elucidating howthis asymmetric distribution is achieved is, therefore, essential to

the understanding of axon formation. Hippocampal neurons gothrough five stages of differentiation (Banker and Cowan, 1977;Dotti et al., 1988). Stage 2 neurons are unpolarized and have

several minor neurites of similar length that potentially all canbecome an axon. Neuronal polarity is established during thetransition from stage 2 to stage 3, when one of the neurites isselected as the axon and elongates rapidly. The remaining

neurites begin to differentiate into dendrites at stage 4.Several signaling cascades that direct the establishment ofneuronal polarity have been identified (Arimura and Kaibuchi,

2007). One key pathway depends on the sequential activity ofphosphatidylinositol 3-kinase and the GTPases Rap1 and Cdc42that act through the Par polarity complex (Garvalov et al., 2007;

Schwamborn and Puschel, 2004). This complex is formed by

1Institut fur Molekulare Zellbiologie, Westfalische Wilhelms-Universitat Munster,Schloßplatz 5, D-48149 Munster, Germany. 2UCL Cancer Institute, UniversityCollege London, London WC1E 6BT, UK. 3Cells-in-Motion Cluster of Excellence,University of Munster, D-48149 Munster, Germany.*Present address: Jungers Center for Neurosciences Research, Oregon Healthand Science University, Portland, OR 97239, USA`Present address: Department of Neurophysiology and Neuropharmacology,Medical University of Vienna, Vienna 1090, Austria.§These authors contributed equally to this work

"Author for correspondence (apuschel@uni-muenster.de)

Received 20 November 2013; Accepted 2 June 2014

� 2014. Published by The Company of Biologists Ltd | Journal of Cell Science (2014) 127, 3463–3476 doi:10.1242/jcs.146696

3463

Jour

nal o

f Cel

l Sci

ence

Partition defective 3 (Par3, also known as PARD3), Par6 (alsoknown as PARD6) and atypical protein kinase C (aPKC) and is

required for polarity not only in neurons but also many othercell types (Arimura and Kaibuchi, 2007; Jan and Jan, 2001;Kemphues, 2000; Khazaei and Puschel, 2009; Ohno, 2001; Shiet al., 2003). The function of Par3 depends on its specific

subcellular localization; it is present in all neurites at stage 2 butbecomes restricted to the axon at stage 3 (Schwamborn andPuschel, 2004; Shi et al., 2003). Disruption of Par3 localization

by interfering with the kinesin-2-dependent transport of Par3causes polarity defects in hippocampal neurons, showing that therestricted localization of Par3 to the axon is essential for neuronal

polarity (Funahashi et al., 2013; Nishimura et al., 2004).Here, we investigate the function of Ndr1 and Ndr2 in axon

formation and show that they act in a novel signaling pathway

that is required to polarize the distribution of Par3. Rassf5 actsupstream of the Ndr kinases and stimulates their activity. The lossof Rassf5 or simultaneous suppression of Ndr1 and 2 disruptsneuronal polarity and induces the formation of supernumerary

axons. Ndr1 and Ndr2 regulate the distribution of Par3 byphosphorylating it at Ser383. This phosphorylation blocks itsinteraction with dynein light intermediate chain 2 (Dlic2, also

known as DYNC1LI2) and thereby facilitates the asymmetriclocalization of Par3. By polarizing the distribution of Par3, theRassf5–Ndr pathway prevents the formation of supernumerary

axons.

RESULTSNdr kinases are required for neuronal polarityStaining with an antibody recognizing the conserved C-terminalregion of both Ndr1 and Ndr2 (Hergovich et al., 2007) revealedNdr1/2 immunoreactivity in all neurites of unpolarized neurons

(Fig. 1A). After polarization, Ndr kinases were detectable mainlyin the axon, and only weak signals were present in minor neurites(Fig. 1A). To analyze the function of Ndr, hippocampal neurons

were transfected at 0 days in vitro (DIV) with vectors for short-hairpin RNAs (shRNAs) that efficiently suppress Ndr1 or Ndr2(Fig. 1B). Neurons were stained with antibody against Tau-1

(also known as MAPT) as an axonal marker and with antibodyagainst MAP2 as a dendritic marker at 3 DIV, and the effect onneuronal polarity was analyzed by quantifying the number ofneurons without an axon, with a single axon or with multiple

axons (Fig. 1C,D). When Ndr1 or Ndr2 were suppressedindividually, no effect on the formation of axons was detected(data not shown). However, simultaneous knockdown of both

Ndr1 and Ndr2 disrupted neuronal polarity and resulted in theformation of multiple Tau-1-positive axons. The percentageof neurons with a single axon was reduced from 7462%

(mean6s.e.m.) in controls to 5062% after knockdown ofboth Ndr1 and Ndr2, whereas the proportion of neurons withsupernumerary axons increased from 2362% to 4761%. This

polarity defect was detectable only when neurons weretransfected at 2 h after plating – transfection at a later time-point did not affect axon formation (data not shown). Co-transfection of neurons with vectors for RNAi-resistant Ndr1 or

Ndr2 (Ndr1M and Ndr2M) and the shRNAs against Ndr1 andNdr2 rescued the loss of Ndr kinases (Fig. 1C,D), confirmingthe specificity of the effect. Interestingly, the Ndr1/2 double

knockdown phenotype was rescued by expression of only Ndr1Mor Ndr2M alone, which indicates a redundant function ofNdr kinases in neuronal polarity (the percentage of the neurons

forming multiple axons under each condition was as follows:

control, 2362%; Ndr1/2 shRNAs, 4761%; Ndr1/2 shRNAs andNdr1M, 2263%; Ndr1/2 shRNAs and Ndr2M, 2663%). Taken

together, these results show that the Ndr kinases are requiredfor neuronal polarity. Their loss leads to the formation ofsupernumerary axons, indicating that Ndr1 and Ndr2 restrict thenumber of axons that are extended during polarization.

Rassf5 is required for neuronal polarity and acts upstreamof Ndr1/2Ndr1 and 2 are regulated by different Mst kinases that actredundantly through the phosphorylation of Thr444 and 442,respectively, in the hydrophobic motif (Cornils et al., 2011b;

Hergovich et al., 2009; Hesson et al., 2003; Oh et al., 2009; Songet al., 2010; Stegert et al., 2005; Vichalkovski et al., 2008; Zhouet al., 2009). To circumvent this redundancy directly upstream of

Ndr1 and Ndr2, we targeted a known regulator of Mst kinases, thetumor suppressor Rassf5 (Hesson et al., 2003; Oh et al., 2009;Song et al., 2010; Zhou et al., 2009). Rassf5 is present throughoutunpolarized neurons at stage 2 but was mainly detectable in

the axon of stage 3 neurons (Fig. 2A). After transfection witha vector expressing Rassf5 shRNA (Fig. 2B), the number ofneurons with multiple axons increased from 2462%

(mean6s.e.m.) in the control to 5064% (Fig. 2C,D). Thephenotype of the Rassf5 knockdown could be rescued by thecoexpression of an RNAi-resistant version of Rassf5 (Rassf5M),

which reduced the number of neurons with multiple axons to2364% (Fig. 2C,D). Thus, Rassf5 is required for neuronalpolarity and its loss results in a phenotype that is similar to that of

the Ndr1/2 double knockdown.To confirm that Rassf5 and Ndr1/2 act in the same pathway to

regulate neuronal polarity, we tested the ability of an Ndr2 mutant(Ndr2-T442D) that mimics phosphorylation by Mst kinases

(Fig. 3A) to rescue the knockdown of Rassf5 (Fig. 3B,C). Aftersuppression of Rassf5, 4761% of the neurons formed multipleaxons compared to 3165% of control neurons. Expression of the

phospho-mimic mutant Ndr2-T442D was sufficient to rescue theloss of Rassf5 and reduced the number of neurons with multipleaxons (2462%) to a level that was comparable to that of the

control. The non-phosphorylatable mutant Ndr2-T442A did notrescue the loss of Rassf5, as the number of neurons with multipleaxons (3963%) was not significantly different from that of theRassf5 knockdown. Thus, Rassf5 acts as an upstream regulator of

Ndr2 in a novel pathway involved in neuronal polarity bystimulating the phosphorylation of Ndr2 at T442.

Knockdown of Rassf5 blocks neuronal polarization incortical slicesTo investigate the function of Rassf5 in neuronal polarity in vivo,

we analyzed Rassf5-knockout mice (Park et al., 2010). Rassf52/2

mice are viable (Park et al., 2010) and do not show any obviousdefects in the development of cortical layers or hippocampal

structures at embryonic day (E)17 (data not shown). Staining withan anti-neurofilament antibody did not show defects in axonformation. However, supernumerary axons might not be stablein the developing nervous system, and their formation could

be difficult to detect by staining all axons. Therefore, weisolated hippocampal neurons from E17 Rassf5+/2 and Rassf52/2

embryos and analyzed them at 3 DIV (supplementary material

Fig. S1). We found that 4162% (mean6s.e.m.) of the neuronsfrom Rassf52/2 embryos formed multiple axons compared with1363% in cultures from Rassf5+/2 brains, confirming the role of

Rassf5 in axon formation.

