rapid diagnosis of leptospirosis by multiplex pcr

7/29/2019 Rapid Diagnosis of Leptospirosis by Multiplex PCR

1/8

www.mjms.usm.my Penerbit Universiti Sains Malaysia, 2012For permission, please email:[email protected]

Original Article Rapid Diagnosis of Leptospirosis byMultiplex PCR

Siti Aminah Ahmed1, Doblin Anak SAndAi1, Suzana muSA2,Chee Hock hoe1, Mehdi RiAdzi3, Kwok Leong LAu2,

Thean Hock TAng1

1 Advanced Medical & Dental Institute, Universiti Sains Malaysia, 11800,Penang, Malaysia

2 Institute for Research in Molecular Medicine, Universiti Sains Malaysia,11800, Penang, Malaysia

3 School of Pharmacy, Universiti Sains Malaysia, 11800, Penang, Malaysia

Submitted:28 Nov 2011Accepted:9 Jan 2012

Abstract

Background: Traditionally, the most common diagnostic approach used for diagnosingleptospirosiswasthedemonstrationofimmune-seroconversioninacuteandconvalescentpatientserumsamples.Recently,avarietyofmoleculartechniques,includingconventionalandreal-timepolymerase chain reaction (PCR), have been developed for the specic detection of pathogenicbacteriafromthegenusLeptospira.PCRisasensitive,specic,andrapidtechniquethathasbeensuccessfullyusedtodetectseveralmicroorganisms;includingthoseofclinicalsignicance. Methods: In this study, we developed a multiplex PCR (mPCR) assay for detectingLeptospirasDNA.ThemPCRassaydetectsboththe16SrRNAgeneandthemajoroutermembranelipoproteingene,whichisknownasLipL32.Representativeserovarsweretestedfrom10speciesofLeptospiraand23otherspeciesofbacteria. Results: A positive result was obtained from all leptospiral serovars. The amplicationsensitivityforthemultiplexassaywas21.8pgand1103leptospires/ml.ThismPCRassayhasthepotentialtofacilitatearapidandsensitivediagnosisforacuteleptospirosis.

Conclusion: ThemPCRassaydevelopedinthisstudycanbeusedfortheearlydetectionof

leptospirosis.TheLipL32genecouldalsoserveasanothertargettoaidintheefcientdetectionofleptospiralinfectionbecauseusing2setsofprimersinmPCRincreasesthesensitivityandspecicityofthetest.

Keywords: 16S rRNA, leptospirosis, LipL32, mPCR, nucleic acid amplication test

Introduction

Leptospirosis is one of the most commonzoonoses in the world. Recently, leptospirosis

has been recognised as a re-emerging infectiousdisease among animals and humans (13).Although leptospirosis is distributed worldwide(4), it is most common in temperate andtropical climates. However, leptospirosis has thepotential to become even more prevalent withthe anticipated rise in global temperature (2,5,6).It was reported that the whole region of SoutheastAsia is an endemic area for leptospirosis (7),including Malaysia as several outbreaks havebeen recorded. An outbreak of acute febrile illnesswas reported among the athletes participatingin the Eco-Challenge located in Sabah, and

the Segama River was found to be the primarysource of infection (8). Furthermore, 46 cases

were identied in an outbreak in Kampung,Kebatu, Beaufort, Sabah that was associated with

swimming in a creek near an oil palm plantation(9) and a few outbreaks involving individuals(10). Lastly, there was a report of a suddenoutbreak of acute febrile illness following theheavy rain and oods in the southern state ofJohor (11,12).

