R e a d y - To - G o™ RT-PCR Beads are designed as pre-mixed, pre -dispensed reactions for perf o rming RT- P C R†. RT-PCR Beads arep rovided as dried beads that are stable at room temperature. Eachbead contains all of the necessary reagents, except primer andtemplate, for perf o rming a one-tube, one-step RT-PCR reaction ina volume of 50 µl. Each kit contains pre-dispensed beads in 0.2 ml or 0.5 ml tubes sufficient for 24, 48, 96 or 100amplification reactions, depending upon the kit format chosen.The kit also provides control beads, pd(N)6 and pd(T)1 2 - 1 8.

† See important licensing information on page 3.

XY-073-00-06

R e a d y · To · G o™

RT-PCR Beads

Rev. 5

N o t e: After opening, store unused reactions in the resealable pouch withdesiccant provided and /or store in a desiccator.

C O N T E N T SNotice to Purchaser: Limited License 3C o m p o n e n t s 4O v e rv i e w 5

Recommendations for Storage 6R e q u i rements/Conditions for First-StrandcDNA Synthesis 7R e q u i rements/Conditions for PCR 7

I n t roduction to Pro t o c o l s 9P ro c e d u re A: Handling of 0.2 ml Tu b e s / P l a t e 1 2P ro c e d u re B: One-Step Protocol for RT- P C R 1 4P ro c e d u re C: Two-Step Protocol for RT- P C R 1 8Appendix 1: Adding MgCl2 ( o p t i o n a l ) 2 2Troubleshooting Guide 2 3Function Testing, Storage 2 7R e f e re n c e s 2 8O rdering Inform a t i o n 2 9

2

NOTE TO PURCHASER: LIMITED LICENSEA license under U.S. Patents 4,683,202, 4,683,195, 4,965,188and 5,075,216 or their foreign counterparts, owned byHoffmann-LaRoche Inc. and F. Hoffmann-LaRoche Ltd.(“Roche”), has an up-front fee component and a running-royaltycomponent. The purchase price of this product includes limited,nontransferable rights under the running-royalty component touse only this amount of the product to practice the PolymeraseChain Reaction (“PCR”) and related processes described in saidpatents solely for the research and development activities of thepurchaser when this product is used in conjunction with athermal cycler whose use is covered by the up-front feecomponent. Rights to the up-front fee component must beobtained by the end user in order to have a complete license.These rights under the up-front fee component may be purchasedfrom Perkin-Elmer or obtained by purchasing an AuthorizedThermal Cycler. No right to perform or offer commercial servicesof any kind using PCR, including without limitation reportingthe results of purchaser’s activities for a fee or other commercialconsideration, is hereby granted by implication or estoppel.Further information on purchasing licenses to practice the PCRProcess may be obtained by contacting the Director of licensingat The Perkin-Elmer Corporation, 850 Lincoln Centre Drive,Foster City, California 94404 or at Roche Molecular Systems,Inc., 1145 Atlantic Avenue, Alameda, California 94501.

3

C O M P O N E N T SRT-PCR Beads: Individual RT-PCR reactions. When

b rought to a final volume of 50 µl, eachreaction will contain ~2.0 units of Ta q D N Apolymerase, 10 mM Tris-HCl, (pH 9.0 atroom temperature), 60 mM KCl, 1.5 mMM g C l2, 200 µM of each dNTP, MoloneyMurine Leukemia Vi rus (M-MuLV) ReverseTranscriptase (FPLCp u re™), RNAguard™

Ribonuclease Inhibitor (porcine) and stabil-izers, including RNase/DNase-Free BSA.

C o n t rol Mix Five beads, each containing rabbit globin Beads (red tubes): mRNA (1 ng) and 8 pmol each of 5'-specific

globin primer (5'-d[ACACTTCTGGTCCAGTCCGACTGAG]-3') and 3'-specific globin primer (5'-d[GCCACTCACTCAGACTTTAT T C A A A ] - 3 ' ) .

p d ( N )6: Lyophilized; 275 µg. Sufficient for 100 reactions using up to 2.5 µg/re a c t i o n .

p d ( T )1 2 - 1 8: Lyophilized; 55 µg. Sufficient for 100 reactions using up to 0.5 µg/re a c t i o n .

Strip Bubble Caps*: 36 strips of eight caps.