RESEARCH ARTICLE Journal of Cell Science (2014) 127, 3463–3476 doi:10.1242/jcs.146696

3464

Jour

nal o

f Cel

l Sci

ence

To test whether Rassf5 is required for neuronal polarization inthe developing brain, we performed ex vivo electroporation ofE14.5 embryonic brains and analyzed neuronal polarization by

live-cell imaging of slice cultures at 36 h after transfection(Fig. 4). Cortical neurons arise in the ventricular zone from radialglial cells (RGCs) and leave the ventricular zone to generate the

cortical plate (Barnes and Polleux, 2009). During their migration,newborn neurons first assume a multipolar morphology in thesubventricular zone (SVZ) and intermediate zone. Subsequently,

they become bipolar by extending a leading process that isrequired for radial migration and a trailing process that extends asthe axon in the intermediate zone. To investigate the phenotype ofRassf5-knockdown neurons by live-cell imaging, the cortex of

wild-type embryos was transfected with a vector that expressesboth the shRNA against Rassf5 and GFP (Fig. 4). RGCs

transfected by ex vivo electroporation gave rise to GFP-positive neurons that became bipolar and initiated their radialmigration in control cultures (Fig. 4A,B). At 36 h after the

transfection, 2065% of the GFP-positive cells were present inthe ventricular zone or SVZ, 4564% in the intermediate zoneand 3462% had reached the cortical plate in the control slices

(Fig. 4C). Over a period of 23 h, a large number of bipolarneurons migrated into the cortical plate (supplementary materialMovies 1, 2; Fig. 4A,B). At the end of the imaging period, the

percentage of neurons in the cortical plate had increased to5061% (Fig. 4C). By contrast, the migration from theintermediate zone into the cortical plate was blocked aftertransfection of the knockdown construct. The number of GFP-

positive cells present in the ventricular zone or SVZ (2063%)was comparable to that observed in controls, but 6862% of the

Fig. 1. Knockdown of Ndr1 and Ndr2 results in the formation of supernumerary axons. (A) Hippocampal neurons from E18 rat embryos were fixed atstage 2 and stage 3 and stained with an antibody against the Ndr-CTD. A higher magnification of the axon at stage 3 is shown in the lower-left corner. Scalebars: 10 mm. (B) HEK 293T cells were transfected with vectors for GFP, Ndr1, Ndr2 or shRNA-resistant Ndr1 (Ndr1M) or Ndr2 (Ndr2M) and shRNAsagainst Ndr1 (N1-sh) and Ndr2 (N2-sh) or pSM2 (control), as indicated. The expression of GFP–Ndr1 and GFP–Ndr2 was analyzed by western blotting (WB)using an anti-GFP antibody. Staining for GFP confirmed comparable transfection efficiencies and protein loading. (C) Hippocampal neurons were transfected at0 DIV with vectors for GFP (green), shRNA-resistant Ndr1 (Ndr1M, N1M) or Ndr2 (Ndr2M, N2M) and shRNAs directed against Ndr1 and Ndr2 (Ndr1+2 RNAi).Neurons were fixed at 3 DIV and stained with the Tau-1 antibody (blue in overlay) and an anti-MAP2 antibody (red in overlay). Scale bars: 50 mm. (D) Thepercentage of unpolarized neurons without an axon (0, white), polarized neurons with a single axon (1, gray) and neurons with multiple axons (.1, black) isshown. Values are the mean6s.e.m. (three transfections, n.100); ns, non-significant; ***P#0.001 compared with control (GFP+pSM2); two-way ANOVA.

RESEARCH ARTICLE Journal of Cell Science (2014) 127, 3463–3476 doi:10.1242/jcs.146696

3465

Jour

nal o

f Cel

l Sci

ence

cells were found in the intermediate zone and only 1162% hadreached the cortical plate. This distribution did not changesignificantly during the imaging period. After 23 h, 6263% of

the transfected neurons remained in the intermediate zone andonly 2062% were present in the cortical plate. Many neurons inthe intermediate zone extended multiple thin processes afterknockdown of Rassf5, which might explain why they were

unable to migrate (Fig. 4B). The morphology of these neuronsindicates that they remain in the multipolar phase afterknockdown of Rassf5. Taken together, these results suggest

that Rassf5 is required in cortical neurons for the transition froma multipolar to a bipolar morphology. Suppression of Rassf5

blocks the formation of a single leading process and a singletrailing axon.

Ndr2 phosphorylates Par3 at Ser383 in hippocampal neuronsTo elucidate how Ndr kinases regulate axon formation, we testedtheir interaction with proteins that are required for neuronalpolarity, and we identified Par3 as an interaction partner of Ndr1

and Ndr2 (data not shown). GST pulldown assays with individualPar3 domains and GFP–Ndr1 or GFP–Ndr2 coexpressed withMob1 and Mst1 in human embryonic kidney (HEK) 293T cells

revealed that the CR domain, the PDZ1 domain and the C-terminus (amino acids 1116–1356) of Par3 act as binding sites for

Fig. 2. Rassf5 is required for neuronal polarity. (A) Neurons from the hippocampus of E18 rat embryos were fixed at stage 2 and stage 3, and stained withthe anti-Rassf5 antibody. A higher magnification of the axon at stage 3 is shown in the lower-left corner. Scale bars: 10 mm. (B) HEK 293Tcells were transfectedwith vectors for GFP, HA–Rassf5A, shRNA-resistant HA–Rassf5A (R5M) and an shRNA against Rassf5 (R5-sh) or pSM2 (control), as indicated. Theexpression of Rassf5A was analyzed by western blotting (WB) using an anti-HA antibody. Staining for GFP confirmed comparable transfection efficiencies andprotein loading. (C) Hippocampal neurons were transfected at 0 DIV with vectors for GFP (green), shRNA-resistant Rassf5A (R5M) and an shRNA againstRassf5 or pSM2 (control). Neurons were fixed at 3 DIV and stained with the Tau-1 antibody (blue in overlay) and an anti-MAP2 antibody (red in overlay). Scalebars: 50 mm. (D) The percentage of unpolarized neurons without an axon (0, white), polarized neurons with a single axon (1, gray) and neurons with multipleaxons (.1, black) is shown. Values are the mean6s.e.m. (three transfections, n.150); ns, non-significant; ***P#0.001 compared with control (GFP+pSM2);two-way ANOVA.

RESEARCH ARTICLE Journal of Cell Science (2014) 127, 3463–3476 doi:10.1242/jcs.146696

3466

Jour

nal o

f Cel

l Sci

ence

both kinases (supplementary material Fig. S2A,B). The sameresult was obtained when using bacterially expressed GST–Ndr1,

GST–Ndr2 and GFP-fusion proteins for different Par3 domainsexpressed in HEK 293T cells, indicating that the interactionof Ndr kinases and Par3 is independent of Mob1 and

Mst1 coexpression (supplementary material Fig. S2C). Massspectrometry analysis of Par3 that was phosphorylated by Ndr2using an in vitro kinase assay resulted in the identification of twophosphorylation sites in Par3 – Ser383 (SPGRFpSPD) in the

PDZ1 domain and Ser1196 (SGRHpSVS) at the C-terminus.To confirm the phosphorylation of Par3 by Ndr kinases, we

generated an antibody that detects phosphorylation at Ser383.

Attempts to obtain an antibody specific for phosphorylation ofSer1196 were not successful. Our further analysis showed thatSer383 is the main Ndr2 phosphorylation site that is essential for

Par3 function in neuronal polarity (see below). The specificity ofthe antibody against phosphorylated (phospho)-Ser383-Par3 wasconfirmed in a heterologous system and in neurons. The phospho-

specific antibody confirmed that Par3 is phosphorylated byNdr2 in an in vitro phosphorylation assay using bacteriallyexpressed GST–Par3-PDZ1/2 and constitutively active NDR2-PIF or a kinase-dead NDR2-PIF mutant (NDR2-PIF-KD) (Stegert

et al., 2004) that were purified from HEK 293T cells (Fig. 5A).The anti-phospho-Ser383-Par3 antibody clearly detected thephosphorylation of GST–Par3-PDZ1/2 by Ndr2-PIF at Ser383,

whereas there was only a weak signal detectable with Ndr2-PIF-KD. Par3 phosphorylation was also observed when GFP–Ndr2,Mob1, Mst1 and Myc–Par3 were expressed in HEK 293T cells

and Par3 was precipitated using the anti-phospho-S383-Par3antibody (data not shown). Strong signals for Par3

phosphorylation were detected for Myc–Par3 but not when non-phosphorylatable Myc–Par3-S383A was used as a control,confirming the specificity of the antibody for phosphorylated Par3.

