pyrvinium targets cd133 in human glioblastoma …...2015/09/30 · cancer therapy: preclinical...

Cancer Therapy: Preclinical

Pyrvinium Targets CD133 in Human GlioblastomaBrain Tumor–Initiating CellsChitra Venugopal1, Robin Hallett2, Parvez Vora1, Branavan Manoranjan1,3,4,Sujeivan Mahendram1, Maleeha A. Qazi1,4, Nicole McFarlane1, Minomi Subapanditha1,SaraM. Nolte1, Mohini Singh1,4, David Bakhshinyan1,4, NehaGarg1,ThusyanthVijayakumar1,Boleslaw Lach5, John P. Provias5, Kesava Reddy6, Naresh K. Murty6, Bradley W. Doble1,4,Mickie Bhatia1,4, John A. Hassell2,4, and Sheila K. Singh1,4,6

Abstract

Purpose: Clonal evolution of cancer may be regulated bydeterminants of stemness, specifically self-renewal, and currenttherapies have not considered how genetic perturbations orproperties of stemness affect such functional processes. Glioblas-toma-initiating cells (GICs), identified by expression of the cellsurface marker CD133, are shown to be chemoradioresistant. Inthe current study, we sought to elucidate the functional role ofCD133 in self-renewal and identify compounds that can specif-ically target this CD133þ treatment-refractory population.

Experimental Design:Using gain/loss-of-function studies forCD133 we assessed the in vitro self-renewal and in vivo tumorformation capabilities of patient-derived glioblastoma cells.We generated a CD133 signature combined with an in silicoscreen to find compounds that target GICs. Self-renewal andproliferation assays on CD133-sorted samples were performed

to identify the preferential action of hit compounds. In vivoefficacy of the lead compound pyrvinium was assessed inintracranial GIC xenografts and survival studies. Lastly, micro-array analysis was performed on pyrvinium-treated GICs todiscover core signaling events involved.

Results:We discovered pyrvinium, a small-molecule inhibitorof GIC self-renewal in vitro and in vivo, in part through inhibitionofWnt/b-catenin signaling andother essential stemcell regulatorypathways. We provide a therapeutically tractable strategy to targetself-renewing, chemoradioresistant, and functionally importantCD133þ stem cells that drive glioblastoma relapse andmortality.

Conclusions: Our study provides an integrated approach forthe eradication of clonal populations responsible for cancerprogression, and may apply to other aggressive and heteroge-neous cancers. Clin Cancer Res; 1–14. �2015 AACR.

IntroductionDespite improvements in cancer treatment, many patients

experience disease progression, relapse, and reduced overallsurvival. Prior research has focused on molecular mechanismsor genetic alterations implicated in drug resistance. However,the contribution of intratumoral heterogeneity to therapy failureand relapse must be acknowledged (1). Individual tumor cellscan display variable proliferation, apoptosis, metabolism, andother "hallmarks of cancer" (2). Therefore, mechanisms driving

intratumoral cellular variability present appealing therapeutictargets.

Intratumoral cancer cell heterogeneity was identified by pro-spective isolation via marker-directed cell sorting of malignantstem-like cell subpopulations, with corresponding phenotypicdiversity. The repertoires of cell surface markers that identifytumor-initiating cells (TICs) across multiple solid tumors includeCD133 (3–6), Stem cell antigen 1 (Sca1; refs. 7–10), CD44(11, 12), CD24 (13, 14), and epithelial-specific antigen (ESA;refs. 13, 15). However, unlike clinical biomarkers (like EGFR,HER2, and KRAS), the functional significance of these proteins intumor progression remains poorly understood. Different cellsurface markers may indicate heterogeneous TIC subpopulationswith different stem cell characteristics, degrees of differentiation,and malignant biologic behaviors. Moreover, using surface mar-kers to dissect intratumoral heterogeneity is complicated bycancer cells alternating between TIC and non-TIC states (16).Determinants of stemness have been shown to contribute totreatment failure, irrespective of whether the tumor cell popula-tion exists in dynamic equilibrium. Self-renewal, the cardinalproperty of stemness, is defined by the ability of a cell, at eachcell division, to generate an identical copy of itself and a cell of thesame or different phenotype (17). Cancer may thus be thought ofas a disease of unregulated self-renewal (18).

CD133 is a marker of self-renewing hematopoietic (19) andneural (20) stem cells that also identifies TIC populations inmultiple human cancers (3–6). CD133 expression correlates with

1McMaster Stem Cell and Cancer Research Institute, McMaster Uni-versity, Hamilton, Ontario, Canada. 2McMaster Centre for FunctionalGenomics, McMaster University, Hamilton, Ontario, Canada. 3MichaelG. DeGroote School of Medicine, McMaster University, Hamilton,Ontario, Canada. 4Department of Biochemistry and BiomedicalSciences, Faculty of Health Sciences, McMaster University, Hamilton,Ontario, Canada. 5Department of Pathology and Molecular Medicine,Faculty of Health Sciences, McMaster University, Hamilton, Ontario,Canada. 6Department of Surgery, Faculty of Health Sciences, McMas-ter University, Hamilton, Ontario, Canada.

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

Corresponding Author: Sheila K. Singh, McMaster University, 1200 Main StreetWest, MDCL 5027, Hamilton, ON L8S 4K1, Canada. Phone: 905-521-2100, ext.75237; Fax: 905-521-992; E-mail: [email protected]

doi: 10.1158/1078-0432.CCR-14-3147

�2015 American Association for Cancer Research.

ClinicalCancerResearch

www.aacrjournals.org OF1

Research. on June 19, 2020. © 2015 American Association for Cancerclincancerres.aacrjournals.org Downloaded from

Published OnlineFirst July 7, 2015; DOI: 10.1158/1078-0432.CCR-14-3147

http://clincancerres.aacrjournals.org/

disease progression, metastasis, recurrence, and poor overallsurvival in several human malignancies (21, 22), but insight intoits function remains limited (23, 24). Although CD133 is the firstidentified member of the Prominin family of pentaspan mem-brane glycoproteins, with an implied signaling role, the function-al significance of CD133 in modulating intratumoral heteroge-neity via self-renewal regulation is unclear.

Here, we describe an integrative approach for the treatment ofhuman glioblastomas (GBM), aggressive brain tumors thatremain incurable despite surgical excision and chemoradiother-apy. Therapeutic failure is in part due to tumor cell heterogeneitythat imparts phenotypic diversity (25, 26). Current knowledge ofglioblastoma-initiating cells (GICs) is based on comparative stud-ies of bulk tumors, enriched or depleted for GIC markers such asCD133 (6, 27) or CD15 (28), whichmay not capture the dynamicnature of GICs (29, 30). We describe a strategic drug discoveryplatform to identify compounds that inhibit self-renewal, offeringa means to selectively eradicate evolving cellular subpopulationsthat drive tumor initiation, maintenance, and relapse.

