Ragulator-Rag Complex Targets mTORC1 tothe Lysosomal Surface and Is Necessaryfor Its Activation by Amino AcidsYasemin Sancak,1,2,3,6 Liron Bar-Peled,1,2,3,6 Roberto Zoncu,1,2,3 Andrew L. Markhard,1,2 Shigeyuki Nada,4

and David M. Sabatini1,2,3,5,*1Whitehead Institute for Biomedical Research, 9 Cambridge Center, Cambridge, MA 02142, USA2Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139, USA3The David H. Koch Institute for Integrative Cancer Research at MIT, 77 Massachusetts Avenue, Cambridge, MA 02139, USA4Department of Oncogene Research, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita,

Osaka 565-0871, Japan5Howard Hughes Medical Institute6These authors contributed equally to this work

*Correspondence: sabatini@wi.mit.edu

DOI 10.1016/j.cell.2010.02.024

SUMMARY

The mTORC1 kinase promotes growth in responseto growth factors, energy levels, and amino acids,and its activity is often deregulated in disease. TheRag GTPases interact with mTORC1 and are pro-posed to activate it in response to amino acids bypromoting mTORC1 translocation to a membrane-bound compartment that contains the mTORC1 acti-vator, Rheb. We show that amino acids induce themovement of mTORC1 to lysosomal membranes,where the Rag proteins reside. A complex encodedby the MAPKSP1, ROBLD3, and c11orf59 genes,which we term Ragulator, interacts with the RagGTPases, recruits them to lysosomes, and is essen-tial for mTORC1 activation. Constitutive targeting ofmTORC1 to the lysosomal surface is sufficient torender the mTORC1 pathway amino acid insensitiveand independent of Rag and Ragulator, but notRheb, function. Thus, Rag-Ragulator-mediated trans-location of mTORC1 to lysosomal membranes is thekey event in amino acid signaling to mTORC1.

INTRODUCTION

The multicomponent kinase mTORC1 (mammalian target of

rapamycin complex 1) regulates cell growth by coordinating

upstream signals from growth factors, intracellular energy levels,

and amino acid availability and is deregulated in diseases such as

cancer and diabetes (reviewed in Guertin and Sabatini, 2007).

The TSC1 and TSC2 proteins form a tumor suppressor complex

that transmits growth factor and energy signals to mTORC1 by

regulating the GTP-loading state of Rheb, a Ras-related GTP-

binding protein. When bound to GTP, Rheb interacts with and

activates mTORC1 (reviewed in Laplante and Sabatini, 2009)

290 Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc.

and appears to be necessary for the activation of mTORC1 by

all signals, including amino acid availability. In contrast, TSC1-

TSC2 is dispensable for the regulation of mTORC1 by amino

acids, and, in cells lacking TSC2, the mTORC1 pathway is sensi-

tive to amino acid starvation but resistant to growth factor with-

drawal (Roccio et al., 2006; Smith et al., 2005).

Recently, the Rag GTPases, which are also members of the

Ras family of GTP-binding proteins, were shown to be amino

acid-specific regulators of the mTORC1 pathway (Kim et al.,

2008; Sancak et al., 2008). Mammals express four Rag

proteins—RagA, RagB, RagC, and RagD—that form hetero-

dimers consisting of RagA or RagB with RagC or RagD. RagA

and RagB, like RagC and RagD, are highly similar to each other

and are functionally redundant (Hirose et al., 1998; Sancak et al.,

2008; Schurmann et al., 1995; Sekiguchi et al., 2001). Rag heter-

odimers containing GTP-bound RagB interact with mTORC1,

and amino acids induce the mTORC1-Rag interaction by

promoting the loading of RagB with GTP, which enables it to

directly interact with the raptor component of mTORC1 (Sancak

et al., 2008). The activation of the mTORC1 pathway by amino

acids correlates with the movement of mTORC1 from an unde-

fined location to a compartment containing Rab7 (Sancak

et al., 2008), a marker of both late endosomes and lysosomes

(Chavrier et al., 1990; Luzio et al., 2007). How the Rag proteins

regulate mTORC1 is unknown, but, in cells expressing a RagB

mutant that is constitutively bound to GTP (RagBGTP), the

mTORC1 pathway is insensitive to amino acid starvation

and mTORC1 resides in the Rab7-positive compartment even

in the absence of amino acids (Sancak et al., 2008). We previ-

ously proposed that amino acids promote the translocation of

mTORC1—in a Rag-dependent fashion—to the surface of an

endomembrane compartment, where mTORC1 can find its

well-known activator, Rheb. Here, we show that the lysosomal

surface is the compartment where the Rag proteins reside and

to which mTORC1 moves in response to amino acids. We iden-

tify the trimeric Ragulator protein complex as a new component

of the mTORC1 pathway that interacts with the Rag GTPases, is

essential for localizing them and mTORC1 to the lysosomal

surface, and is necessary for the activation of the mTORC1

pathway by amino acids. In addition, by expressing in cells

a modified raptor protein that targets mTORC1 to the lysosomal

surface, we provide evidence that supports our model of

mTORC1 pathway activation by amino acids.

RESULTS

Amino Acids Cause the Translocation of mTORC1to Lysosomal Membranes, Where the Rag GTPasesAre Already PresentTo better define the compartment to which mTORC1 moves

upon amino acid stimulation, we costained human cells with

antibodies to endogenous mTOR, raptor, or RagC, as well as

to various endomembrane markers (data not shown). This

revealed that in the presence, but not in the absence, of amino

acids, mTOR and raptor colocalized with LAMP2 (Figures 1A

and 1B), a well-characterized lysosomal marker (reviewed in

Eskelinen, 2006). Amino acid stimulation also resulted in an

appreciable increase in the average size of lysosomes, which,

as determined by live-cell imaging, was most likely caused by

lysosome-lysosome fusion (R.Z., unpublished data). The amino

acid-induced movement of mTOR to the LAMP2-positive

compartment depends on the Rag GTPases, as it was eliminated

by the RNA interference (RNAi)-mediated coknockdown of RagA

and RagB (Figures S1A and S1B available online). Endogenous

RagC also colocalized extensively with LAMP2, but, unlike

mTORC1, this colocalization was unaffected by amino acid

availability (Figure 1C). Consistent with amino acids not regu-

lating the interaction between RagC and RagA or RagB (Fig-

ure 1D), an antibody that recognizes RagA and RagB stained

lysosomes in both amino acid-starved and replete cells (Fig-

ure 1E). Lastly, GFP-tagged wild-type and GTP-bound mutants

of RagB (RagBGTP) and RagD (RagDGTP) behaved identically

to their endogenous counterparts (Figures 1F and 1G). Thus,

amino acids stimulate the translocation of mTORC1 to the lyso-

somal surface, where the Rag GTPases reside irrespective of

their GTP-loaded states or amino acid availability. Given that

mTORC1 interacts with the Rag heterodimers in an amino

acid-dependent fashion (Sancak et al., 2008), the mTORC1

and Rag localization data are consistent with the Rag GTPases

serving as an amino acid-regulated docking site for mTORC1

on lysosomes.

The Translocation of mTORC1 to Lysosomes Does NotDepend on Growth Factors, Rheb, or mTORC1 ActivityThe movement of mTORC1 to lysosomes is a specific response

to amino acids. In wild-type mouse embryonic fibroblasts

(MEFs), amino acids promoted the translocation of mTORC1 to

lysosomes even when cells were cultured in the absence of

serum (Figure S1C), a condition in which mTORC1 signaling,

as detected by phosphorylated S6K1, is not active (Figure S1D).

Conversely, in the absence of amino acids, neither serum stimu-

lation nor constitutive activation of Rheb caused by the loss of

TSC2 led to the lysosomal translocation of mTORC1 (Fig-

ure S1C). In both wild-type and TSC2 null MEFs, RNAi-mediated

suppression of Rheb1 expression inhibited mTORC1 activation

by amino acids (Figure S1E) but did not interfere with the amino

acid-induced movement of mTOR to lysosomes (Figure S1F).

Thus, the amino acid-induced translocation of mTORC1 to the

lysosomal surface occurs independently of mTORC1 activity

and does not require TSC2, Rheb, or growth factors.

The Trimeric Ragulator Complex Interacts with the RagGTPases and Colocalizes with Them on LysosomalMembranesInspection of the amino acid sequence of the Rag GTPases

did not reveal any obvious lipid modification signals that

might mediate Rag recruitment to lysosomal membranes.

Thus, we pursued the possibility that unknown Rag-interacting

proteins are needed to localize the Rag GTPases to lysosomes

and play a role in mTORC1 signaling. To identify such proteins,

we used protein purification approaches that have led to

the discovery of other mTOR pathway components (see the

Extended Experimental Procedures). Mass spectrometric anal-

ysis of anti-FLAG immunoprecipitates prepared from human

HEK293T cells stably expressing FLAG-RagB or FLAG-RagD,

but not FLAG-Rap2a, consistently revealed the presence of

proteins encoded by the MAPKSP1, ROBLD3, and c11orf59

genes (Figure 2A). Furthermore, the same proteins were also de-

tected in immunoprecipitates of endogenous RagC but not

control proteins like p53 or tubulin. Previous work indicates

that these three small proteins interact with each other, localize

to endosomes and lysosomes, and play positive roles in the

MAPK pathway (Lunin et al., 2004; Nada et al., 2009; Schaeffer

et al., 1998; Teis et al., 2002, 2006; Wunderlich et al., 2001).

The proteins encoded by MAPKSP1, ROBLD3, and c11orf59

have been called MP1, p14, and p18, respectively, and we use

these names throughout this study. For convenience and

because MP1, p14, and p18 are Rag and mTORC1 regulators

(see below), we refer to the trimeric complex as the ‘‘Ragulator.’’

Orthologs of MP1, p14, and p18 are readily detectable in

vertebrates as well as in Drosophila (Figure 2A), but extensive

database searches did not reveal any potential orthologs in

budding or fission yeast. The amino acid sequences of MP1,

p14, and p18 reveal little about their function, and other than

p14, which has a roadblock domain of unknown function (Koonin

and Aravind, 2000), the proteins do not share sequence

homology among themselves or with any other proteins in the

databases besides their direct orthologs. In particular, they do

not share any sequence similarity with the Ego1p or Ego3p,

proteins, which interact with Gtr1p and Gtr2p (Dubouloz et al.,

2005; Gao and Kaiser, 2006), the orthologs of the Rag proteins

in budding yeast (Gao and Kaiser, 2006; Schurmann et al.,

1995). The lysosomal localization of p18 requires its lipidation

through N-terminal myristoylation and palmitoylation sites, and

p18 likely serves as a platform for keeping MP1 and p14 on the

lysosomal surface (Nada et al., 2009).