*Provided only with RT-PCR Beads (0.2 ml tubes/plate).

4

O V E RV I E WR e a d y - To - G o™ RT-PCR Beads utilize Moloney Murine LeukemiaVi rus (M-MuLV) reverse transcriptase and Ta q DNA polymeraseto generate PCR product from an RNA template. Each bead isoptimized to allow the first-strand cDNA synthesis and PCRreactions to proceed sequentially as a single-tube, single-stepreaction. Simply add RNA, first-strand primer and PCR primersto the reaction incubate at 42°C for 15 minutes and cycle. Thefirst-strand cDNA synthesis reaction may be primed with anoligo(dT) primer, a random primer such as pd(N)6 or a custom(gene-specific) primer complementary to a specific mRNAsequence. The PCR reaction may be primed with two gene-specific primers or with pd(T)1 2 - 1 8 and a single gene-specificp r i m e r.First-Strand cDNA generated with the RT-PCR Beads is designedto be used directly as a template for PCR (i.e., RT-PCR, ref. 1-4).In this pro c e d u re, the double-stranded RNA:cDNA hetero d u p l e xmade during first-strand synthesis is heat-denatured to allow thecDNA strand to be used as a template for polymerization in PCR( 5 - 7 ) .The specificity of the PCR amplification is based on twoamplification primers which flank the cDNA segment to beamplified and hybridize to complementary strands. Repeatedcycles of denaturation, primer annealing, and primer extension byTa q DNA polymerase can result in exponential amplification of a

5

t a rget cDNA. Even cDNA made from relatively rare transcriptscan be successfully amplified using this technique.R e a d y - To-Go RT-PCR Beads provide the reagents for RT- P C Rreactions in a convenient ambient-temperature-stable bead. Thebeads are manufactured using a pro p r i e t a ry technology licensedto Amersham Pharmacia Biotech. Ready-To-Go RT-PCR Beadshave been optimized for first-strand cDNA synthesis and PCRreactions and contain buff e r, MgCl2, nucleotides, M-MuLVreverse transcriptase, RNAguard and Ta q DNA polymerase. Theonly reagents that must be added to the reaction are templateRNA, a first-strand primer and PCR primers. The Ready-To - G oBead format significantly reduces the number of pipetting steps,t h e reby increasing the re p roducibility of the RT-PCR techniqueand minimizing the risk of contamination.

Recommendations for StorageAfter opening the kit, store unused reactions at ambientt e m p e r a t u re in the resealable pouch with desiccant provided. Do not remove the foil seal from unused reactions in 0.2 ml tubesuntil just prior to use. If the foil layer is accidentally re m o v e d ,reseal the unused tubes with the strip bubble caps that arep rovided. If the reactions will not be used immediately, store inthe pouch with desiccant.In areas with high relative humidity, we recommend that theresealed pouch be stored in a desiccator. S t o re reconstituted pd(N)6 and pd(T)1 2 - 1 8 at -20°C.

6

Requirements/Conditions for First-StrandcDNA SynthesisThe use of intact RNA is of primary importance to the success offirst-strand cDNA synthesis. The amount of RNA needed in thefirst-strand reaction will vary depending on the re l a t i v eabundance of the message of interest. We recommend using 100 pg to 1 µg of mRNA or 20 ng to 2 µg of total RNA. D E P C - t reated water is pre f e rred over TE buffer for pre p a r i n gRNA. In some cases, the EDTA in TE buffer may inhibit the PCR.Choices for primers include 0.2-2.5 µg of pd(N)6, 0.1-0.5 µg ofp d ( T )1 2 - 1 8 or 5-25 pmol of gene-specific primers. In a limitednumber of systems it may be beneficial to use up to 5 µg ofp d ( N )6 to minimize nonspecific bands. This may re q u i re thep u rchase of additional pd(N)6 (see page 28).Assemble reactions on ice to pre s e rve M-MuLV activity and tominimize production of nonspecific first-strand pro d u c t s .The standard reaction temperature for first-strand cDNAsynthesis using RT-PCR Beads is 42°C. The reaction temperaturecan be increased to 48°C if nonspecific priming is a pro b l e m ;h o w e v e r, signal intensity may decre a s e .