Materials and MethodsDissociation and culture of primary GBM tissue

Human GBM samples (Supplementary Tables S1 and S6) wereobtained from consenting patients, as approved by the HamiltonHealth Sciences/McMaster Health Sciences Research Ethics Board.Samples were dissociated in artificial cerebrospinal fluid contain-ing 0.2 W€unsch unit/mL Liberase Blendzyme 3 (Roche), andincubated at 37�C in a shaker for 15 minutes. The dissociatedtissue was filtered through a 70-mm cell strainer and collected bycentrifugation (1,500 rpm, 3 minutes). Tumor cells were resus-pended in a serum-free tumor stem cell medium (TSM), andplated on ultra-low attachment plates (Corning). Our completeTSM per 500 mL includes: Dulbecco's modified Eagle's medium/F12 (480 mL; Invitrogen), N2-supplement (5 mL; Invitrogen), 1mol/L HEPES (5 mL; Wisent), glucose (3 g; Invitrogen), N-acetylcysteine (1 mL of 60 mg/mL solution; Sigma), and neural

survival factor-1 (10 mL; Lonza). Added growth factors includehuman recombinant epidermal growth factor (20 ng/mL; Invi-trogen), basic fibroblast growth factor (20 ng/mL; Invitrogen),leukemia-inhibitory factor (10 ng/mL; Chemicon), and antibiotic–antimycotic (10 mg/mL; Wisent). Red blood cells were lysed usingammonium chloride solution (STEMCELL Technologies).

Propagation of GICsNeurospheres derived from minimally cultured human GBM

samples were propagated as previously described (31). Adherentcells were replated in low-binding plates and cultured as tumor-spheres, which were maintained as spheres upon serial passagingin vitro. These cells retained their self-renewal potential and werecapable of multilineage differentiation. Cell lines were subtypedbased on the expression of 21 subtype-specific genes, as describedby Verhaak and colleagues (32). The GBM sample subtypes arelisted in Supplementary Table S6.

Secondary sphere formation assayTumorspheres were dissociated using 5 to 10 mL Liberase

Blendzyme3 in 1 mL PBS for 5 minutes at 37�C. Cells wereplated at 200 cells per well in 200 mL of TSMmedia in a 96-wellplate. Cultures were left undisturbed at 37�C with 5% CO2.After 7 days, the number of secondary spheres per well wascounted and used to estimate the mean number of spheres per2,000 cells. Limiting dilution assay on GICs that had beensorted for CD133 was plated at limiting dilution (from 200 to 2cells per well) in 200 mL of TSM in quadruplicate in a 96-wellplate and 0.37 intercepts calculated (27) to determine thesphere-forming frequency.

Cell proliferation assaySingle cells were plated in a 96-well plate at a density of 1,000

cells/200 mL per well in quadruplicate and incubated for 5 days.Twenty microliters of Alamar Blue (Invitrogen), a fluorescent cellmetabolism indicator, was added to each well approximately 18hours prior to the readout time point. Fluorescence wasmeasuredusing a FLUOstar Omega Fluorescence 556 Microplate reader(BMG LABTECH) at excitation and emission wavelengths of 535nm and 600 nm, respectively. Readings were analyzed usingOmega analysis software.

Viral production and transductionLentiviral vectors shCD133-1 and shCD133-2, expressing

shRNAs targeting human CD133 (50GCGTCTTCCTATTCAGG-ATAT30 and 50GTTGAAACTATACCCATGAAA30, respectively),and the control vector, shGFP (50ACAACAGCCACAACGTCTATA30), were gifts from Dr. Jason Moffat. A CD133 overexpressionvector was purchased from Genecopoeia. Replication-incompe-tent lentiviruses were produced by cotransfection of the expres-sion vector and packaging vectors pMD2G and psPAX2 (forknockdown vectors) and pLP1, pLP2, and pLP/VSVG (for over-expression vectors) in HEK 293FT cells. Viral supernatants wereharvested 48 hours after transfection, filtered through a 0.45-mmcellulose acetate filter, and precipitated with PEGit (System bios-ciences). The viral pellet was resuspended in 1.0 mL of DMEMF-12 media and stored at �80�C.

Quantitative real-time–polymerase chain reactionTotal RNA was extracted using a Norgen Total RNA isolation

kit and quantified using the NanoDrop Spectrophotometer

Translational Relevance

Glioblastoma (GBM) is one of many highly aggressive,heterogeneous, and treatment-refractory human cancers, withno truly efficacious treatment option, and patients inevitablyrelapse following current standard chemoradiotherapy. A dis-tinct pool of cancer stem-like cells or glioblastoma-initiatingcells (GICs) within human GBM impart tumorigenicity andresistance to conventional therapy. Numerous studies haveimplicated CD133þ GICs as drivers of chemo- and radio-resistance. We have designed a novel in silico, in vitro, and invivo drug discovery approach to target treatment-refractoryCD133þ GBM cells that evade current therapy. We discoveredthat pyrvinium, an FDA-approved antihelminthic compound,reduces in vitro and in vivo self-renewal and tumor-initiatingcapability through targeting of CD133þGICs. This novel drugdiscovery approach can be applied to other prospectivelyidentified GIC populations that drive tumor heterogeneity,to allow for strategic targeting ofmultiple functionally relevantstem cell populations that may be implicated in tumor recur-rence and patient relapse.

Venugopal et al.

Clin Cancer Res; 2015 Clinical Cancer ResearchOF2




ND-1000. Complementary DNA was synthesized from 0.5 to 1mg RNA by using qScript cDNA Super Mix (Quanta Biosciences)and a C1000 Thermo Cycler (Bio-Rad) with the following cycleparameters: 4 minutes at 25�C, 30 minutes at 42�C, 5 minutesat 85�C, hold at 4�C. qRT-PCR was performed by using PerfectaSybrGreen (Quanta Biosciences) and an Opticon Chrom4instrument (Bio-Rad). Gene expression was quantified by usingOpticon software, and expression levels were normalized toGAPDH expression. Primers are listed in Supplementary TableS4.

Flow cytometric analysis and cell sortingTumorspheres were dissociated and single cells resuspended in

PBS þ2 mmol/L EDTA. Cell suspensions were stained with APC-conjugated anti-CD133 or a matched isotype control (Miltenyi)and incubated for 30 minutes on ice. Samples were run on aMoFlo XDP Cell Sorter (Beckman Coulter). Dead cells wereexcluded using the viability dye 7AAD (1:10; Beckman Coulter)or using near IR Live/Dead fixable staining kit (Life technologies).Compensation was performed using mouse IgG CompBeads(BD). Expression of CD133 was defined as positive or negativebased on the analysis regions set on the isotype control. Cells weresorted into tubes containing 1mLTSM, and small aliquots of eachsort tube were reanalyzed to determine the purity of the sortedpopulations. Cells were allowed to equilibrate at 37�C for a fewhours prior to use in experiments.

Generation of CD133 gene signature and identification ofcompounds for selective therapeutic targeting of GICsPatients and samples. All data were publicly available and down-loaded from the gene expression omnibus (http://www.ncbi.nlm.nih.gov/geo/) or the Repository for Brain Neoplasia Data(REMBRANDT, http://rembrandt.nci.nih.gov/). Multiple CD133-signature discovery cohorts (GSE4290,GSE7696, GSE13041)wereindependently evaluated to determine CD133 coexpressed genes.Together, these cohorts comprised 455 patient tumor gene expres-sion profiles. The REMBRANDT data were used as an independentvalidation set. In every case, the raw intensity files (.CEL) compris-ing each dataset were downloaded and normalized usingthe RobustMultichip Algorithm (RMA) to generate probeset inten-sities (33).

Identification of target-related genes. CD133-signature genes wereidentifiedby their coexpressionwithCD133 (204304_s_at) basedon a Pearson distance function (34).We filtered these results suchthat only probe sets appearing in the most and least 5% ofcoexpressed probe sets within each discovery cohort were includ-ed in the CD133 signature. In this fashion, the CD133 signaturecomprised overlapping probe sets among the top and bottom 5%of coexpressed with CD133 in each of the three training cohorts.The final CD133 signature comprised 65 probe sets with positiveand 20 probe sets with negative correlation to CD133 transcriptlevels (Supplementary Table S2).