In humans, a mutation that leads to a partial reduction in the

expression of p14 causes a pronounced growth defect so that

individuals carrying the mutation are below the third percentile

in age-adjusted height (Bohn et al., 2007). Furthermore, mice

engineered to lack either p14 or p18 die around embryonic

day 7–8 and exhibit severe growth retardation (Nada et al.,

2009; Teis et al., 2006). Given the major role of the mTORC1

Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc. 291

B

D

E

F

G

LA

MP

1-m

RF

PG

FP

-R

agD

merg

eL

AM

P1-

mR

FP

GF

P-

Rag

Dm

erge

-a.a. for50 min

-a.a. for50 min

+a.a. for10 min

GFP-RagD LAMP1-mRFP GFP-RagDGTP LAMP1-mRFPcells

expressing:

C

merg

eL

AM

P2

Rag

A/B

merg

e

-a.a. for50 min

-a.a. for50 min

+a.a. for10 min

antibody: RagA/B LAMP2L

AM

P2

Rag

A/B

+- +-control RagC

amino acids:IP antibody:

P -T389-S6K1

S6K1

RagA

RagB

RagC

RagA

RagBIP

lysate

GFP-RagB LAMP1-mRFP GFP-RagBGTP LAMP1-mRFP

LA

MP

1-m

RF

PG

FP

-R

agB

merg

eL

AM

P1-

mR

FP

GF

P-

Rag

Bm

erge

-a.a. for50 min

-a.a. for50 min

+a.a. for10 min

cells expressing:

A

mT

OR

mT

OR

antibody: mTOR LAMP2

LA

MP

2m

erge

LA

MP

2m

erge

raptor LAMP2

rapto

rL

AM

P2

merg

erap

tor

-a.a. for50 min

-a.a. for50 min

+a.a. for10 min

antibody:

LA

MP

2m

erge

RagC LAMP2

Rag

CR

agC

-a.a. for50 min

-a.a. for50 min

+a.a. for10 min

antibody:

LA

MP

2m

erge

LA

MP

2m

erge

-a.a. for50 min

-a.a. for50 min

+a.a. for10 min

Figure 1. mTORC1 Localizes to Lysosomal Membranes in an Amino Acid-Dependent Fashion while the Rag GTPases Are Constitutively

Localized to the Same Compartment

(A) Images of HEK293T cells coimmunostained for lysosomal protein LAMP2 (green) and mTOR (red). Cells were starved of and restimulated with amino acids for

the indicated times before processing and imaging.

(B) Images of HEK293T cells coimmunostained for LAMP2 (green) and raptor (red). Cells were treated and processed as in (A).

(C) Images of HEK293T cells coimmunostained for LAMP2 (green) and RagC (red). Cells were treated and processed as in (A).

(D) RagC interacts with RagA and RagB independently of amino acid availability. RagC immunoprecipitates were prepared from HEK293T cells starved or stim-

ulated with amino acids as in (A), and immunoprecipitates and lysates were analyzed by immunoblotting for the indicated proteins.

(E) Images of HEK293T cells coimmunostained for RagA/B (green) and LAMP2 (red). Cells were treated, processed, and imaged as in (A).

(F) GFP-RagB and GFP-RagBGTP colocalize with coexpressed LAMP1-mRFP independently of amino acid availability. HEK293T cells transfected with the

indicated cDNAs were treated and processed as in (A).

(G) GFP-RagD and GFP-RagDGTP colocalize with coexpressed LAMP1-mRFP independently of amino acid availability. HEK293T cells transfected with the

indicated cDNAs were treated and processed as in (A).

In all images, insets show selected fields that were magnified five times and their overlays. Scale bars represent 10 mm. See also Figure S1.

pathway in growth control, these loss-of-function phenotypes

were of interest to us.

As an initial step in verifying our mass spectrometric identifica-

tion of MP1, p14, and p18 as Rag-interacting proteins, we coex-

pressed them along with RagB and RagD in HEK293T cells and

found that the Ragulator, but not the control Rap2A protein,

coimmunoprecipitated both Rag GTPases but not the metap2

292 Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc.

protein that has the same molecular weight as tagged RagB (Fig-

ure 2B). Furthermore, when coexpressed with a RagB mutant

(RagBGTP) that binds constitutively to GTP, the Ragulator coim-

munoprecipitated the mTORC1 components raptor and mTOR

(Figure 2C), consistent with the GTP-loading of RagB promoting

the interaction of the Rag heterodimers with mTORC1 (Sancak

et al., 2008). Furthermore, endogenous RagA, RagB, and RagC

Figure 2. The Trimeric Ragulator Complex Interacts and Colocalizes with the Rag GTPases

(A) Schematic amino acid sequence alignment of human MP1, p14, and p18 and their corresponding Drosophila orthologs.

(B) Recombinant epitope-tagged Ragulator coimmunoprecipitates recombinant RagB and RagD. Anti-FLAG immunoprecipitates were prepared from HEK293T

cells cotransfected with the indicated cDNAs in expression vectors and cell lysates and immunoprecipitates analyzed by immunoblotting for levels of indicated

proteins. The * indicates the band corresponding to the metap2 protein as it has the same apparent molecular weight as HA-GST-RagB.

(C) Recombinant Ragulator coimmunoprecipitates mTORC1 when it is coexpressed with the GTP-bound mutant of RagB. HEK293T cells were cotransfected

with the indicated cDNAs in expression vectors and analyzed as in (B). The * indicates the bands corresponding to metap2 as it has the same apparent molecular

weight as HA-GST-RagB.

(D) Recombinant Ragulator co-immunoprecipitates endogenous RagA, RagB, and RagC. HEK293T cells were cotransfected with indicated cDNAs in expression

vectors and anti-FLAG immunoprecipitates analyzed as in (B).

(E) Recombinant RagB-RagD heterodimers coimmunoprecipitate endogenous p14, MP1, and p18. HEK293T cells were cotransfected with indicated cDNAs in

expression vectors and anti-FLAG immunoprecipitates analyzed as in (B).

(F) Endogenous RagC coimmunoprecipitates endogenous p14 and MP1. Anti-RagC immunoprecipitates were prepared from HEK293T cells and analyzed for the

levels of the indicated proteins.

(G) Amino acids do not regulate the amounts of endogenous MP1, p14, RagA, or RagB that coimmunoprecipitate with recombinant p18. p18 null cells (p18�/�) or

p18 null cells stably expressing FLAG-p18 (p18rev) were starved for amino acids for 50 min or starved and restimulated with amino acids for 10 min. After in-cell

crosslinking, anti-FLAG immunoprecipitates were prepared from cell lysates and analyzed for the levels of the indicated proteins by immunoblotting.

(H) Amino acids do not affect the amounts of endogenous p14 and p18 that coimmunoprecipitate with endogenous RagA/B. HEK293T cells were treated as in (G),

and anti-RagA/B immunoprecipitates were analyzed by immunoblotting for the indicated proteins.

(I) Endogenous Ragulator coimmunoprecipitates with FLAG-RagB independently of amino acid availability and GTP-loading of RagB. HEK293T cells stably

expressing FLAG-RagB or FLAG-RagBGTP were starved and restimulated with amino acids as in (G), and anti-FLAG immunoprecipitates were analyzed for

the levels of indicated proteins.

(J) The Rag GTPases colocalize with GFP-tagged p18. HEK293T cells were transfected with a cDNA encoding p18-GFP, processed for immunostaining for

endogenous RagA/B or RagC, and imaged for the RagA/B (red) or RagC (red) signal as well as for p18-GFP fluorescence (green). Note that not all cells express

p18-GFP. In all images, insets show selected fields that were magnified five times and their overlays. Scale bars represent 10 mm.

See also Figure S2.

copurified with recombinant Ragulator (Figure 2D), and endoge-

nous Ragulator components copurified with the recombinant

RagB-RagD heterodimer (Figure 2E). Lastly, endogenous p14

and MP1 were present in immunoprecipitates prepared with

an antibody directed against endogenous RagC that readily

coimmunoprecipitates RagA (Figure 2F).

Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc. 293

RagC LAMP2 RagC LAMP2

RagC

LAMP2

merge

p14+/+

antibody:

RagC

LAMP2

merge

p14-/-A

RagC LAMP2 RagC LAMP2

RagC

LAMP2

merge

p18rev

antibody:

RagC

LAMP2

merge

p18-/-

B

-a.a. for50 min

-a.a. for50 min

+a.a. for10 min

-a.a. for50 min

-a.a. for50 min

+a.a. for10 min

mTOR LAMP2 mTOR LAMP2

mTOR

LAMP2

merge

antibody:

mTOR

LAMP2

merge

p18rev p18-/-

-a.a. for50 min

-a.a. for50 min

+a.a. for10 min

C

mTOR

LAMP2

merge

mTOR

LAMP2

merge

mTOR LAMP2 mTOR LAMP2

p14+/+

antibody:

p14-/-

-a.a. for50 min

-a.a. for50 min

+a.a. for10 min

mRFP-RagB GFP-Mito mR

FP

-R

agB

GF

P-

Mito

merg

e

mRFP-RagB GFP-Mito mRFP-RagB GFP-Mito

p18rev p18-/- p18mitocotransfected

cDNAs:

Figure 3. The Ragulator Is Necessary to Localize the Rag GTPases and mTORC1 to Lysosomal Membranes

(A) Images of p14 null or p18 null cells or their respective controls coimmunostained for RagC (red) and LAMP2 (green). Cells were starved of and restimulated with

amino acids for the indicated times before processing for the immunofluorescence assay and imaging.

(B) Images of p14 null or p18 null cells or their respective controls coimmunostained for mTOR (red) and LAMP2 (green). Cells were treated and processed

as in (A).

(C) Colocalization of mRFP-RagB (red) with GFP-Mito (green) in cells expressing mitochondrially localized p18. p18 null cells (p18�/�), or p18 null cells expressing

wild-type p18 (p18rev) or mitochondrially localized p18 (p18mito), were transiently transfected with the indicated cDNAs in expression plasmids and imaged.

In all images, insets show selected fields that were magnified five times and their overlays. Scale bars represent 10 mm. See also Figure S3.

