lable at ScienceDirect

Fish & Shellfish Immunology 25 (2008) 533–541

Contents lists avai

Fish & Shellfish Immunology

journal homepage: www.elsevier .com/locate / fs i

Development of adaptive immunity in rainbow trout, Oncorhynchus mykiss(Walbaum) surviving an infection with Yersinia ruckeri

Martin K. Raida*, Kurt BuchmannDepartment of Veterinary Pathobiology, Section of Fish Diseases, Faculty of Life Sciences, The University of Copenhagen, Stigbøjlen 7, DK-1870 Frederiksberg C, Denmark

a r t i c l e i n f o

Article history:Received 26 March 2008Received in revised form 2 July 2008Accepted 15 July 2008Available online 23 July 2008

Keywords:ImmunityRainbow troutYersinia ruckeriqPCRHost–pathogen interactionImmune responseAdaptive immunity

* Corresponding author. Tel.: þ45 35332701; fax: þE-mail address: mkr@life.ku.dk (M.K. Raida).

1050-4648/$ – see front matter � 2008 Elsevier Ltd.doi:10.1016/j.fsi.2008.07.008

a b s t r a c t

Development of adaptive immunity in rainbow trout (Oncorhynchus mykiss) surviving a primary infec-tion with 5� 105 CFU Yersinia ruckeri O1 (LD50 dose) was investigated by transcriptome analysis of spleentissue. These fish surviving a primary infection showed also a significantly increased survival followinga secondary infection (same dose) when compared to naı̈ve trout. The weight of the rainbow trout spleendoubled during the first 14 days of the primary infection but the affected organs subsequently recoverednormal weight which remained constant during the re-infection period. Gene transcription in the spleenwas measured using Quantitative real-time RT-PCR (qPCR). Samples taken 8 h.p.i., 1, 3, 7, 14 and 28 d.p.i.were compared to PBS-injected control fish sampled at the same time points. The investigated cytokinesand chemokines comprised interleukin (IL)-1b, IL-1 receptor antagonist (Ra), IL-6, IL-8, IL-10, IL-11 andIFN-g, IL-1 receptor I and II (IL-RI and IL-RII). Transcript levels of genes encoding cytokines and receptorswere increased during the primary infection but not during the secondary infection. Changes of T celloccurrence or activity in the spleen during the infections were inferred from the transcript level of T cellreceptor (TCR), CD4 and CD8a genes. No alteration in the expression of MHC class ll and immunoglobulin(Ig)M and IgT was detected during the experiment. The amount of Y. ruckeri O1 in the spleen wasmeasured with a Y. ruckeri 16S ribosomal RNA specific qPCR and this parameter was correlated to theexpression of IL-1b, IL-8 and IL-10 genes with a peak expression at 3 d.p.i. (first infection). The lowtranscript levels of the bacterial gene and the hosts’ immune genes during the re-infection can beinterpreted as a result of development of adaptive immunity. This would explain the relatively fastelimination of the bacteria during the secondary infection whereby the activation of cytokines becomesless pronounced.

� 2008 Elsevier Ltd. All rights reserved.

1. Introduction

Yersinia ruckeri is the aetiological agent of enteric redmouth(ERM) disease or yersiniosis, affecting mainly salmonids [1,2].Although generally well controlled by means of vaccination andantibiotic treatment, this disease has kept on causing outbreaks,especially in endemic areas. In some cases the losses due to thisdisease can be as high as 30–70% of the stock [3]. Protectiveimmunity in rainbow trout against ERM has been known since thefirst commercial fish vaccines based on formalin killed bacteriawere introduced [4]. Recently, transcription of genes encoding bothinnate and adaptive immune parameters in the spleen followingvaccination has been described [5].

The spleen seems to represent a major secondary lymphoidorgan in fish during bacterial infections. Thus, it has been reportedthat antigens are captured by immunocompetent cells at

45 5282742.

All rights reserved.

inflammatory foci and then transported to the spleen for theinitiation of adaptive immune responses [6]. In vaccinated rainbowtrout, antigen trapping takes place in the walls of the splenicellipsoids, which suggests a specific role for these cell clustersduring development of immunity [7]. Further, during Y. ruckeriinfection in rainbow trout a dramatic increase in spleen weight (upto threefold) has been observed and interpreted as a result of influxof cells recruited by inflammatory cytokines [8]. This complies withthe fact that Y. ruckeri counts increase in spleen tissue after chal-lenge [8,9], which is associated with migration of leukocytes fromthe anterior kidney to the blood and the spleen in rainbow troutduring Y. ruckeri infection [9]. Likewise, expression of cytokines andchemokines was increased in the spleen during Y. ruckeri infection,indicating that the spleen is actively involved in rainbow troutimmune responses against this pathogen [8,9]

It is generally agreed that regulation of inflammation resultsfrom a balance between pro- and anti-inflammatory cytokines,which also will minimize the negative effects of the inflammatoryprocesses [10]. However, the immediate activation of the innateimmune response is an important event during induction of the

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541534

adaptive response eventually leading to specific long-termprotection [11]. Also in fish a strict regulation of these two immunebranches is likely to produce an optimal immune response.

The present work contributes to our understanding of thecomplex interactions between humoral and cellular factors inrainbow trout responding to primary and secondary Y. ruckeriinfections. Due to the central role of the spleen in this process theinvestigation is based on a description of the expression of immunerelevant genes in spleen tissue. The work emphasizes genesencoding cytokines, their antagonists, immunoglobulins and T cellmarkers and adds to the notion that these are central elements ofthe adaptive immune response in rainbow trout.

2. Materials and methods

2.1. Fish and rearing conditions

Juvenile rainbow trout (Skinderup strain from Jutland, Den-mark), hatched and reared under pathogen-free conditions (DanishCentre for Wild Salmon, Randers, Denmark), were brought to theexperimental fish keeping facility at the University of Copenhagenwhen reaching a body weight of 4–6 g. The pathogen-free status ofthe fish was confirmed upon their arrival in the laboratory byanalysis for bacterial, parasitic and viral pathogens. The 600 fishwere kept in three 200 l tanks with bio-filters (Eheim, Germany)and maintained at a 12 h light and 12 h dark cycle in aerated (100%oxygen saturation) tap water at 13 �C. They were fed a commercialtrout feed (BioMar, Denmark) (2% biomass per day).

2.2. Bacterial strain

Y. ruckeri serovar I (strain 392/2003), isolated from diseasedrainbow trout in Spain [12], was used for the challenge experi-ments. The bacteria were grown in LB-medium (Oxoid LP0042,Tryptone 10 g, Oxoid LP0021Yeast-extract 5 g, NaCl 5 g, H2O to1000 ml, pH 7.4) at 20 �C for 36 h and enumerated as colonyforming units (CFUs) by the spread plate method on blood agar(Blood agar base CM55 [Oxoid] supplemented with 5% bovineblood).

2.3. Primary and secondary challenge experiments

Primary infection trials were conducted using a total of 400rainbow trout, half of them were used as non-infected control fish.All fish were anaesthetized by immersion in 40 mg/l tricainemethane sulfonate (MS-222, Sigma–Aldrich, Denmark). Twohundred trout were infected by intra-peritoneal (ip.) injection(5�105 CFU/fish in 50 ml PBS) corresponding to a previouslydetermined LD50 (data not shown). Two hundred non-infectedcontrol fish were injected with 50 ml sterile PBS. In the primarychallenge experiment the infected fish received an ip. injection andwere observed for 35 days. In the re-challenge experiment a total of97 surviving fish from the primary challenge received an additionalinjection of 5�105 (CFU/fish) bacteria 35 days after the primaryinfection. When performing the re-challenge of the survivors,a group of 200 naı̈ve fish was infected as control to confirm viru-lence of the bacteria. The non-infected control fish were also re-injected with sterile PBS at day 35 post-primary injection. Bacterialsamples from the head kidney from all fish that died were culturedon blood agar plates to confirm the cause of death. Mortalities wereonly considered to be caused by Y. ruckeri if the bacteria wererecovered as pure culture from the head kidney.