Leptospirosis is caused by pathogenicbacteria from the genus Leptospira, whichis a spirochete of the family Leptospiraceaeand the order Spirochatales. Approximately10 million people are affected by leptospirosisthroughout the year with a 5%25% fatality rate(5). However, with early detection and treatment,

leptospirosis is a treatable disease. Nevertheless,early detection and treatment depends on

9Malays J Med Sci. Jul-Sep 2012; 19(3): 9-16
mailto:aminah_ahmad%40amdi.usm.edu.my?subject=mailto:aminah_ahmad%40amdi.usm.edu.my?subject=mailto:aminah_ahmad%40amdi.usm.edu.my?subject=mailto:aminah_ahmad%40amdi.usm.edu.my?subject=mailto:aminah_ahmad%40amdi.usm.edu.my?subject=


2/8

10 www.mjms.usm.my

Malays J Med Sci. Jul-Sep 2012; 19(3): 9-16

epidemiological factors, symptoms and laboratorytests. A large array of tests for this diseasehave been described, including microscopicdemonstration, molecular diagnosis, isolation andidentication of leptospires, as well as serologicaldiagnosis, such as the microscopic agglutinationtest (MAT) (3). There are several limitationsto MAT, including the false-negative resultsobtained early in the course of the disease, thecross-reactivity excluding the ability to distinguishbetween serovars, the highly labour-intensive andtime-consuming nature of the technique, and therequirement of a large panel of live leptospires (1).Thus, MAT is a complex test to control, perform,and interpret.

Enzyme-linked immunosorbent assay(ELISA) and micro-capsular agglutination test

(MCAT) are serological tests that reduce thefalse-positives associated with vaccinal responsesand provide earlier detection. In Australia, itwas found that the IgM ELISA test could exhibitnotably high sensitivity (100%) for the detectionof acute leptospirosis (13). However, the samecommercial assay demonstrated poor diagnosticaccuracy (sensitivity of 60.9% and specicityof 65.6%) using admission serum in Laos (14).Bacterial culture, MAT, and ELISA can beapplied in well-equipped laboratories by trainedstaff. However, few diagnostic facilities have the

capacity and expertise to perform these testsfor leptospirosis.PCR has been used to detect leptospiral

DNA in samples obtained from animals (15,16)and human (1722). In this study, we havedeveloped an mPCR amplication with 2 setsof primers, which will aid in the specic andsensitive detection of Leptospira species. ThemPCR targets the well-known 16s rRNA gene(17), and a newly designed primer that targetsthe LipL32 gene. The LipL32 gene is a majorouter-membrane lipoprotein from the genus

Leptospira. Furthermore, the LipL32 gene is animportant virulence factor conned to pathogenicstrains of all Leptospira species. The mPCRcould be used as an alternative to the traditionaldiagnostic methods, such as leptospiral isolationand the MAT serological assay.

Materials and Methods

Organisms and growth conditionsLeptospiral serovars were obtained from

Universiti Putra Malaysia, Selangor. Leptospirawere grown in Ellinghausen, McCullough,

Johnson, and Harris (EMJH) medium (Becton-Dickinson Biosciences, Detroit, US) at 28 C

and were periodically subcultured in freshmedium. Commonly encountered commensaland pathogenic bacteria cultures from our ownstock culture were used as controls.

Genomic DNA isolation and puricationUsing an in-house genomic extraction

protocol, DNA extraction was carried out on thecell pellets of leptospiral and bacterial cultures.Briey, 1.5 mL of culture isolate was centrifugedat 13000 g for 5 minutes to obtain approximately0.1 g of pellet. A solution of 200 L of 20%sucrose, 50 mM Tris-HCl, 1% SDS, 0.2 N NaOH,25 mM EDTA, and 0.1 M NaCl was added andthe mixture was inverted gently. The mixturewas subsequently incubated at room temperaturefor 5 minutes. For protein precipitation, 200 L

of 3 M NaOAc (pH 5.2) was added and themixture was gently inverted. The mixture wassubsequently spun down at 13 000 g for5 minutes at 4 C to separate the supernatantcontaining the DNA. The clear supernatant wassubsequently placed into a fresh tube and 600 Lof ice-cold 95% ethanol was added to precipitatethe genomic DNA. The mixture was incubated inliquid nitrogen for 15 minutes and spun down at13 000 g for 15 minutes at 4 C to pellet theDNA. Next, the pellet was washed with 1 mL of80% ethanol, air-dried, and resuspended in

50 L of sterile distilled water. The concentrationof the DNA extract was measured using aspectrophotometer and stored at 20 C.