Amino acids did not appreciably regulate the interaction

of recombinant p18 with endogenous p14, MP1, or the Rag

GTPases (Figure 2G). Similarly, amino acids did not affect the

interaction of endogenous Ragulator with endogenous Rag A/B

(Figure 2H). The amounts of p14, p18, and MP1 that coimmuno-

precipitated with the GTP-bound RagB mutant (RagBGTP) were

slightly less than with wild-type RagB (Figure 2I). Because

mTORC1 pathway activity is high in cells expressing RagBGTP

(Sancak et al., 2008), the reduced Ragulator-Rag interaction in

these cells may reflect a compensatory mechanism to reduce

mTORC1 activity. To test whether the Rag GTPases interact

with one or more Ragulator components directly, we performed

in vitro binding assays between purified RagB-RagD hetero-

dimers and individual Ragulator proteins. p18 interacted with

RagB-RagD in vitro, but not with the Rap2a control protein

(Figure S2A). In contrast, we did not detect a direct interaction

between either p14 or MP1 and the Rag GTPases (data not

shown), suggesting that p18 is the principal Rag-binding subunit

of the Ragulator. Lastly, within HEK293T cells, GFP-tagged p18

colocalized with endogenous RagA/B and RagC (Figure 2J).

294 Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc.

Collectively, these results show that the Ragulator interacts with

the Rag GTPases and that a supercomplex consisting of

Ragulator, a Rag heterodimer, and mTORC1 canexist within cells.

Ragulator Localizes the Rag Proteins to the LysosomalSurface and Is Necessary for the Amino Acid-DependentRecruitment of mTORC1Because the Rag GTPases interact with Ragulator and given the

function of p18 in localizing MP1 and p14 to lysosomes (Nada

et al., 2009), it seemed possible that the Ragulator is necessary

for localizing the Rag proteins to the lysosomal surface. Indeed,

in cells lacking p14 or p18 (Nada et al., 2009; Teis et al., 2006),

endogenous RagC was localized in small puncta throughout

the cytoplasm of the cells rather than to lysosomes (Figure 3A),

the morphology of which was not obviously affected by the

loss of either protein. In contrast, in p14+/+ cells or p18 null cells

reconstituted with wild-type p18 (p18rev), RagC constitutively

colocalized with the LAMP2 lysosomal marker (Figure 3A). Anal-

ogous results were obtained in HEK293T cells with an RNAi-

mediated reduction in MP1 expression (Figure S3A). Consistent

A B C

D

cell diameter (µm)

10 12 14 16 18 20 22

p14-/-p14+/+

cell diameter (µm)8 10 12 14 16 18

p18revp18-/-

+- +-+ + + +

+ + +++- +-

p14+/+p14-/- p14-/-

S6K1

RagC

RagA

serum:amino acids:

p14

p14+/+

P -T389-S6K1

amino acids:

dsRNA: GFPdRagC

dMP1dp14

dp18

+- +- +- +- +-

dS6K

P -T398-dS6K

P -T398-dS6K

shortexp

longexp

+- +-GFP

-MP1_1 MP1_2

+

P -T389-S6K1

S6K1

shRNA:

MP1

amino acids:

E

+- +-+ + + +

+ + +++- +-

p18rev p18revp18-/- p18-/-

RagC

p18

S6K1

serum:amino acids:

shortexp

longexp

P -T389-S6K1

P -T389-S6K1

RagA

GF

+- +-amino acids:

healthydonor

S6K1

P -T389-S6K1

patientdonor 1

p14

Akt

P -S473-Akt

+ + +++- +-

p14+/+

p14-/-

serum:amino acids:

+ ++ +

p18-/-

p18rev

+-

patientdonor 2

Figure 4. Ragulator Null and -Depleted Cells are Highly Deficient in the Activation of mTORC1 Signaling by Amino Acids

(A) p14 is necessary for the activation of the mTORC1 pathway by amino acids and serum. p14 null or control cells were starved of amino acids or serum for

50 min, or starved and restimulated with amino acids or serum for 10 min. Immunoblot analyses were used to measure the levels of the indicated proteins

and phosphorylation states.

(B) p18 is necessary for the activation of the mTORC1 pathway by amino acids and serum. p18 null or control cells were treated and analyzed as in (A).

(C) Partial knockdown of MP1 blunts mTORC1 pathway activation by amino acids. HEK293T cells expressing a control shRNA or two distinct shRNAs targeting

MP1 were starved for amino acids for 50 min, or starved and stimulated with amino acids for 10 min and analyzed as in (A).

(D) p14 and p18 are not necessary for mTORC2 pathway activity. p14 null or control cells were starved for serum, or starved and then restimulated with serum as

in (A). p18 null or control cells were grown in complete media. Cell lysates were prepared and analyzed by immunobloting for the levels of Akt1 and Akt phos-

phorylation at the S473 site phosphorylated by mTORC2.

(E) Decreased p14 expression impairs amino acid-induced mTORC1 activation in human cells. Cells derived from patients with lower p14 expression or healthy

individuals were treated and analyzed as in (A).

(F) Cells lacking Ragulator are smaller than control cells. Cell size distributions of p14 null or p18 null cells are overlaid with those from corresponding control cells.

(G) Ragulator function is conserved in Drosophila cells. Drosophila S2 cells were transfected with a control dsRNA, or dsRNAs targeting dRagC, dMP1, dp14, or

dp18, starved of amino acids for 90 min, or starved and restimulated with amino acids for 30 min. Levels of indicated proteins and phosphorylation states were

analyzed by immunobloting.

See also Figure S4.

with the essential role of the Rag proteins in the translocation of

mTORC1 to the lysosomal surface (Figure S1), in cells lacking

p14 or p18 or in HEK293T cells with p14, p18, or MP1 knock-

downs, amino acids failed to induce lysosomal recruitment of

mTOR, which was found throughout the cytoplasm in both

amino acid-starved and -stimulated cells (Figure 3B, Figures

S3B and S3D). Thus, all Ragulator subunits are required for lyso-

somal targeting of the Rag GTPases and mTORC1.

To determine whether Ragulator is sufficient to control the

intracellular localization of the Rag proteins, it was necessary

to target Ragulator to a location that is distinct from the lyso-

somal surface. As p18 binds both p14 and MP1 and is necessary

for targeting them to the lysosomal surface (Nada et al., 2009),

we chose to manipulate the intracellular localization of p18. To

accomplish this, we generated a variant of p18, called p18mito,

which lacks its N-terminal lipidation sites but is fused at its

C terminus to the transmembrane region of OMP25, which is

sufficient to target heterologous proteins to the mitochondrial

surface (Nemoto and De Camilli, 1999). When expressed in

p18 null cells, p18mito was associated with mitochondria, as veri-

fied by colocalization with the established mitochondrial protein

Cytochrome c (Figure S3E). Remarkably, in the p18 null cells

expressing p18mito, RFP-tagged RagB colocalized with the mito-

chondrial marker GFP-mito (Figure 3C). In contrast, RFP-RagB

did not colocalize with GFP-mito in p18 null cells (p18�/�) or

p18rev cells and instead was present in a cytoplasmic or lyso-

somal pattern, respectively (Figure 3C). In cells expressing

p18mito, mTORC1 activity remained very low and mTOR was

not recruited to the mitochondria (Figures S3E and S3F), likely

because the mitochondrial surface does not contain the

machinery necessary to load the Rag GTPases with the appro-

priate nucleotides. These results indicate that the location of

p18 is sufficient to define that of the Rag proteins and are consis-

tent with Ragulator serving as a constitutive docking site on lyso-

somes for the Rag heterodimers, which, in amino acid-replete

cells, have an analogous function for mTORC1.

Ragulator Is Necessary for TORC1 Activation by AminoAcids in Mammalian and Drosophila CellsWe employed the cells lacking p14 or p18 to determine whether

Ragulator is necessary for mTORC1 activation by amino acids.

Strikingly, in both p14 and p18 null cells, but not in control cells,

amino acids were incapable of activating the mTORC1 pathway

as detected by the phosphorylation of S6K1 (Figures 4A and 4B)

and 4E-BP1 (Figure S4A). Similarly, cells derived from patients

with a homozygous mutation in the p14 gene that causes

a reduction in p14 expression (Bohn et al., 2007) showed a defect

in amino acid-induced mTORC1 activation compared to cells

Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc. 295

derived from a healthy donor (Figure 4E). In addition, autophagy,

a process normally inhibited by mTORC1, was activated in p14

null cells, as detected by an increase compared to in control cells

in the size and number of GFP-LC3-II puncta (Figures S4B

and S4C). mTORC1 activity was also suppressed in HEK293T

cells with RNAi-induced reductions in p14, p18, or MP1 levels

(Figure 4C, Figure S3C). Consistent with the known requirement

of amino acids and Rag function for growth factors to activate

mTORC1 (Sancak et al., 2008), serum was also incapable of

activating the mTORC1 pathway in cells null for p14 or p18

(Figures 4A and 4B). In contrast, no defect was observed in the

level of S473 phosphorylation of Akt (Figure 4D). In fact, Akt

phosphoylation was slightly higher in the p14 null and p18 null

cells than in controls cells, which likely results from the lack of

the well-appreciated inhibitory input from mTORC1 to the PI3K

pathway in these cells (reviewed in Manning, 2004). As mTORC2

is the growth factor-regulated S473 kinase of Akt (Sarbassov

et al., 2005), these results also indicate that the Ragulator does

not play a detectable positive role in mTORC2 signaling. Interest-

ingly, in the p18 null cells the expression of RagA and RagC was

higher than in control cells (Figure 4B), suggesting that feedback

signals in these cells may be trying to overcome the defect in

mTORC1 activity by boosting Rag expression or that Ragulator

also negatively controls Rag GTPase levels. Consistent with

p18, p14, and MP1 forming a complex, the expression or stability

of the Ragulator proteins seems to be coregulated because in

cells that lack p14, p18 protein levels are also reduced, and,

similarly, in cells that lack p18, p14 protein levels are also low

(Figure S2B). A well-known function of the mTORC1 pathway

is the positive regulation of cell growth, so that inhibition of the

pathway leads to a reduction in cell size (reviewed in Laplante

and Sabatini, 2009). Consistent with Ragulator being a positive

component of the mTORC1 pathway, the p14 and p18 null cells

were smaller in size than their respective controls (Figure 4F).

Many components of the TORC1 pathway, such as the Rag

proteins, have conserved roles in mammalian and Drosophila

cells (Kim et al., 2008; Sancak et al., 2008). RNAi-inducing

double-stranded RNAs (dsRNAs) that target the Drosophila

orthologs of MP1 (CG5110), p14 (CG5189), and p18 (CG14184)

were as effective at blocking amino acid-stimulated activation

of dTORC1 in Drosophila S2 cells as dsRNAs targeting dRagC

(Figure 4G). Our loss-of-function experiments indicate that

Ragulator is a component of the TORC1 pathway that, like the

Rag GTPases, is essential for amino acids to activate TORC1

signaling in mammalian and Drosophila cells.