Relative percentage survival (RPS) was calculated using thefollowing equation: RPS¼ (1� (percent immune mortality/percentcontrol mortality))� 100 [13].

2.4. Detection of Y. ruckeri in blood

Counts of Y. ruckeri in the blood of 5 ip. infected naı̈ve rainbowtrout were taken 0, 1, 2, 3, 5 and 6 days post-infection. The fish werekilled after blood sampling. Samples (10 ml blood) from each fishwere plated onto blood agar in a 10-fold dilution series (intriplicate).

2.5. Sampling for gene expression studies

Spleens from five infected and five control fish were sampled at0, 8 h and 1, 3, 7, 14 and 28 d following infection (both primary andsecondary challenges). No moribund fish were sampled for geneexpression experiments. Fish were killed by immersion into anoverdose of MS-222 (100 mg/l). Spleen tissue was sampled asep-tically, immediately transferred to RNA-later (Sigma–Aldrich), pre-stored for 24 h at 4 �C and subsequently stored at �20 �C untilisolation of RNA. When comparing groups for immunologicalparameters the infected fish and non-infected control fish sampledat the same time points were compared. A spleen size index wascalculated as the ratio between spleen weight (g): body weight (g),for individual fish from day 7 in order to describe changes of spleenweight during infection.

2.6. Expression of Y. ruckeri-specific 16S ribosomal RNA gene in thespleen of rainbow trout

A primer pair and a TaqMan probe were designed in anunconserved region of the Y. ruckeri partial 16S ribosomal RNA gene(Genbank accession number: X75275), which gives a specificamplification of Y. ruckeri strains only [14]. The amplicon is 70 bplong. Forward primer: 50GCGAGGAGGAAGGGTTAAGTG30, reverseprimer: 50GTTAGCCGGTGCTTCTTCTG30, and the TaqMan probe:50AATAGCACTGAACATTGACGTTACTCG30.

2.7. Isolation of total RNA and cDNA synthesis

Homogenisation of tissue was done by sonication on ice (Soni-cator Ultrasonic Liquid Processor Model XL 2020, heat Systems,New York, USA) and total RNA isolated using GenElute� total RNAkit (Sigma–Aldrich, Denmark). Removal of genomic DNA was con-ducted with deoxyribonuclease I (Sigma–Aldrich). RNA quantitywas checked by OD260/280 measurements (SmartSpec� 3000,BIO-RAD, USA). cDNA synthesis was performed on 400 ng total RNAin a 20 ml setup using TaqMan� Reverse Transcription reagentsfollowing the manufacturer’s instructions (Applied Biosystems,USA). Random hexamer primers were used in the reverse tran-scription reactions. RT-reactions lacking reverse transcriptase (RTminus) but not RNA were also performed to verify that the samplesdid not contain genomic DNA. The synthesised cDNA samples werediluted 1:10 in MilliQ H2O and stored at �20 �C.

2.8. Gene expression analysis

Spleen samples were analyzed using qPCR for expression ofgenes encoding cytokines (IL-1b1, IL-1Ra, IL-6, IL-10, IL-11 and IFN-g), chemokine IL-8, immunoglobulins (IgM, IgT) and cellularreceptors (TCR, CD4, CD8a, MHC II and IL-1 receptor I and II). qPCRassays were performed using a Stratagene MX3000PTM real-timePCR system. Based on available GenBank (NCBI) sequences primersand dual-labelled TaqMan� probes conjugated with 50 HEX, FAM orCY 50 and a 30 BHQ1 or BHQ2 were designed using Primer3 software(http://frodo.wi.mit.edu/). Primers and probes were analyzedfor hairpin structure, self- and hetero-dimers in OligoAnalyzer3.0 (http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/Default.aspx?c¼EU). Primers and probes are listed in Table 1. All

Table 1Quantitative PCR (qPCR) expression of immune relevant genes in rainbow trout

Gene GenBankaccession no.

Productsize

Forwardprimer

Reverseprimer

Probe qPCR efficiency %

CytokinesIL-1b1 AJ223954, AJ298294 91 acattgccaacctcatcatcg ttgagcaggtccttgtccttg catggagaggttaaagggtggc 99.7IL-1Ra AJ295296 65 aaggaggacaaggaggagga cactccattgatcgtcagga gccttcgccagtgaaggagaca 98.7IL-6 DQ866150 91 actcccctctgtcacacacc ggcagacaggtcctccacta ccactgtgctgatagggctgg 104.7IL-8 AJ279069 69 agaatgtcagccagccttgt tctcagactcatcccctcagt ttgtgctcctggccctcctga 104.8IL-10 AB118099 70 cgactttaaatctcccatcgac gcattggacgatctctttcttc catcggaaacatcttccacgagct 101.7IL-11 AJ 535687 104 gcaatctcttgcctccactc ttgtcacgtgctccagtttc tcgcggagtgtgaaaggcaga 98.6IFN-g AY795563 68 aagggctgtgatgtgtttctg tgtactgagcggcattactcc ttgatgggctggatgactttagga 102.4

Cell receptorsCD8-a AF178054 74 acaccaatgaccacaaccatagag gggtccacctttcccacttt accagctctacaactgccaagtcgtgc 104.5CD4 AY973028 89 cattagcctgggtggtcaat ccctttctttgacagggaga cagaagagagagctggatgtctccg 98.6TcR AF329700 73 tcaccagcagactgagagtcc aagctgacaatgcaggtgaatc ccaatgaatggcacaaaccagagaa 96.6IL-1RI AJ295296 70 atcatcctgtcagcccagag tctggtgcagtggtaactgg tgcatcccctctacaccccaaa 116.2IL-1RII AJ276474 91 ctcaatctgctctcggcatt gcggaggtagtcgtagtcca ttcatcgctcgctctgcctg 97.6MHC-II b AF115533 67 tgccatgctgatgtgcag gtccctcagccaggtcact cgcctatgacttctaccccaaacaaat 101.1

ImmunoglobulinsIgM S63348 72 cttggcttgttgacgatgag ggctagtggtgttgaattgg tggagagaacgagcagttcagca 98.4IgT AY870265 72 agcaccagggtgaaacca gcggtgggttcagagtca agcaagacgacctccaaaacagaac 98.5

House-keeping geneElongation factor 1a AF498320 63 accctcctcttggtcgtttc tgatgacaccaacagcaaca gctgtgcgtgacatgaggca 100.0

Primers and probe sets including their accession number, product sizes, sequences and qPCR efficiency.

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541 535

primers and probes were HPLC-purified (Sigma–Genosys Ltd., UK).The primers were optimized according to MgCl2 concentrations.Melting curve analysis of the primers was conducted with an SYBRGreen based qPCR assay, to make sure that the primers did not formprimer dimers. To assess that the primer and probe pairs werequantitative within the working range, serial dilutions in 10-foldincrement of cDNA were used, and efficiency for the primer pairswas calculated (Table 1). The cycling conditions were one cycle ofinitial denaturation at 94 �C for 2 min, followed by 40 cycles withdenaturation at 94 �C for 30 s and annealing and elongation in onestep at 60 �C for 1 min. Wells contained 6.25 ml of 2� JumpStartTMTaq ReadyMixTM, 3–6 mM MgCl2 (all chemicals from Sigma–Aldrich, Denmark), 0.5 ml forward and reverse primer (10 mM), 0.5 mlTaqMan� probe (5 mM), 2.5 ml of diluted cDNA (1:10) and autoclavedMilliQ water to a volume of 12.5 ml. RT minus and negative controls(MilliQ water without template) were used for every plate setup.Several reference genes were validated in spleen tissue, namely b-actin, Ribosomal protein S20 and Elongating factor 1-a (EF1-a). Bycomparing the expression results of the spleen tissues from infectedand non-infected control fish, it was found that EF1-a was the moststably expressed gene between all individuals. EF1-a primers withcorresponding probe were therefore used as endogenous control(reference or house-keeping gene) to correlate for potentiallydifferent loading amounts of RNA added to the RT-PCR reaction andfor variation in cDNA synthesis efficiencies [15,16]. If the real-timecurve did not reach the threshold within 40 cycles the sample wasnot considered for that particular gene. A high Ct value designatesthat the gene is expressed at a low level and one Ct value corre-sponds to a two-fold difference in gene expression.