Primers design and PCR amplicationOligonucleotide sequences of Lep F,

Lep R, Lau01, and Lau02 used for the mPCRamplication of the Leptospira species are listedin Table 1. Lep F and Lep R primer (17)amplied a 330 bp sequence from the16S rRNA gene. The Lau01 and Lau02 primerpair was designed by aligning the LipL32gene (accession number: NC 005823) usingthe ClustalW programme (EMBL, UK) (23),and primers were selected using the Primer3programme (Whitehead, US) (24). Lau01 andLau02 primer pair amplies a 660 bp sequenceof the LipL32 gene. The specicity of the primerswas bioinformatically veried using the Primer-Blast programme (NCBI, MD).

The nal optimised conditions for themPCR were as follows: PCR was performedwith the 1X Colorless GoTaq Flexi Buffer(Promega, US), 200 M (each) deoxynucleosidetriphosphates, 1.5 mM MgCl2, 1U of GoTaq

Flexi DNA Polymerase (Promega, US), 5 Mof Lau primers, and 10 M of Lep primers in


3/8

Original Article | Development of mPCR for leptospirosis

www.mjms.usm.my 11

a total 20 L reaction volume. Amplicationwas performed in a thermocycler (Bio-Rad, US)with initial denaturation at 94 C for 3 minutesfollowed by 29 cycles of denaturation at 94 Cfor 30 seconds, primer annealing at 58 C for30 seconds, and DNA extension at 72 C for40 seconds before the nal extension step at 72 Cfor 5 minutes to complete synthesis of all strands.

Detection of amplied DNAsPCR products were analysed by gel

electrophoresis. Next, 10 L with 2 L of gelloading buffer of each sample was loadedonto a 1.2% electrophoresis-grade agarose gel(Bio-Rad, California, US) and run in 1X TAEbuffer at 100 V for 45 minutes. Gels were stainedwith ethidium bromide and visualised using aUV transilluminator (UVP Inc., CA).

Detection limits and specicity of primersThe detection limits and sensitivity of

the mPCR was determined using a serialdilution of leptospiral DNA mix and by urine-spiking experiments. L. interrogans serovarIcterohaemorrhagiae was used for the spikingof urine sample. Leptospiral cell concentrationwas measured by spectrophotometry at anoptical density (OD) of 0.14 at 420 nm(approximately 5 108 cells/ml) (33). Next,400 l of the cultured Leptospira in liquidEMJH (number of cells as 2 108 cells) was added

to 1.6 ml of urine from a healthy human (nalconcentration of cells is 1 108 cells). A 10-foldserial dilution was subsequently preparedby diluting the spiked urine sample withurine of a healthy human. Next, 1 ml ofeach dilution was used for DNA extraction.Leptospires in each 1 ml dilution wereconcentrated by centrifugation at 13 000 g for15 minutes and washed once with 1 ml PBS.Next, 500 L of chelex slurry (10% 200400mesh) (Bio-RAD, US) was added and thesolution was vortexed for 15 seconds andquickly spun for 1 minute. The samples were

subsequently incubated in a 100 C water bathfor 20 minutes. The samples were vortexed for

15 seconds and spun at 13 000 g for 20 minutesto ensure that all contents were in the bottomof the microcentrifuge tube. Lastly, 5 L ofthe supernatant was used for the mPCR.

The specicity of the primers was evaluatedwith 9 serogroups identied in Malaysia and23 strains of commensal and pathogenic bacteria(non-Leptospira) commonly encountered inclinical specimens.