Requirements/Conditions for PCRIn general, PCR primers should be 15-30 bp long with a GCcontent of approximately 50%. In order to minimize the

7

p roduction of primer-dimers, avoid complementarity betweenprimer pairs and within each primer. Each RT-PCR Bead reaction is formulated so that the MgCl2concentration for PCR is 1.5 mM. See Appendix 1 if a higherM g C l2 concentration is desired or if more than 10 µl of RNA inTE buffer (10 mM Tris-HCl, 1 mM EDTA) is used.S t a n d a rd PCR consists of multiple cycles of denaturation (95°C),annealing (40-60°C) and elongation (72°C). An initialdenaturation step (95°C for 5 minutes) is recommended to ensurecomplete denaturation of the template DNA and inactivation ofthe reverse transcriptase. The optimal annealing temperaturevaries depending on the sequence of the primers and theirhomology to the template DNA. In RT-PCR Bead reactions, aslightly higher annealing temperature, compared to a standard“wet reaction”, may be used if products other than the desire done are present following amplification.For most standard, three-step PCR reactions, 35 cycles results in a1 05 to 109-fold amplification of the target sequence. The yield ofPCR product may be increased by increasing the number of cyclesto 45. However, an increased number of cycles may also pro d u c espurious bands and increased background. The time of each stepwhen using a “rapid cycler” such as a Perkin-Elmer 9600 therm a lcycler (or equivalent) should be approximately half the time aswhen using a Perkin-Elmer 480 thermal cycler (or equivalent).

8

Introduction to ProtocolsP ro c e d u re A details the recommended handling of the 0.2 mltubes/plate. There f o re, it may by skipped if the 0.5 ml tubef o rmat has been purc h a s e d .P ro c e d u re B (One-Step Protocol for RT-PCR) is the mostconvenient protocol for use since primers for first-strand cDNAsynthesis and PCR are added along with the template to an RT-P C R Bead. Most templates will amplify using the One-StepP rotocol. Pro c e d u re C (Two-Step Protocol for RT-PCR) isslightly less convenient because only pd(N)6 or pd(T)1 2 - 1 8 i sadded with the template, and each tube must be opened prior toP C R amplification to add the gene-specific PCR primers. Inc e rtain cases, the Two-Step Protocol will give higher yield andg reater specificity than that achieved with the One-StepP rotocol. For example, if nonspecific priming is a problem or ifan extremely low amount of template RNA is being used,P ro c e d u re C may give better re s u l t s .The reaction conditions described in Pro c e d u res B and C aregeneral recommendations. Optimal conditions for each systemmust be determined empirically.The use of intact, undegraded RNA is of primary importance tothe success of first-strand cDNA synthesis. We strongly re c o m-mend the use of our mRNA purification kits for preparing high-quality mRNA. For rapid purification of mRNA directly fro m

9

cells or tissues, we recommend either QuickPre p™ M i c ro m R N APurification Kit or QuickPrep mRNA Purification Kit (seeO rdering Information on page 28).For purification of total RNA we recommend the use of theQ u i c k P rep Total RNA Extraction Kit. With this kit, total RNAf rom cells and tissue can be extracted and purified in appro x-imately 1 hour. The purified total RNA is of sufficient quantityand purity for use in RT- P C R .

C a u t i o n s :

• Wear gloves when preparing RNA and when setting up RT-PCR reactions to avoid contamination with ribonucleasesf rom the skin.

• Each tube of Ready-To-Go RT-PCR Beads (white tube)contains one bead sufficient for an RT- P C R reaction of 50 µl.Do not resuspend a single bead in more or less volume.

• When perf o rming PCR, exercise extreme care to pre v e n tcontamination by nucleic acids. Always use sterile filter pipettetips and microcentrifuge tubes, and avoid carry-over contami-nation of stock solutions.

10

pd(N)6 and pd(T)12-18The tube of pd(N)6 contains 275 µg of lyophilized pro d u c t .Reconstitute the pd(N)6 with 550 µl of DEPC-treated water togive a final concentration of 0.5 µg/µl. The tube of pd(T)1 2 - 1 8contains 55 µg of lyophilized product. Reconstitute the pd(T)1 2 - 1 8with 110 µl of DEPC-treated water to give a final concentrationof 0.5 µg/µl. Store reconstituted pd(N)6 and pd(T)1 2 - 1 8 at -20°C.