2.9. Calculations and statistical analysis

Results from the challenge experiments were analysed using theKaplan–Meier test (GraphPad Prism 4, www.graphpad.com/manuals/Prism4/PrismUsersGuide.pdf), which were used toanalyse for differences in mortality between groups.

2.10. Data analysis of gene expression

The threshold cycle (Ct) was determined at the linear slope ina log fluorescence/Ct plot. The expression results were analyzed

using the 2�DDCt method [17]. Expression of all genes in fishinjected with bacteria or PBS was expressed relative to the geneexpression of the five unhandled fish sampled pre-injection whichwere used for calibration (mean expression¼ 1) for each investi-gated gene. In order to describe the effects of infection on geneexpression the normalized gene expression data (DDCt) for infectedand PBS-injected control fish were compared to each other. Sincedata followed a normal distribution (Kolmogorov–Smirnoff’s test),Student’s t-test was used for testing differences in relative tran-scription level between the controls and infected fish at eachsampling time. Correlations between expression of the Y. ruckerispecific 16S ribosomal RNA gene and expression of immune genesin the spleen of rainbow trout were analysed using the SpearmanRank Order correlation test.

A significance level of 5% was applied in all tests. The data arepresented as the mean value of fold increase/decrease from five fishat each sampling point post-injection. All statistical calculationswere performed with GraphPad Prism 4 (GraphPad Software, Inc.,San Diego, USA).

3. Results

3.1. Challenge experiment

Each fish received an intra-peritoneal (ip.) injection with5�105 CFU Y. ruckeri in 50 ml PBS. This dose was found to be the LD50 ina pilot experiment (data not shown) and was used for both the primaryand the secondary challenge experiment. Pure Y. ruckeri cultures werere-isolated from head kidney of all infected fish which died in thechallenge experiments. Control fish were injected with 50 ml PBS, andno mortality was observed during the experiment. During the primaryinfection, the survival of infected fry was significantly (p< 0.0001)(Fig.1) lower than the non-infected control group (n¼ 200). Survivorsof the primary infection were re-infected ip. with the same dose(5�105 CFU/fish) on day 35, and a group of naı̈ve fish were infected asvirulence control (to confirm that the virulence of the bacteria was thesame as in the primary infection). The survival of re-infected fry wassignificantly (p¼ 0.0009) lower than the non-infected control group.When comparing the survival in the primary infected versus the re-infected fry, the survival was significantly higher during the re-infec-tion (p< 0.0001). During the 35 day period following the primary

Fig. 1. Percent survival of Y. ruckeri infected and non-infected rainbow trout duringprimary and secondary infections. During the primary infection, the survival ofinfected fry was significantly (p< 0.0001) lower than the non-infected control group(n¼ 200). Survivors of the primary infection were re-infected ip. with the same dose(5�105 CFU/fish) day 35, and a group of naı̈ve fish were infected as virulence control(to confirm the virulence of the bacterial broth). The survival of re-infected fry wassignificantly (p¼ 0.0009) lower than the non-infected control group. When comparingthe survival in the primary infected versus the re-infected fry, the survival wassignificantly higher during the re-infection (p< 0.0001).

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541536

infection 34% of the infected fish died. A total of 97 fish survived theprimary infection and were re-challenged at day 35. During the re-infection only 7% of the previously infected fish died. The cumulativepercent mortality (CPM) was determined after 28 days, and the RPSwas 79%.

3.2. Re-isolation of pathogen

Y. ruckeri was re-isolated from the head kidney of all fish whichdied during the challenge experiments. Dead fish exhibited externalsigns associated with ERM infection including petechial haemor-rhages in the mouth, around the anus and at the base of the dorsal fins.

3.3. Detection of Y. ruckeri in the spleen

The Y. ruckeri specific primer pair with corresponding TaqManprobe detected the presence of Y. ruckeri in the infected fish. The

Fig. 2. Expression of a Y. ruckeri specific 16S sequence, in the spleen of rainbow trout (n¼ 5) d16S transcript was significantly increased relative to controls day 3 and 7 after the primary

bacteria were detectable 8 h.p.i. The Y. ruckeri gene transcriptsincreased rapidly and peaked on day 3 with more than a 21,000-fold increase relative to the detection level. The amount of Y. ruckeridecreased from day 3 and at day 28 the infection was barelydetectable (Fig. 2). The expression of Y. ruckeri was detectable8 h.p.i. (re-infection) but decreased rapidly. Thus, Y. ruckeri wasonly detected in one out of five re-infected fish at day 3 and 7. Thiswas also supported when agar culturing was conducted. By usingthis technique Y. ruckeri was re-isolated from the head kidney of20% of the fish 28 days after the primary challenge, and in only 4% ofthe fish 28 days after the re-challenge.

The spleen weight index (spleen weight/body weight) was twiceas high in the infected fish as in the controls 7 and 14 d.p.i. duringthe primary infection. During the secondary infection no significantweight differences were found (Fig. 3).

3.4. Detection of Y. ruckeri in blood

The presence of Y. ruckeri in the blood of infected trout wasdetected from 2 days after the primary infection (Fig. 4). More than1�106 CFU/ml blood were detected in infected fish 6 d.p.i..

3.5. Expression of investigated immune genes in the spleen ofrainbow trout

Low levels of constitutive expression of all examined genes inthe spleen were detected in unhandled fish, but transcription ofa range of genes was shown to be significantly regulated due toinfection (Table 2).

3.6. Expression of the IL-1 family genes in the spleen of rainbowtrout

Genes encoding the pro-inflammatory cytokine IL-1b1, the anti-inflammatory antagonist IL-1Ra and the IL-1 receptor type I (IL-1RI)and the IL-1 decoy receptor type II (IL-1RII) were investigated in thespleen tissue. A significantly increased gene expression of all themeasured IL-1 family genes was detected in the infected rainbow

uring primary and secondary ip. infection with 5�105 CFU/fish Y. ruckeri. The Y. ruckeriinfection.

Fig. 3. The figure shows a spleen weight index (spleen weight/body weight) from un-infected and infected fish (n¼ 5). The weight of the spleen was significantly increased7 and 14 days pi. during the primary infection (p¼ 0.03).

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541 537

trout when compared to un-infected controls. The number of IL-1btranscripts was significantly increased in the infected fishcompared to the non-infected control fish at 8 h.p.i., 1 and 3 d.p.i.The IL-1b expression peaked 3 d.p.i. with a 77.8-fold increasecompared to PBS injected control fish. No differences in expressionof IL-1b1 were seen at later time points. Expression of genesencoding IL-1RI and IL-1RII was significantly increased at 1 and3 d.p.i. in the primary infected fish. Gene transcript numbers ofboth genes peaked on day 3 p.i. IL-1RI transcript was elevated 4.2-and 6.9-fold, and IL-1RII was 3.4- and 17.4-fold increased at 1 and3 d.p.i., respectively. No significant regulations were seen at latertime points (Tables 2 and 3 and Fig. 5).

The transcript of the IL-1 receptor antagonist (Ra) was signifi-cantly increased in all samples from the infected fish from 8 h.p.i. to7 d.p.i. IL-1Ra expression peaked 3 d.p.i. Expression of IL-1Ra andthe IL-1 receptor expression were correlated with the expression ofIL-1b1 (IL-1Ra: r¼ 0.69, p< 0.0001), (IL-1RI: r¼ 0.69, p< 0.0001),(IL-1RII: r¼ 0.79, p< 0.0001). Likewise, IL-1Ra also showed corre-lation to IL-1RI (r¼ 0.50, p< 0.0001) and IL-1RII (r¼ 0.59,

Fig. 4. Detection of Y. ruckeri in blood of infected rainbow trout (n¼ 5). More than1�106 CFU/ml blood were detected in infected fish 6 days post-infection.

p< 0.0001). The expression of IL-1RI was also correlated toexpression of IL-1RII (r¼ 0.85, p< 0.0001).