Results

Optimisation of mPCR amplicationBecause primer-dimers and other nonspecic

products may interfere with the specic productsof mPCR, the reaction often requires extensiveoptimisation. Amplication specicity is alsoinuenced by other factors, such as the MgCl2concentration in the PCR buffers and primer

concentration. We split our mPCR optimisationstrategy into 3 main steps: annealing temperature,amount of primers used, and concentrationsof MgCl2 in the PCR reaction. We beganthe optimisation strategy by performing themPCR in standard 20 L reactions (consisting of200 mM dNTP, 1.5 mM MgCl2, 10 pmole each ofprimers, 1X PCR buffer, 1 unit Taq polymerase,and 218 ng of template DNA from a mixture ofleptospiral genomic DNA).

Optimisation of annealing temperature

The annealing temperature in a PCR usuallydepends directly on the length and compositionof the primer(s). In our mPCR, we chose todetect 2 targets: 16S rRNA and the leptospiral

LipL32 gene. For the 16S rRNA target, we tookadvantage of previously reported primers (17).Concerning the LipL32 gene, we extracted thesequence from genebank and designed newprimers. Recently, the LipL32 gene has beensuggested to be a target for nested and real-timePCR (2527).

We rst optimised the multiplex PCRamplication conditions using both the primer

sets of Lep-F-Lep-R and Lau01-Lau02 with thegenomic DNA mixture from the extracted DNA.

Table1: Primers for the mPCR amplication ofLeptospira species

Oligonucleotidesequence5-3 Length(bp) Ampliconsize(bp) Ref.

Lep F: GGCGGCGCGTCTTAAACATG 20 330 17

Lep R: TCCCCCCATTGAGCAAGATT 20 330 17Lau01: ACTCTTTGCAAGCATTACCGC 21 660 This study

Lau02: AGCAGACCAACAGATGCAACG 21 660 This study


4/8

12 www.mjms.usm.my


A gradient PCR was carried out to determinethe best annealing temperature using a BioRADMyCycler Thermocycler. Figure 1a shows theresult of the gradient PCR at an annealing

temperature of 50 C60 C. The annealingtemperature of 58 C was chosen as the optimalannealing temperature for the mPCR.

Optimisation of primer concentrationThe quantity of DNA primer(s) supplied to

the PCR may inuence the results of the mPCR.Extremely high or low primer amounts shouldbe avoided because high primer concentrationsmay inhibit the multiplex reaction, whereaslow amounts may not be sufcient. In orderto amplify all of the specic PCR productswith equal efciency, the concentrations of

the individual primer pairs were optimised.Figure 1c shows that the best combinations ofprimers were 5 M and 10 M for Lau01-Lau02and Lep-F-Lep-R primers, respectively.

Optimisation of MgCl2 concentrationFinally, optimisation was carried out to

determine the best amount of MgCl2 to be addedto each reaction. The optimal MgCl2 concentrationyields maximal amplication of a specic targetwith minimal non-specic products and primer-dimer formation. In order to nd the optimal

Figure 1a: The optimisation of the reactionsannealing temperature. Theoptimum annealing temperaturewas 58.0 C.

Figure 1c: The optimisation of the primerconcentration. The optimal ratio ofprimers was 5 M of Lau primersand 10 M of Lep primers. Lane 1:Lau 10 M and Lep 10 M, Lane 2:Lau 5 M and Lep 10 M Lane 3:

Lau 5 M and Lep 15 M, Lane 4:Lau 5 M and Lep 20 M.

amount, MgCl2 concentration was variedbetween 1.5 mM4.0 mM. As shown in Figure 1b,1.5 mM of MgCl2 was selected as the optimalconcentration.

Detection limits of mPCRThe sensitivity and detection level of the

mPCR was determined using a serial dilution ofgenomic DNA mix from leptospiral strains andby urine-spiking. The PCR was performedusing the optimised conditions, as mentionedpreviously. The lowest limit of detection usinggenomic DNA of Leptospira in this assay wasfound to be 21.8 pg, as shown in Figure 2.However, the sensitivity of the test using urinesamples spiked with serial dilutions of a pureculture of leptospires was 1 103 cells/ml urine

(Figure 3).