The anti-phospho-Ser383-Par3 antibody revealed a uniformstaining of the soma and dendrites in unpolarized neurons atstage 2 (Fig. 5B). Moreover, endogenous phospho-S383-Par3could also be detected in lysates from E18 rat brain using the

anti-phospho-S383-Par3 antibody, which indicates that Par3 isphosphorylated by Ndr kinases in the brain (Fig. 5C). At stage 3,a strong accumulation of phospho-Ser383-Par3 could be detected

in the axon. After knockdown of Ndr1 and Ndr2, staining for Par3phosphorylated at Ser383 was significantly reduced in theaxon [control, 80614 arbitrary units (a.u.); Ndr1/2 double

knockdown, 762 a.u.] (Fig. 5D,E). When Par3 was suppressedby an shRNA, the signal for phospho-S383 Par3 was also almostcompletely lost (data not shown). Taken together, these results

show that Par3 is phosphorylated at Ser383 by Ndr kinasesspecifically in the axon.

The phosphorylation of Par3 by Ndr1/2 is required forneuronal polarityTo address the function of Par3 phosphorylation, non-phosphorylatable (Par3-S383,1196A) and phospho-mimicking

mutants (Par3-S383,1196D) were used to test their ability torescue the loss of Ndr1 and Ndr2 (Fig. 5F). We found that5063% of the neurons formed multiple axons after double

Fig. 3. Ndr2-T442D is sufficient to rescue the suppression of Rassf5. (A) Schematic representation of Ndr2. Mst kinases phosphorylate Ndr2 at Thr442 (p)and activate its kinase activity. (B) Hippocampal neurons were transfected at 0 DIV with vectors for GFP (green), phospho-mimic Ndr2-Thr442 (N2-442D), non-phosphorylatable Ndr2-Thr442 (N2-442A) and an shRNA against Rassf5 or pSM2 (control), as indicated. Neurons were fixed at 3 DIV and stained with the Tau-1antibody (blue) and an anti-MAP2 antibody (red). Scale bars: 50 mm. (C) The percentage of unpolarized neurons without an axon (0, white), polarizedneurons with a single axon (1, gray) and neurons with multiple axons (.1, black) is shown. Values are the mean6s.e.m. (three transfections, n.150 neurons);ns, non-significant; *P,0.05; ***P#0.001, compared with control (GFP+pSM2); two-way ANOVA.

RESEARCH ARTICLE Journal of Cell Science (2014) 127, 3463–3476 doi:10.1242/jcs.146696

3467

Jour

nal o

f Cel

l Sci

ence

knockdown of Ndr1/2. This number was reduced to 2861% whenPar3-S383,1196D was coexpressed with the Ndr1/2 shRNAs.

However, there was no significant change in the percentageof neurons with multiple axons when Par3-S383,1196A wascoexpressed (4464%) (Fig. 5G). These results show that the Par3

phospho-mimic is sufficient to rescue the loss of Ndr kinases andthat the phosphorylation of Par3 by Ndr kinases is required for theestablishment of neuronal polarity. Because Rassf5 regulates

the activity of Ndr kinases in neurons, we investigated whetherSer383 phosphorylation also depends on Rassf5. We stainedneurons after the knockdown of Rassf5 with the anti-phospho-Ser383-Par3 antibody to confirm that the loss of Rassf5 results in

a reduction in the amount of Par3 phosphorylation. In control

neurons, Par3 phosphorylation at Ser383 was observed in thedistal axon (intensity, 3664 a.u.). After suppression of Rassf5,

phospho-Ser383-Par3 immunoreactivity was strongly reduced(962 a.u.) (Fig. 6A,B). This result confirmed that Par3phosphorylation depends on Rassf5.

Next, we tested whether expression of Par3-S383,1196Dis able to rescue the loss of Rassf5. Hippocampal neurons wereco-transfected with vectors for the Rassf5 shRNA and the

pseudophosphorylated Par3-S383,1196D at 0 DIV and wereanalyzed at 3 DIV (Fig. 6C,D). After knockdown of Rassf5,4361% of the neurons formed multiple axons compared with1567% of control neurons. The expression of the phospho-mimic

Par3-S383,1196D was sufficient to rescue the Rassf5-knockdown

Fig. 4. The knockdown of Rassf5 interferes with the polarization of neurons. (A–C) E14.5 brains were transfected by ex vivo electroporation with emptypCAGGS-U6 (control) or pCAGGS-U6-Rassf5 with an shRNA against Rassf5 (Rassf5 RNAi), and live-cell imaging of slice cultures was performed at 36 h afterelectroporation. (A) Representative images (maximum-intensity projection) of cortical slices at the indicated time-points are shown. CP, cortical plate; IZ,intermediate zone; VZ, ventricular zone. Scale bars: 50 mm. (B) Representative images (maximum-intensity projection) of transfected neurons after 23 h of live-cell imaging from control and Rassf5-knockdown slices are shown. Open arrowheads mark leading processes, black arrowheads mark trailing axons orprocesses of unpolarized neurons after knockdown of Rassf5. Scale bars: 10 mm. (C) The percentage of GFP-positive cells in the ventricular and subventricularzone (VZ), intermediate zone and cortical plate at 0, 6, 12 and 23 h is shown. Values are the mean6s.e.m. (three experiments, n5200–400 neurons per time-point); ****P,0.0001 compared with control; two-way ANOVA.

RESEARCH ARTICLE Journal of Cell Science (2014) 127, 3463–3476 doi:10.1242/jcs.146696

3468

Jour

nal o

f Cel

l Sci

ence

Fig. 5. Ndr kinases phosphorylate Par3 at Ser383. (A) Bacterially expressed GSTor GST–Par3-PDZ1 (Par3) were purified (input, Coomassie Blue staining)and incubated with HA–Ndr2-PIF or HA–Ndr2-PIF-KD isolated from HEK 293Tcells for an in vitro phosphorylation assay. Par3 phosphorylation was analyzed bywestern blotting (WB) using antibody against phosphorylated (P)-Ser383-Par3 antibody (upper panel). Blotting for HA confirmed comparable expressionof Ndr2 constructs (lower panel). Numbers indicate the molecular mass in kDa. (B) Hippocampal neurons were stained with the anti-phospho-Ser383-Par3antibody at stage 2 (unpolarized neuron, scale bar: 20 mm) and stage 3 (polarized neuron, scale bar: 50 mm). (C) Par3 was immunoprecipitated from lysates ofE18 rat brain using the anti-phospho-S383-Par3 or an anti-Myc antibody as negative control, and the precipitation of phosphorylated protein was detected withan anti-Par3 antibody. (D) Hippocampal neurons were transfected at 0 DIV with vectors for GFP (green in overlay) and pSM2 (control), and shRNAs for Ndr1 and2 (Ndr1+2 RNAi), fixed at 3 DIV and stained with the anti-phospho-Ser-383Par3 antibody (red in overlay). Scale bars: 50 mm. (E) The intensity of theimmunofluorescence signal in the axon, soma and dendrites for staining with the anti-phospho-Ser383-Par3 antibody was quantified in arbitrary units (a.u.;control, white bars; Ndr1+2 RNAi, black bars). Values are the mean6s.e.m. (n.10); ns, non-significant; **P#0.01 compared with control; two-way ANOVA.(F) Hippocampal neurons were transfected at 0 DIV with vectors for GFP (green), phospho-mimic Par3-S383,1196D (Par3-SD) or non-phosphorylatable Par3-S383,1196A (Par3-SA) and shRNAs directed against Ndr1 and Ndr2 (Ndr1+2 RNAi) or pSM2 (control), as indicated. Neurons were fixed at 3 DIV andstained with the Tau-1 antibody (blue in overlay) and an anti-MAP2 antibody (red in overlay). Scale bars: 50 mm. (G) The percentage of unpolarized neuronswithout an axon (0, white), polarized neurons with a single axon (1, gray) and neurons with multiple axons (.1, black) is shown. Values are the mean6s.e.m.(three transfections, n.180 neurons); ns, non-significant; ***P#0.001 compared with the control (GFP+pSM2); two-way ANOVA.

RESEARCH ARTICLE Journal of Cell Science (2014) 127, 3463–3476 doi:10.1242/jcs.146696

3469

Jour

nal o

f Cel

l Sci

ence

phenotype (1962% of neurons formed multiple axons). Bycontrast, the expression of Par3-S383,1196A did not rescue

the polarity defect caused by the Rassf5 knockdown (3869%of neurons formed multiple axons). These results confirmedthat Rassf5 acts upstream of the Ndr kinases and Par3 to

regulate neuronal polarity. Taken together, these experimentsstrongly suggest that phosphorylation of Par3 downstream ofRassf5–Ndr signaling is essential for the establishment of

neuronal polarity.