3.7. Expression of other cytokine and chemokine genes in the spleenof rainbow trout

Gene transcripts encoding IL-6 and IL-11 were significantly up-regulated in infected fish 1–3 d.p.i. (primary infection) (10.2 to 20.7and 14.7- to 18.8-fold, respectively) (Table 2).

The gene encoding the chemokine IL-8 was significantly up-regulated during the primary infection from 8 h.p.i. to 14 d.p.i.,peaking at 3 d.p.i. (Table 2).

The number of IL-10 gene transcripts was 396.2-fold increasedin the infected fish 3 d.p.i. (primary infection) (Table 2), and a minordown-regulation relative to the un-infected fish was seen 14 d.p.i.(re-infection) (Table 3).

The IFN-g gene transcript level was increased 22.1-fold in theinfected trout 3 d.p.i. (primary infection), and down-regulatedrelative to the un-infected control group 3 and 7 d.p.i. during there-infection.

The transcript of the T cell receptor gene was stable during theinfections, but an increase in CD4 expression was seen 1–3 d.p.i. (2-to 2.3-fold) (primary infection), and CD8a was 3.4-fold up-regu-lated 14 d.p.i. (re-infection).

No significant changes in expression of genes encoding MHC II,IgM and IgT were seen during the infections (Tables 2 and 3).

4. Discussion

The head kidney of teleosts is considered to be the major organfor the capture and clearance of bacteria due to the presence ofresident macrophage populations [18], but it has been speculatedthat recruitment and activation of lymphocytes following infectionoccur in the spleen [6,19]. This complies with the finding thatexpression of genes encoding cytokines was higher in the spleencompared to the head kidney following ip. injection of a Y. ruckeribacterin [5]. In the present study, the immune gene activation inthe spleen was found to be extensive during the primary Y. ruckeriinfection in rainbow trout, concomitant with a significant increaseof spleen weight (Fig. 3), probably due to influx or proliferation ofcells. Further, the early peak of Y. ruckeri in the spleen compared tothe blood could indicate that the spleen actively clears the bacterialinfection.

4.1. Cytokines within the IL-1 family

IL-1b is one of the best described pro-inflammatory cytokines inrainbow trout [20–23]. Increased levels of IL-1b transcripts inrainbow trout tissue have been reported and ascribed to infectionswith ectoparasites [24–26], virus [27] and injection of killed Y.ruckeri bacterin [5]. The IL-1 system of ligands and receptors isa complex system of agonists and antagonists. IL-1-induced activityoccurs as a consequence of binding to its receptor complex (IL-1R)on the cell surface of target cells [28]. In mammals the IL-1Rtransduction system is extraordinarily sensitive and just a fewligand-occupied receptors initiate biological activity [29]. We founda significantly increased expression of the IL-1b1 gene and itsassociated receptors in infected fish (Table 2 and Fig. 5). The IL-1b1expression was significantly increased from 8 h.p.i. to 3 d.p.i. whereit peaked (77.8-fold) and also was positively correlated to theabundance of the pathogen (Table 2 and Fig. 2).

The present work indicates that this established path ofimmunological events in mammals also occurs in rainbow trout,involving IL-1b as an important mediator of the early immuneresponse in rainbow trout.

Table 2Quantitative PCR (qPCR) expression of immune relevant genes in the spleen of rainbow trout following primary ip. infection with Y. ruckeri

Gene Treat-ment Gene expression in Spleen. Fold increase of target gene relative to elongation factor a (�SD)

0 h 8 h 1 Day 3 Days 7 Days 14 Days 28 Days

IL-1b Infected 1.0 0.5–2.2 2.6* 1.1–5.9 13.6* 0.7–269.4 77.8*** 46.8–129.4 3.1 0.2–42.4 1.2 0.2–5.5 0.5 0.2–1.3Control 0.6 0.5–0.9 0.4 0.3–0.6 0.6 0.2–1.5 0.6 0.3–1.3 0.7 0.2–1.8 0.6 0.2–1.9

IL-6 Infected 1.0 0.7–1.5 0.7 0.3–1.8 10.2* 1.5–69.3 20.7*** 10.0–42.8 1.4 0.4–5.4 1.9 0.3–11.3 0.4 0.2–0.8Control 0.4 0.3–0.5 0.5 0.3–0.8 0.5 0.2–1.1 1.4 0.6–3.3 0.4 0.1–2.5 0.8 0.2–3.4

IL-8 Infected 1.0 0.6–1.7 4.8* 2.4–9.5 32.7* 5.0–212.9 58.9*** 29.2–118.9 8.4* 1.5–46.1 3.1* 2.2–4.5 3.4 1.9–6.3Control 2.2 1.8–2.9 2.3 1.6–3.3 2.0 1.1–3.7 0.9 0.5–1.8 1.4 0.7–2.7 1.9 0.9–4.0

IL-10 Infected 1.0 0.5–2.0 0.8 0.4–1.6 6.6 0.7–62.3 396.2*** 169.8–924.3 8.7 0.5–138.3 19.9 3.7–106.5 7.3 1.3–41.5Control 0.8 0.5–1.2 1.0 0.8–1.4 0.8 0.3–2.6 1.5 0.2–9.7 7.9 1.3–48.2 6.6 1.1–38.8

IL-11 Infected 1.0 0.5–2.0 1.0 0.4–2.4 14.7* 3.6–59.9 18.8* 11.1–32.0 2.1 0.9–4.9 3.5 0.9–13.8 1.6 0.8–3.2Control 1.0 0.4–2.3 1.2 0.6–2.6 1.9 1.3–2.7 1.5 0.5–4.7 2.6 0.8–7.8 2.4 1.0–5.7

IFN-g Infected 1.0 0.6–1.8 2.5 1.6–3.8 9.4 1.8–50.4 22.1* 16.4–29.8 8.7 2.3–33.5 15.0 1.9–117.4 10.0 4.1–24.6Control 1.9 0.8–4.3 3.9 2.2–7.1 3.7 1.6–8.4 5.8 1.5–22.7 9.7 2.0–47.6 6.7 2.0–23.3

CD4 Infected 1.0 0.7–1.3 1.1 0.6–1.9 2.0* 1.0–4.2 2.3* 1.3–4.1 1.6 0.5–4.6 1.1 0.7–1.7 0.8 0.5–1.2Control 0.8 0.5–1.2 0.8 0.6–1.2 0.8 0.5–1.3 0.9 0.5–1.6 1.0 0.5–1.8 0.7 0.5–1.0

CD8 Infected 1.0 0.6–1.7 0.7 0.4–1.4 0.9 0.4–2.0 0.5 0.2–1.3 0.9 0.5–1.8 2.4 1.3–4.4 2.1 1.4–3.0Control 0.8 0.4–1.5 1.1 0.8–1.5 1.3 0.8–2.0 0.8 0.6–1.1 1.6 0.9–3.0 1.1 0.5–2.3

TcR Infected 1.0 0.7–1.3 0.9 0.4–1.9 1.2 0.6–2.4 0.4 0.2–0.9 0.7 0.3–1.5 2.1 1.3–3.3 1.1 0.7–1.8Control 0.8 0.5–1.3 0.9 0.7–1.2 0.9 0.6–1.3 1.1 0.9–1.4 1.0 0.5–2.0 1.0 0.6–1.8

IL-1RI Infected 1.0 0.7–1.5 0.9 0.4–2.5 4.2* 1.4–13.1 6.9* 3.4–14.0 2.0 0.7–5.6 1.8 0.5–6.7 1.4 0.7–2.9Control 0.5 0.3–1.0 0.6 0.5–0.8 0.7 0.4–1.2 1.1 0.6–2.1 1.6 0.6–4.4 1.2 0.5–2.5