Specicity of multiplex PCR10 leptospiral serovars representative

of different serogroups commonly isolatedin Malaysia were analysed to determine thespecicity of the mPCR. Our results showedthat each strain produced a positive signalfor both targeted genes (a 330 bp band anda 660 bp band) (Figure 4). The specicityof the oligonucleotide primer sets were alsotested against a number of commensal and


5/8


www.mjms.usm.my 13

Figure 2: The sensitivity of mPCR in terms ofthe amount of genomic DNA mixtureused as template. The agarose gel

revealed that the mPCR was able todetect up to 21.8 pg of genomic DNA.

Figure3: The sensitivity of the mPCR tested onspiked urine samples. M: PCR marker(NEB), Lane 1: 1 108 leptospires/ml, Lane 2: 1 107 leptospires/ml, Lane 3: 1 106 leptospires/ml, Lane 4: 1 105 leptospires/ml,Lane 5: 1 x 104 leptospires/ml, Lane6: 1 103 leptospires/ml, Lane 7:1 102 leptospires/ml, Lane 8:

1 10 leptospires/ml, Lane 9:1 leptospires/ml.

pathogenic bacteria (Yersinia enterocolitica,Methicillin Resistance Staphylococcus aureus,Psuedomonas aeruginosa, Enterococcusspecies, Burkholderia pseudomallei, Shigella

exneri, Enteropathogenic Escherichia colipolyval, Shigella boydii, Staphylococcus aureus,Salmonella paratyphi B, Corynebacteriumdiphtheria, Shigella dysenteriae, Bacillussubtilis, Morganella morganii, Enteropathogenic

Escherichia coli, Staphylococcus saprophyticus,Diphteroid, Vibrio cholera, Providencia stuarti,Trepanoma pallidum, Flovobacterium species,

Shigella sonnei, and Klebsiella species) commonlyencountered in clinical specimens. All of thenon-Leptospira bacteria commonly encounteredin clinical specimens were negative with both

Figure 1b: The optimisation of the MgCl2concentration. The optimal amountof MgCl2 was 1.5 mM.

of the primer sets used in the multiplex PCR(results not shown).

Discussion

Detection of the pathogenic Leptospiraspecies is important for the early diagnosis ofleptospirosis because it provides unequivocalevidence of active infection. However, theapplication of this strategy was hampered by thelimitation of conventional methods. As a result,clinical diagnosis is often based on serologicaltests, despite the fact that antibodies begin toappear 810 days after the onset of the illness.

The use of PCR is now gaining popularityfor the diagnosis of fastidious organisms,


6/8

14 www.mjms.usm.my


Figure 4: The specicity of the mPCR on Leptospira species. 10 serovars ofbacteriologically identiedLeptospira were used from Malaysia. LaneM: PCR marker (New England Biolab, US), Lane 1: L. interrogansserovar Canicola, Lane 2: L. interrogans serovar Pomona, Lane 3:

L. interrogans serovar Australis, Lane 4: L. interrogans serovar

Bataviae, Lane 5: L. interrogans serovar Pyrogenes, Lane 6:L. interrogans serovar Grippotyphosa, Lane 7: L. interrogans serovarIcterohaemorrhagiae, Lane 8: L. interrogans serovar Hebdomadis,Lane 9: L. borgpeterseniiserovar Ballum, Lane 10: L. kmetyiserovarMalaysia, Lane 11: Negative control.

including Leptospira. This method offersseveral key advantages over the gold standardtechniques of culture and MAT, such as a fasterturn-around time, less contamination, andelimination of the need for the production of

reference hyperimmune antisera to determinethe identity of the cultured organism. To date,most of the reported conventional or nested PCRdiagnosis are based on the detection of a singletarget, such as the 16S rRNA gene (17,18,28) orthe 23S rDNA (29), or using G1/G2 primerpairs (13,30).