Control MixThe five control beads included in the kit are packaged in red 0.5 ml microcentrifuge tubes. Each contains one ro o m -t e m p e r a t u re-stable bead containing 1 ng of rabbit globin mRNAand 8 pmol each of two globin-specific PCR primers. A Contro lMix Bead can be used to evaluate the perf o rmance of the RT- P C RBeads by adding the rehydrated Control Mix to a tube of RT- P C RBeads and perf o rming RT- P C R .The globin primer specific for the 3'-end of the globin messagewill anneal to the mRNA and serve as a primer for the re v e r s etranscriptase to produce first-strand globin cDNA. SubsequentPCR amplification of the first-strand product, utilizes the 5'globin-specific primer and the remaining 3' globin-specific primeras PCR primers, resulting in a 550 bp PCR pro d u c t .In the pro c e d u res which follow, components provided with the kita re highlighted by the use of boldface type.

11

Procedure A: Handling of 0.2 ml Tubes/PlateFor RT-PCR Beads in 0.2 ml tubes, you have the option of usingall 96 tubes at once, a strip of 8 tubes or a single tube. The sealcovering the plate is composed of a top paper layer and a lowerfoil layer. To access the complete plate, both layers can beremoved simultaneously. To access individual strips of tubeswhile keeping the remaining strips sealed, the top paper layermust first be removed keeping the lower foil seal intact.To use all 96 tubes at once:1. Remove the plate from the pouch.

2. Check that the bead in each tube is visible at the bottom ofthe tube. If necessary, gently tap the plate against a hardsurface to force each bead to the bottom of the tube.

3 . Place the plate, paper side up, on the bench top or other hards u rface. Following the instructions printed on the paper layer,grasp the edge of the paper layer along with the edge of the foill a y e r. Carefully pull off together the paper and foil and discard .

To use less than 96 tubes:The 96 well plate is designed to allow a single strip of 8 tubes tobe pushed out from the holding tray. To access individual strips oftubes while keeping the remaining strips sealed, the top paperlayer must first be removed keeping the lower foil seal intact.Follow the directions below to remove a single strip of 8 tubesf rom the tray.

12

1. Remove the plate from the pouch.2 . Locate the side that allows access to the individual strips indi-

cated by the arrow and instructions printed on the paper layer.3. Grasp the edge of the seal (paper and foil) and carefully

pull it back to separate the paper layer from the bottomfoil layer at the first cut closest to the holes.

4. Hold down the edge of the bottom foil seal and carefullyremove and discard the top paper layer.– Note: If the foil layer is accidentally removed, reseal the unused

tubes with the strip bubble caps that are provided. If the reactionswill not be used immediately, store in the pouch with desiccant.

5. Gently remove the outer perforated edge of foil thatconnects the individual strips and discard.

6. Gently apply pressure to the bottoms of all of the tubes inthe strip that will be used. Gently rock the strip of tubeswhile continuing to apply gentle pressure until the strip oftubes come free from the plate tray.Be careful not to remove the foil seal from the tubes whenpushing out the strip.

7 . Place the tubes that you have removed into an appro p r i a t eh o l d e r. If you want to use less than 8 reactions, you may cuto ff the desired number of reactions with a scissors. Snip theplastic strip connecting the individual tube from the adjacenttube then, carefully cut the foil seal between the tubes.

8. Place the plate and any other unused tubes into theresealable pouch with desiccant.

13

Procedure B: One-Step Protocol for RT-PCRWhen perf o rming RT-PCR, exercise extreme care. Wear gloveswhen setting up reactions to prevent the introduction ofexogenous RNases from the skin. Always use sterile, filterpipette tips and avoid carry-over contamination of stocksolutions. RT-PCR Beads a re designed for a 50 µl re a c t i o nvolume (one RT-PCR Bead /tube). When brought to a finalvolume of 50 µl, each reaction will contain 1.5 mM MgCl2. If ahigher concentration of MgCl2 is desired for PCR or if morethan 10 µl of RNA in TE buffer (10 mM Tris-HCl, 1 mM EDTA )is used, refer to Appendix 1.1. Check that the bead in each tube is visible at the bottom of

the tube. If necessary, tap the tubes against a hard surfaceto force each bead to the bottom of the tube. Remove thecaps from 0.5 ml/0.2 ml tubes or remove the foil from the0.2 ml tubes to be used.