The phosphorylation of Par3 by Ndr1/2 changes itsdistributionThe localization of Par3 to the distal axon is important for itsfunction in neuronal polarity (Shi et al., 2003). To investigatewhether Par3 phosphorylation by Ndr kinases affects its

subcellular localization, the phospho-mimic Myc–Par3-Ser383Dor non-phosphorylatable Myc-Par3-Ser383A were expressedin hippocampal neurons. Neurons were fixed at different stages

and stained with an anti-Myc antibody (Fig. 7A; supplementary

Fig. 6. The phospho-mimic Par3-S383,1196Dis sufficient to rescue the effects of Rassf5knockdown. (A) Hippocampal neurons weretransfected at 0 DIV with vectors for GFP (green)and an shRNA against Rassf5 (Rassf5 RNAi) orpSM2 (control). Neurons were fixed at 3 DIV andstained with antibody against phosphorylated(P)-Ser-383Par3 antibody (red in overlay).(B) The intensity of the immunofluorescence forstaining with the anti-phospho-Ser383-Par3antibody was quantified in arbitrary units (a.u.).Boxes show the median (midline), 25thpercentile (control, 29.22; Rassf5-shRNA, 5) and75th percentile (control, 43; Rassf5-shRNA, 11).Whiskers show the minimum and maximum(control, 20 to 53; Rassf5-shRNA, 3 to 21). n57;**P#0.01 compared with control (Student’st-test). (C) Hippocampal neurons weretransfected at 0 DIV with vectors for GFP(green), Par3-S383,1196A (Par3-SA) or Par3-S383,1196D (Par3-SD) and an shRNA againstRassf5 or pSM2 (control), as indicated. Neuronswere stained at 3 DIV with the Tau-1 antibody(blue in overlay) and an anti-MAP2 antibody (redin overlay). Scale bars: 50 mm. (D) Thepercentage of unpolarized neurons without anaxon (0, white), polarized neurons with a singleaxon (1, gray) and neurons with multiple axons(.1, black) is shown. Values are themean6s.e.m. (three transfections, n.180neurons); ns, non-significant; **P#0.01compared with the control (GFP+pSM2); two-way ANOVA.

RESEARCH ARTICLE Journal of Cell Science (2014) 127, 3463–3476 doi:10.1242/jcs.146696

3470

Jour

nal o

f Cel

l Sci

ence

material Fig. S3). In unpolarized stage 2 neurons, both the non-phosphorylatable and the phospho-mimic Par3 mutants weredetected throughout all neurites (supplementary material Fig. S3).

At the transition to stage 3, when one of the neurites is slightlylonger than the others, Par3-Ser383A was present in all neurites,including the longest one, which presumably is the future axon.

By contrast, Par3-Ser383D displayed a higher accumulationin the longest neurite. After the establishment of polarity, a cleardifference in the distribution of Par3-S383A and Par3-S383D

was observed (Fig. 7A). Par3-S383D was abundant in the axon,including the tip. Quantification of the staining intensity showedthat 4961% of the total signal for Par3-S383D was present in

the axon. By contrast, the majority of Par3-S383A was present inthe dendrites and soma (7264% of the Par3-S383A signal) andmuch less was detected in the axon (2964%) (Fig. 7B). The

distribution of Par3-S1196A and Par3-S1196D did not showany difference between axons and minor neurites (datanot shown). Thus, the phosphorylation of Par3 at Ser383 is

required for its axonal localization. The Par3-S383D phospho-mimic preferentially localizes to the axon, whereas the non-phosphorylatable mutant is localized mainly to the soma and

dendrites.To elucidate how Ser383 phosphorylation affects the

distribution of Par3, we analyzed the interaction between Par3

and the kinesin-2 subunit KIF3A or the dynein subunit Dlic2, twomotor proteins that interact with Par3 (Nishimura et al., 2004;Schmoranzer et al., 2009). While there was no significant

difference in the binding of Par3-S383A and Par3-S383D toKIF3A (data not shown), the mutation of Ser383 clearly affectedthe interaction of Par3 with Dlic2 (Fig. 7C), which could play a

Fig. 7. Par3-S383A and Par3-S383D showdifferent patterns of subcellular localization.(A) Hippocampal neurons were transfected at0 DIV with vectors encoding GFP and Myc–Par3-S383A or Myc–Par3-S383D. Neurons were fixedat 3 DIV and stained with an anti-Myc antibody(Par3). A higher magnification of the areasmarked by squares is shown below each image.Scale bars: 50 mm. (B) The relative intensity of theimmunofluorescence in the axon (gray bars) orsoma and dendrites (black bars) for staining withthe anti-phospho-Ser383-Par3 antibody wasquantified as the percentage of the total signal forphospho-Ser383-Par3. Values are themean6s.e.m. (n56); **P,0.01 between indicatedpairs; two-way ANOVA. (C) RFP–Dlic2 (DIC) orRFP (negative control) were coexpressed withMyc-tagged wild-type (WT) Par3, phospho-mimicPar3-S383D or non-phosphorylatable Par3-S383A in HEK 293T cells. Dlic2 wasimmunoprecipitated (IP) from cell lysates with ananti-RFP antibody, and the bound proteins weredetected by western blotting (WB) using an anti-Myc antibody. Blotting for RFP, Myc and tubulin(input) confirmed that comparable amounts ofproteins were expressed and loaded. Numbersindicate the molecular mass in kDa.

RESEARCH ARTICLE Journal of Cell Science (2014) 127, 3463–3476 doi:10.1242/jcs.146696

3471

Jour

nal o

f Cel

l Sci

ence

role in the retrograde transport of Par3. Myc-tagged Par3, Par3-S383A and Par3-S383D were coexpressed with RFP-tagged

Dlic2 in HEK 239T cells, and their interaction was analyzed byimmunoprecipitation using an anti-RFP antibody. Wild-type Par3and Par3-S383A showed a strong interaction as reportedpreviously (Schmoranzer et al., 2009), but the binding of Par3-

S383D to Dlic2 was almost completely abolished, which suggeststhat Par3 phosphorylation at Ser383 disrupts the interactionbetween Par3 and dynein. Therefore, a defect in dynein-mediated

retrograde transport of Par3 might cause the aberrant distributionof pseudophosphorylated Par3. Taken together, these resultsshow that the normal distribution of Par3 depends on its

phosphorylation by Ndr kinases, which affects its interactionwith dynein.

DISCUSSIONA novel pathway regulates Par3 localization and neuronalpolarityIn this study, we identify a novel signaling cascade that regulates

the establishment of neuronal polarity through Par3. In thisRassf5–Ndr–Par3 pathway, Rassf5 acts upstream of Ndr1 andNdr2 to stimulate their kinase activity. Activated Ndr kinases then

phosphorylate Par3 to polarize its distribution to the axon. Thus,they promote the establishment of neuronal polarity and preventminor neurites from becoming axons. Inhibition of this pathway

results in the formation of supernumerary axons. This functionappears to be conserved, as neurons form ectopic neurites inmutants of the C. elegans Ndr homolog SAX-1 (Zallen et al.,

2000).Our results show that the loss of Rassf5 or the simultaneous

knockdown of Ndr1 and Ndr2 in hippocampal neurons bothresult in the disruption of neuronal polarity and the formation of

multiple axons. The analysis of a knockdown of Rassf5 in corticalslices confirms its function in neuronal polarity. An Ndr2 mutantmimicking phosphorylation by Mst kinases is sufficient to rescue

the loss of Rassf5, indicating that Rassf5 acts indirectly tostimulate Ndr kinase activity. Finally, we identify Par3 as a noveltarget for the Ndr kinases, which phosphorylate Par3 at Ser383 in

vitro and in neurons. This phosphorylation depends on Rassf5 andNdr1/2, because the knockdown of Rassf5 or Ndr1/2 results in theloss of Par3 Ser383 phosphorylation. The functional relevanceof this phosphorylation is confirmed by the ability of a Par3

construct mimicking phosphorylation by Ndr1/2 to rescue theknockdown of Ndr1/2 or Rassf5.

Par3 phosphorylated at Ser383 is strongly enriched in the axon,

and this phosphorylation is required for its axonal localization.The phospho-mimic Par3-Ser383D reproduces the enrichmentin the axon, whereas the non-phosphorylatable Par3-Ser383A

mutant preferentially localizes to the soma and dendrites. Theaberrant localization of non-phosphorylatable Par3-Ser383A instage 3 neurons can be explained by its unregulated interaction

with the dynein subunit Dlic2. Failure to block the binding ofPar3-Ser383A to dynein results in the continuing retrogradetransport of Par3 in the axon. Taken together, our data supportthe model that Rassf5 activates Ndr kinases, which, in turn,

phosphorylate Par3 on Ser383 to regulate the Par3–Dlic2interaction and polarize Par3 distribution.