Forced Targeting of mTORC1 to the LysosomalSurface Eliminates the Amino Acid Sensitivityof the mTORC1 PathwayThe findings we have presented so far are consistent with the

amino acid-induced movement of mTORC1 to the lysosomal

surface being necessary for the activation of mTORC1 by amino

acids. To test whether the placement of mTORC1 on lysosomal

membranes is sufficient to mimic the amino acid input to

mTORC1, it was necessary to force mTORC1 onto these mem-

branes in the absence of amino acids. To accomplish this, we

expressed in HEK293T cells modified raptor proteins that

consist of epitope-tagged raptor fused to the intracellular target-

296 Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc.

ing signals of Rheb1 or Rap1b, small GTPases that localize, in

part, to the lysosomal surface (Pizon et al., 1994; Saito et al.,

2005; Sancak et al., 2008). Because the targeting signals of

these proteins are in their C-terminal tails, we added the last

15 or 17 amino acids of Rheb1 or Rap1b, respectively, to the

C terminus of raptor (Figure 5A). For simplicity, we refer to these

fusion proteins as raptor-Rheb15 and raptor-Rap1b17. As

a control, we generated a raptor fusion protein that lacks the

CAAX box of the Rheb1 targeting signal (raptor-Rheb15DCAAX)

and so cannot associate with membranes (Buerger et al., 2006;

Clark et al., 1997; Takahashi et al., 2005).

When expressed in cells together with myc-mTOR, raptor-

Rheb15 and raptor-Rap1b17 localized to lysosomes in the pres-

ence or absence of amino acids, as judged by costaining with

LAMP2 (Figure 5B). In contrast, raptor-Rheb15DCAAX behaved

like wild-type raptor and localized to lysosomes only upon amino

acid stimulation (Figure 5B). In all cases, the localization of

the coexpressed myc-mTOR mirrored that of the wild-type or

altered forms of raptor, indicating that C-terminal modifications

of raptor do not perturb its interaction with mTOR (Figure 5C),

which was confirmed in coimmunoprecipitation experiments

(Figure S5A).

Remarkably, transient expression of raptor-Rheb15 or raptor-

Rap1b17 in HEK293T cells was sufficient to render the mTORC1

pathway, as judged by the phosphorylation of S6K1, resistant to

amino acid starvation (Figure 6A). In contrast, the expression of

wild-type raptor or raptor-Rheb15DCAAX did not affect the

amino acid sensitivity of the pathway (Figure 6A). In HEK293E

cells, the expression of raptor-Rheb15 made S6K1 phosphoryla-

tion insensitive to amino acid starvation but did not affect its

regulation by insulin (Figure 6B). Thus, lysosomal targeting of

mTORC1 can substitute for the amino acid, but not growth

factor, input to mTORC1. This is consistent with previous work

showing that growth factors signal to mTORC1 in large part

through the TSC1-TSC2-Rheb axis (reviewed in Laplante and

Sabatini, 2009), and not through the Rag GTPases (Sancak

et al., 2008).

To verify the effects of lysosomally targeted mTORC1 in a

more physiological setting than that achieved by transient com-

plementary DNA (cDNA) expression, we generated HEK293T cell

lines stably expressing FLAG-tagged raptor-Rheb15 or wild-

type raptor. In cells expressing the lysosomally targeted but

not wild-type raptor, mTOR was always associated with lyso-

somes, irrespective of amino acids (Figure 6C). As with the

transient expression of raptor-Rheb15, its stable expression

rendered the mTORC1 pathway fully resistant to amino acid

starvation (Figure 6D). Furthermore, under normal growth condi-

tions, these cells had an increase in mTORC1 activity and were

larger than controls (Figure 6E).

We next examined whether the targeting of mTORC1 to

membranes other than lysosomal membranes could also elimi-

nate the amino acid sensitivity of the mTORC1 pathway. This

was not the case because although the stable expression of

a raptor variant consisting of raptor fused to the last 25 amino

acids of H-Ras (raptor-HRas25) (Figure 5A, Figure S5B) was

sufficient to target a fraction of cellular mTOR to the plasma

membrane (Figure 6C), it did not render the mTORC1 pathway

resistant to amino acid starvation (Figure 6D).

Figure 5. In Cells Expressing Raptor Variants Fused to the Targeting Signals of Rheb1 or Rap1b, mTORC1 Localizes to Lysosomal

Membranes in an Amino Acid-Independent Fashion

(A) Schematic of raptor fusion proteins that target mTORC1 to lysosomal membranes (raptor-Rheb15; raptor-Rap1b17) or to the plasma membrane (Raptor-

HRas25) as well as proteins used as controls (wild-type raptor; raptor-Rheb15DCAAX).

(B) Images of amino acid starved or replete cells expressing lysosomally targeted or control HA-tagged raptor proteins and coimmunostained for the HA epitope

(red) and endogenous LAMP2 (green). HEK293T cells were transfected with the indicated cDNAs, starved of and restimulated with amino acids for the indicated

times, and processed in the immunofluorescence assay.

(C) Images of amino acid starved or replete cells coexpressing myc-mTOR and the indicated raptor fusion proteins and coimmunostained for the myc epitope

(green) and endogenous LAMP2 (red). HEK293T cells were co-transfected with the indicated cDNAs and treated and processed as in (B).

In all images, insets show selected fields that were magnified five times and their overlays. Scale bars represent 10 mm.

Forced Targeting of mTORC1 to the Lysosomal SurfaceEliminates the Requirement in mTORC1 Signalingfor Rag and Ragulator, but Not Rheb, FunctionThe ability to constitutively localize mTORC1 to lysosomal

membranes enabled us to probe in more detail the role of the

Rag and Rheb GTPases, as well as Ragulator, in the activation

of mTORC1 by amino acids. We hypothesized that if the major

role of the Rag GTPases is to allow mTORC1 to localize to

lysosomes, then in cells that express raptor-Rheb15, mTORC1

activity should be independent of Rag function. Indeed, while

in control cells the RNAi-mediated knockdown of both RagA

and RagB strongly blunted the activation of mTORC1 by

amino acids, it did not reduce the amino acid-insensitive

mTORC1 activity observed in raptor-Rheb15-expressing cells

(Figure 7A). As an additional approach to inhibit Rag function,

we exploited the fact that coexpression of a GDP-bound RagB

mutant (RagBGDP) and a GTP-bound RagD mutant (RagDGTP)

eliminates mTORC1 pathway activity within cells (Kim et al.,

2008; Sancak et al., 2008). Expression of RagBGDP-RagDGTP

completely prevented mTORC1 activation by amino acids in

control cells but had no effect on the amino acid-insensitive

mTORC1 activity of cells expressing raptor-Rheb15 (Figure 7B).

If the main function of Ragulator in the mTORC1 pathway is to

localize the Rag GTPases to the lysosomes, then it should be

possible to reactivate the mTORC1 pathway in Ragulator null

cells by expressing raptor-Rheb15. Remarkably, the stable

expression of raptor-Rheb15, but not wild-type raptor, in p14

or p18 null cells reactivated mTORC1 signaling and made it

Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc. 297

Figure 6. Constitutive Association of Raptor with Lysosomal Membranes, but Not the Plasma Membrane, Is Sufficient to Make the mTORC1

Pathway Insensitive to Amino Acid Starvation(A) The mTORC1 pathway is not sensitive to amino acid starvation in cells that express lysosomally targeted but not control raptor proteins. HEK293T cells

were cotransfected with the indicated cDNA expression plasmids and starved of amino acids for 50 min or starved and restimulated with amino acids for

10 min. Cell lysates and anti-FLAG-S6K1 immunoprecipitates were analyzed by immunobloting for the levels of the indicated proteins and phosphorylation

states.

(B) The mTORC1 pathway is sensitive to serum starvation and insulin stimulation in cells that express lysosomally targeted as well as control raptor proteins.

HEK293E cells were cotransfected with the indicated cDNA expression plasmids, starved of amino acids for 50 min, or starved and restimulated with amino acids

for 10 min. Duplicate cultures were starved of serum for 50 min or starved and stimulated with insulin for 10 min. Cell lysates and anti-FLAG-S6K1 immunopre-

cipitates were analyzed by immunobloting for the levels of the indicated proteins and phosphorylation states.

(C) Images of cells stably expressing FLAG-raptor, FLAG-raptor-Rheb15, or FLAG-raptor-HRas25 and coimmunostained for endogenous mTOR (green) and

endogenous LAMP2 (red). HEK293T cells stably expressing the indicated proteins were treated as in (A) for the indicated times before processing in the immu-

nofluorescence assay. In all images, insets show selected fields that were magnified five times and their overlays. The scale bar represents 10 mm.

(D) Targeting of mTORC1 to the lysosomal but not the plasma membrane makes the mTORC1 pathway insensitive to amino acid starvation. HEK293T cells stably

expressing FLAG-raptor, FLAG-raptor-Rheb15, or FLAG-raptor-HRas25 were treated as in (A) and analyzed by immunoblotting for the levels of the indicated

proteins and phosphorylation states.

(E) Targeting of mTORC1 to the lysosomal membrane increases cell size and pathway activity in cells under normal growth conditions. Cell size distributions of

cells that stably express FLAG-raptor or FLAG-raptor-rheb15 as well as immunoblot analyses of the mTORC1 pathway in the same cells are shown.

298 Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc.

insensitive to amino acid deprivation (Figures 7C and 7D).

Furthermore, expression of raptor-Rheb15 in the p18 null cells

was sufficient to increase their size (Figure 7E). In contrast to

the results observed with the Rag GTPases and Ragulator,

RNAi-mediated suppression of Rheb1 blocked amino acid-

induced mTORC1 activation in cells expressing raptor-Rheb15

to the same extent as it did in control cells (Figure 7F).

To test whether the presence of mTORC1 and Rheb on

the same membrane compartment is sufficient to render the

mTORC1 pathway insensitive to amino acid levels, we generated

cells in which mTORC1 and Rheb are both present on the plasma

membrane. To accomplish this, we prepared a Rheb1 variant,

called Rheb1-HRas25, that localizes to the plasma-membrane

(Figure S5C) because it contains the C-terminal 25 amino acids

of H-Ras instead of the normal Rheb1 localization signal. When

Rheb1-HRas25 was stably coexpressed with raptor-HRas25,

but not wild-type raptor, the mTORC1 pathway became insensi-

tive to amino acid starvation (Figure 7G). Importantly, mTORC1

signaling remained amino acid-sensitive in cells in which either

Rheb or mTORC1, but not both, was targeted to the plasma

membrane (Figure 7G).