2 . Place the tubes or plate that you plan to use on ice. If desire d ,one or more tubes may be used for a negative control to testfor DNA contamination (see step 6).

3 . D e t e rmine the total volume of RNA and primers that will beused in an RT- P C R B e a d reaction. It is necessary to calculatethis volume in order to determine the volume of water inwhich to dissolve the bead.

14

first-strand primer V µlP C R primer 1 W µlPCR primer 2 (if necessary ) X µltemplate RNA* Y µlD E P C - t reated water Z µl

(to a total of 50 µl)

*See Appendix 1, if the RNA is in a solution containing EDTA.

4 . To the side of each tube, add Z µl of room temperatureD E P C - t reated water. If necessary, tap the tube to mix thewater with the bead. Incubate on ice until the bead dissolves( a p p roximately 5 minutes).

5 . Flick each tube with a finger to mix or pipet gently up anddown and replace on ice. Do not v o rtex since this may causef o a m i n g .

6. (Optional) To prepare a negative control reaction to testfor DNA contamination, incubate the rehydrated beadwithout template and primers at 95°C for 10 minutes toinactivate the M-MuLV reverse transcriptase.

7. Add template and primers individually to each dissolvedbead, including the bead that was dissolved and incubatedin step 6.– Note: Some systems are sensitive to the order of addition of

template and primers.

15

8 . For the positive control reaction, add 50 µl of DEPC-tre a t e dwater to the C o n t rol Mix Bead. Transfer the entire contentsof the red tube to a tube containing an RT- P C R B e a d.

9 . Overlay the reaction with 50 µl of mineral oil only if theaddition of mineral oil is a re q u i rement for your therm a lc y c l e r.

10. Close caps on 0.5 ml/0.2 ml tubes or apply Bubble Caps t othe 0.2 ml tubes/plate. Push down firmly to ensure that thecaps fit tightly on the tubes.

11. Transfer reactions to a pre-warmed incubator, heat blockor thermal cycler and incubate at 42°C for 15-30 minutes.– Note: Bubble Caps may become deformed if this incubation is

carried out in a thermal cycler. If this occurs, use one of theadditional Bubble Caps provided.

12. Incubate the reactions at 95°C for 5 minutes to inactivatethe reverse transcriptase and to completely denature thetemplate. Cycle 20-45 times depending on the abundanceof the target.– Note: Bubble Caps may be deformed after cycling. If this occurs,

use one of the additional Bubble Caps provided.

16

For the control reaction we recommend the following “cycle”p rofile for Perkin-Elmer 480 thermal cyclers (or equivalent):

Denaturation at 95°C for 1 minute, 55°C for 1 minute andpolymerization at 72°C for 1 minute. Repeat for a total of 32 cycles.

For the control reaction we recommend the following “cycle”p rofile for Perkin-Elmer 9600 thermal cyclers (or equivalent):

Denaturation at 95°C for 30 seconds, 55°C for 30 secondsand polymerization at 72°C for 60 seconds. Repeat for atotal of 32 cycles.

17

Procedure C: Two-Step Protocol for RT-PCRWhen perf o rming RT-PCR, exercise extreme care. Wear gloveswhen setting up reactions to prevent the introduction ofexogenous RNases from the skin. Always use sterile, filterpipette tips and avoid carry-over contamination of stocksolutions. RT-PCR Beads a re designed for a 50 µl re a c t i o nvolume (one RT-PCR Bead /tube). When brought to a finalvolume of 50 µl, each reaction will contain 1.5 mM MgCl2. If ahigher concentration of MgCl2 is desired for PCR, refer toAppendix 1.1 . Check that the bead in each tube is visible at the bottom of

the tube. If necessary, tap the tubes against a hard surface tof o rce each bead to the bottom of the tube. Remove the capsf rom 0.5 ml/0.2 ml tubes or remove the foil from the 0.2 mltubes to be used.

2 . Place the tubes or plate to be used on ice. If desired, one orm o re tubes may be used for control to test for DNAc o n t a m i n a t i o n .

3 . D e t e rmine the total volume of RNA and primers that will beused in an RT- P C R B e a d reaction. It is necessary to calculatethis volume in order to determine the volume of water inwhich to dissolve the bead.