Rassf5 activates Ndr kinasesOur analysis of the Rassf5–Ndr–Par3 pathway identifies a novelfunction of Ndr kinases that act redundantly at an early stage of

neuronal differentiation to promote the establishment of neuronal

polarity. The Ndr kinases appear to target intracellular transportprocesses; they regulate the interaction of Par3 with Dlic2, as

reported here, and are also known to phosphorylate Aak1 andRabin8 (also known as RAB3IP), two proteins involvedin regulating trafficking in neurons (Chiba et al., 2013; Ultaniret al., 2012). This distinguishes Ndr kinases from the closely

related Lats kinases that regulate cell growth and organ size atthe transcriptional level through YAP and TAZ as centralcomponents of the Hippo pathway (Hergovich et al., 2006a;

Hergovich et al., 2006b; Yu and Guan, 2013).Here, we identify Rassf5 as a new upstream activator of Ndr

kinases in neurons. The function of Rassf5 in neuronal polarity

is confirmed by the knockdown of Rassf5 in cortical slices by ex

vivo electroporation. Suppression of Rassf5 resulted in the arrestof neurons in the intermediate zone. Instead of forming a single

leading process and a single trailing axon, neurons displayedmultiple thin processes and were not able to migrate. Theanalysis of Rassf5-knockout mice did not reveal major defects incortical organization, probably because a constitutive knockout

throughout development allows sufficient time for compensatorychanges to overcome the loss of Rassf5. This might involve oneor several of the ten known Rassf proteins (Sherwood et al.,

2010).The Ndr2-T442D mutant that mimics phosphorylation by Mst

kinases is sufficient to rescue the loss of Rassf5, whereas Ndr2-

T442A is not able to restore normal polarity. Rassf5 has beenshown to stimulate the activity of Mst kinases, suggesting that itmost likely regulates Ndr1/2 indirectly by activating the Mst

kinases during neuronal polarization (Khokhlatchev et al., 2002;Praskova et al., 2004). However, given that at least three differentMst kinases can function upstream of Ndr (Cornils et al., 2011b;Hergovich et al., 2009; Stegert et al., 2005; Stegert et al., 2004;

Vichalkovski et al., 2008), future research is warranted to dissectthe role of Rassf5 in more detail. One member of the Mst kinasefamily, Mst3 (also known as STK24), has been shown to regulate

axon growth of cortical neurons and to mediate the growth-promoting effects of trophic factors during regeneration (Lorberet al., 2009). It will be interesting to test whether these functions

also depend on the Ndr kinases, and whether Mst3 regulates Ndrin these settings.

Rassf5 has also been shown to bind to microtubules(Moshnikova et al., 2006; Moshnikova et al., 2008; van der

Weyden et al., 2005). This suggests the interesting possibility thatthe activity of the Rassf5–Ndr pathway is regulated by changesin the organization of the neuronal cytoskeleton. Because the

dynamics of microtubules differ in axons and dendrites, it istempting to speculate that the microtubule-binding protein Rassf5links the activity of Ndr kinases to specific aspects of microtubule

dynamics and thereby preferentially activates these kinases in theaxon (Witte et al., 2008).

Par3 is a novel substrate of Ndr kinasesSo far, only few substrates for the Ndr kinases have beenidentified. They phosphorylate p21 to control the cell cycle, andAak1 and Rabin mediate their function in dendrite arborization

and spine development (Cornils et al., 2011a; Ultanir et al.,2012). We identified two phosphorylation sites in Par3 for Ndrkinases (Ser383 and Ser1196) using kinase assays and mass

spectrometry. The Ndr phosphorylation sites in Par3 are noveland distinct from the sites for Aurora A, ROCK and Erk2that regulate its function in neuronal polarity (Chen et al., 2006;

Funahashi et al., 2013; Khazaei and Puschel, 2009; Nakayama

RESEARCH ARTICLE Journal of Cell Science (2014) 127, 3463–3476 doi:10.1242/jcs.146696

3472

Jour

nal o

f Cel

l Sci

ence

et al., 2008). By using a phospho-specific antibody, we confirmedSer383 as the major regulatory site involved in neuronal

polarization but we did not observe a role for Ser1196phosphorylation in Par3 localization. Par3 phosphorylated atSer383 is highly concentrated in the distal axon and largelyabsent from dendrites, which is consistent with the function of

Par3 in axon specification. Ser383 phosphorylation of Par3depends on Ndr1/2 and Rassf5, and only the Ser383 Par3phospho-mimic is sufficient to rescue the loss of Ndr kinases or

the loss of Rassf5, whereas the non-phosphorylatable mutantdid not show rescuing activity. This confirms the functionalimportance of Par3 phosphorylation by Ndr kinases for the

normal establishment of neuronal polarity.The Par3-S383A and Par3-S383D mutants exhibited different

subcellular localizations when expressed in hippocampal

neurons. Par3-S383D is located preferentially in the axon,whereas the majority of Par3-S383A remains in the soma. Thisdifference in the distribution pattern suggests that Ser383phosphorylation affects the localization and/or transport of

Par3. The asymmetric distribution of Par3 is crucial for thepolarization of neurons (Nishimura et al., 2004; Shi et al., 2003).In stage 2 neurons, Par3 is present in all neurites but becomes

restricted to the axon upon its formation at stage 3. A uniformdistribution after overexpression of Par3 or a block of its KIF3A-dependent anterograde transport into the axon disrupts the

establishment of neuronal polarity (Nishimura et al., 2004; Shiet al., 2003). Par3 interacts not only with KIF3A but alsowith the dynein subunit Dlic2 (Schmoranzer et al., 2009). The

dynein-dependent transport of the Drosophila Par3 homologBazooka is required for the segregation of apically localizedproteins during the establishment of epithelial polarity (Harrisand Peifer, 2005). Thus, dynein might perform a similar function

in neurons to mediate the retrograde transport of Par3 andsegregate dendritic and axonal properties. Par3-Ser383D shows astrongly reduced interaction with Dlic2 compared with that of

Par3-Ser383A, suggesting that Par3 phosphorylated at Ser383does not undergo dynein-mediated retrograde transport. Theirdifferential interaction with dynein is a possible explanation

for the difference in the distribution of Par-Ser383D andPar-Ser383A.

Ndr kinases and Par3 have been implicated in the regulation ofcentrosome duplication and orientation, respectively (Hergovich

et al., 2007; Schmoranzer et al., 2009). It has been suggestedthat the centrosome induces the formation of axons (de Andaet al., 2010; de Anda et al., 2005) but subsequent experiments

have indicated that its role in the initiation of polarity ismore complicated than initially suggested (Gartner et al., 2012;Sakakibara et al., 2014). The suppression of Ndr kinases in

dividing cells negatively affects centrosome duplication(Hergovich et al., 2007) and, thus, would be expected to resultin the loss of axons due to reduced centrosome numbers but not

the formation of multiple axons as observed after the knockdownof Ndr1/2 in neurons. Therefore, it is unlikely that the Rassf5–Ndr–Par3 signaling cascade regulates neuronal polarity throughan effect on centrosomes. Recently, it was shown that Par3 also

acts as a microtubule-binding protein that bundles and stabilizesmicrotubules to promote axon extension (Chen et al., 2013). Itsconcentration-dependent oligomerization determines its ability

to bind microtubules. A reduced retrograde transport of Par3would increase its local concentration in the axon, favoring itsoligomerization and microtubule-binding and thereby promoting

axon extension.

The Rassf5–Ndr pathway suppresses supernumerary axonformation by regulating Par3 localizationOur results indicate that Rassf5 and Ndr regulate the localizationof Par3 to the axon by changing the balance between anterogradeand retrograde transport to favor Par3 retention in the axon. Theinteraction with kinesin and dynein subunits initially distributes

Par3 uniformly to all neurites at stage 2. During the establishmentof polarity, kinesin-2 transports Par3 into the axon where it isreleased after phosphorylation by Erk2 (Funahashi et al., 2013).

Phosphorylation at Ser383 by Ndr kinases then prevents theinteraction of Par3 with dynein and thereby blocks its retrogradetransport to the soma, which allows the accumulation of Par3

in a single neurite to promote axon formation. By contrast,Par3 Ser383 is not phosphorylated in the remaining minorneurites, allowing its depletion from these processes by continued

retrograde transport. Thus, the suppression of retrogradePar3 transport together with kinesin-2-mediated anterogradetransport establishes the enrichment of Par3 in a single neurite.In the absence of Ndr kinases, Par3 Ser383 remains

unphosphorylated and the retrograde transport of Par3 persists.As a consequence, Par3 continues to be equally distributed to allneurites, which results in the formation of supernumerary axons.

Taken together, we identify a novel function of Rassf5 and Ndrkinases, which might also play important roles in other types ofpolarized cells, such as epithelial cells, where Par3 performs an

important function.

MATERIALS AND METHODSCell culture and transfectionE18 hippocampal neurons were prepared and transfected by using calcium

phosphate co-precipitation as described previously (Schwamborn and

Puschel, 2004). Briefly, E18 hippocampal neurons were transfected by

adding the DNA and calcium solution (6 mg of DNA, 6.25 ml of 1 M CaCl2and ddH2O in a total volume of 25 ml) at 2–6 h after plating. The culture

medium (Neurobasal Medium, Life Technologies) was replaced with

400 ml of Opti-MEM (Life Technologies) before the DNA mixture was

added. After incubation for 45 min at 37 C under 5% CO2, the neurons

were washed for 15 min with 1 ml of Opti-MEM, which had been pre-

incubated at 37 C under 10% CO2, and the conditioned Neurobasal

medium was added back to the cells.

Immunostaining and imaging of hippocampal culturesNeurons were fixed at 3 DIV and permeabilized with a solution of 0.1%

Triton X-100 and 0.1% sodium citrate in PBS for 3 min on ice. After

three washes with PBS, fixed cells were blocked for 1 h at room

temperature with 10% normal goat serum in PBS. Incubation with

primary and secondary antibodies was performed in the blocking buffer.