DISCUSSION

Our findings, together with previous work showing that Rheb is

required for amino acids to activate the mTORC1 pathway (Roc-

cio et al., 2006; Smith et al., 2005) and can localize to late endo-

somes/lysosomes (Saito et al., 2005; Sancak et al., 2008), is

consistent with a model in which amino acids induce mTORC1

to associate with the endomembrane system of the cell and

thus allow it to encounter its activator Rheb. In this model, the

essential role of the Ragulator-Rag complex is to serve as an

amino acid-regulated docking site for mTORC1 on lysosomal

membranes (see schematic in Figure 7H). The proposed link

between the Rag and Rheb GTPases in the regulation of the

mTORC1 pathway provides an explanation for why activation

of mTORC1 occurs only when activators of both Rheb (e.g.,

growth factors and energy) and the Rags (i.e., amino acids) are

available. For technical reasons (Buerger et al., 2006; Sancak

et al., 2008), it has not been possible to determine the intracel-

lular localization of endogenous Rheb, and work using overex-

pressed GFP-tagged Rheb1 has placed it on various endomem-

brane compartments, including endosomes and lysosomes

(Buerger et al., 2006; Saito et al., 2005; Sancak et al., 2008; Ta-

kahashi et al., 2005). Our results suggest that at some point in its

life cycle, Rheb must traverse the lysosomal surface in order to

encounter mTORC1, and so in our model we have chosen to

place Rheb on this compartment (Figure 7H). However, at any

given time only a small fraction of cellular Rheb may actually

be on the lysosomal surface, or, alternatively, some of the

mTORC1 within the cell may move to a nonlysosomal endomem-

brane compartment that also contains Rheb. These issues will

only be answered once a definitive location for endogenous

Rheb can be determined.

The trimeric p14, p18, and MP1 protein complex, which

we call Ragulator, is a Rag-interacting complex that is essential

for amino acid signaling to mTORC1 and represents an addi-

tional critical component of the TORC1 signaling pathway in

mammals and flies. p18 directly interacts with the Rag GTPases

(Figure S2A) as well as with p14 and MP1 (Nada et al., 2009) and

so may serve as a scaffold to bring the Rag GTPases and MP1-

p14 next to each other. In vitro we have not detected a direct

interaction between the Rag GTPases and either MP1 or p14,

but both proteins are, like p18, necessary for localizing the Rag

GTPases to the lysosomal surface. p14 is required to maintain

normal p18 expression levels (Figure S2B), suggesting that

within cells p14 and MP1 form a crucial part of the Ragulator

structure. Given the nonspecific nature of the p14 and p18

names, in the future it may be best to rename these proteins,

perhaps to names that reflect their essential roles in the mTORC1

pathway.

The location of the Rag GTPases, the Ragulator, and mTORC1

on the lysosomal surface implicates this organelle as the site of

a yet to be discovered sensing system that signals amino acid

availability to the Ragulator-Rag complex. The lysosomal loca-

tion of the amino acid sensing branch of the mTORC1 pathway

is consistent with increasing evidence that lysosomes, and their

yeast counterparts, vacuoles, are at the nexus of amino acid

metabolism within cells. Lysosomes are a major site of protein

degradation and amino acid recycling, and vacuoles store amino

acids at high concentrations (reviewed in Li and Kane, 2009).

Thus, mTORC1 and its regulators may reside on the lysosomal

surface so as to sense a currently unknown aspect of lysosomal

function that reflects the intracellular pools of amino acids.

It is interesting to consider the differences and similarities

between the still poorly understood amino acid signaling mech-

anisms employed by the mTORC1 and yeast TORC1 pathways.

Consistent with previous work in mammalian cells (Sancak et al.,

2008), the Gtr1p-Gtr2p heterodimer that is orthologous to RagA/

B-RagC/D interacts with yeast TORC1 when Gtr1p is GTP

loaded (Binda et al., 2009). TORC1 and the Gtr proteins are

located on the surface of the vacuole (Berchtold and Walther,

2009; Binda et al., 2009), the yeast equivalent of lysosomes,

but, unlike in mammals, yeast TORC1 does not leave the vacu-

olar surface upon amino acid deprivation although amino acids

do control the interaction of TORC1 with Gtr1p-Gtr2p (Binda

et al., 2009). This finding suggests that there must be a distinct

mechanism for retaining TORC1 at the vacuolar surface and

that in yeast the interaction between TORC1 and Gtr1p-Gtr2p

serves other purposes besides controlling the intracellular loca-

tion of TORC1. In contrast, our current work argues that in

mammals, the main role of the Rag GTPase and the associated

Ragulator complex is to control the association of mTORC1 with

the cellular endomembrane system, in particular, lysosomes.

Rheb, which is essential for the activation of mTORC1 by all

upstream signals, does not appear to be part of the TORC1

pathway in yeast (reviewed in Berchtold and Walther, 2009). As

we suggest that the Rag-dependent and amino acid-regulated

translocation of mTORC1 to the lysosomal surface may ulti-

mately be a mechanism for controlling the access of mTORC1

to Rheb, the absence of Rheb in the yeast TORC1 pathway

may make regulation of TORC1 localization unnecessary. That

known Rag- and Gtr-interacting proteins share no sequence

homology also suggests that the mechanisms through which

the Rag and Gtr GTPases regulate mTORC1 and yeast

TORC1, respectively, have diverged. Although it is clear that

Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc. 299

Figure 7. Targeting of mTORC1 to the Lysosomal Surface Makes the Activity of the mTORC1 Pathway Independent of Rag and Ragulator, but

Not Rheb, Function

(A) In cells that express FLAG-raptor-Rheb15, mTORC1 pathway activity is independent of Rag GTPase function. Lysates of HEK293T cells expressing FLAG-

raptor or FLAG-raptor-Rheb15 were analyzed by immunobloting for the indicated proteins and phosphorylation states after disruption of Rag function by RNAi-

mediated coknockdown of RagA and RagB. Cells were starved of amino acids for 50 min or starved and restimulated with amino acids for 10 min before lysis.

(B) In cells that express FLAG-raptor-Rheb15, mTORC1 pathway activity is independent of Rag GTPase function. Lysates of HEK293T cells expressing FLAG-

raptor or FLAG-raptor-Rheb15 were analyzed as in (A) after disruption of Rag function by expression of the dominant negative RagBGDP-RagDGTP heterodimer.

Cells were treated and processed as in (A).

(C) Stable expression of FLAG-raptor-Rheb15 but not FLAG-raptor in p14 null cells is sufficient to reactivate the mTORC1 pathway and make it insensitive to

amino acid starvation. Cells stably expressing the indicated proteins were treated and analyzed as in (A).

(D) Stable expression of FLAG-raptor-Rheb15 but not FLAG-raptor in p18 null cells is sufficient to reactivate the mTORC1 pathway and make it insensitive to

amino acid starvation. Cells stably expressing the indicated proteins were treated and analyzed as in (A).

(E) In p18 null cells expression of raptor-Rheb15, but not wild-type raptor, increases cell size. Cell size distributions of p18 null cells that stably express FLAG-

raptor or FLAG-raptor-Rheb15 are shown.

(F) In cells that express FLAG-raptor-Rheb15, the activity of the mTORC1 pathway is still Rheb dependent. Lysates of HEK293T cells that stably express FLAG-

raptor or FLAG-raptor-Rheb15 were analyzed by immunobloting for the indicated proteins and phosphorylation states after disruption of Rheb function by an

RNAi-mediated knockdown of Rheb1. Cells were treated as in (A).

(G) Coexpression of plasma membrane-targeted raptor and plasma membrane-targeted Rheb1 renders the mTORC1 pathway insensitive to amino acid starva-

tion. HEK293T cells stably expressing the indicated proteins were treated and analyzed as in (A).

300 Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc.

the Ragulator and EGO complexes both control the intracellular

localization of the Rag (this paper) and Gtr (Gao and Kaiser, 2006)

GTPases, respectively, whether these complexes have addi-

tional functions remains to be determined.

Previous studies suggest that MP1-p14-p18 complex plays an

adaptor role in the MAP kinase (MAPK) pathway (reviewed in

Dard and Peter, 2006), and our current findings do not contradict

these results. However, considering the very strong inhibition of

the mTORC1 pathway that occurs in cells lacking p14 or p18, it

seems possible that some of the impairment in MAPK signaling

observed in those cells reflects an altered feedback signaling

from Akt to the MAPK pathway. For example, in Ragulator null

cells, Akt is slightly activated, almost certainly because the

well-known inhibitory signal from mTORC1 to PI3K is absent.

As Akt suppresses MAPK signaling by phosphorylating and

inhibiting Raf (Zimmermann and Moelling, 1999), it is conceiv-

able that the activation of Akt that occurs in Ragulator null cells

could account, at least in part, for the inhibition of MAPK

signaling that has been observed in these cells.

Mice lacking either p14 or p18 die around embryonic day 7.5–8

and have obvious growth defects (Nada et al., 2009; Teis et al.,

2006). We would not be surprised if, when generated, mice

lacking the Rag proteins die at around the same age and pre-

sent similar defects. On the other hand, mice lacking the core

mTORC1 component raptor die earlier (before embryonic day

6.5) than p14 and p18 null mice (Guertin et al., 2006). This may

be expected because although loss of p14 or p18 completely

blocks mTORC1 activation by amino acids, cells lacking the

Ragulator proteins are likely to retain a low residual level of

mTORC1 activity that may be sufficient to support development

further than in embryos completely lacking mTORC1 function.

Lastly, our results suggest that the strong growth retardation

observed in humans with a mutation that reduces p14 expres-

sion (Bohn et al., 2007) is a result of partial suppression of the

mTORC1 pathway. If this turns out to be the case, it would repre-

sent the first human example of a loss-of-function mutation in

a positive component of the mTORC1 pathway.

EXPERIMENTAL PROCEDURES

Cell Lines and Tissue Culture

HEK293E cells, HEK293T cells, and TSC2+/+, TSC2�/�, p14+/+, and p14�/�

MEFs were cultured in Dulbecco’s modified Eagle’s medium (DMEM) with

10% inactivated fetal calf serum. p18rev, p18mito, and p18�/� cells were

cultured in DMEM with 10% fetal bovine serum. HEK293E and HEK293T cells

express E1a and SV40 large T antigen, respectively. In HEK293E, but not

HEK293T, cells the mTORC1 pathway is strongly regulated by serum and

insulin (Sancak et al., 2007). TSC2�/�, p53�/�, and TSC2+/+, p53�/� MEFs

were kindly provided by David Kwiatkowski (Harvard Medical School). The

HEK293E cell line was kindly provided by John Blenis (Harvard Medical

School). p14�/� and control MEFs were kindly provided by Lukas A. Huber

(Innsbruck Medical University) and described are in Teis et al. (2006). p18�/�

cells are epithelial in nature, and p18rev cells are p18�/� cells in which wild-

type p18 has been re-expressed (Nada et al., 2009). Patient-derived cells

with a homozygous mutation in the ROBLD3 (p14) gene 30 untranslated region

(H) Model for amino-acid induced mTORC1 activation. In the absence of amino a

access to its activator Rheb. In the presence of amino acids, the Rag GTPases, w

site for mTORC1, allowing mTORC1 to associate with endomembranes and thus

See also Figure S5.

and control healthy donor-derived cells were kindly provided by Christoph

Klein (Universitat Munchen) and have been described in Bohn et al. (2007)

Amino Acid and Serum Starvation and Stimulation of Cells

Serum and/or amino acid starvation of HEK293T cells, HEK293E cells, p14 null

and control cells, p18 null and control cells, MEFs, and patient-derived and

healthy donor-derived cells were performed essentially as described (Sancak

et al., 2008). Serum was dialyzed against phosphate-buffered saline (PBS) in

dialysis cassettes (Thermo Scientific) having a 3500 molecular weight cutoff.