18

first-strand primer* V µlP C R primer 1** W µlPCR primer 2** X µltemplate RNA*** Y µlD E P C - t reated water Z µl

(to a total of 50 µl)

*For increased sensitivity, use pd(N)6 or pd(T)1 2 - 1 8 as the first-strand primer.The success of this approach will be system-dependent.**Add these primers a f t e r the first-strand cDNA synthesis reaction iscompleted (see step 12). The combined total volume of the two PCR primersshould be ≤ 10 µl.

***See Appendix 1, if the RNA is in a solution containing EDTA.

4 . To the side of each tube, add Z µl of room temperatureD E P C - t reated water. If necessary, tap the tube to mix thewater with the bead. Incubate on ice until the bead dissolves( a p p roximately 5 minutes).

5 . Flick each tube with a finger to mix or pipet gently up anddown and replace on ice. Do not v o rtex since this may causef o a m i n g .

6. (Optional) To prepare a negative control reaction to testfor DNA contamination, incubate the rehydrated beadwithout template and primers at 95°C for 10 minutes toinactivate the M-MuLV reverse transcriptase.

19

7 . Add template and only the primer for first-strand cDNAs y n t h e s i s individually to the dissolved bead, including thebead that was dissolved and incubated in step 6.

8 . For the positive control reaction, add 50 µl of DEPC-tre a t e dwater to the C o n t rol Mix Bead. Transfer the entire contentsof the red tube to a tube containing an RT- P C R B e a d.

9 . Overlay the reaction with 50 µl of mineral oil only if theaddition of mineral oil is a re q u i rement for your therm a lc y c l e r.

10. Close caps on 0.5 ml/0.2 ml tubes or apply Bubble Caps(provided) to the 0.2 ml tubes/plate. Push down firmly toensure that the caps fit tightly on the tubes.

11. Transfer reactions to a pre-warmed incubator, heat blockor thermal cycler and incubate at 42°C for 15-30 minutes.– Note: Bubble Caps may become deformed if this incubation is

carried out in a thermal cycler. If this occurs, use one of theadditional Bubble Caps provided.

12. Incubate the reactions at 95°C for 5 minutes to inactivatethe reverse transcriptase and to completely denature thet e m p l a t e .– Note: Bubble Caps may become deformed. If this occurs, use one

of the additional Bubble Caps provided.

13. Add gene-specific primers for PCR. (Do not add to thepositive control re a c t i o n . )

20

14.Cycle 20-45 times depending on the abundance of thetarget.– Note: Bubble Caps may be deformed after cycling. If this occurs,

use one of the additional Bubble Caps provided.

We recommend the following “cycle” profile as a starting pointfor Perkin-Elmer 480 thermal cyclers (or equivalent):

Denaturation at 95°C for 1 minute, 55°C for 1 minute andpolymerization at 72°C for 1 minute. Repeat for a total of 32 cycles.

We recommend the following “cycle” profile as a starting pointfor Perkin-Elmer 9600 thermal cyclers (or equivalent):

Denaturation at 95°C for 30 seconds, 55°C for 30 secondsand polymerization at 72°C for 60 seconds. Repeat for atotal of 32 cycles.

21

Appendix 1: Adding MgCl2 ( o p t i o n a l )E D TA present in the RNA solution will chelate Mg2 + re q u i red forthe RT-PCR and may lead to suboptimal results. To compensate,additional Mg2 + may be added when assembling the reactions. Asa starting point, add 0.4 µl of 25 mM MgCl2 to the dissolvedbead for each 10 µl of RNA solution. The final volume of theassembled reaction should be kept to 50 µl.

RT-PCR Bead reaction will contain 1.5 mM MgCl2 in a finalvolume of 50 µl. Extra MgCl2 can be added to the reaction if ahigher concentration of Mg2 + is desired. Note: MgCl2concentrations above 4.0 mM will inhibit the PCR re a c t i o n.Use the table below to determine the volume of a sterile 25 mMM g C l2 solution that should be added to increase the Mg2 +

concentration of the reaction. If extra MgCl2 is added, decre a s ethe amount of water added to the reaction so that the finalvolume equals 50 µl.

Final [MgCl2] Volume of 25 mM MgCl22.0 mM 1.0 µl2.5 mM 2.0 µl3.0 mM 3.0 µl3.5 mM 4.0 µl4.0 mM 5.0 µl

22

Troubleshooting GuideThis guide is organized in the following fashion: A problem isstated, followed by its possible cause(s) and solution(s).