IL-1RII Infected 1.0 0.4–2.3 0.5 0.2–1.5 3.4* 0.4–33.2 17.4*** 6.7–44.9 0.9 0.1–5.6 0.8 0.2–3.0 0.5 0.2–1.6Control 0.3 0.2–0.7 0.2 0.2–0.2 0.3 0.1–0.5 0.3 0.1–0.8 0.6 0.2–2.1 0.3 0.1–1.0

IL-1Ra Infected 1.0 0.8–1.3 1.1* 0.7–1.8 3.7* 1.2–12.1 8.2*** 5.0–13.6 2.0* 0.7–5.5 0.6 0.4–0.8 0.7 0.5–1.0Control 0.5 0.3–0.7 0.7 0.6–1.0 0.6 0.4–0.8 0.6 0.4–0.8 0.4 0.3–0.5 0.5 0.4–0.7

MHC II Infected 1.0 0.7–1.5 1.1 0.6–2.2 1.4 0.8–2.5 0.5 0.2–0.9 0.7 0.4–1.4 1.0 0.7–1.4 1.3 0.9–1.8Control 0.8 0.6–1.1 1.0 0.8–1.2 1.0 0.6–1.6 0.8 0.5–1.1 0.9 0.6–1.3 1.1 0.8–1.4

IgM Infected 1.0 0.7–1.4 0.7 0.5–0.9 0.6 0.4–0.8 0.5 0.3–0.9 1.0 0.6–1.8 0.7 0.6–0.9 0.6 0.4–0.9Control 0.7 0.4–1.2 1.2 0.5–2.7 0.6 0.4–0.8 0.6 0.5–0.8 0.7 0.6–0.9 0.6 0.5–0.9

IgT Infected 1.0 0.6–1.7 0.4 0.2–0.8 0.5 0.2–1.6 0.6 0.2–1.5 1.6 0.7–4.1 0.4 0.1–7.9 1.0 0.5–2.2Control 0.2 0.0–4.4 0.8 0.3–1.7 1.2 0.7–2.1 0.2 0.1–4.1 0.9 0.4–2.2 0.3 0.1–3.9

Expression was compared to controls injected with PBS, and *indicates significant up- or down-regulation relative to control (p< 0.05), **(p< 0.01) and ***(p< 0.001).

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541538

IL-1Ra is a structural variant of IL-1 that binds to both types ofIL-1 receptors but fails to activate cells. IL-1Ra functions have notbeen described in fish, but in mammals it acts as an anti-inflam-matory protein which blocks the effects of IL-1. The balancebetween IL-1 and IL-1Ra in tissue plays an important role insusceptibility to and severity of many diseases. Thus, IL-1Raprotects against IL-1-induced leucocyte inflammation [30–32], andaugments suppression of serum IFN-g, TNF-a, IL-1b, IL-6 and C3concentrations [33]. In the present work IL-1Ra transcript wasexpressed in the spleen of rainbow trout and the level of transcriptwas increased from 8 h.p.i. to 7 d.p.i. (Table 2). The antagonist genetranscription was also positively correlated to the expression of IL-1b1, IL-1RI and IL-1RII, suggesting that the gene is involved indown-regulation of the IL-1b induced inflammation.

4.2. IL-1 receptors

Only binding of IL-1b to the IL-1R type I receptor evokes signaltransduction and activation of the nuclear factor (NF)-kB pathway[34]. IL-1RII binds IL-1b but is unable to transduce a signal due tothe lack of a functional cytoplasmic tail [35,36]. Thus, IL-1R type IIacts as a decoy receptor, functioning by capturing excess IL-1 [34].In the present study Y. ruckeri infection induced highly significantincreases of both IL-1b and IL-1R1 in the spleen (Table 2). Expres-sion of the IL-1RII ‘‘decoy receptor’’ in rainbow trout is known to beup-regulated during ectoparasitic infection [24–26]. The presentwork showed that IL-1RII expression was increased during bacterial

infection, and we suggest that the function of this protein inrainbow trout is also to bind excess IL-1b and in that way act asa regulating molecule.

4.3. Other cytokines and chemokines

The rainbow trout IL-6 gene was recently cloned and charac-terized. It was found expressed in trout spleen, gill, gastrointestinaltract, ovary and brain [37]. The key features of IL-6 appear to bephylogenetically well conserved within the vertebrates [37] andfrom mammalian immunology it is known that expression of IL-6 isinduced by pro-inflammatory mediators including IL-1b [24,38–40]. IL-6 is important as the major mediator of acute phase reac-tions [34]. In rainbow trout IL-6 is known to be up-regulated froma very low level following both LPS and b-glucan in vivo stimulation[41] and to be up-regulated due to bath-vaccination with Y. ruckeribacterin [42]. In the present work we found that IL-6 expressionwas almost silent in control fish, whereas the expression increased10-fold 1 d.p.i., and 20-fold 3 d.p.i. (Table 2). These events supportits suggested role as a pro-inflammatory mediator in this host. IL-8belongs to the CXC chemokine subfamily, and is considered to havea chemo-attractive effect on neutrophils in trout [43,44]. Previousstudies have described increased expression of IL-8 during Y. ruckeribath-vaccination and challenge [8]. Our results support theimpression of IL-8 as a central part of the inflammatory reaction.Thus, IL-8 was up-regulated in the spleen from 8 h.p.i. to 14 d.p.i.and the higher amount of IL-8 transcripts is likely to have attracted

Table 3Quantitative PCR (qPCR) expression of immune relevant genes in the spleen of rainbow trout following secondary ip. infection with Y. ruckeri

Gene Treatment Gene expression in spleen. Fold increase of target gene relative to elongation factor a (�SD)

8 h 1 Day 3 Days 7 Days 14 Days 28 Days

IL-1b Infected 1.0 0.5–2.0 0.7 0.2–2.7 0.3 0.3–0.5 0.2 0.1–0.4 0.2 0.1–0.4 0.4 0.2–1.1Control 0.2 0.1–0.4 0.5 0.2–1.6 0.6 0.3–1.3 0.3 0.1–0.7 0.9* 0.4–1.7 0.8 0.2–2.8

IL-6 Infected 1.0 0.5–2.1 0.5 0.2–1.5 0.4 0.2–1.0 0.8 0.6–1.2 1.3 0.7–2.4 0.4 0.2–0.8Control 0.4 0.1–1.4 2.4 0.8–6.8 0.8 0.5–1.4 0.9 0.5–1.6 2.2 1.0–5.2 2.4* 1.2–4.7

IL-8 Infected 3.7 1.3–10.5 3.8 2.8–5.3 2.1 1.4–3.1 2.8 1.4–5.5 1.9 1.2–3.3 3.7 2.9–4.7Control 2.0 1.1–4.0 3.2 1.8–5.6 3.1 1.9–5.0 3.6 2.7–4.7 3.3 2.2–5.0 5.3 3.0–9.4

IL-10 Infected 1.1 0.9–1.4 2.2 0.9–5.4 2.0 0.9–4.3 1.5 0.6–3.6 1.7 0.6–5.4 0.4 0.2–0.8Control 1.4 0.6–3.5 0.9 0.3–2.8 2.7 1.5–4.9 0.7 0.4–1.4 14.5* 3.0–70.2 0.7 0.4–1.3

IL-11 Infected 1.7 0.6–5.0 1.4 0.8–2.4 2.3 1.8–2.9 1.8 1.0–3.1 6.5 3.9–11.1 2.7 2.3–3.1Control 1.1 0.6–2.0 2.7* 2.1–3.4 2.2 1.1–4.4 3.7 2.2–6.4 6.9 3.8–12.6 5.8 3.6–9.4

IFN-g Infected 6.3 2.7–14.9 4.0 2.0–13.5 3.8 1.7–8.2 2.7 1.3–5.3 5.4 1.9–15.6 2.2 0.7–6.8Control 1.7 1.1–2.8 5.2 2.0–13.5 8.7* 4.4–17.0 20.2* 6.5–62.6 2.1 1.5–3.0 1.7 0.9–3.3