Evaluation of CD133 signature. To evaluate the target index, theexpression values for each probe set were transformed such thatthemeanand SDwere set to 0 and1 in eachdataset, respectively. Atarget index was calculated for each patient as follows:

Si2PxinP

�Si2Nxj

nN;

where x is the transformed expression, n is the number of probesets, P is the set of probes with reported positive correlation to thetarget probe set, andN is the set of probes with reported negativecorrelation to the target probe set (35, 36). Patients were stratifiedinto either CD133 high or CD133 groups based on medianCD133 signature score.

Gene set enrichment analysis.Gene set enrichment analysis (GSEA)was performedusing the gene expressionprofiles of REMBRANDTtumor samples as previously described, using previous definedembryonic stem (ES) cell gene sets (37), and the CD133 signatureto define phenotype.

Connectivity mapping. Connectivity mapping was carried outusing the Connectivity Map 02 (https://www.broadinstitute.org/genome_bio/connectivitymap.html; ref. 38). Probe setsthat were among the top 5% coexpressed or anti-coexpressedgenes in at least 2 of the 3 discovery cohorts were used as tags toidentify perturbagens that reduce or increase the expression ofCD133 coexpressed and anti-coexpressed genes, respectively.

Network analysis. Probe sets among the top 5% CD133 coex-pressed probe sets were mapped as genes onto nodes of theREACTOME functional interaction network (refs. 39, 40; Supple-mentary Table S5). Next, Pearson correlation coefficients werecalculated for all interacting gene pairs and assigned as edges ontothe network. Markov clustering was used to subset the networkand identify modules of interacting genes. Subsequently, mod-ules were annotated with significantly enriched pathways. Allnetwork analyses were carried out using Cytoscape (v2.8.2) andthe Reactome FIs plugin (v2012).

Targeted treatment of GICsIC50 values were determined as follows: 1,000 cells (unsorted

and CD133-sorted) were plated in a 96-well plate in quadrupli-cates at a volume of 200 mL/well in increasing concentrations (5nmol/L–5 mmol/L) of hit compounds (Supplementary Table S3)including pyrvinium. DMSO was used as a control. Seven daysafter treatment, an alamar blue assay was performed as describedin the proliferation assay. Dose–response curves were fitted to thedata. To determine the tumor-initiating function of treatment-refractory cells, GICs were treated with pyrvinium at its IC80 levelsfor 3 days in vitro prior to intracranial injections in NOD-SCIDmice. Trypan blue exclusion was used to count viable cells usingthe Countess Automated Cell Counter (Invitrogen).

In vivo GIC intracranial injections and H&E staining ofxenograft tumors

Intracranial injections were performed as previously described(6) using each of the following GICs: shGFP, shCD133, Ctrl OE,CD133OE,DMSO-treated control, andpyrvinium-treated. Briefly,the appropriate number of live cells (determined by Trypan Blueexclusion)was resuspended in10mLofPBS.NOD-SCIDmicewereanaesthetized using isofluorane gas (5% induction, 2.5% main-tenance), and cells were injected into the frontal lobe using a 10 mLHamilton syringe as per Research Ethics Board (REB)-approvedprotocols, in a nonrandomized, nonblinded fashion. The miceinjected with drug-treated cells were sacrificed when the controlgroup reached endpoint. Upon reaching endpoint, brains wereharvested, formalin-fixed, andparaffin-embedded forhematoxylinand eosin (H&E) and human COX IV staining (Cell Signaling).

Pyrvinium Targets CD133 in Human Glioblastoma

www.aacrjournals.org Clin Cancer Res; 2015 OF3




Images were captured using an Aperio Slide Scanner and analyzedusing ImageScope v11.1.2.760 software (Aperio).

Microarray analysisRNA samples from 3 independent GIC lines that were treated

with 200 nmol/L pryvinium or DMSO were labeled using theIllumina Total Prep-96 RNA Amplification Kit (Ambion) as peramplification protocol. cRNA (750 ng) generated from thesesamples was hybridized onto Human HT-12 V4 Beadchips. TheBeadChips were incubated at 58�C, with rotation speed 5 for 18hours for hybridization. The BeadChips were washed and stainedas per Illumina protocol and scannedon the iScan (Illumina). Thedata files were quantified in GenomeStudio Version 2011.1(Illumina). All samples passed Illumina sample-dependent and-independentQCMetrics. GSEA analysis was performed using theMySigDB oncogenic signature collection.

Wnt/TCF reporter assaysGBM GICs and GBM cells transduced with shGFP, shCD133-1,

OE Ctrl, OECD133 vectors were cotransfected with the constructs8X TOPFlash (1.8 mg), driving firefly luciferase (41), and pRL-CMV(0.2 mg), driving expression of renilla luciferase for normalization(Promega). After 24 hours, GBM cells were supplementedwith Wnt 3a conditioned media with or without pyrvinium(200 nmol/L), and KD andOE cells were supplemented with TSMmedia.Cellswerewashed twicewithPBS24hours followingmediachangeand lysedwithpassive lysis buffer (Promega). The luciferasereporter activities were measured using a luminometer as per themanufacturer's instructions (Promega Dual-Light System).

Statistical analysisBiologic replicates from at least three patient samples were

compiled for each experiment, unless otherwise specified infigurelegends. Respective data represent mean � SD, n values are listedin figure legends. Student t test analyses, 2-way ANOVA withBonferroni post-hoc tests, and log-rank (Mantel–Cox test) anal-ysis were performed using GraphPad Prism 5. P < 0.05 wasconsidered significant. Statistical tests for in silico analyses weretwo-sided and were completed in R.

ResultsCD133 expression and increased self-renewal are prognosticvariables in human GBM

We have shown that a higher self-renewal index correlates withreduced GBM patient survival (42). Here, we sought to establishthe clinical utility of CD133 as a prognostic GBM biomarker.Using amedian cutoff of 15.8%based onCD133 expression in 23primary human GBMs (Supplementary Table S1), we comparedoverall survival in CD133high (n ¼ 11) with CD133low (n ¼ 12)GBMs. CD133high tumors were associated with a lower survival(P¼ 0.012; Supplementary Fig. S1A) in keeping with their higherself-renewal index. The median survival of CD133high andCD133low tumors was 10 and 14.5 months, respectively. Recentreports suggest that CD133 is a prognostic biomarker for relapse(21), time tomalignant progression from low-grade gliomas, andpoor survival (22). To provide a functional context for the clinicalutility of CD133 expression in GBM, we enumerated GIC fre-quency through in vitro sphere formation assays. When comparedwith CD133� cells, CD133þ cells generated larger (Supplemen-tary Fig. S1B), more frequent (Supplementary Fig. S1C and S1D),

and more proliferative (Supplementary Fig. S1D) GBM tumor-spheres. Thus, CD133þ cellsmay promote poor outcome throughan enhanced self-renewal mechanism.

CD133 functions to regulate GIC self-renewalAs CD133 serves as a prognostic biomarker, we aimed to

determine its function in gliomagenesis by short hairpin RNA(shRNA)–mediated silencing approach. In order to exclude thepossibility of off-target effects, we used two independent shRNAvectors. Both constructs yielded efficient knockdown (KD) ofmRNA levels (Fig. 1A), and shCD133-1 was more effective inreducing the protein levels (Fig. 1B). We performed self-renewaland proliferation assays to assess the effects of CD133 KD in ourGIC lines. Rates of secondary tumorsphere formation (Fig. 1C)and proliferative potentials (Fig. 1D) were markedly impairedfollowing CD133 KD with shCD133-1.