No bands are visible on the gel.

• The thermal cycler did not function pro p e r l y. I m p ro p e rcycling conditions can result in poor amplification. Yo u rt h e rmal cycler may not be functioning properly if the RT-PCR Bead control reaction failed to produce a specificp roduct at ~550 bp. Switch to a diff e rent thermal cycler.

• No primer was added to the re a c t i o n . RT-PCR Beads containno primer. Primers for both first-strand cDNA synthesis andPCR must be added by the customer. In Pro c e d u re C, at leastone PCR primer must be added after first-strand synthesis.

• I n s u fficient RNA was used in the re a c t i o n . The amount ofRNA needed to give a good signal in diff e rent RT- P C Rsystems can vary. Titrate the amount of template re q u i re d .

• The quality of the template RNA was poor. I m p u re ordegraded RNA may fail to be primed during first-strandcDNA synthesis or may fail to amplify. Isolate and handleR N A using precautions against RNases.

• Template RNA is in a buffer containing EDTA. E D TAp resent in the RNA solution will chelate Mg2 + re q u i red for theRT-PCR and may lead to suboptimal results. To compensate,

23

add additional Mg2 + when assembling the reactions. Refer toAppendix 1 for details.

• The dissolved bead remained at room temperature beforeinitiating the RT-PCR. M - M u LV reverse transcriptase will losesignificant activity if kept at room temperature for 30 minutes.Maintain dissolved beads on ice until the tube is moved to the42°C incubation.

• RNases were introduced into the reaction. Use only DEPC-t reated water and wear gloves when setting up re a c t i o n s .

• The wrong reaction volume was used. Each RT-PCR Beadshould only be used in a final reaction volume of 50 µl.

There are extra, nonspecific bands on the gel.

• In Pro c e d u re B, the primers are binding nonspecifically tothe RNA during first-strand cDNA synthesis.D e c rease the amount of template and/or primers.D e t e rmine if your system is sensitive to the order of additionof template and primers.I n c rease the amount of pd(N)6 in the reaction and/or useP ro c e d u re C.

• The PCR primers are hybridizing to a secondary site on thet e m p l a t e . Design new primers that are less specific for thes e c o n d a ry site.D e c rease the amount of template and/or primers.

24

I n c rease the annealing temperature during PCR by 5°Cand/or decrease the number of cycles.

• DNA contamination is present in the RNA template. Tryusing other purification methods which will re d u c e / e l i m i n a t eD N A in the RNA template (e.g. QuickPrep M i c ro m R N APurification Kit)

There is excessive smearing on the gel.

• Too much template RNA was added to the re a c t i o n . R e d u c ethe amount of template RNA in the reaction until thesmearing is eliminated.

• The quality of the template RNA was poor. Impurities ordegraded RNA may serve as a template for priming duringfirst-strand cDNA synthesis. Isolate and handle RNA u s i n gp recautions against RNases.

• RNases were introduced into the reaction. Use only DEPC-t reated water and wear gloves when setting up re a c t i o n s .

• Too much primer was added to the re a c t i o n . Reduce theamount of primer in the re a c t i o n .

• M g C l2 concentration was too low. Titrate the amount ofM g C l2 in the reaction (Appendix 1) until the smearing ise l i m i n a t e d .

• The annealing temperature during PCR was too low. T h eoptimal annealing temperature varies depending upon the

25

sequence of the primers and their homology to the templatecDNA. In RT-PCR Bead reactions, a slightly higher annealingt e m p e r a t u re, compared to standard “wet” reaction, may bere q u i red. Try increasing the annealing temperature 5°C.

• The reaction was cycled for more than 35 cycles. The yield ofPCR product may be increased by increasing the number ofcycles to 45. However, an increased number of cycles mayalso produce spurious bands and increased backgro u n d .Reduce the number of cycles until the smearing is eliminated.

• Cycling conditions suitable for a Perkin-Elmer 480 therm a lcycler (or equivalent) were used with a “rapid cycling”t h e rmal cycler. The length of each step when using a “rapidcycler” such as a Perkin-Elmer 9600 thermal cycler (orequivalent) should be approximately half the length as whenusing a Perkin-Elmer 480 thermal cycler (or equivalent).

