ra boon et al. nature 000 , 1-4 (2013) doi:10.1038/nature11919

1

RA Boon et al. Nature 000, 1-4 (2013) doi:10.1038/nature11919 miR-34a reduction inhibits age-related and myocardial infarction-induced cardiomyocyte cell death and cardiac function.

Upload: oded

Post on 22-Feb-2016

26 views

Category:

Documents

0 download

Report

Download

Tags:

Embed Size (px):

DESCRIPTION

miR-34a reduction inhibits age-related and myocardial infarction-induced cardiomyocyte cell death and cardiac function. RA Boon et al. Nature 000 , 1-4 (2013) doi:10.1038/nature11919. - PowerPoint PPT Presentation

TRANSCRIPT

Page 1: RA Boon et al. Nature 000 , 1-4 (2013) doi:10.1038/nature11919

RA Boon et al. Nature 000, 1-4 (2013) doi:10.1038/nature11919

miR-34a reduction inhibits age-related and myocardialinfarction-induced cardiomyocyte cell death and cardiac function.

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

1 November 2007 doi:10.1038/nature06221 LETTERS

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

GI Motility online (May 2006) | doi:10.1038/gimo12

Nature, 2008, Doi:10.1038/nature07103 Semrah Kati 09.02.2009

DOI: 10.1038/NPHYS3211 Supplementary Information for

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

doi:10.1038/nature05202 LETTERS

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

DOI: 10.1038/NMAT4204 Supplementary Information · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4204. NATURE MATERIALS | . 1. 1 . Supplementary Information . High-precision realization

Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling in astrocytes … · 2014-06-25 · nature neuroscience correction notice Nat. Neurosci.; doi:10.1038/nn.3725 Leptin signaling

Nature , 2008, Doi:10.1038/nature07103

DOI: 10.1038/NMAT3074 Maltodextrin based imaging … · and in vivo SUPPLEMENTARY INFORMATION DOI: 10.1038/NMAT3074 ©

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

DOI: 10.1038/NMAT4143 - Nature Research...in – √ ((− ((((= √ (. (). (in (() (∼ × → in ≃), ∆ = (˜)/ (˜ +) ± × ˜/ = = ˜/ =. × ×−

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

doi:10.1038/nature05150 LETTERS

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

GI Motility online (May 2006) | doi:10.1038/gimo31

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

17 September 2009 doi:10.1038/nature08355 LETTERS

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The

GI Motility online (May 2006) | doi:10.1038/gimo6

Neuropsychopharmacology (2013) 38 , 1521-1534; doi:10.1038/npp.2013.51

doi:10.1038/nature12886 Neanderthal from the Altai

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

DOI: 10.1038/ncomms1280 molecular dynamics of single

Nature Biotechnology: doi:10.1038/nbt

DOI: 10.1038/NMAT4204 Supplementary Information...NATURE MATERIALS | . DOI: 10.1038/NMAT4204. , , – – |