Antibodies against the following proteins were used: Tau-1 (Chemicon,

MAB3420; 1:500), MAP2 (Chemicon, AB5622; 1:1000), Myc (Cell

Signaling Technology, 2272; 1:500), Par3 (Upstate, 07-330; 1:750),

phosphorylated Par3 (Ser383) (Eurogentec, 1:500), NDR-CTD

(Hergovich et al., 2007) and Rassf5 (Bioss, bs-11168R; 1:500). Alexa-

Fluor-conjugated secondary antibodies were also used (Molecular

Probes; 1:1000). The polyclonal rabbit antibody against phospho-Par3

(Ser383) was generated using the peptide SPGRF-S[PO3H2]-PDSHC,

derived from the mouse Par3 sequence (Eurogenetec). The stage of

neuronal differentiation and axon formation was determined according to

published criteria (Schwamborn and Puschel, 2004). Statistical

significance was determined using a two-way ANOVA.

BiochemistryPulldown assays, immunoprecipitation and western blotting were

performed as described previously (Khazaei and Puschel, 2009). For

pulldown assays, bacterially expressed GST-fusion proteins were

immobilized on glutathione–Sepharose (GE Healthcare). After washing

RESEARCH ARTICLE Journal of Cell Science (2014) 127, 3463–3476 doi:10.1242/jcs.146696

3473

Jour

nal o

f Cel

l Sci

ence

the beads with lysis buffer [50 mM Tris-HCl pH 7.4, 150 mM NaCl,

1 mM DTT, 10 mM MgCl2, 4 mM EDTA, 10% glycerol, 1% Triton X-

100 and complete protease inhibitor cocktail (Roche)], they were

incubated with lysates from transfected HEK 293T cells and washed,

and the bound proteins were eluted with sample buffer.

For immunoprecipitation, transfected HEK 293T cells were lysed at

48 h after transfection. The cell lysate was incubated with 3–5 mg of

antibody at 4 C for 3 h or overnight with shaking. A total of 50 ml of

Protein-G2agarose beads (Roche) was added to the lysate and incubated

at 4 C for 3–5 h with shaking. After three washes of the beads with

immunoprecipitation wash buffer [20 mM Tris-HCl pH 7.4, 150 mM

NaCl, 5 mM MgCl2, 2 mM EDTA, 10% (v/v) glycerol, 0.1% (v/v) NP-

40], bound proteins were eluted with 30–50 ml of 26SDS sample buffer,

boiled at 95 C for 5 min and analyzed by western blotting.

Western blotting was performed using the following antibodies: mouse

anti-FLAG M2 (Sigma, F3165; 1:1000), mouse anti-GFP (BabCo, MMS-

118P; 1:1000), mouse anti-HA (Sigma, H6908; 1:200 and Roche,

1867423; 1:500), rabbit anti-Par3 (Upstate, 07-330; 1:750), mouse anti-

Myc (Roche, 1667149; 1:1000), rabbit anti-RFP (Evrogen, 23402290601;

1:5000) and HRP-coupled secondary antibodies (Dianova; 1:1000). For

kinase assays, proteins were expressed in BL21-StarTM (Rosetta+) bacteria

or HEK 293T cells and purified by pulldown or immunoprecipitation,

respectively, as described previously (Khazaei and Puschel, 2009). The

kinase was incubated with substrate proteins in 20 ml of kinase buffer

containing 1 mM ATP at 30 C for 30 min (Khazaei and Puschel, 2009).

The reaction was terminated by the addition of sample buffer followed by

boiling for 5 min and was then analyzed by western blotting or staining

with Coomassie Blue. The bands corresponding to the phosphorylated

substrates were isolated, digested and analyzed by mass spectrometry at the

Zentrale Bioanalytic, Zentrum fur Molekulare Medizin Koln.

PlasmidsExpression vectors for FLAG–Mst1 (Lin et al., 2002), FLAG–Ndr1,

FLAG–Ndr2 (Devroe et al., 2004) and HA–Rassf5 (Ortiz-Vega et al.,

2002) were obtained from Addgene (plasmid numbers 1965, 8972,

8931 and 1979, respectively). pEGFP-Mob1b, FLAG–Ndr1-K118A and

FLAG–Ndr2-119A (Devroe et al., 2005) were kindly provided by Alan

Engelman. HA–NDR2-PIF and HA–NDR2-PIF-KD were described

previously (Stegert et al., 2004). GFP-tagged Mus musculus dynein

cytoplasmic 1 light intermediate chain 2 (DYNC1LI2) was purchased

from Origene (catalog number MG207876) and cloned into a pTagRFP-

N vector from Evrogen (catalog number FP142) using the XhoI and

NotI sites. To generate the shRNA vectors (Paddison et al., 2002), the

following target sequences were used: NDR1, 59-GACATGATGAC-

TTTATTGA-39; Ndr2, 59-GCAGCATGCTCGTAAAGAA-39; Rassf5,

59-GACAAGTGCT CTTCCAGAA-39. The amplified PCR fragments

were cloned into the XhoI and EcoRI sites of the pSHAG-MAGIC2 or

pCAGGS-U6 vector. RNAi-resistant Ndr1, Ndr2 (Ndr1M and Ndr2M)

and Rassf5 (Rassf5M) were generated by site-directed mutagenesis

using the QuikChange Site-Directed Mutagenesis kit (Stratagene)

according to the manufacturer’s instructions. The shRNA target

sequences containing the two mutations were used as primers in a

PCR: Ndr1M, 59-GCCTGGAGGGGACATGATGACCTTGTTGATG-

AAAAAAGATACT-39; Ndr2M, 59-GTTACGTCGATCGCAGCAT-

GCCCGGAAAGAAACAGAG-39; Rassf5M, 5-CAAAGATGGACAAG-

TCCTGTTCCAGAAACTCTCCATTGCT-39. Positive colonies were

confirmed by sequencing. The constructs for phospho-mimic or non-

phosphorylatable Ndr2 and Par3 were generated by site-directed

mutagenesis using the QuikChange Site-Directed Mutagenesis kit

(Stratagene) according to the manufacturer’s instructions using the

following primers: Ndr2-T442A, 59-CTGGGTTTTTCTCAATTACG-

CCTACAAAAGGTTTGAAG-39; Ndr2-T442D, 59-CTGGGTTTTT-

CTCAATTACGACTACAAAAGGTTTGAAG-39; Par3-S383A, 59-CA-

ATTACTATTCAAGCCGTTTTGCCCCTGACAGCCAGTAT-39; Par3-

S383D, 59-CAATTACTATTCAAGCCGTTTTGACCCTGACAGCC-

AGTAT-39; Par3-S1196A, 59-AGCGGGCGACACGCGGTGTCCGT-

GGAG-39; Par3-S1196D, 59-AGCGGGCGACACGACGTGTCCGT-

GGAG-39: The Par3 constructs CR (amino acids 1–200), PDZ1 (amino

acids 201–400), PDZ2 (amino acids 401–560), PDZ3 (amino acids 561–

780), aPKC-binding domain (aPKC BD, amino acids 700–1356), coiled-

coil region 1 (CC1) (amino acids 1116–1184), CC2 (amino acids 1185–

1247), CC3 (amino acids 1186–1356) and ABD-Z (amino acids 1116–

1356) have been described previously (Khazaei and Puschel, 2009).

Rassf5-knockout miceRassf5-knockout mice were generously provided by Sean Bong Lee (Park

et al., 2010). Genotyping of Rassf5-knockout mice was performed using

the following primers for the wild-type (177-bp product); Rassf5_WT_S1,

59-CCCAGTGTTCTCACCTGGAGAATC-39 and Rassf5_WT_AS1,

59-GTCAGCTCATGTCACTGGCAATAAGC-39, and the following

primers for the mutant (228-bp product); Rassf5_MUT_S1, 59-

CCCAGTGTTCTCACCTGGAGAATC-39 and Rassf5_MUT_AS1, 59-

CCAGACTGCCTTGGGAAAAGC G-39. The conditions were 35 cycles

of 95 C for 30 s, 58 C for 30 s and 72 C for 30 s.

Ex vivo electroporation and live-cell imagingBrains from wild-type CD1 E14.5 embryos were used for ex vivo

electroporation. Briefly, plasmids were mixed with Fast Green dye (0.5%)

and injected into the lateral ventricle. Embryos were transfected by five pulses at

54 V for 50 ms at 1 s intervals, using the ECM-830 BTX square wave

electroporator (BTX, Gentronic). The brains were embedded in 3% low-melting

agarose (Biozym). Slices with a thickness of 290 mm were cut using a vibratome

(Leica), placed onto the membrane of a Millicell tissue culture insert (0.4 mm,

30 mm; Millipore) and cultured at the air–liquid interface using neurobasal

medium supplemented with B27 and N2 in 35-mm tissue culture dishes at 37 C

under 5% CO2 and 40% O2. Imaging was performed in an incubation chamber

at 37 C and under 5% CO2 at 36 h after electroporation, using a Zeiss LSM 700

laser-scanning microscope (Carl Zeiss MicroImaging, Jena, Germany)

equipped with the Zeiss ZEN Software (Carl Zeiss MicroImaging). Images

were taken every 30 min for a period of 24 h. The distribution of transfected

neurons was analyzed by determining the percentage of GFP-positive cells in

the ventricular zone or SVZ, intermediate zone and cortical plate.