Weused in vivo xenotransplantation assays to assess the effect ofknockdown of CD133 on tumor size. We injected shGFP andshCD133-1 cells fromGBMs to assess in vivo effects of CD133 KD.Intracranial injections of shGFP GICs into NOD-SCID miceyielded invasive, multifocal tumors, whereas shCD133-1 GICsgenerated noninvasive, well-circumscribed lesions (Fig. 1E).Despite these differences betweenCD133KDand control tumors,both conditions formed tumors, which may reflect residualCD133 from incomplete knockdown. However, the tumor sizewas significantly reduced upon knockdown of CD133 (Fig. 1F).Previous studies (6) together with our KD data implicate CD133as a regulator of GIC self-renewal, a function with clinical utilitybeyond that of a biomarker (43).

A CD133 gene signature is predictive of poor overall gliomasurvival

As high fractions of CD133þ tumor cells negatively correlatewith patient survival, and CD133 positively influences GIC self-renewal, we hypothesized that the transcriptional programlinking CD133 with GBM stemness could be used to identifynovel therapeutic targets (44). We generated a CD133 geneexpression signature based on CD133 coexpressed and anti-coexpressed genes from 3 independent brain tumor geneexpression datasets (GSE4290, GSE7696, GSE1304) represent-ing 455 gliomas (Fig. 2A). The CD133 signature comprisedprobe sets from the top and bottom 5% of all probes based onsimilarity in expression to CD133 (Fig. 2B and C; Supplemen-tary Table S2). To confirm the capacity of the CD133 signatureto measure GBM stemness, we reasoned that the signatureshould identify tumors enriched in stem cell processes, anddisplay an aggressive course of disease. Initially, we completedGSEA (45) with previously defined ES cell gene sets (37) in avalidation cohort of brain tumors (REMBRANDT, n ¼ 286;ref. 46; Supplementary Fig. S2). REMBRANDT tumors with aCD133high signature, defined using a median cut-point for theCD133 signature score, were significantly enriched for each ESgene set. We also compared signature values across allREMBRANDT gliomas and found that CD133 signature valueswere significantly higher in GBM relative to low-grade gliomas(Fig. 2D, ANOVA). We compared the survival of all gliomapatients (n ¼ 238) with either CD133high or CD133low signa-ture tumors using the median signature score as a cutoff forpatient stratification. Patients with CD133high tumors dis-played dramatically poorer overall survival relative toCD133low patients (Fig. 2E; HR ¼ 2.1, P < 0.0001), a finding

Venugopal et al.





BT428

BT428

BT428 BT458 BT465

BT428 BT458 BT465

BT458

BT458 BT465

6

4

2

0

6

4

2

0

2.0

1.5

1.0

0.5

0.0

50

40

30

20

10

0

50

40

30

20

10

0

50

25

0

15,000

10,000

5,000

0

15,000

10,000

5,000

0

10,000

8,000

6,000

4,000

2,000

0

shGFPshCD133-1shCD133-2

shGFPshCD133-1

shC

D13

3-2

shC

D13

3-1

shC

D13

3-1

shG

FP

shG

FP

shCD133-2

shGFPshCD133-1shCD133-2

10

8

6

4

2

0

Tum

or a

rea

(mm

2 )

shGFP shCD133-1

CD

133

tran

scrip

t lev

els

(rel

ativ

e to

GA

PD

H)

CD

133

tran

scrip

t lev

els

(rel

ativ

e to

GA

PD

H)

Num

ber

of

sphe

res

per

2,00

0 ce

llsF

luor

esce

nce

inte

nsity

(A

.U.)

CD133-APC

CD133+

CD133+

CD133+ CD133+ CD133+

CD133+ CD133+

CD133+ CD133+

24.2%

3.7%

18.5% 9.5% 64.0%

7.0% 9.9%

28.0% 76.6%

A B

C

D

E F

Figure 1.CD133 knockdown impairs the self-renewal and tumor-initiating capacity of GICs. CD133 (A) transcript by qRT-PCR [bars represent the mean relative transcriptlevel of 3 technical replicates of a single sample (one-way ANOVA)] and (B) protein levels as shown by flow cytometric analysis are significantly reducedfollowing shRNA-mediated knockdown of CD133. CD133 knockdown functionally diminishes the (C) self-renewal by secondary sphere formation assay (left: barsrepresent the mean spheres per 2,000 cells of 8 technical replicates of a single sample, mean � SD, two-tailed t test), and (D) proliferative potential byAlamar Blue proliferation assay (left: bars represent the mean fluorescence intensity of 3 technical replicates of a single sample; mean � SD; two-tailed t test);E, BT428-generated xenograft tumors demonstrate a significant reduction in tumor size (red arrows) and number of mitotic cells identified by thickening ofchromatin (blue arrows) following CD133 knockdown (bottom panel) when compared with control shGFP-generated xenografts (top). F, shCD133-1 xenografttumors were significantly smaller when compared with shGFP-generated xenografts. A.U., arbitrary units; scale bar: left ¼ 2 mm, right ¼ 200 mm. � , P < 0.05;�� , P < 0.01; �� , P < 0.001.






replicated in the GBM patient subgroup (Fig 2F; HR ¼ 1.5, P ¼0.02). While our signature predicted poor survival, we wantedto assess whether this was in part be due to treatment resistanceconferred by a CD133 transcriptional profile. MGMT promotermethylation status serves as a robust biomarker for sensitivityto temozolomide, the primary chemotherapy for GBM

patients. Among a cohort of GBMs with methylation statusdata (GSE7696, n ¼ 80 GBM), the CD133high signature wassignificantly elevated in patients whose tumors had unmethy-lated MGMT (Fig. 2G) and was associated with a poor overalloutcome (Fig. 2H, tertile cut-point). Collectively, these anal-yses demonstrate a robust relationship between the CD133

GSE7696,GSE13041,

GSE4290

Correlate

to CD133

expression

probe sets

Identify commonly coexpressed probe sets

1.5

1.0

0.5

0.0

Pea

rso

n d

ista

nce

GSE13041 (n = 191)GSE7696 (n = 84)GSE4290 (n = 180)

CD133co-expressed

co-expressedCD133 anti

0 10,000 20,000

Probe set

CD133 high CD133 low

GSE7696 GSE7696GSE13041 GSE13041

GSE4290 GSE4290

760 72

21765

127

705

850 84666

20182

881

147

765

A B C

D E F4

2

0

–2

–4

CD

133

sig

nat

ure

Oligoden

droglio

ma

Mix

ed

Low-g

rade

gliom

aGBM

100

50

0

% S

urv

ival

All glioma, n = 238

CD133 high

CD133 low

HR: 2.1P < 0.0001

0 50 100 150 200 250

Time (months)

GBM, n = 147

CD133 high

CD133 low

HR: 1.5P = 0.02

% S

urv

ival

100

50

0

Time (months)

0 50 100 150

CD

133

sig

nat

ure

4

2

0

-2

-4

P = 0.02

MGM

T U

MGM

T M

HG

% S

urv

ival

100

50

0

CD133 high

CD133 low

HR: 1.9P = 0.02

GBM, n = 80

Time (months)