Preparation of Cell Lysates and Immunoprecipitations

Cell lysate preparation, cell lysis, and immunoprecipitations were done as

described in the Extended Experimental Procedures.

For cotransfection experiments, 2,000,000 HEK293T or HEK293E cells were

plated in 10 cm culture dishes. Twenty-four hours later, cells were transfected

with the indicated plasmids as follows: 50 ng or 1500 ng myc-mTOR in pRK5;

20 ng or 500 ng HA-, myc-, or FLAG-Raptor in pRK5 or pLJM1 with or without

the targeting signals; 100 ng HA-GST-Rap2a in pRK5; 100 ng HA-GST-Rheb1

in pRK5; 100 ng HA-GST-RagB in pRK5; 100 ng HA-GST-RagD in pRK5; 1 ng

FLAG-S6K1 in pRK7; 50 ng or 600 ng HA- or FLAG-p14 in pRK5; 75 ng or 600 ng

HA-MP1 in pRK5; and 50 ng or 800 ng HA-p18 in pRK5. The total amount of

plasmid DNA in each transfection was normalized to 2 mg with empty pRK5.

Cell Size Determinations

For measurement of cell size, 2,000,000 HEK293T cells or 200,000 of other cell

types were plated into 10 cm culture dishes. Twenty-four hours later, the cells

were harvested by trypsinization in a 4 ml volume and diluted 1:20 with count-

ing solution (Isoton II Diluent, Beckman Coulter). Cell diameters were deter-

mined with a particle size counter (Coulter Z2, Beckman Coulter) running

Coulter Z2 AccuComp software.

Mammalian Lentiviral shRNAs and cDNAs

Lentiviral short hairpin RNAs (shRNAs) targeting human Rheb1, RagB, and

RagC have been described (Sancak et al., 2008). Lentiviral shRNAs targeting

mouse Rheb1 and human p14 were obtained from Sigma-Aldrich. Lentiviral

shRNAs targeting the messenger RNA for human MP1 and human p18 were

cloned into pLKO.1 vector as described (Sarbassov et al., 2005). The target

sequences are provided in the Extended Experimental Procedures. Virus

generation and infection was done as previously described (Sancak et al.,

2008).

Raptor was cloned into the AgeI and BamHI sites of a modified pLKO.1

vector (pLJM1) (Sancak et al., 2008) with or without the Rheb1, Rap1b, and

HRas targeting signals or cloned into the pRK5 vector with or without the

same localization signals. After sequence verification, pLJM1 based plasmids

were used in transient cDNA transfections or to produce lentivirus needed to

generate cell lines stably expressing these proteins. pRK5 based plasmids

were also used for transient transfection experiments. The p18mito expression

plasmid was generated by cloning of a mutant p18 with amino acids 2–5

changed to alanines into a modified version of the pLKO.1 vector that added,

to the C terminus of p18, the mitochondrial localization signal of OMP25

protein. This plasmid was used in transient cDNA transfections or to produce

lentivirus needed to generate stable cell lines. HA-Rheb1 and HA-Rheb1-

HRas25 were cloned into pLJM5, a derivative of pLJM1 carrying a hygromycin

instead of puromycin resistance gene. The vectors were used as above for

lentivirus production.

Immunofluorescence Assays

Fifty thousand HEK293T cells or 20,000 of other cell types were plated on

fibronectin-coated glass coverslips in 12-well tissue culture plates. Twenty-

four hours later, the slides were rinsed with PBS once and fixed for 15 min

with 4% paraformaldehyde in PBS warmed to 37�C. The slides were rinsed

cids, mTORC1 cannot associate with the endomembrane system and has no

hich are tethered to the lysosomal surface by the Ragulator, serve as a docking

encounter and become activated by Rheb.

Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc. 301

twice with PBS and cells were permeabilized with 0.05% Triton X-100 in PBS

for 30 s. After rinsing twice with PBS, the slides were incubated with primary

antibody in 5% normal donkey serum for 2 hr at room temperature, rinsed

four times with PBS, and incubated with secondary antibodies produced in

donkey (diluted 1:1000 in 5% normal donkey serum) for 1 hr at room temper-

ature in the dark, washed four times with PBS. Slides were mounted on glass

coverslips using Vectashield (Vector Laboratories) and imaged. Transient

transfections for immunofluorescence assays were performed as described

in the Extended Experimental Procedures.

SUPPLEMENTAL INFORMATION

Supplemental Information includes Extended Experimental Procedures and

Five Figures and can be found with this article online at doi:10.1016/j.cell.

2010.02.024.

ACKNOWLEDGMENTS

We thank all members of the Sabatini Lab for helpful suggestions and Eric

Spooner for the mass spectrometric analysis of samples. We thank Lukas A.

Huber for providing p14 null and control cells and Christoph Klein for providing

patient-derived and healthy donor-derived cells. This work was supported

by grants from the National Institutes of Health (CA103866 and AI47389)

and Department of Defense (W81XWH-07-0448) to D.M.S., awards from the

W.M. Keck Foundation and LAM Foundation to D.M.S, and fellowship support

from the LAM Foundation and from the Jane Coffin Childs Memorial Fund for

Medical Research to R.Z. D.M.S. is an investigator of the Howard Hughes

Medical Institute.

Received: October 16, 2009

Revised: December 28, 2009

Accepted: February 5, 2010

Published online: April 8, 2010

REFERENCES

Berchtold, D., and Walther, T.C. (2009). TORC2 plasma membrane localization

is essential for cell viability and restricted to a distinct domain. Mol. Biol. Cell

20, 1565–1575.

Binda, M., Peli-Gulli, M.P., Bonfils, G., Panchaud, N., Urban, J., Sturgill, T.W.,

Loewith, R., and De Virgilio, C. (2009). The Vam6 GEF controls TORC1 by acti-

vating the EGO complex. Mol. Cell 35, 563–573.

Bohn, G., Allroth, A., Brandes, G., Thiel, J., Glocker, E., Schaffer, A.A.,

Rathinam, C., Taub, N., Teis, D., Zeidler, C., et al. (2007). A novel human

primary immunodeficiency syndrome caused by deficiency of the endosomal

adaptor protein p14. Nat. Med. 13, 38–45.

Buerger, C., DeVries, B., and Stambolic, V. (2006). Localization of Rheb to the

endomembrane is critical for its signaling function. Biochem. Biophys. Res.

Commun. 344, 869–880.

Chavrier, P., Parton, R.G., Hauri, H.P., Simons, K., and Zerial, M. (1990). Local-

ization of low molecular weight GTP binding proteins to exocytic and endocytic

compartments. Cell 62, 317–329.

Clark, G.J., Kinch, M.S., Rogers-Graham, K., Sebti, S.M., Hamilton, A.D., and

Der, C.J. (1997). The Ras-related protein Rheb is farnesylated and antagonizes

Ras signaling and transformation. J. Biol. Chem. 272, 10608–10615.

Dard, N., and Peter, M. (2006). Scaffold proteins in MAP kinase signaling: more

than simple passive activating platforms. Bioessays 28, 146–156.

Dubouloz, F., Deloche, O., Wanke, V., Cameroni, E., and De Virgilio, C. (2005).

The TOR and EGO protein complexes orchestrate microautophagy in yeast.

Mol. Cell 19, 15–26.

Eskelinen, E.L. (2006). Roles of LAMP-1 and LAMP-2 in lysosome biogenesis

and autophagy. Mol. Aspects Med. 27, 495–502.

Gao, M., and Kaiser, C.A. (2006). A conserved GTPase-containing complex is

required for intracellular sorting of the general amino-acid permease in yeast.

Nat. Cell Biol. 8, 657–667.

302 Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc.

Guertin, D.A., and Sabatini, D.M. (2007). Defining the role of mTOR in cancer.

Cancer Cell 12, 9–22.

Guertin, D.A., Stevens, D.M., Thoreen, C.C., Burds, A.A., Kalaany, N.Y., Mof-

fat, J., Brown, M., Fitzgerald, K.J., and Sabatini, D.M. (2006). Ablation in mice

of the mTORC components raptor, rictor, or mLST8 reveals that mTORC2 is

required for signaling to Akt-FOXO and PKCalpha, but not S6K1. Dev. Cell

11, 859–871.

Hirose, E., Nakashima, N., Sekiguchi, T., and Nishimoto, T. (1998). RagA is

a functional homologue of S. cerevisiae Gtr1p involved in the Ran/Gsp1-

GTPase pathway. J. Cell Sci. 111, 11–21.

Kim, E., Goraksha-Hicks, P., Li, L., Neufeld, T.P., and Guan, K.L. (2008).

Regulation of TORC1 by Rag GTPases in nutrient response. Nat. Cell Biol.

10, 935–945.

Koonin, E.V., and Aravind, L. (2000). Dynein light chains of the Roadblock/LC7

group belong to an ancient protein superfamily implicated in NTPase regula-

tion. Curr. Biol. 10, R774–R776.

Laplante, M., and Sabatini, D.M. (2009). mTOR signaling at a glance. J. Cell

Sci. 122, 3589–3594.

Li, S.C., and Kane, P.M. (2009). The yeast lysosome-like vacuole: endpoint and

crossroads. Biochim. Biophys. Acta 1793, 650–663.

Lunin, V.V., Munger, C., Wagner, J., Ye, Z., Cygler, M., and Sacher, M. (2004).

The structure of the MAPK scaffold, MP1, bound to its partner, p14. A complex

with a critical role in endosomal map kinase signaling. J. Biol. Chem. 279,

23422–23430.

Luzio, J.P., Pryor, P.R., and Bright, N.A. (2007). Lysosomes: fusion and func-

tion. Nat. Rev. Mol. Cell Biol. 8, 622–632.

Manning, B.D. (2004). Balancing Akt with S6K: implications for both metabolic

diseases and tumorigenesis. J. Cell Biol. 167, 399–403.