CD4 Infected 1.4 0.9–2.2 0.9 0.5–1.5 0.9 0.7–1.1 1.2 0.8–2.0 1.6 1.1–2.2 1.2 0.8–2.0Control 1.2 0.6–2.4 1.0 0.6–1.9 1.5 0.8–2.9 1.9 1.4–2.5 2.0 1.1–3.6 1.7 1.1–2.6

CD8 Infected 1.2 0.8–1.9 0.9 0.4–2.1 1.7 0.8–3.6 2.5 1.6–3.8 3.4* 2.3–5.0 2.2 1.5–3.2Control 1.6 1.0–2.7 1.0 0.3–3.9 1.1 0.7–1.7 1.9 1.5–2.6 1.8 1.2–2.7 2.8 1.9–4.1

TcR Infected 0.8 0.6–1.2 1.1 0.5–2.4 1.3 0.8–1.9 2.0 1.3–3.2 2.9 1.5–5.3 1.7 1.3–2.1Control 1.0 0.5–1.9 1.1 0.7–1.8 1.1 0.6–2.0 1.9 1.1–3.3 2.5 1.8–3.4 2.8* 2.2–3.6

IL-1RI Infected 0.9 0.4–1.9 0.8 0.4–1.6 1.0 0.9–1.2 0.9 0.6–1.4 1.4 0.7–2.6 1.0 0.5–2.2Control 0.8 0.4–1.4 1.4 0.7–3.0 1.2 0.7–2.3 1.5 0.7–2.9 2.4 1.2–4.5 1.1 0.6–2.1

IL-1RII Infected 0.3 0.1–0.7 0.2 0.1–0.4 0.3 0.2–0.4 0.1 0.1–0.2 0.3 0.2–0.5 0.2 0.1–0.4Control 0.3 0.1–0.5 0.3 0.1–0.6 0.3 0.2–0.5 0.2 0.1–0.4 0.9* 0.4–2.2 0.2 0.1–0.6

IL-1Ra Infected 0.9 0.6–1.4 1.0 0.6–1.5 0.9 0.7–1.1 0.8 0.4–1.5 1.0 0.8–1.3 0.7 0.4–1.1Control 0.6 0.3–1.0 1.1 0.8–1.5 0.8 0.5–1.2 0.9 0.7–1.2 0.5 0.2–1.0 0.7 0.4–1.3

MHC II Infected 1.1 0.7–1.9 0.9 0.6–1.4 1.1 0.9–1.4 1.6 1.2–2.3 1.5 1.1–2.1 1.5 1.0–2.3Control 1.2 0.7–1.9 1.4 0.8–2.5 1.0 0.7–1.5 1.6 1.4–1.8 1.6 1.4–1.9 1.7 1.4–2.1

IgM Infected 0.5 0.3–0.8 0.6 0.3–1.1 0.6 0.4–0.9 0.5 0.3–1.0 0.6 0.5–0.7 0.4 0.3–0.7Control 0.6 0.4–0.9 0.7 0.4–1.4 0.7 0.5–1.2 0.9 0.6–1.3 0.6 0.4–0.8 0.6 0.4–1.1

IgT Infected 0.9 0.4–1.9 0.8 0.3–1.8 1.5 0.5–4.2 2.5 1.4–4.5 1.1 0.6–2.0 1.3 0.5–3.0Control 1.3 1.0–1.6 0.2 0.1–7.8 1.7 1.0–3.0 1.2 0.7–2.2 0.9 0.4–1.8 0.5 0.1–4.7

Expression was compared to controls injected with PBS, and * indicates significant up- or down-regulation relative to control (p< 0.05).

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541 539

neutrophils to the spleen which could partly explain the weightincrease of this organ during the primary infection (Fig. 3). IL-8 was(as IL-1b1 and IL-10) positively correlated to the expression of Y.ruckeri 16S ribosomal RNA gene, which could indicate that IL-8 isattracting phagocytes to the site of inflammation. This result is inagreement with the finding that Y. ruckeri bacterial counts havebeen associated with increased levels of CXCd mRNA expression inthe spleen of infected rainbow trout [8].

It is generally agreed that regulation of inflammation resultsfrom a balance between pro- and anti-inflammatory cytokines.Regulation of inflammation is a central event in the immuneresponse reducing the negative effects of the inflammatoryprocesses. Recently, some anti-inflammatory factors in teleostshave been cloned. The cytokine IL-10 belongs to this group, and IL-10 homologues have been found in rainbow trout [45], fugu [46],carp [47] and zebrafish [48]. IL-10, initially known as cytokinesynthesis inhibitory factor, is a multifunctional cytokine anddemonstrates immunosuppressive function. The main function ofIL-10 seems to be regulation of the inflammatory response, therebyminimizing damage to the host induced by an excessive response.Thus, IL-10 blocks chemokine receptors and inhibits the effect ofpro-inflammatory cytokines [49] and inhibits the activation ofmacrophages/monocytes, whereby it controls cytokine synthesis,nitric oxide (NO) production and the expression of other cos-timulatory molecules [50]. The function of IL-10 in teleosts is lessclear. Our study demonstrated high expression of IL-10 3 d.p.i. andno pro-inflammatory cytokines were found up-regulated after the

high IL-10 expression (Table 2). This could indicate that IL-10 servesan anti-inflammatory role also in rainbow trout corresponding toits action in mammals.

IL-11 is a multifunctional cytokine that in mammals stimulateshaematopoietic progenitor cells and exerts a series of importantimmunomodulatory effects. This cytokine is in rainbow troutmodulated by infection and other cytokines, suggesting that IL-11 isan active player in the cytokine network and the fish immuneresponse to infection [51]. During our investigation on infectionwith Y. ruckeri, IL-11 transcription increased from day 1 to 3.Therefore, the exact function of this cytokine should be addressedin future studies.

4.4. Expression of genes involved in the adaptive immunity

In mammals, CD4þ T cells differentiate into IFN-g producingcells following exposure to IL-1b [52]. The present study couldindicate that a similar pathway occurs in rainbow trout. Wedetected an increased expression of IL-1b1 followed by a doublingof the CD4 expression. This was again associated with a highlyincreased expression of IFN-g transcripts (22.1-fold). In the presentstudy no regulation of expression of the genes encoding IgM, IgTand MHC II was found in the spleen (Tables 2 and 3). It is possiblethat the main regulation of immunoglobulin expression takes placein the head kidney and not in the spleen. It has previously beenindicated from studies on vaccinated trout, showing that the anti-body response was mainly caused by Ig secretion from plasma cells

Fig. 5. Gene expression of IL-1b, IL-1 receptor antagonist (Ra) and IL-1 receptor I and II, in the spleen of rainbow trout infected with Y. ruckeri (n¼ 5).

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541540

in the anterior kidney [5,53]. However, the lack of increases in Iggene transcripts during the infections may also be explained by thefact that Y. ruckeri-specific Ig mRNA merely represents a limitedfraction of the huge amount of mRNA encoding secreted Ig [5].

In mammals CD8a is known as a marker for cytotoxic T cells.CD8 positive T cells recognize antigens that are displayed as pep-tide:MHC class I complexes on the cell surface [54]. The geneencoding CD8a has been identified in rainbow trout [55] andspecific cytotoxicity of T-cells has also been recognized using clonalrainbow trout [56,57].

There were no difference in the transcript levels of CD8abetween infected and control fish during the primary Y. ruckeriinfection, but during the secondary infection, the CD8a gene wasthe only one up-regulated relative to the controls. It is noteworthythat the gene encoding CD-8a previously was found up-regulatedin rainbow trout bath-vaccinated with Y. ruckeri bacterin [42],which indicates that activity of cytotoxic T-cells plays a role in thecellular adaptive protection mechanisms against Y. ruckeri infec-tion. Increased expression of CD-8a in spleen of rainbow trout waspreviously reported following exposure to other viral and bacterialpathogens such as infectious haematopoietic necrosis virus (IHNV)and Flavobacterium psychrophilum [19] and a similar reaction inperipheral blood leucocytes after infection with viral haemorrhagicsepticaemia virus (VHSV) [57].