In this report, we described the developmentof an mPCR for the rapid detection of leptospiralinfection based on the amplication of 2 genes:16S rRNA gene and LipL32 gene. The mPCRused in this study offers further advantage

over that of conventional PCR because ituses 2 sets of primers that increase thespecic amplication (330 bp and/or 660 bp).Therefore, pathogenic strains can be detectedrapidly for diagnostic purposes. It was alsoshown that the mPCR is a notably sensitive test,detecting up to 21.8 pg of genomic DNA and1 103 leptospires/ml in seeded urine. Althoughreal-time PCR has increasingly gained popularity(due to the elimination of the agarose gelelectrophoresis step), the method is still relativelyexpensive for a small laboratory, especially inthe third-world countries where the disease ispredominant. Therefore, conventional PCR is

still a better choice because this methodologyis not technically demanding and uses onlycommercially available reagents. Therefore,this technique can be applied to diagnosticlaboratories to help in identifying pathogenic

leptospires, especially in developing countries.The mPCR uses 2 sets of primers, which

are based upon amplication of the Leptospira16S rRNA gene that is conserved throughoutthe bacterial kingdom, as well as another setof primers detecting the leptospiral majorouter-membrane lipoprotein LipL32 gene. The

LipL32 gene is highly specic and is absentfrom nonpathogenic leptospira or any othercommensal pathogenic bacteria. The leptospiralmajor outer-membrane lipoprotein (LipL32)is expressed during infection by all pathogenic

strains and can prove to be an importantcandidate antigen for the development of asensitive and specic test for leptospirosis(31,32).

Even though the study started with thedetection ofLeptospira species using extractedgenomic DNA, the results were notablyencouraging, and we believe that this methodcan be used as a valuable tool in the earlydiagnosis of human leptospirosis. However,clinical evaluation to conrm the potential ofthe PCR protocol is needed. To monitor theeffectiveness of DNA extraction and the presenceof any inhibitory factors in the PCR, an internal


7/8


www.mjms.usm.my 15

control that will be co-amplied is to be includedin this multiplex PCR. The conversion of thecurrent method into a thermo-stabilised PCRwill be undertaken in future work.

Conclusion

In summary, the mPCR was shown to bea promising adjunct to the early diagnosis ofleptospirosis. The LipL32 gene can be anothertarget for the efcient detection of leptospiralinfection because the 2 sets of primers in anmPCR increases the sensitivity and specicityof the test. On the basis of its sensitivity andspecicity, the mPCR method described hereshould be a useful tool for the early diagnosisof leptospirosis, irrespective of serovar.

Acknowledgements

We gratefully acknowledge and thankProfessor Abdul Rani Bahaman, Universiti PutraMalaysia, 43400 Serdang, Selangor, Malaysiafor providing leptospiral serovars. This workis dedicated to late Dr. Lau Kwok Leong whoinitiated the project. The work was supported byUniversiti Sains Malaysia short-term grant no.304/CIPPT/638154.

Authors ContributionsConception and design: MS, THT, KLLObtaining of funding, analysis and interpretationof the data: THTProvision of study materials or patients, collectionand assembly of the data: MR, SAADrafting of the article: DAS, SAACritical revision of the article: SAAFinal approval of the article: DAS, THTAdministrative, technical or logistic support:MS, CHH

Correspondence

Ms Siti Aminah AhmedMSC in Molecular and Cell Biology

Infectious Diseases ClusterAdvance Medical and Dental Institute

Universiti Sains Malaysia22-1 Lot 13, Persiaran Seksyen 4/9Bandar Putra Bertam

13200 Kepala BatasPulau Pinang, MalaysiaTel: +604-562 2888 ext. 2317

Email: [email protected]

References

1. Plank R, Dean D. Overview of the epidemiology,microbiology, and pathogenesis ofLeptospira spp. inhumans.Microbes Infect. 2000;2(10):12651276.