Nada, S., Hondo, A., Kasai, A., Koike, M., Saito, K., Uchiyama, Y., and Okada,

M. (2009). The novel lipid raft adaptor p18 controls endosome dynamics by

anchoring the MEK-ERK pathway to late endosomes. EMBO J. 28, 477–489.

Nemoto, Y., and De Camilli, P. (1999). Recruitment of an alternatively spliced

form of synaptojanin 2 to mitochondria by the interaction with the PDZ domain

of a mitochondrial outer membrane protein. EMBO J. 18, 2991–3006.

Pizon, V., Desjardins, M., Bucci, C., Parton, R.G., and Zerial, M. (1994). Asso-

ciation of Rap1a and Rap1b proteins with late endocytic/phagocytic compart-

ments and Rap2a with the Golgi complex. J. Cell Sci. 107, 1661–1670.

Roccio, M., Bos, J.L., and Zwartkruis, F.J.T. (2006). Regulation of the small

GTPase Rheb by amino acids. Oncogene 25, 657–664.

Saito, K., Araki, Y., Kontani, K., Nishina, H., and Katada, T. (2005). Novel role of

the small GTPase Rheb: its implication in endocytic pathway independent of

the activation of mammalian target of rapamycin. J. Biochem. 137, 423–430.

Sancak, Y., Thoreen, C.C., Peterson, T.R., Lindquist, R.A., Kang, S.A.,

Spooner, E., Carr, S.A., and Sabatini, D.M. (2007). PRAS40 is an insulin-regu-

lated inhibitor of the mTORC1 protein kinase. Mol. Cell 25, 903–915.

Sancak, Y., Peterson, T.R., Shaul, Y.D., Lindquist, R.A., Thoreen, C.C.,

Bar-Peled, L., and Sabatini, D.M. (2008). The Rag GTPases bind raptor and

mediate amino acid signaling to mTORC1. Science 320, 1496–1501.

Sarbassov, D.D., Guertin, D.A., Ali, S.M., and Sabatini, D.M. (2005). Phosphor-

ylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 307,

1098–1101.

Schaeffer, H.J., Catling, A.D., Eblen, S.T., Collier, L.S., Krauss, A., and Weber,

M.J. (1998). MP1: a MEK binding partner that enhances enzymatic activation

of the MAP kinase cascade. Science 281, 1668–1671.

Schurmann, A., Brauers, A., Massmann, S., Becker, W., and Joost, H.G.

(1995). Cloning of a novel family of mammalian GTP-binding proteins (RagA,

RagBs, RagB1) with remote similarity to the Ras-related GTPases. J. Biol.

Chem. 270, 28982–28988.

Sekiguchi, T., Hirose, E., Nakashima, N., Ii, M., and Nishimoto, T. (2001). Novel

G proteins, Rag C and Rag D, interact with GTP-binding proteins, Rag A and

Rag B. J. Biol. Chem. 276, 7246–7257.

Smith, E.M., Finn, S.G., Tee, A.R., Browne, G.J., and Proud, C.G. (2005). The

tuberous sclerosis protein TSC2 is not required for the regulation of the

mammalian target of rapamycin by amino acids and certain cellular stresses.

J. Biol. Chem. 280, 18717–18727.

Takahashi, K., Nakagawa, M., Young, S.G., and Yamanaka, S. (2005). Differ-

ential membrane localization of ERas and Rheb, two Ras-related proteins

involved in the phosphatidylinositol 3-kinase/mTOR pathway. J. Biol. Chem.

280, 32768–32774.

Teis, D., Wunderlich, W., and Huber, L.A. (2002). Localization of the MP1-

MAPK scaffold complex to endosomes is mediated by p14 and required for

signal transduction. Dev. Cell 3, 803–814.

Teis, D., Taub, N., Kurzbauer, R., Hilber, D., de Araujo, M.E., Erlacher, M.,

Offterdinger, M., Villunger, A., Geley, S., Bohn, G., et al. (2006). p14-MP1-

MEK1 signaling regulates endosomal traffic and cellular proliferation during

tissue homeostasis. J. Cell Biol. 175, 861–868.

Wunderlich, W., Fialka, I., Teis, D., Alpi, A., Pfeifer, A., Parton, R.G., Lottspeich,

F., and Huber, L.A. (2001). A novel 14-kilodalton protein interacts with the

mitogen-activated protein kinase scaffold mp1 on a late endosomal/lysosomal

compartment. J. Cell Biol. 152, 765–776.

Zimmermann, S., and Moelling, K. (1999). Phosphorylation and regulation of

Raf by Akt (protein kinase B). Science 286, 1741–1744.

Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc. 303

Supplemental Information

EXTENDED EXPERIMENTAL PROCEDURES

MaterialsReagents were obtained from the following sources: antibodies to phospho-T389 S6K1, S6K1, mTOR, raptor, RagA/B, RagC, p14,

p18, MP1, the myc epitope, the HA epitope, the FLAG epitope (unconjugated and alexa fluor conjugated), TSC2, phospho-T398

dS6K, phospho-S473 Akt, Akt1, phospho-T70 4E-BP1, 4E-BP1, and Rheb from Cell Signaling Technology; antibodies to LAMP2

from Abcam (ab25631 and ab13524); antibody to raptor (for immunostaining) from Millipore; antibody to Cytochrome c from BD

Biosciences; HRP-labeled anti-mouse, anti-goat, and anti-rabbit secondary antibodies from Santa Cruz Biotechnology; FLAG M2

affinity gel, FLAG M2 antibody, human recombinant insulin, from Sigma Aldrich; protein G-sepharose and dialysis cassettes from

Thermo Scientific; DMEM from SAFC Biosciences; FuGENE 6 and Complete Protease Cocktail from Roche; alexa fluor conjugated

secondary antibodies from Invitrogen; 16% paraformaldehyde solution from Electron Microscopy Sciences; fibronectin from Jack-

son Immunoresearch Laboratories; 35 mm glass bottom dishes from Mattek Corporation; glass coverslips from Ted Pella, Inc; amino

acid and glucose-free RPMI from United States Biological; Schneider’s medium, Drosophila-SFM, and Inactivated Fetal Calf Serum

(IFS) from Invitrogen. The dS6K antibody was a generous gift from Mary Stewart (North Dakota State University).

Preparation of Cell Lysates and ImmunoprecipitationsCells were rinsed once with ice-cold PBS and lysed in ice-cold lysis buffer (40 mM HEPES [pH 7.4], 2 mM EDTA or 5mM MgCl2, 10

mM pyrophosphate, 10 mM glycerophosphate, 0.3% CHAPS, or 1% Trition X-100 and one tablet of EDTA-free protease inhibitors

(Roche) per 25 ml). The soluble fractions of cell lysates were isolated by centrifugation at 13,000 rpm for 10 min by centrifugation. For

immunoprecipitations, primary antibodies were added to the lysates and incubated with rotation for 1.5 hr at 4�C. 60 ml of a 50%

slurry of protein G-sepharose was then added and the incubation continued for an additional 1 hr. Immunoprecipitates were washed

three times with lysis buffer containing 150mM NaCl. Immunoprecipitated proteins were denatured by the addition of 20 ml of sample

buffer and boiling for 5 min, resolved by 8%–16% SDS-PAGE, and analyzed by immunoblotting. For Flag purifications, Flag M2

affinity gel was washed with lysis buffer 3 times. 20 ul of beads in 50% slurry was then added to pre-cleared cell lysates and incubated

with rotation for 2 hr at 4�C. Finally, The beads were washed 3 times with lysis buffer containing 150 mM NaCl. Immunoprecipitated

proteins were denatured by the addition of 50 ml of sample buffer and boiling for 5 min.

Mammalian Lentiviral shRNAs and cDNAsThe sequences of shRNAs targeting human MP1 and p18 are as follows:

MP1_1: GAGATGGAGTACCTGTTATTA

MP1_2: ATATCAATCCAGCAATCTTTA

p18: AGACAGCCAGCAACATCATTG

Identification of Ragulator Components as Rag-Associated ProteinsRagulator components (MP1, p14, and p18) were detected in anti-FLAG immunoprecipitates prepared from HEK293T cells stably

expressing FLAG-RagB or FLAG-RagD as well as in immunoprecipitates of endogenous RagC prepared from HEK293T cells. Immu-

noprecipitates were prepared as described (Sancak et al., 2008). Proteins were eluted with the FLAG peptide from the anti-FLAG

affinity matrix or recovered from the protein G-sepharose by boiling with sample buffer, resolved by SDS-PAGE, and stained with

simply blue stain (Invitrogen). Each gel lane was sliced into 10-12 pieces and the proteins in each gel slice digested overnight

with trypsin. The resulting digests were analyzed by mass spectrometry as described (Sancak et al., 2008). 2-3 peptides correspond-

ing to each Ragulator component were identified in the FLAG-RagB and endogenous RagC immunoprecipitates, while no peptides

corresponding to any of the proteins were ever found in the FLAG-Rap2a, p53, or a-tubulin immunoprecipitates that served as

controls.

Amino Acid Starvation and Stimulation and dsRNA-Mediated Knockdowns in Drosophila CellsAmino acid starvation and stimulation of Drosophila S2 cells was performed as described (Sancak et al., 2008). The design and

synthesis of dsRNAs has also been described (Sancak et al., 2008).

Primer sequences used to amplify DNA templates for dsRNA synthesis for dp14, dp18, and dMP1, including underlined 50 and 30 T7

promoter sequences, are as follows:

dp14 (CG5189) dsRNA forward primer: GAATTAATACGACTCACTATAGGGAGACTCTATTGGCCTACTCCGGTTAT

dp14 (CG5189) dsRNA reverse primer: GAATTAATACGACTCACTATAGGGAGATATGAGGCCGAGATCTGCTTA

dp18 (CG14184) dsRNA forward primer: GAATTAATACGACTCACTATAGGGAGAGCAGAATACTGCGATAAACATGATA

dp18 (CG14184) dsRNA reverse primer: GAATTAATACGACTCACTATAGGGAGATGGATAGGTTGGCTTAGACAGATAG

dMP1 (CG5110) dsRNA forward primer: GAATTAATACGACTCACTATAGGGAGAGTCGGACGACATCAAGAAGTATTTA

dMP1 (CG5110) dsRNA reverse primer: GAATTAATACGACTCACTATAGGGAGAAGTACATGGAGATGATGGTCTTGTT

Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc. S1

In Vitro Binding Assay2 million HEK293T cells were transfected with 2 mg FLAG-p18 (lipidation mutant G2A), 2 mg HA-GST-Rap2a, or 2 mg HA-GST-RagB

together with 2 mg of HA-GST-RagC. 2 days after transfection, the cells were lysed in lysis buffer containing 1% Triton X-100 as

described (Sancak et al., 2007) and cleared lysates were incubated with glutathione- or FLAG-beads for 3 hr at 4�C with rotation.