In conclusion, this study on the development of adaptiveimmunity in rainbow trout suggests that the immune response isinitiated by cytokines which activate lymphocytes to initiate anadaptive immune response eventually leading to long-lastingprotective immunity. The amount of Y. ruckeri in the spleen wasincreased 21,000-fold during the first 3 days before the bacterialinfection decreased probably due to innate immune responsefactors. During the re-infection with the same dose of Y. ruckeri, thepresence of bacteria was only detectable in three out of five re-infected fish 8 h.p.i. and in none of the tested fish 1 d.p.i. These datacomply with the viewpoint that the adaptive immunity is muchmore efficient than the innate immune response when clearinga bacterial infection in rainbow trout.

The weak expression of the investigated genes in the well pro-tected rainbow trout following the re-infection was noteworthy. Itcorresponds to expression data on the immune response inrainbow trout reacting to a parasite where, following full recovery

from the primary infection, re-infection did not elicit transcriptionlevels above those seen in un-infected rainbow trout [25]. Oneexplanation of the weak gene expression during the re-infection isthat the pathogen is killed very fast, whereby the associatedexpression of some pro-inflammatory cytokines is kept ata minimum. The present work has pin-pointed a series of immu-nological events during this dynamic infection and re-infectioninteraction between host and pathogen. Following the initialregulated cytokine expression (involving IL1b and its antagonists,receptor and decoy receptor) it is indicated that the protectiveeffect may comprise regulated activity of T-cells.

Acknowledgments

This work was supported in part by a grant to the project 274-07-0354 from the Danish Agency for Science Technology andInnovation and by the integrated research project IMAQUANIMsponsored by the European Commission and by a grant to theproject FFS05-7 ‘‘Welfare in farmed Rainbow trout’’ from theDanish Ministry for Food.

References

[1] Fernandez L, Mendez J, Guijarro JA. Molecular virulence mechanisms of thefish pathogen Yersinia ruckeri. Veterinary Microbiology 2007;125:1–10.

[2] Tobback E, Decostere A, Hermans K, Haesebrouck F, Chiers K. Yersinia ruckeriinfections in salmonid fish. Journal of Fish Diseases 2007;30:257–68.

[3] Horne MT, Barnes AC. Enteric redmouth disease (Yersinia ruckeri). In:Woo PTK, Bruno DW, editors. Fish diseases and disorders. Viral, bacterial andfungal infections, vol. 3. CABI Publishing; 1999. p. 455–77.

[4] Ellis AE. Immunity to bacteria in fish. Fish & Shellfish Immunology1999;9:291–308.

[5] Raida MK, Buchmann K. Temperature-dependent expression of immune-relevant genes in rainbow trout following Yersinia ruckeri vaccination.Diseases of Aquatic Organisms 2007;77:41–52.

[6] Chaves-Pozo E, Munoz P, Lopez-Munoz A, Pelegrin P, Ayala AG, Mulero V, et al.Early innate immune response and redistribution of inflammatory cells in thebony fish gilthead seabream experimentally infected with Vibrio anguillarum.Cell and Tissue Research 2005;320:61–8.

[7] Espenes A, Press CM, Dannevig BH, Landsverk T. Immune complex trapping inthe splenic ellipsoids of rainbow trout (Oncorhynchus mykiss). Cell and TissueResearch 1995;282:41–8.

[8] Wiens GD, Glenney GW, Lapatra SE, Welch TJ. Identification of novel rainbowtrout (Oncorynchus mykiss) chemokines, CXCd1 and CXCd2: mRNA expressionafter Yersinia ruckeri vaccination and challenge. Immunogenetics2006;58:308–23.

M.K. Raida, K. Buchmann / Fish & Shellfish Immunology 25 (2008) 533–541 541

[9] Welch TJ, Wiens GD. Construction of a virulent, green fluorescent protein-tagged Yersinia ruckeri and detection in trout tissues after intraperitoneal andimmersion challenge. Diseases of Aquatic Organisms 2005;67:267–72.

[10] Murphy K, Travers P, Walport M. Janeway’s immuno biology. 7th ed. New Yorkand London: Garland Science Publishing; 2008.

[11] Janeway CA. Presidential address to the American Association of Immunolo-gists – the road less traveled by: the role of innate immunity in the adaptiveimmune response. Journal of Immunology 1998;161:539–44.

[12] Fouz B, Zarza C, Amaro C. First description of non-motile Yersinia ruckeriserovar I strains causing disease in rainbow trout, Oncorhynchus mykiss(Walbaum), cultured in Spain. Journal of Fish Diseases 2006;29:339–46.

[13] Ellis AE. Fish vaccination. 1st ed. London: Academic Press Limited; 1988.[14] Gibello A, Blanco MM, Moreno MA, et al. Development of a PCR assay for

detection of Yersinia ruckeri in tissues of inoculated and naturally infectedtrout. Applied and Environmental Microbiology 1999;65:346–50.

[15] Olsvik PA, Lie KK, Jordal AEO, Nilsen TO, Hordvik I. Evaluation of potentialreference genes in real-time RT-PCR studies of Atlantic salmon. BMC Molec-ular Biology, http://www.biomedcentral.com/content/pdf/1471-21996-21.pdf,2005;6.

[16] Ingerslev HC, Pettersen EF, Jakobsen RA, Petersen CB, Wergeland HI. Expres-sion profiling and validation of reference gene candidates in immune relevanttissues and cells from Atlantic salmon (Salmo salar L.). Molecular Immunology2006;43:1194–201.

[17] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the ‘2(-Delta Delta CT) method’. Methods2001;25:402–8.

[18] Press CM, Evensen O. The morphology of the immune system in teleost fishes.Fish & Shellfish Immunology 1999;9:309–18.

[19] Overturf K, LaPatra S. Quantitative expression of immunological factors inrainbow trout, Oncorhynchus mykiss (Walbaum), after infection with eitherFlavobacterium psychrophilum, Aeromonas salmonicida, or infectious haema-topoietic necrosis virus. Journal of Fish Diseases 2006;29:215–24.

[20] Hong SH, Peddie S, Campos-Perez JJ, Zou J, Secombes CJ. The effect of intra-peritoneally administered recombinant IL-1 beta on immune parameters andresistance to Aeromonas salmonicida in the rainbow trout (Oncorhynchusmykiss). Developmental and Comparative Immunology 2003;27:801–12.

[21] Martin S, Zou J, Houlihan D, Secombes C. Directional responses followingrecombinant cytokine stimulation of rainbow trout (Oncorhynchus mykiss)RTS-11 macrophage cells as revealed by transcriptome profiling. BMC Geno-mics 2007;8:150.

[22] Secombes CJ, Bird S, Cunningham C, Zou J. Interleukin-1 in fish. Fish &Shellfish Immunology 1999;9:335–43.

[23] Secombes CJ, Zou J, Laing K, Daniels GD, Cunningham C. Cytokine genes in fish.Aquaculture 1999;172:93–102.

[24] Gonzalez SF, Huising MO, Stakauskas R, Forlenza M, Verburg-vanKemenade BML, Buchmann K, et al. Real-time gene expression analysis in carp(Cyprinus carpio L.) skin: inflammatory responses to injury mimicking infec-tion with ectoparasites. Developmental and Comparative Immunology2007;31:244–54.

[25] Lindenstrom T, Buchmann K, Secombes CJ. Gyrodactylus derjavini infectionelicits IL-1 beta expression in rainbow trout skin. Fish & Shellfish Immunology2003;15:107–15.

[26] Sigh J, Lindenstrom T, Buchmann K. Expression of pro-inflammatory cytokinesin rainbow trout (Oncorhynchus mykiss) during an infection with Ichthyoph-thirius multifiliis. Fish & Shellfish Immunology 2004;17:75–86.