0 20 40 60 80

Figure 2.A CD133 stemness gene signature predicts poor overall glioma survival. A, schematic for generation of CD133 stemness gene signature. B, probe setschosen for signature represented the top and bottom 5% of all probe sets in each data set. C, 85 CD133-associated probe sets were selected in our finalsignature, representing65 and20probe sets displayingpositive andnegative associationwith CD133 transcripts. D, theCD133 signaturewas substantially enriched inGBM patients when compared with all other glioma types (low-grade glioma, mixed-lineage gliomas, and oligodendrogliomas). E, among glioma patients(n ¼ 238) stratified based on the median CD133 signature score, CD133high signature tumors displayed a dramatically poorer overall survival relative toCD133low tumors (HR ¼ 2.1, P < 0.0001). F, a similar observation with respect to overall survival was made in GBM patients, again stratified based on the medianCD133 score, (n ¼ 147) with CD133high tumors displaying poorer overall survival (HR ¼ 1.5, P ¼ 0.02). G, CD133high tumors were significantly enriched in GBMpatients with an unmethylated MGMT promoter (P ¼ 0.02), which corresponded to a reduced overall survival in these patients when using a (H) tertile cutpointfor patient stratification (HR ¼ 1.9, P ¼ 0.02). �� , P < 0.001.

Venugopal et al.





signature, tumor aggressiveness, and GIC transcriptionalpathways.

A CD133-dependent gene signature identifies molecularnetworks for therapeutic targeting

To identify key targetable biologic processes associated withCD133 gene expression andGIC-intrinsic pathways, we generateda protein interaction network (Fig. 3A) comprising protein pro-ducts encoded by CD133 coexpressed genes. CD133 coexpressedgenes interacted in 4 subnetworks or modules (Fig. 3B–E), eachassociated with distinct biologic processes (Fig. 3F). Modules 0(Fig. 3B), 1 (Fig. 3C), 2 (Fig. 3D), and 3 (Fig. 3E) were enriched incell proliferation pathways (including both PLK1 and Aurora Bkinase), RNA processing andmetabolism, protein translation andexport, and DNA repair (Fanconi anemia pathway), respectively.These pathways represent diverse biologic programs associatedwith CD133 gene expression and GIC maintenance that maycontribute to the treatment-refractory nature of GBM. To identifyadditional candidates specific to GIC self-renewal machinery, wecompleted connectivity mapping (38) with CD133 coexpressedand anti-coexpressed genes. With data on 6,100 chemical pertur-bations on gene expression profiles of multiple human malig-nancies, the Connectivity Map provides access to a high-through-put exploration of interactions between small molecules andtranscriptional profiles. In searching for compounds that reducedthe expression of CD133 coexpressed genes and increased theexpression of CD133 anti-coexpressed genes, we identified 70compounds, 15 of which cross the blood–brain barrier (Fig. 3G;Supplementary Table S3) andhave already been reported to targetTIC self-renewal (47–49).

Pyrvinium targets CD133þ cells to attenuate self-renewalSelf-renewal and proliferation assays in three GBMs showed

that the majority of our hits were unable to target properties ofstemness and thus resembled current chemotherapeutic agents(Supplementary Fig. S3A and S3B).Of our candidate compounds,pyrvinium, an FDA-approved antihelminthic drug, functioned asthe most potent inhibitor of self-renewal and proliferation (Sup-plementary Fig. S3A). Given our data implicating CD133 inregulation of self-renewal, we treated CD133high and CD133low

GBMs with pyrvinium and observed a significantly lower IC50 inCD133high GBMs (Fig. 4A). Pyrvinium has shown potent toxicityagainst various cancer cell lines (50, 51), but its effects on TICpopulations are untested. Thus, we sorted our GIC lines forCD133þ and CD133� fractions to assess the effects of pyrviniumcompared with phenothiazine drugs, which demonstrated effectson cell proliferation and self-renewal in our unsorted GIC lines(Supplementary Fig. S3A). Phenothiazines showed minimalselectivity toward CD133� cells and did not target CD133þ cellsat a therapeutic dose (Supplementary Fig. S3B). By contrast,pyrvinium targeted the self-renewal (Fig. 4B), proliferative capac-ities (Fig. 4C) and caused cell death (Supplementary Fig. S4A) ofCD133þ cells in the low nanomolar range and CD133� cells at aslightly higher dose, distinguishing this drug from themajority ofchemotherapeutic agents, which completely fail to target thecancer stem cell population at a clinically relevant dose.

Notably, our GIC lines were completely resistant to temozo-lomide (TMZ), current first-line chemotherapy for GBM (Supple-mentary Fig. S3A). As pyrvinium showed the ability to targetCD133þ GICs in primary GBMs, we aimed to test its efficacy in

recurrent GBMs driven by treatment-refractory CD133þ cells.Pyrvinium also targeted CD133þ cells at a lower dose in arecurrent GBM (Supplementary Fig. S4B). We also found thatthere was a decline in CD133þ cells after pyrvinium treatmentin both primary and recurrent GBM samples (Fig. 4D). Toassess the clinical utility of treating GBMs with pyrvinium,CD133high GIC lines were treated with pyrvinium at IC80 orDMSO after which 1 � 106 viable cells, representing treatment-refractory CD133þ GICs, were injected intracranially intoNOD-SCID mice. Pyrvinium-treated mice displayed no evi-dence of tumor formation, suggesting complete abrogation ofthe self-renewal machinery required for tumor initiation (Fig.4E). By contrast, DMSO-treated control mice exhibited large,infiltrative GBM tumors (Fig. 4E). These pathologic differenceswere also reflected in a significant survival advantage for thepyrvinium-treated cohort (Fig. 4F). Together, these data impli-cate pyrvinium in preventing GIC-driven recurrence.

Pyrvinium targets the dynamic flux of CD133 expression inGICs by inhibiting developmental signaling pathways

TICs likely exist in a steady-state equilibrium with TMCs(tumor-maintaining cells), preserving the cellular diversity ofsolid tumors (16). Because CD133 expression changes duringtumor evolution (30), we sought to investigate how ectopicexpression of CD133 in CD133-na€�ve cells affects the phenotypichierarchy in GBM. Transgenic overexpression of CD133 in threeGIC lines resulted in a marked increase in CD133 expression(Supplementary Fig. S5A and S5B), with corresponding increasesin self-renewal (Fig. 5A) and proliferation (Fig. 5B; ref. 52).

We then aimed to determine the functional consequence oftransgenic CD133 overexpression on self-renewal. We detected asignificant increase in CD133 expression in a GIC line (BT241)with lowCD133 (<3%CD133þ cells; Fig. 5C). Ectopic expressionof CD133 in CD133low BT241 cells significantly increased self-renewal (P < 0.0001; Fig. 5D) and proliferative potential (P <0.0001; Fig. 5E) of these cells when compared with controls.Given glioma cell plasticity (53, 54), we aimed to model theemergence of CD133 fromCD133� cells and the consequences todrug treatment. Upon converting CD133low BT 241(Ctrl OE) cellsto CD133þ GICs, we treated our transformed cells (CD133 OE)with pyrvinium. CD133 OE cells demonstrated preferential sen-sitivity to pyrvinium, illustrated by a reduced capacity for sec-ondary sphere formation when compared with Ctrl OE cells (Fig.5F).Notably, the IC50 and therapeutic dose of pyrviniumdeclinedto 120 nmol/L in CD133 OE cells from 240 nmol/L in Ctrl OEcells (Fig. 5G), suggesting an increased potency in CD133-expres-sing cells. The differential sensitivity of CD133 OE to pyrviniumwasmuchmore pronounced at lower concentrations of 25 and 50nmol/L, whereas no significant difference was observed at higherconcentrations (Fig. 5H). Together, these data suggest that pyrvi-nium may constitute a unique therapy for cells endowed withincreased CD133-driven stemness.