The beads were washed 3 times with lysis buffer and two times with lysis buffer containing 0.3% CHAPS. FLAG-p18 was eluted

from FLAG beads with the FLAG peptide and 1/8 of the eluate was incubated with 1/4 of the Rag-containing glutathione beads in

lysis buffer with 0.3% CHAPS for 45 min at 4�C. The glutathione beads were washed three times with lysis buffer containing

0.3% CHAPS and 150 mM NaCl. Proteins were denatured by the addition of 20 ml of sample buffer and boiling for 5 min and analyzed

by SDS-PAGE and immunoblotting.

Transient Transfections for Immunofluorescence AssaysFor myc-mTOR and HA-raptor co-transfection experiments, HEK293T cells were seeded in 60 mm culture plates. 24 hr later, cells

were transfected with 500 ng myc-mTOR and 50 ng HA-Raptor. 24 hr after transfections, cells were split and plated on fibronectin

coated glass coverslip in 12-well culture plates and processed as above.

For GFP-RagB, GFP-RagD, p18-GFP, GFP-Mito, RFP-RagB, and LAMP1-mRFP co-transfection experiments, HEK293T cells

(250,000 cells/dish) or p18�/�, p18rev or p18mito cells (50,000 cells/dish) were plated on 35 mm, glass-bottom Mattek dishes. The

next day, each dish was transfected with 100 ng of GFP-RagB or GFP-RagD, p18-GFP, GFP-mito, RFP-RagB or LAMP1-mRFP using

fugene. At 18-24 hr post transfections, cells were fixed and imaged. GFP-Mito has been described (Nemoto and De Camilli, 1999).

For GFP-LC3 localization experiments, 2 million cells were transfected by electroporation with 1 mg of GFP-LC3 plasmid, and

plated on 35 mm glass-bottom Mattek dishes. The next day the cells were starved for 3 hr in serum- and amino acid-free RPMI

to induce autophagy and processed for imaging as above.

All images were acquired with a spinning disk confocal microscope (Perkin Elmer) equipped with a Hamamatsu 1k X 1k EM-CCD

camera. For each image, 8-10 optical slices were acquired and displayed as maximum projections.

Quantification of Number of Autophagosomes per CellAfter acquisition, the images were opened with Image J, made binary and the number of autophagosomes per cell was obtained

using the ‘‘Analyze Particle’’ function.

SUPPLEMENTAL REFERENCES

Nemoto, Y., and De Camilli, P. (1999). Recruitment of an alternatively spliced form of synaptojanin 2 to mitochondria by the interaction with the PDZ domain of

a mitochondrial outer membrane protein. EMBO J. 18, 2991–3006.

Sancak, Y., Peterson, T.R., Shaul, Y.D., Lindquist, R.A., Thoreen, C.C., Bar-Peled, L., and Sabatini, D.M. (2008). The Rag GTPases bind raptor and mediate amino

acid signaling to mTORC1. Science 320, 1496–1501.

Sancak, Y., Thoreen, C.C., Peterson, T.R., Lindquist, R.A., Kang, S.A., Spooner, E., Carr, S.A., and Sabatini, D.M. (2007). PRAS40 is an insulin-regulated inhibitor

of the mTORC1 protein kinase. Mol. Cell 25, 903–915.

S2 Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc.

Figure S1. Movement of mTORC1 to Lysosomal Membranes in Response to Amino Acids Depends on the Rag GTPases and Is Independent

of TSC1/2, Rheb, and Growth Factors, Related to Figure 1

(A) Immunoblot analysis of RagB and raptor protein levels in HEK293T cells with an RNAi-mediated knockdown of a control protein or RagA and RagB.

(B) Images of cells with knockdowns of RagA and RagB and co-immunostained for mTOR (green) and LAMP2 (red) after starvation and restimulation with amino

acids for the indicated times. HEK293T cells expressing the indicated shRNAs were starved and restimulated with amino acids as indicated and processed in the

immunofluorescence assay. In all images, insets show selected fields that were magnified five times and their overlay. Scale bar is 10 mm.

(C) mTOR co-localizes with LAMP2 only in the presence of amino acids and independently of serum stimulation. Images show co-immunostaining of mTOR

(green) and LAMP2 (red) in TSC2+/+ and TSC2�/�MEFs after indicated treatments. Cells were starved for serum and amino acids, and stimulated with dialyzed

Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc. S3

serum, amino acids, or both before processing in the immunofluorescence assay.

(D) Lysates from TSC2+/+ and TSC2�/� MEFs starved and stimulated as in (A) were analyzed by immunobloting for the activity of the mTORC1 pathway.

(E) Loss of Rheb expression inhibits mTORC1 signaling in TSC2+/+ and TSC2�/�MEFs. Cells expressing the indicated shRNAs were starved for amino acids or

starved and restimulated with amino acids and lysates analyzed by immunobloting for mTORC1 pathway activity and Rheb1 levels.

(F) mTOR co-localizes with LAMP2 only in the presence of amino acids and independently of Rheb or TSC2. Images show co-immunostaining of mTOR (green)

and LAMP2 (red) in TSC2+/+ and TSC2�/� MEFs treated as in (C).

In all images, insets show selected fields that were magnified five times and their overlays. Scale bar is 10 mm.

S4 Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc.

Figure S2. The Expression of Ragulator Proteins Is Coregulated and Purified FLAG-p18 Interacts with Purified HA-GST-RagB/HA-GST-RagDDimer In Vitro, Related to Figure 2

(A) In vitro binding assay using purified soluble FLAG-p18 and HA-GST-RagB/HA-GST-RagD heterodimer bound to glutathione beads was performed as

described in the Experimental Procedures.

(B) p14 protein levels are lower in p18 null cells than in p18 null cells expressing FLAG-p18 (p18rev). Similarly, in cells that lack p14 (p14�/�), p18 expression is

reduced compared to control cells (p14+/+). Cells were grown to confluency, lysates were prepared, and the levels of the indicated proteins analyzed by immu-

noblotting.

Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc. S5

Figure S3. The Ragulator Is Required for RagC Localization to Lysosomal Membranes and Amino Acid-Induced mTOR Lysosomal Localiza-

tion, Related to Figure 3

(A) An MP1 knockdown displaces RagC from the lysosomal surface. Images of cells with shRNA-mediated knockdowns of a control protein or MP1 and co-immu-

nostained for RagC (red) and LAMP2 (green). HEK293T cells expressing the indicated shRNAs were starved of and restimulated with amino acids for the stated

times and then processed in the immunofluorescence assay.

(B) An MP1 knockdown impairs the recruitment of mTOR to the lysosomal surface in response to amino acid stimulation. Images of cells with shRNA-mediated

knockdowns of a control protein or MP1 and co-immunostained for mTOR (red) and LAMP2 (green). HEK293T cells expressing the indicated shRNAs were

starved of and restimulated with amino acids for the stated times and then processed in the immunofluorescence assay.

(C) Knockdown of p18 or p14 in HEK293T cells impair amino acid-induced mTORC1 activation. HEK293T cells with RNAi-mediated knockdown of p14 or p18, or

control cells, were starved for amino acids for 50 min or starved and restimulated with amino acid for 10 min. Cell lysates were prepared and analyzed by immu-

noblotting for the phosphorylation states and levels of indicated proteins.

(D) Knockdown of p18 or p14 in HEK293T cells impairs amino acid-induced lysosomal recruitment of mTOR. Control cells and cells with p14 or p18 knockdown

were treated as in (C) and immunostained for mTOR (green) and LAMP2 (red). In all images, insets show selected fields that were magnified five times and their

overlays. Scale bar is 10 mm.

(E) Images of p18�/� cells stably expressing FLAG-p18mito and co-immunostained for FLAG-p18mito or mTOR (red) and Cytochrome c (Cyt c) (green).

(F) The mTORC1 pathway can be activated by amino acids in p18 null cells expressing wild-type p18 (p18rev), but not mitochondrially-targeted p18 (p18mito). Cells

were starved for amino acids in the presence of dialyzed serum for 50 min, or starved and restimulated with amino acids for 10 min. Lysates were prepared and

phosphorylation states and levels of indicated proteins were analyzed by immunoblotting.

S6 Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc.

Figure S4. 4E-BP1 Phosphorylation Is Inhibited and Autophagy Is Induced in Cells Lacking Ragulator Components, Related to Figure 4

(A) Amino acids fail to stimulate 4E-BP1 phosphoryation in cells lacking p14 or p18. Cells were starved for amino acids in the presence of dialyzed serum for 50

min, or starved and restimulated with amino acids for 10 min. Lysates were prepared and 4E-BP1 phosphorylation and levels analyzed by immunoblotting.

(B) Autophagy is induced in p14 null cells. Images of cells transiently expressing GFP-LC3 and starved for amino acids and serum for 3 hr or growing in complete

media. Accumulation of GFP-LC3 in large puncta in starved control cells and in the non-starved p14 null cells indicates increased levels of autophagy in these

cells.

(C) Quantification of autophagosomes in wild-type or p14 null cells expressing GFP-LC3. Cells were treated as in (B), images were taken and the number of au-

tophagosomes per cell was quantified using Image J. At least six cells were analyzed per sample. The data are represented as mean �/+ standard deviation.

Starved wild-type cells, or p14 null cells, irrespective of being starved or not, show statistically significant increases in the number autophagosomes per cell

compared to wild-type non-starved cells (p < 0.000002). There is no statistically significant difference between starved and non-starved p14 null cells (p = 0.38).

Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc. S7

Figure S5. Addition of Rheb1 and Rap1b Targeting Signals to Raptor Does Not Interfere with Its Binding to mTOR and Raptor-HRas25 and

Rheb-HRas25 Localize to the Plasma Membrane, Related to Figure 7

(A) HEK293T cells were co-transfected with plasmids encoding myc-mTOR and the indicated HA-raptor variants. Anti-myc immunoprecipitates as well as lysates

were analyzed by immunobloting for the indicated proteins.

(B) Raptor fused at its C terminus with the localization signal of HRas localizes to the plasma membrane. Images of cells expressing FLAG-raptor-HRas25 and

starved of and restimulated with amino acid for the indicated times and co-immunostained with antibodies to the FLAG epitope (red) and endogenous LAMP2

(green).

(C) Rheb1 localizes to the plasma membrane when its localization signal is swapped for that of HRas. Schematic shows composition of the HA-Rheb1-HRas25

variant. Images of cells expressing HA-Rheb1 or HA-Rheb1-HRas25 (green).

S8 Cell 141, 290–303, April 16, 2010 ª2010 Elsevier Inc.