2. Levett PN. Leptospirosis. Clin Microbiol Rev. 2001;14(2):296326.

3. Levett PN. Leptospirosis: A forgotten zoonosis? ClinApp Immunol Rev. 2004;4(6):435448.

4. Bharti AR, Nally JE, Ricaldi JN, Matthias MA, DiazMM, Lovett MA, et al. Leptospirosis: A zoonoticdisease of global importance.Lancet Infect Dis. 2003;3(12):757771.

5. Ko AI, Reis MG, Dourado CMR, Johnson Jr WD, RileyLW & the Salvador Leptospirosis Study Group. Urbanepidemic of severe leptospirosis in Brazil. Lancet

Infect Dis. 1999;354(9181):820825.

6. Pappas G, Papadimitriou P, Siozopoulou V, ChristouL, Akritidis N. The globalization of leptospirosis:

Worldwide incidence trends. Int J Infect Dis.2008;12(4):351357.

7. Laras K, Van CB, Bounlu K, Tien NTK, Olson JG,Thongchanh S, et al. The importance of Leptospirosisin Souteast Asia. Am J Trop Med Hyg. 2002;67(3):278286.

8. Sejvar J, Bancroft E, Winthrop K, Bettinger J, BajaniM, Bragg S, et al. Leptospirosis in Eco-Challengeathletes, Malaysian Borneo, 2000. Emerg Infect Dis.2003;9(6):702707.

9. Koay TK, Nirmal S, Noitie L, Tan E. Anepidemiological investigation of an outbreak ofleptospirosis associated with swimming, Beaufort,Sabah.Med J Malaysia. 2004;59(4):5.

10. Thiruventhiran T, Tan SY. The patient who had apicnic at a waterfall and presented with haemoptysisand renal failure.Nephrol Dial Transpl. 2000;15(5):727728.

11. Al-Jazeera Asia-Pacic News. Fatal oods strikesouth Malaysia [Internet]. Doha (QA): Al-JazeeraEnglish; 2007 [cited 2007 Jan 15]. Availablefrom: http://english.aljazeera.net/news/asia-pacific/2007/01/2008525131241424879.html.

12. Agence France-Presse (AFP). Malaysia battlesoutbreaks of disease in ood zone [Internet].Reliefweb; 2007 [cited 2007 17 Jan]. Available from:http://www.reliefweb.int/rw/rwb.nsf/db900SID/LSGZ-6XJDMG?OpenDocument&RSS20=03.

13. Winslow WE, Merry DJ, Pirc ML, Devine PL.Evaluation of a commercial enzyme-llinkedimmunosorbent assay for detection of immunoglobulinM antibody in diagnosis of human leptospiralinfection.J Clin Microb. 1997;35(8):19381942.

14. Blacksell SD, Smythe L, Phetsouvanh R, Dohnt M,Hartskeerl R, Symonds M, et al. Limited diagnosiccapacities of two commercial assays for the detectionofLeptospira immunoglobulin M antibodies in Laos.

Clin Vaccine Immunol. 2006;13(10):11661169.


8/8

16 www.mjms.usm.my


15. Bomm MRQ, Barbosa-Stancioli EF, Koury MC.Detection of pathogenic leptospires in urine fromnaturally infected cattle by nested PCR. Vet J.2008;178(2):251256.

16. Lilenbaum W, Varges R, Brandao FZ, Cortez A, de

Souza SO, Brandao PE, et al. Detection ofLeptospiraspp. in semen and vaginal uids of goats and sheep

by polymerase chain reaction. Theriogenology.2008;69(7):837842.

17. Merien F, Amouriaux P, Perolat P, Baranton G,Girons IS. Polymerase chain reaction for detection of

Leptospira spp. in clinical samples. J Clin Microbiol.1992;30(9):22192224.

18. Bal AE, Gravekamp C, Hartskeerl RA, Meza-BrewsterJD, Korver H, Terpstra WJ. Detection of leptospiresin urine by PCR for early diagnosis of leptospirosis. JClin Microbiol. 1994;32(8):18941898.