Wehave shown that pyrvinium functions as a novel inhibitor ofself-renewal in CD133þ GICs. Recent studies have suggested thatpyrvinium exerts its potent antineoplastic effects by attenuatingdevelopmental signaling pathways such as Wnt (55) and sonichedgehog (Shh; ref. 50). CD133 has been shown to form a ternarycomplex with HDAC6 to stabilize the central molecule of thecanonical Wnt pathway, b-catenin, and thereby promote Wnttarget gene activation (24). We hypothesized that pyrviniummay






function as an anti-GIC agent by inhibiting Wnt/b-catenin sig-naling. Using the well-characterized Wnt inhibitor XAV939,which stimulates b-catenin degradation via Axin stabilization

(56), we compared the levels of the b-catenin target gene, Axin2,in GICs treated with pyrvinium and XAV939. Both treatmentgroups yielded equivalent and significant decreases inAxin2 levels

Module 3

Module 1

Module 2

Module 0

Module Pathway FDR Thioridazine

Trifluoperazine

L-cycloserineMorantel

ProcholoroperazineFenoprofenChlorozoaneIfenprodilAntimycin AZimeldinePyrviniumMebendazoleSulfadimethoxineMeticraneD-cycloserine

P < 0.05

Co

nn

ecti

vity

000

0

0

1

1

12 Translation(R) <1.00e-03

<5.00e-04Protein export(K)23 Fanconi anemia pathway(N) <1.00e-03

<5.00e-043

Mitotic M-M/G1 phases(R) <1.00e-03<5.00e-04 <3.33e-04

<2.50e-04

<2.00e-04 Mitotic G2-G2/M phases(R)

PLK1 signaling events(N)

Regulation of mitotic cellAurora B signaling(N)

cycle(R)

Processing of Capped Intron-Containing Pre-mRNA(R)

<1.00e-03

<5.00e-04

<3.33e-04

Metabolism of non-codingRNA(R)

Spliceosome(K)

DNA Repair(R)

A B

C D E

F G

Figure 3.A CD133 gene signature identifies key transcriptional pathways for GIC-targeted therapy. A, a protein interaction network based on the protein productsencoded by CD133 coexpressed genes identified 4 sub-networks or modules. Modules (B) 0, (C) 1, (D) 2, and (E) 3 were enriched in (F) cell proliferation pathways(including both PLK1 and Aurora B kinase), RNA processing and metabolism, protein translation and export, and DNA repair (Fanconi anemia pathway),respectively. G, connectivity mapping based on the CD133 protein interaction network identified 15 compounds that reduced and increased the expression ofCD133 coexpressed and anti-coexpressed genes, respectively.

Venugopal et al.





125

100

75

50

25

010 100 1,000 10,000

Concentration (nmol/L)

BT 428

BT 459BT 241

BT 486%

Flu

ores

cenc

e(r

elat

ive

to D

MS

O c

ontr

ol)

% F

luor

esce

nce

(rel

ativ

e to

DM

SO

con

trol

)

BT428

BT428

BT428 BT566

BT458 BT465 BT566

BT458 BT465 BT566

Num

ber

of s

pher

es p

er

2,00

0 ce

lls

80

60

40

20

0

80

60

40

20

0

80

60

40

20

0

60

40

20

0

DMSOPyrvinium

CD133

+

CD133

+

CD133

+

CD133

+

CD133

−

CD133

−

CD133

−

CD133

−

100

50

0

100

50

0

100

50

0

100

50

0

CD133+

CD133−

25 nmol/L

50 nmol/L

100 nmol/L

200 nmol/L

25 nmol/L

50 nmol/L

100 nmol/L

200 nmol/L

25 nmol/L

50 nmol/L

100 nmol/L

200 nmol/L

25 nmol/L

50 nmol/L

100 nmol/L

200 nmol/L

DMSO DMSOPyrvinium Pyrvinium

CD133-APC

H&E Stain COXIV Stain

DM

SO

(C

on

tro

l)P

yrvi

niu

m

100

75

50

25

00 25 50 75 100 125 150

Time (days)

Per

cen

t su

rviv

al

A B

C

D

E F

CD133+ CD133+ CD133+CD133+

94.0% 17.0% 9% 5%

Pyrvinium

DMSO (control)

Figure 4.Pyrvinium selectively impairs the self-renewal machinery of CD133þ cells. A, GBM samples with a CD133high fraction (BT428A, BT459; IC50s: 12.89 nmol/Land 29.82 nmol/L) are much more sensitive to pyrvinium treatment than those with a CD133low fraction (BT241, BT486; IC50s: 239.8 nmol/L and 122.5 nmol/L,respectively). 2-tailed t test P < 0.001. B, self-renewal of the CD133þ cell population in four distinct GBM samples, as evaluated by secondary sphereformation assay, is selectively reduced following treatment with pyrvinium. Data are presented asmean� SD. C, proliferative potential of the CD133þ cell populationin four distinct GBM samples, as assessed by Alamar Blue proliferation assay, is selectively reduced following treatment with pyrvinium. D, CD133þ cellsdecline upon treatment with 200 nmol/L treatment with pyrvinium for 48 hours in both primary (BT428) and recurrent (BT 566) GBM samples. E, xenografts(H&E, Cox IV staining for human cells) generated from pyrvinium-treated cells displayed no visible tumor suggesting pyrvinium as an inhibitor of self-renewaland tumor initiation. F, mice injected with pyrvinium-treated cells maintain a significant survival advantage over control mice (n¼ 4, P¼ 0.04). Bars represent theself-renewal or proliferative potential as per the mean fluorescence intensity of 8 or 3 technical replicates (mean � SD), respectively, normalized to DMSOcontrol. Two-way ANOVA with Bonferroni post-hoc tests were performed to assess significance. n.d., not determined. Scale bar, 2 mm. �, P < 0.05; �� , P < 0.01;�� , P < 0.001; �� , P < 0.0001.






100

50

0

100

50

0

100

50

0BT428 BT458 BT465

BT428 BT458 BT465

Ctrl OE

CD133 OE

Ctrl OE

CD133 OE

Ctrl OE

CD133 OECtrl OE

CD133 OE

Num

ber

of s

pher

es p

er 2

,000

cel

ls

Num

ber

of s

pher

espe

r 2,

000

cells

Flu

ores

cenc

e in

tens

ity (

A.U

.)

Flu

ores

cenc

e in

tens

ity (

A.U

.)