AcknowledgementsWe thank Alan Engelman (Harvard Medical School, Cambridge, MA) forplasmids, Sean Bong Lee (NIDDK, Bethesda, MD) for knockout mice andChristian Klambt (Institute of Neurobiology, Munster, Germany) for comments onthe manuscript.

Competing interestsThe authors declare no competing interests.

Author contributionsR.Y., E.K. and J.J. performed the experiments and analyzed data. R.Y., A.H. andA.W.P. wrote the manuscript.

FundingThis work was funded by the Deutsche Forschungsgemeinschaft [grant numberPU 102/12-1 to A.W.P.]; and a German Academic Exchange Service (DAAD)fellowship to E.K. A.H. is a Wellcome Trust Research Career Development fellow[grant number 090090/Z/09/Z] at the UCL Cancer Institute. Deposited in PMC forrelease after 6 months.

Supplementary materialSupplementary material available online athttp://jcs.biologists.org/lookup/suppl/doi:10.1242/jcs.146696/-/DC1

ReferencesArimura, N. and Kaibuchi, K. (2007). Neuronal polarity: from extracellular signalsto intracellular mechanisms. Nat. Rev. Neurosci. 8, 194-205.

Banker, G. A. and Cowan, W. M. (1977). Rat hippocampal neurons in dispersedcell culture. Brain Res. 126, 397-425.

Barnes, A. P. and Polleux, F. (2009). Establishment of axon-dendrite polarity indeveloping neurons. Annu. Rev. Neurosci. 32, 347-381.

Bichsel, S. J., Tamaskovic, R., Stegert, M. R. and Hemmings, B. A. (2004).Mechanism of activation of NDR (nuclear Dbf2-related) protein kinase by thehMOB1 protein. J. Biol. Chem. 279, 35228-35235.

Calvisi, D. F., Ladu, S., Gorden, A., Farina, M., Conner, E. A., Lee, J. S., Factor,V. M. and Thorgeirsson, S. S. (2006). Ubiquitous activation of Ras and Jak/Stat pathways in human HCC. Gastroenterology 130, 1117-1128.

RESEARCH ARTICLE Journal of Cell Science (2014) 127, 3463–3476 doi:10.1242/jcs.146696

3474

Jour

nal o

f Cel

l Sci

ence

Chen, Y. M., Wang, Q. J., Hu, H. S., Yu, P. C., Zhu, J., Drewes, G.,Piwnica-Worms, H. and Luo, Z. G. (2006). Microtubule affinity-regulatingkinase 2 functions downstream of the PAR-3/PAR-6/atypical PKC complex inregulating hippocampal neuronal polarity. Proc. Natl. Acad. Sci. USA 103, 8534-8539.

Chen, S., Chen, J., Shi, H., Wei, M., Castaneda-Castellanos, D. R., Bultje,R. S., Pei, X., Kriegstein, A. R., Zhang, M. and Shi, S. H. (2013). Regulation ofmicrotubule stability and organization by mammalian Par3 in specifyingneuronal polarity. Dev. Cell 24, 26-40.

Chiba, S., Amagai, Y., Homma, Y., Fukuda, M. and Mizuno, K. (2013). NDR2-mediated Rabin8 phosphorylation is crucial for ciliogenesis by switching bindingspecificity from phosphatidylserine to Sec15. EMBO J. 32, 874-885.

Cornils, H., Stegert, M. R., Hergovich, A., Hynx, D., Schmitz, D., Dirnhofer, S.and Hemmings, B. A. (2010). Ablation of the kinase NDR1 predisposes mice tothe development of T cell lymphoma. Sci. Signal. 3, ra47.

Cornils, H., Kohler, R. S., Hergovich, A. and Hemmings, B. A. (2011a).Downstream of human NDR kinases: impacting on c-myc and p21 proteinstability to control cell cycle progression. Cell Cycle 10, 1897-1904.

Cornils, H., Kohler, R. S., Hergovich, A. and Hemmings, B. A. (2011b). HumanNDR kinases control G(1)/S cell cycle transition by directly regulating p21stability. Mol. Cell. Biol. 31, 1382-1395.

de Anda, F. C., Pollarolo, G., Da Silva, J. S., Camoletto, P. G., Feiguin, F. andDotti, C. G. (2005). Centrosome localization determines neuronal polarity.Nature 436, 704-708.

de Anda, F. C., Meletis, K., Ge, X., Rei, D. and Tsai, L. H. (2010). Centrosomemotility is essential for initial axon formation in the neocortex. J. Neurosci. 30,10391-10406.

Devroe, E., Erdjument-Bromage, H., Tempst, P. and Silver, P. A. (2004). HumanMob proteins regulate the NDR1 and NDR2 serine-threonine kinases. J. Biol.Chem. 279, 24444-24451.

Devroe, E., Silver, P. A. and Engelman, A. (2005). HIV-1 incorporates andproteolytically processes human NDR1 and NDR2 serine-threonine kinases.Virology 331, 181-189.

Dotti, C. G., Sullivan, C. A. and Banker, G. A. (1988). The establishment ofpolarity by hippocampal neurons in culture. J. Neurosci. 8, 1454-1468.

Emoto, K., He, Y., Ye, B., Grueber, W. B., Adler, P. N., Jan, L. Y. and Jan,Y.-N. (2004). Control of dendritic branching and tiling by the Tricornered-kinase/Furry signaling pathway in Drosophila sensory neurons. Cell 119, 245-256.

Emoto, K., Parrish, J. Z., Jan, L. Y. and Jan, Y. N. (2006). The tumoursuppressor Hippo acts with the NDR kinases in dendritic tiling and maintenance.Nature 443, 210-213.

Funahashi, Y., Namba, T., Fujisue, S., Itoh, N., Nakamuta, S., Kato, K.,Shimada, A., Xu, C., Shan, W., Nishioka, T. et al. (2013). ERK2-mediatedphosphorylation of Par3 regulates neuronal polarization. J. Neurosci. 33, 13270-13285.

Gallegos, M. E. and Bargmann, C. I. (2004). Mechanosensory neuritetermination and tiling depend on SAX-2 and the SAX-1 kinase. Neuron 44,239-249.

Gartner, A., Fornasiero, E. F., Munck, S., Vennekens, K., Seuntjens, E.,Huttner, W. B., Valtorta, F. and Dotti, C. G. (2012). N-cadherin specifies firstasymmetry in developing neurons. EMBO J. 31, 1893-1903.

Garvalov, B. K., Flynn, K. C., Neukirchen, D., Meyn, L., Teusch, N., Wu, X.,Brakebusch, C., Bamburg, J. R. and Bradke, F. (2007). Cdc42 regulatescofilin during the establishment of neuronal polarity. J. Neurosci. 27, 13117-13129.

Harris, T. J. and Peifer, M. (2005). The positioning and segregation of apicalcues during epithelial polarity establishment in Drosophila. J. Cell Biol. 170, 813-823.

Harvey, K. and Tapon, N. (2007). The Salvador-Warts-Hippo pathway – anemerging tumour-suppressor network. Nat. Rev. Cancer 7, 182-191.

He, Y., Fang, X., Emoto, K., Jan, Y. N. and Adler, P. N. (2005). The tricorneredSer/Thr protein kinase is regulated by phosphorylation and interacts with furryduring Drosophila wing hair development. Mol. Biol. Cell 16, 689-700.

Hergovich, A. (2011). MOB control: reviewing a conserved family of kinaseregulators. Cell. Signal. 23, 1433-1440.

Hergovich, A., Schmitz, D. and Hemmings, B. A. (2006a). The human tumoursuppressor LATS1 is activated by human MOB1 at the membrane. Biochem.Biophys. Res. Commun. 345, 50-58.

Hergovich, A., Stegert, M. R., Schmitz, D. and Hemmings, B. A. (2006b). NDRkinases regulate essential cell processes from yeast to humans. Nat. Rev. Mol.Cell Biol. 7, 253-264.

Hergovich, A., Lamla, S., Nigg, E. A. and Hemmings, B. A. (2007).Centrosome-associated NDR kinase regulates centrosome duplication. Mol.Cell 25, 625-634.

Hergovich, A., Kohler, R. S., Schmitz, D., Vichalkovski, A., Cornils, H. andHemmings, B. A. (2009). The MST1 and hMOB1 tumor suppressors controlhuman centrosome duplication by regulating NDR kinase phosphorylation. Curr.Biol. 19, 1692-1702.

Hesson, L., Dallol, A., Minna, J. D., Maher, E. R. and Latif, F. (2003). NORE1A,a homologue of RASSF1A tumour suppressor gene is inactivated in humancancers. Oncogene 22, 947-954.

Hwang, E., Ryu, K. S., Paakkonen, K., Guntert, P., Cheong, H. K.,Lim, D. S., Lee, J. O., Jeon, Y. H. and Cheong, C. (2007). Structuralinsight into dimeric interaction of the SARAH domains from Mst1 and RASSF

family proteins in the apoptosis pathway. Proc. Natl. Acad. Sci. USA 104, 9236-9241.