[27] Tafalla C, Coll J, Secombes CJ. Expression of genes related to the early immuneresponse in rainbow trout (Oncorhynchus mykiss) after viral haemorrhagicsepticemia virus (VHSV) infection. Developmental and Comparative Immu-nology 2005;29:615–26.

[28] Scapigliati G, Costantini S, Colonna G, Facchiano A, Buonocore F, Bossu P, et al.Modelling of fish interleukin-1 and its receptor. Developmental andComparative Immunology 2004;28:429–41.

[29] Dinarello CA. Biologic basis for interleukin-1 in disease. Blood 1996;87:2095–147.[30] Bandara G, Mueller GM, Galealauri J, Tindal MH, Georgescu HI, Suchanek MK,

et al. Intraarticular expression of biologically active interleukin-1 receptorantagonist protein by ex vivo gene transfer. Proceedings of the NationalAcademy of Sciences of the United States of America 1993;90:10764–8.

[31] Cominelli F, Bortolami M, Pizarro TT, Monsacchi L, Ferretti M, Brewer MT, et al.Rabbit interleukin-1 receptor antagonist. Cloning, expression, functionalcharacterization, and regulation during intestinal inflammation. The Journal ofBiological Chemistry 1994;269:6962–71.

[32] Hung GL, Galealauri J, Mueller GM, Georgescu HI, Larkin LA, Suchanek MK,et al. Suppression of intraarticular responses to interleukin-1 by transfer of theinterleukin-1 receptor antagonist gene to synovium. Gene Therapy1994;1:64–9.

[33] Yang H, Tuzun E, Alagappan D, Yu X, Scott BG, Ischenko A, et al. IL-1 receptorantagonist-mediated therapeutic effect in murine myasthenia gravis isassociated with suppressed serum proinflammatory cytokines, C3, and anti-acetylcholine receptor IgG1. Journal of Immunology 2005;175:2018–25.

[34] Engelsma MY, Huising MO, van Muiswinkel WB, Flik G, Kwang J, Savelkoul HFJ,et al. Neuroendocrine–immune interactions in fish: a role for interleukin-1.Veterinary Immunology and Immunopathology 2002;87:467–79.

[35] Dinarello CA, Abraham E. Does blocking cytokines in sepsis work? AmericanJournal of Respiratory and Critical Care Medicine 2002;166:1156–7.

[36] Sangrador-Vegas A, Martin SAM, O’Dea PG, Smith TJ. Cloning and character-ization of the rainbow trout (Oncorhynchus mykiss) type II interleukin-1receptor cDNA. European Journal of Biochemistry 2000;267:7031–7.

[37] Iliev DB, Castellana B, MacKenzie S, Planas JV, Goetz FW. Cloning andexpression analysis of an IL-6 homolog in rainbow trout (Oncorhynchusmykiss). Molecular Immunology 2007;44:1803–7.

[38] Ammit AJ, Lazaar AL, Irani C, O’Neill GM, Gordon ND, Amrani Y, et al. Tumornecrosis factor-alpha-induced secretion of RANTES and interleukin-6 fromhuman airway smooth muscle cells – modulation by glucocorticoids and beta-agonists. American Journal of Respiratory Cell and Molecular Biology2002;26:465–74.

[39] Bergamaschi A, Corsi M, Garnier MJ. Synergistic effects of cAMP-dependentsignalling pathways and IL-1 on IL-6 production by H19-7/IGF-IR neuronalcells. Cellular Signalling 2006;18:1679–84.

[40] Takezako N, Hayakawa M, Hayakawa H, Aoki S, Yanagisawa K, Endo H, et al.ST2 suppresses IL-6 production via the inhibition of I kappa B degradationinduced by the LPS signal in THP-1 cells. Biochemical and Biophysical ResearchCommunications 2006;341:425–32.

[41] Lovoll M, Fischer U, Mathisen GS, Bogwald J, Ototake M, Dalmo RA. The C3subtypes are differentially regulated after immunostimulation in rainbowtrout, but head kidney macrophages do not contribute to C3 transcription.Veterinary Immunology and Immunopathology 2007;117:284–95.

[42] Raida MK, Buchmann K. Bath vaccination of rainbow trout (Oncorhynchusmykiss Walbaum) against Yersinia ruckeri: effects of temperature on protectionand gene expression. Vaccine 2008;26:1050–62.

[43] Zhang H, Thorgaard GH, Ristow SS. Molecular cloning and genomic struc-ture of an interleukin-8 receptor-like gene from homozygous clones ofrainbow trout (Oncorhynchus mykiss). Fish & Shellfish Immunology2002;13:251–8.

[44] Jimenez N, Coll J, Salguero FJ, Tafalla C. Co-injection of interleukin 8 with theglycoprotein gene from viral haemorrhagic septicemia virus (VHSV) modu-lates the cytokine response in rainbow trout (Oncorhynchus mykiss). Vaccine2006;24:5615–26.

[45] Inoue Y, Kamota S, Itoa K, Yoshiura Y, Ototake M, Moritomo T, et al. Molecularcloning and expression analysis of rainbow trout (Oncorhynchus mykiss)interleukin-10 cDNAs. Fish & Shellfish Immunology 2005;18:335–44.

[46] Zou J, Clark MS, Secombes CJ. Characterisation, expression and promoteranalysis of an interleukin 10 homologue in the puffer fish, Fugu rubripes.Immunogenetics 2003;55:325–35.

[47] Savan R, Igawa D, Sakai M. Cloning, characterization and expression analysis ofinterleukin-10 from the common carp, Cyprinus carpio L. European Journal ofBiochemistry 2003;270:4647–54.

[48] Zhang DC, Shao YQ, Huang YQ, Jiang SG. Cloning, characterization andexpression analysis of interleukin-10 from the zebrarish (Danio rerion). Journalof Biochemistry and Molecular Biology 2005;38:571–6.

[49] D’Amico G, Frascaroli G, Bianchi G, Transidico P, Doni A, Vecchi A, et al.Uncoupling of inflammatory chemokine receptors by IL-10: generation offunctional decoys. Nature Immunology 2000;1:387–91.

[50] Dumoutier L, Louahed J, Renauld JC. Cloning and characterization ofIL-10-related T cell-derived inducible factor (IL-TIF), a novel cytokine struc-turally related to IL-10 and inducible by IL-9. Journal of Immunology2000;164:1814–9.

[51] Wang T, Holland JW, Bols N, Secombes CJ. Cloning and expression of the firstnonmammalian interleukin-11 gene in rainbow trout (Oncorhynchus mykiss).FEBS Journal 2005;272:1136–47.

[52] Acosta-Rodriguez EV, Napolitani G, Lanzavecchia A, Sallusto F. Interleukins1 beta and 6 but not transforming growth factor-beta are essential for thedifferentiation of interleukin 17-producing human T helper cells. NatureImmunology 2007;8:942–9.

[53] Bromage ES, Kaattari IM, Zwollo P, Kaattari SL. Plasmablast and plasma cellproduction and distribution in trout immune tissues. Journal of Immunology2004;173:7317–23.

[54] Janeway CA, Travers P, Walport M, Shlomchik MJ. Immunobiology: theimmune system in health and disease. 6th ed. New York and London: GarlandScience Publishing; 2005.

[55] Hansen JD, Strassburger P. Description of an ectothermic TCR coreceptor, CD8alpha, in rainbow trout. Journal of Immunology 2000;164:3132–9.

[56] Fischer U, Utke K, Ototake M, Dijkstra JM, Kollner B. Adaptive cell-mediatedcytotoxicity against allogeneic targets by CD8-positive lymphocytes ofrainbow trout (Oncorhynchus mykiss). Developmental and ComparativeImmunology 2003;27:323–37.

[57] Utke K, Bergmann S, Lorenzen N, Kollner B, Ototake M, Fischer U. Cell-mediated cytotoxicity in rainbow trout, Oncorhynchus mykiss, infected with viralhaemorrhagic septicaemia virus. Fish & Shellfish Immunology 2007;22:182–96.