% F

luor

esce

nce

(re

lativ

e to

DM

SO

con

trol

)

% F

luor

esce

nce

(re

lativ

e to

DM

SO

con

trol

)

% S

pher

e fo

rmat

ion

(re

lativ

e to

DM

SO

con

trol

)

10,000

5,000

0

10,000

5,000

0

10,000

5,000

0

CD

133

OE

Ctr

l OE

CD133-APC

CD133+

CD133+

2.6%

48.8%

200

150

100

50

0

80,000

60,000

40,000

20,000

0Ctrl OE CD133 OE Ctrl OE CD133 OE

100

50

0

100

50

0

Concentration (nmol/L)

10 100 1,000 10,000

125

100

75

50

25

0Ctrl OE CD133 OE

A

B

C D E

F G H

25 nmol/L

50 nmol/L

100nmol/L

200nmol/L

Figure 5.CD133 overexpression enhances self-renewal capacity of CD133� cells, sensitizing them topyrvinium treatment. CD133OE functionally enhances the (A) self-renewalas evaluated by secondary sphere formation assay (left: mean spheres per 2,000 cells, n ¼ 10) and (B) proliferation quantified by Alamar Blue cell viabilityreagent (left: mean fluorescence intensity, n ¼ 3). C, representative flow cytometric plot showing an increase in CD133þ cells (from 2.6% to 50.0%) followingCD133 OE (BT241). CD133 OE functionally enhances the (D) self-renewal as assessed by secondary sphere formation assay [mean spheres formed per2,000 cells: 16.25 � 4.199 (Ctrl OE) and 155.0 � 9.258 (CD133 OE)] and (E) proliferation determined by Alamar Blue cell viability reagent [mean fluorescenceintensity: 12188 � 1204 (Ctrl OE) and 71669 � 274.4 (CD133 OE)] of CD133� cells. F, impaired sphere formation in CD133 OE cells compared with controlfollowing pyrvinium treatment: 92.50 � 24.05% (Ctrl OE) and 69.10 � 33.84 (CD133 OE). G, IC50 for pyrvinium-treated CD133� cells decline from 240 nmol/L(Ctrl OE) to 120 nmol/L (CD133 OE). H, pyrvinium treatment is more effective in targeting CD133þ OE cells at lower concentrations (25 nmol/L, P < 0.001;50 nmol/L, P < 0.01). � , P < 0.05; �� , P < 0.01; �� , P < 0.001; �� , P < 0.0001.

Venugopal et al.





relative to their controls (P > 0.05; Fig. 6A), indicating thecanonical Wnt/b-catenin pathway as a possible target of pyrvi-nium treatment. We also found that pyrvinium reducedWnt/TCFreporter activity (8X TOPFlash; Fig. 6B), further confirming thatWnt/b-catenin pathway to be a potential target of pyrvinium. Toelucidate Wnt activity in CD133 sorted populations, we assessedAxin2 expression levels in multiple GIC samples and found themtobe elevated inCD133þ cellswhen comparedwithCD133� cells(Fig. 6C).We usedWnt/TCF reporters onGICs thatwere KDorOECD133 and found that reporter activity was reduced in cells thatwere knocked down for CD133 (Fig. 6D) and was enhanced incells thatwere overexpressingCD133 (Fig. 6E). This suggests a linkbetween Wnt/b-catenin pathway and CD133. To understandadditional mechanisms by which pyrvinium targets GICs, weperformed global gene expression profiling of pyrvinium-treated

GICs. GSEA revealed the most significant reduction in pathwaysthat govern self-renewal and proliferation: Bmi1, JAK2, andWnt/b-catenin (Fig. 6B; Supplementary Fig. S6). These data furtherestablish CD133 as a GIC self-renewal gene responsible forendowing cells with a stemness phenotype thatmay be selectivelytargeted with pyrvinium, at least in part through inhibition of thecanonical Wnt pathway.

DiscussionThe cellular composition of solid tumors reflects a complex

ecosystem inwhich cells adapt, interact, and compete for survival.Our results establish CD133 as an important factor that canenable glioma cells to adapt to current therapies and transitbetween different clonal populations of tumor cells based on

Figure 6.Pyrvinium targets Wnt signaling inCD133þ GICs. A, pyrvinium treatmentof GICs decreases Axin2 transcriptlevels similar to a knownWnt inhibitor,XAV939 (P > 0.05). Axin2 transcriptlevels by qRT-PCR are representedrelative to the DMSO-treated control.B, TCF reporter (8XTOPFlash) activityincreased after treatment withWnt 3aconditioned media and decreasedafter pyrvinium treatment asevaluated by luciferase activity(Promega; n ¼ 2; P > 0.001). C, Wnttarget gene Axin2 transcript levels byqRT-PCR are higher in CD133þ GICswhen compared with CD133�

population (BT428, P ¼ 0.01; BT 458,P ¼ 0.04; BT 624, P ¼ 0.04). D, TCFreporter activity on BT458 transducedwith shGFP or shCD133-1. shCD133-1cells showed a significant decline inluciferase activity when comparedwith control shGFP cells. Datarepresent average of 3 experimentalreplicates, mean � SD, P > 0.0001.E, TCF reporter activity on BT241transduced with OECtrl or OECD133.OECD133 cells showed a significantincrease in luciferase activity whencompared with OE Ctrl cells. Datarepresent average of 3 experimentalreplicates, mean � SD, P > 0.0001.F, GSEA analysis using the MySigDBoncogenic signature in pyrvinium-treated GICs shows that the topenriched gene sets were associatedwith reduced Wnt/b-cateninsignaling, JAK2 signaling, andBmi1 signaling. Ctrl, control;OE, overexpression; A.U.,arbitrary units. � , P < 0.05;�� , P < 0.001.






phenotypic differences in stemness. Our approach for the treat-ment of human GICs takes into account these functional prop-erties endowed by CD133 expression. In linking the core tran-scriptional program associated with CD133 and GBM stemness,our prognostic GIC signature not only enriched for those patientsmost likely to relapse rapidly, but also presented us with aphenotypic platform for assessing the efficiency with whichcandidate molecules impaired the self-renewal of GICs. Whereasthe majority of our small molecule hits were unable to targetCD133, pyrvinium uniquely inhibited the self-renewal ofCD133þ cells, and lead to a survival advantage in an in vivomodelof recurrence. If current chemotherapeutics fail to eliminate cancerstem cell populations that evade therapy to drive patient relapse,pyrvinum will provide a unique survival advantage by targetingboth the CD133� bulk tumor and CD133þ GICs. In describingCD133 as a functionally relevant molecule amenable to thera-peutic targeting, this work provides an approach for eradicatingother GIC populations responsible for disease progression andrelapse.

In the evolutionofGBM,CD133maymark theoriginal TIC thatseeds a tumor. A low-frequency CD133þ subclone may thenpersist throughout the course of treatment by generating a cellularhierarchy that contributes to intratumoral heterogeneity and theacquisition of drug resistance. Whereas current chemotherapeuticagents may debulk the bottom of the cellular hierarchy, cellsendowed with a CD133-driven self-renewal phenotype couldescape such therapies and re-emerge to initiate tumor relapse.A similar paradigm in acute myeloid leukemia describes rarehematopoietic stem cells that acquire preleukemicmutations thatare able to regenerate the heterogeneous leukemic landscape andmaintain a clonal reservoir of treatment-resistant cells implicatedin leukemic progression and relapse (57). The presence of theseancestral leukemic cells at disease onset and recurrence highlightsself-renewal as an essential process by which these cells persistthroughout tumorigenesis. Given that self-renewal is largely mea-sured by functional assays that require proliferation, the identi-fication of targeted therapies that affect both self-renewal andproliferation has been increasingly difficult (43, 47). This hasbeen especially true in GBM where self-renewal regulators iden-tified in transgenic mouse models have been of limited clinicalutility (58).