Jan, Y. N. and Jan, L. Y. (2001). Asymmetric cell division in the Drosophilanervous system. Nat. Rev. Neurosci. 2, 772-779.

Kemphues, K. (2000). PARsing embryonic polarity. Cell 101, 345-348.Khazaei, M. R. and Puschel, A. W. (2009). Phosphorylation of the parpolarity complex protein Par3 at serine 962 is mediated by aurora aand regulates its function in neuronal polarity. J. Biol. Chem. 284, 33571-33579.

Khokhlatchev, A., Rabizadeh, S., Xavier, R., Nedwidek, M., Chen, T., Zhang,X. F., Seed, B. and Avruch, J. (2002). Identification of a novel Ras-regulatedproapoptotic pathway. Curr. Biol. 12, 253-265.

Lin, Y., Khokhlatchev, A., Figeys, D. and Avruch, J. (2002). Death-associatedprotein 4 binds MST1 and augments MST1-induced apoptosis. J. Biol. Chem.277, 47991-48001.

Lorber, B., Howe, M. L., Benowitz, L. I. and Irwin, N. (2009). Mst3b, an Ste20-like kinase, regulates axon regeneration in mature CNS and PNS pathways.Nat. Neurosci. 12, 1407-1414.

Moshnikova, A., Frye, J., Shay, J. W., Minna, J. D. and Khokhlatchev, A. V.(2006). The growth and tumor suppressor NORE1A is a cytoskeletal protein thatsuppresses growth by inhibition of the ERK pathway. J. Biol. Chem. 281, 8143-8152.

Moshnikova, A., Kuznetsov, S. and Khokhlatchev, A. V. (2008). Interaction ofthe growth and tumour suppressor NORE1A with microtubules is not requiredfor its growth-suppressive function. BMC Res. Notes 1, 13.

Nakayama, M., Goto, T. M., Sugimoto, M., Nishimura, T., Shinagawa, T., Ohno,S., Amano, M. and Kaibuchi, K. (2008). Rho-kinase phosphorylates PAR-3and disrupts PAR complex formation. Dev. Cell 14, 205-215.

Nishimura, T., Kato, K., Yamaguchi, T., Fukata, Y., Ohno, S. and Kaibuchi, K.(2004). Role of the PAR-3-KIF3 complex in the establishment of neuronalpolarity. Nat. Cell Biol. 6, 328-334.

Oh, S., Lee, D., Kim, T., Kim, T. S., Oh, H. J., Hwang, C. Y., Kong, Y. Y.,Kwon, K. S. and Lim, D. S. (2009). Crucial role for Mst1 and Mst2 kinasesin early embryonic development of the mouse. Mol. Cell. Biol. 29, 6309-6320.

Ohno, S. (2001). Intercellular junctions and cellular polarity: the PAR-aPKCcomplex, a conserved core cassette playing fundamental roles in cell polarity.Curr. Opin. Cell Biol. 13, 641-648.

Ortiz-Vega, S., Khokhlatchev, A., Nedwidek, M., Zhang, X. F., Dammann, R.,Pfeifer, G. P. and Avruch, J. (2002). The putative tumor suppressor RASSF1Ahomodimerizes and heterodimerizes with the Ras-GTP binding protein Nore1.Oncogene 21, 1381-1390.

Paddison, P. J., Caudy, A. A., Bernstein, E., Hannon, G. J. and Conklin, D. S.(2002). Short hairpin RNAs (shRNAs) induce sequence-specific silencing inmammalian cells. Genes Dev. 16, 948-958.

Pan, D. (2007). Hippo signaling in organ size control. Genes Dev. 21, 886-897.

Park, J., Kang, S. I., Lee, S. Y., Zhang, X. F., Kim, M. S., Beers, L. F., Lim, D. S.,Avruch, J., Kim, H. S. and Lee, S. B. (2010). Tumor suppressor ras associationdomain family 5 (RASSF5/NORE1) mediates death receptor ligand-inducedapoptosis. J. Biol. Chem. 285, 35029-35038.

Praskova, M., Khoklatchev, A., Ortiz-Vega, S. and Avruch, J. (2004).Regulation of the MST1 kinase by autophosphorylation, by the growthinhibitory proteins, RASSF1 and NORE1, and by Ras. Biochem. J. 381, 453-462.

Sakakibara, A., Sato, T., Ando, R., Noguchi, N., Masaoka, M. and Miyata, T.(2014). Dynamics of centrosome translocation and microtubule organization inneocortical neurons during distinct modes of polarization. Cereb. Cortex 24,1301-1310.

Scheel, H. and Hofmann, K. (2003). A novel interaction motif, SARAH, connectsthree classes of tumor suppressor. Curr. Biol. 13, R899-R900.

Schmoranzer, J., Fawcett, J. P., Segura, M., Tan, S., Vallee, R. B., Pawson, T.and Gundersen, G. G. (2009). Par3 and dynein associate to regulate localmicrotubule dynamics and centrosome orientation during migration. Curr. Biol.19, 1065-1074.

Schwamborn, J. C. and Puschel, A. W. (2004). The sequential activity of theGTPases Rap1B and Cdc42 determines neuronal polarity. Nat. Neurosci. 7,923-929.

Sherwood, V., Recino, A., Jeffries, A., Ward, A. and Chalmers, A. D. (2010).The N-terminal RASSF family: a new group of Ras-association-domain-containing proteins, with emerging links to cancer formation. Biochem. J. 425,303-311.

Shi, S. H., Jan, L. Y. and Jan, Y. N. (2003). Hippocampal neuronal polarityspecified by spatially localized mPar3/mPar6 and PI 3-kinase activity. Cell 112,63-75.

Song, H., Mak, K. K., Topol, L., Yun, K., Hu, J., Garrett, L., Chen, Y., Park, O.,Chang, J., Simpson, R. M. et al. (2010). Mammalian Mst1 and Mst2 kinasesplay essential roles in organ size control and tumor suppression. Proc. Natl.Acad. Sci. USA 107, 1431-1436.

Stegert, M. R., Tamaskovic, R., Bichsel, S. J., Hergovich, A. andHemmings, B. A. (2004). Regulation of NDR2 protein kinase by multi-sitephosphorylation and the S100B calcium-binding protein. J. Biol. Chem. 279,23806-23812.

Stegert, M. R., Hergovich, A., Tamaskovic, R., Bichsel, S. J. and Hemmings,B. A. (2005). Regulation of NDR protein kinase by hydrophobic motif

RESEARCH ARTICLE Journal of Cell Science (2014) 127, 3463–3476 doi:10.1242/jcs.146696

3475

Jour

nal o

f Cel

l Sci

ence

phosphorylation mediated by the mammalian Ste20-like kinase MST3.Mol. Cell.Biol. 25, 11019-11029.

Ultanir, S. K., Hertz, N. T., Li, G., Ge, W. P., Burlingame, A. L., Pleasure,S. J., Shokat, K. M., Jan, L. Y. and Jan, Y. N. (2012). Chemicalgenetic identification of NDR1/2 kinase substrates AAK1 and Rabin8Uncovers their roles in dendrite arborization and spine development. Neuron73, 1127-1142.

van der Weyden, L., Tachibana, K. K., Gonzalez, M. A., Adams, D. J., Ng, B. L.,Petty, R., Venkitaraman, A. R., Arends, M. J. and Bradley, A. (2005). TheRASSF1A isoform of RASSF1 promotes microtubule stability and suppressestumorigenesis. Mol. Cell. Biol. 25, 8356-8367.

Vichalkovski, A., Gresko, E., Cornils, H., Hergovich, A., Schmitz, D. andHemmings, B. A. (2008). NDR kinase is activated by RASSF1A/MST1 inresponse to Fas receptor stimulation and promotes apoptosis. Curr. Biol. 18,1889-1895.

Witte, H., Neukirchen, D. and Bradke, F. (2008). Microtubule stabilizationspecifies initial neuronal polarization. J. Cell Biol. 180, 619-632.

Yu, F. X. and Guan, K. L. (2013). The Hippo pathway: regulators and regulations.Genes Dev. 27, 355-371.

Zallen, J. A, Peckol, E. L., Tobin D. M. and Bargmann, C. I. (2000). Neuronal cellshape and neurite initiation are regulated by the Ndr kinase SAX-1, a member ofthe Orb6/COT-1/warts serine/threonine kinase family. Mol. Biol. Cell 11, 3177-3190.

Zhao, B., Tumaneng, K. and Guan, K. L. (2011). The Hippo pathway in organsize control, tissue regeneration and stem cell self-renewal. Nat. Cell Biol. 13,877-883.

Zhou, D., Conrad, C., Xia, F., Park, J. S., Payer, B., Yin, Y., Lauwers, G. Y.,Thasler, W., Lee, J. T., Avruch, J. et al. (2009). Mst1 and Mst2 maintainhepatocyte quiescence and suppress hepatocellular carcinoma developmentthrough inactivation of the Yap1 oncogene. Cancer Cell 16, 425-438.

RESEARCH ARTICLE Journal of Cell Science (2014) 127, 3463–3476 doi:10.1242/jcs.146696

3476