19. Romero EC, Billerbeck AEC, Lando VS, Camargo ED,

Souza CC, Yasuda PH. Detection ofLeptospira DNAin patients with aseptic meningitis by PCR. J Clin

Microbiol. 1998;36(5):14531455.

20. Sugathan S, Varghese TP. Multiplex PCR onleptospiral isolates from Kolenchery, Kerala, India.

Indian J Med Microbiol. 2005;23(2):114116.

21. Fonseca C de A, Teixeira MMG, Romero EC,Tengan FM, da Silva MV, Shikanai-Yasuda MA.

Leptospira DNA detection for the diagnosis of humanleptospirosis.J Infect. 2006;52(1):1522.

22. Ooteman MC, Vago AR, Koury MC. Evaluation ofMAT, IgM ELISA and PCR methods for the diagnosisof human leptospirosis. J Microbiol Methods.

2006;65(2):247257.

23. Larkin MA, Blackshields G, Brown NP, ChennaR, McGettigan PA, McWilliam H, et al. Clustal

W and Clustal X version 2. Bioinformatics.2007;23(21):29472948.

24. Rozen S, Skaletsky HJ. Primer3 on the WWW forgeneral users and for biologist programmers. In:Krawetz S, Misener S, editors.Bioinformatics methodsand protocols: Methods in molecular biology. NewJersey: Humana Press; 2000. p. 365386.

25. Levett PN, Morey RE, Galloway RL, Turner DE,Steigerwalt AG, Mayer LW. Detection of pathogenicleptospires by real-time quantitative PCR. J Med

Microbiol. 2005;54(1):4549.

26. Tansuphasiri U, Chanthadee R, Phulsuksombati D,

Sangjun N. Development of a duplex-polymerasechain reaction for rapid detection of pathogenic

Leptospira. Southeast Asian J Trop Med PublicHealth. 2006;37(2):297308.

27. Cheema PS, Srivastava SK, Amutha R, Singh S, SinghH, Sandey M. Detection of pathogenic leptospires inanimals by PCR based on lipL21 and lipL32 genes.

Indian J Exp Biol. 2007;45(6):568573.

28. Smythe LD, Smith IL, Smith GA, Dohnt MF,Symonds ML, Barnett LJ, et al. A quatitative PCR(TaqMan) assay for pathogenic Leptospira spp.

BMC Infect Dis. 2002;2(13):17.

29. Kositanont U, Rugsasuk S, Leelaporn A,

Phulsuksombati D, Tantitanawat S, Naigowit P.Detection and differentiation between pathogenicand saprophytic Leptospira spp. by multiplexpolymerase chain reaction. Diagn Microbiol Infect

Dis. 2007;57(2):117122.

30. Oliveira MAA, Caballero OL, Vago AR, Harskeerl RA,Romanha AJ, Pena DJ, et al. Simpson AJG, KouryMC. Low-stringency single specic primer PCRfor identication of Leptospira. J Med Microbiol.2003;52(2):127135.

31. Haake DA, Chao G, Zuerner RL, Barnett JK, BarnettD, Mazel M, et al. The leptospiral major outermembrane protein LipL32 is a lipoprotein expressedduring mammalian infection. Infect Immun.2000;68(4):22762285.

32. Yang CW, Wu MS, Pan MJ, Hsoeh WJ, Vandewalle A,Huang CC. The Leptospira outer membrane proteinLipL32 induces tubulointerstitial nephritis-mediatedgene expression in mouse proximal tubule cells.J Am

Soc Nephrol. 2002;13(8):20372045.

33. Schreier S, Triampo W, Doungchawee G, Triampo D,Chadsuthi S. Leptospirosis research:Fast, easy, andreliable enumeration of mobile leptospires. Biol Res.2009;42(1):512.

rapid diagnosis of leptospirosis by multiplex pcr

Documents