There is excessive primer-dimer on the gel.

• Too much primer was added to the re a c t i o n . E x c e s s i v eprimer to template ratios can cause an abundance of lowmolecular weight bands and smearing. Titrate the amount ofprimers until the primer-dimer band is eliminated.

• Primers were not properly designed. In general, PCR primersshould be 15-30 bp long with a GC content of appro x i-mately 50%. Complementarity between primer pairs andwithin each primer should be avoided.

26

FUNCTION TESTINGEach batch of Ready-To - G o RT-PCR Beads is tested to ensure itsability to generate an RT-PCR product using a Control Mix Beadand an RT-PCR Bead. In addition, a second test is perf o rm e dusing D rosophila melanogaster mRNA (7.6 kb), an RT-PCR Beadand primers specific for a 425 bp region of the f s h g e n e .

STORAGES t o re ambient. After opening the kit, store unused reactions inthe resealable pouch with desiccant (provided). Storereconstituted pd(N)6 and pd(T)1 2 - 1 8 at -20°C.

27

REFERENCES1 . B e rchtold, Martin W., Nucl. Acids Res. 1 7, 453 (1989).

2 . Noonan, E. and Roninson, I. B., Nucl. Acids Res. 1 6, 10366( 1 9 8 8 ) .

3 . C h e l l e y, J. et al., N a t u re 3 3 3, 858 (1988).

4 . Rappolee, D. A. et al., S c i e n c e 2 4 1, 708 (1988).

5. Saiki, R. K. et. al., S c i e n c e 2 3 0, 1350 (1985).

6. Mullis, K. B. et. al., Cold Spring Harbor Symp. Quant.Biol. 51, 263 (1986).

7. Mullis, K. B and Faloona, F. A., Methods Enzymol. 155,335 (1987).

28

ORDERING INFORMATION

R e a d y - To - G o™ RT-PCR Beads(0.5 ml tubes) 100 re a c t i o n s 2 7 - 9 2 6 6 - 0 1

R e a d y - To - G o™ RT-PCR Beads(0.2 ml tubes/plate) 96 re a c t i o n s 2 7 - 9 2 6 7 - 0 1

R e a d y - To - G o™ RT-PCR Beads(0.2 ml tubes) 96 re a c t i o n s 2 7 - 9 2 5 9 - 0 1

48 re a c t i o n s 2 7 - 9 2 5 9 - 0 2

24 re a c t i o n s 2 7 - 9 2 5 9 - 0 3

Companion Products

Q u i c k P re p™ Total RNA Extraction Kit 1 kit 2 7 - 9 2 7 1 - 0 1

Q u i c k P re p™ M i c romRNA Purification Kit 1 kit 2 7 - 9 2 5 5 - 0 1

p d ( N )6 50 A2 6 0 u n i t s 2 7 - 2 1 6 6 - 0 1

p d ( T )1 2 - 1 8 25 A2 6 0 u n i t s 2 7 - 7 8 5 8 - 0 2100 A2 6 0 u n i t s 2 7 - 7 8 5 8 - 0 3

29

F P L C p u re, RNAguard, Ready-To - G oa n dQ u i c k P re p a rere g i s t e red trademarks of Amersham P h a rmacia Biotech Limitedor its subsidiaries. Amersham is a trademark of NycomedAmersham plc. Pharmacia and Drop Design are trademarks ofP h a rmacia & Upjohn Inc.All goods and services are sold subject to the terms andconditions of sale of the company within the AmershamP h a rmacia Biotech group that supplies them. A copy of theset e rms and conditions of sale is available on re q u e s t .

© Amersham Pharmacia Biotech Inc. 1999—All rightsre s e rv e d .Printed in the United States for Amersham Pharm a c i aBiotech, Inc. Amersham Pharmacia Biotech UK Limited .Amersham Place, Little Chalfont, Buckinghamshire, EnglandHP7 9NA.Amersham Pharmacia Biotech AB . SE-751 84, Uppsala,S w e d e n .Amersham Pharmacia Biotech, Inc. 800 Centennial Av e n u e ,PO Box 1327 Piscataway, NJ 08855, USA.A m e r s h a mP h a rmacia Biotech Europe GmbH. Munzinger Strasse 9,D-79111, Fre i b u rg, Germ a n y.

30