Mechanistically, CD133 may modulate proliferation throughactivation of the PI3K/AKT pathway as CD133 phosphorylationregulates a direct interaction with p85, the regulatory subunit ofPI3K (23). By forming a stabilization complex with b-catenin,CD133 may also activate targets of Wnt/b-catenin signaling tomaintain the self-renewal capacity of GICs (24). As a functionalnexus for the proliferation and self-renewal of GICs, CD133presents a potential high-yield therapeutic target. Our data estab-lish pyrvinium as a novel compound capable of attenuatingCD133-mediated proliferation, self-renewal, and tumor forma-tion in GBMs. Pyrvinium has been shown to downregulate bothAkt and Wnt signaling, although its effects on b-catenin signalingoutput may be secondary to its attenuation of Akt phosphoryla-tion (59). Our gene expression data additionally show pyrviniummay also abrogate signaling through other pathways, includingBmi1 and Jak2. Importantly, our lab has previously identifiedBmi1 as an essential regulator ofGIC self-renewal inCD133þ cells(42). Therefore, although CD133 may be the functional hub forGICs, pyrvinium may form a therapeutic nexus of its own withcombinatorial targets that are downstream of one another.

Admittedly, many of the compounds identified in our CD133signature-based connectivity map screen did not target GICs,suggesting that our approach may be limited. This could be aresult of inherent limitations within the connectivity map thatuses cell lines, whereas we completed experiments with primarycells. Moreover, the connectivity map does not include any braintumor cell lines, suggesting that "hit" compounds may be lessrelevant in brain tumor models. Finally, it is also possible thatmany of the candidates do indeed targetGICs, but that the sphere-forming assay does not optimally detect all GIC targeting com-pounds. Notably, many of our candidates comprised phenothia-zines, which have previously been reported to target cancer stemcells (CSCs) (47).We also note that although the screen identifiedfalse positives, the overall true hit rate was excellent. We screenedsome 20 compounds in order to discover that pyrvinium displaysanti-GIC activity, representing an approximate 5% hit rate. Incontrast, many groups have screened 1000s of compounds toidentify a single or a few compounds that target TICs. For example,Gupta and colleagues report screening approximately 16,000compounds to identify salinomycin as an antibreast cancer TICtherapeutic (60).

The failure of current cancer therapeutics may be attributed to anumber of determinants such as clonal expansion based oncellular and genomic diversity, properties of stemness such asself-renewal, and the inability to effectively identify targets that acton multiple pathways with functional importance. Our noveldrug discovery approach can be applied to other prospectivelyidentified GIC populations that drive tumor heterogeneity. Ourstudyprovides a strategic platform for thepreclinical evaluationofthese factors in primary human cancer cells. The eradication ofTICs is dependent on the translation of preclinical findings tothe patient bedside, so future studies should be focused on theidentification of additional signaling hubs that regulate the self-renewal of human TICs. Compounds that converge on these cell-intrinsic pathwaysmay overcome the dynamic nature of TICs andthereby prevent the evolution of TIC clones that drive tumorinitiation, maintenance, and relapse.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: C. Venugopal, R. Hallett, P. Vora, B. Manoranjan,M. Bhatia, J.A. Hassell, S.K. SinghDevelopment of methodology: C. Venugopal, R. Hallett, P. Vora, J.A. Hassell,S.K. SinghAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): C. Venugopal, R. Hallett, P. Vora, S. Mahendram,M.A. Qazi, N. McFarlane, M. Subapanditha, S.M. Nolte, M. Singh,D. Bakhshinyan, B. Lach, J.P. Provias, K. Reddy, N.K. Murty, S.K. SinghAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): C. Venugopal, R. Hallett, P. Vora, S. Mahendram,N. McFarlane, S.M. Nolte, S.K. SinghWriting, review, and/or revision of the manuscript: C. Venugopal, R. Hallett,P. Vora, B. Manoranjan, S. Mahendram, M.A. Qazi, N. McFarlane, S.M. Nolte,D. Bakhshinyan, J.P. Provias, N.K. Murty, B.W. Doble, J.A. Hassell, S.K. Singh,T. VijayakumarAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): P. Vora, S. Mahendram, M.A. Qazi,N. McFarlane, M. Subapanditha, M. SinghStudy supervision: J.A. Hassell, S.K. SinghOther (collection and/or assembly of data, final approval of manuscript):N. Garg


Venugopal et al.




Grant SupportS.K. Singh is supported by a Canada Research Chair award, a Canadian

Institutes of Health Research (CIHR) Operating Grant, a Stem Cell NetworkDrug Discovery Grant, the Ontario Institute for Cancer Research Cancer StemCell Program, the Canadian Cancer Society Research Institute, and a Terry FoxResearch Institute New Investigator Award.

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received December 11, 2014; revised June 16, 2015; accepted June 16, 2015;published OnlineFirst July 7, 2015.

References1. Swanton C. Intratumor heterogeneity: evolution through space and time.

Cancer Res 2012;72:4875–82.2. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell

2011;144:646–74.3. Cox CV, Diamanti P, Evely RS, Kearns PR, Blair A. Expression of CD133 on

leukemia-initiating cells in childhood ALL. Blood 2009;113:3287–96.4. Hermann PC, Huber SL, Herrler T, Aicher A, Ellwart JW, Guba M, et al.

Distinct populations of cancer stem cells determine tumor growth andmetastatic activity in human pancreatic cancer. Cell Stem Cell 2007;1:313–23.

5. O'Brien CA, Pollett A, Gallinger S, Dick JE. A human colon cancer cellcapable of initiating tumour growth in immunodeficient mice. Nature2007;445:106–10.

6. Singh SK, Hawkins C, Clarke ID, Squire JA, Bayani J, Hide T, et al.Identification of human brain tumour initiating cells. Nature 2004;432:396–401.

7. Collins AT, Berry PA, Hyde C, Stower MJ, Maitland NJ. Prospectiveidentification of tumorigenic prostate cancer stem cells. Cancer Res 2005;65:10946–51.

8. Xin L, Lawson DA, Witte ON. The Sca-1 cell surface marker enriches for aprostate-regenerating cell subpopulation that can initiate prostate tumor-igenesis. Proc Natl Acad Sci U S A 2005;102:6942–7.

9. Batts TD, Machado HL, Zhang Y, Creighton CJ, Li Y, Rosen JM. Stem cellantigen-1 (sca-1) regulates mammary tumor development and cell migra-tion. PloS One 2011;6:e27841.

10. Seigel GM, Campbell LM, NarayanM, Gonzalez-Fernandez F. Cancer stemcell characteristics in retinoblastoma. Mol Vis 2005;11:729–37.

11. Du L, Wang H, He L, Zhang J, Ni B, Wang X, et al. CD44 is of functionalimportance for colorectal cancer stem cells. Clin Cancer Res 2008;14:6751–60.

12. Patrawala L, Calhoun T, Schneider-Broussard R, LiH, Bhatia B, Tang S, et al.Highly purifiedCD44þprostate cancer cells fromxenograft human tumorsare enriched in tumorigenic and metastatic progenitor cells. Oncogene2006;25:1696–708.

13. Li C,Heidt DG,Dalerba P, Burant CF, Zhang L, Adsay V, et al. Identificationof pancreatic cancer stem cells. Cancer Res 2007;67:1030–7.

14. Baumann P, Cremers N, Kroese F, Orend G, Chiquet-Ehrismann R, UedeT, et al. CD24 expression causes the acquisition of multiple cellularproperties associated with tumor growth and metastasis. Cancer Res2005;65:10783–93.

15. Dalerba P, Dylla SJ, Park IK, Liu R, Wang X, Cho RW, et al. Phenotypiccharacterization of human colorectal cancer stemcells. ProcNatl Acad SciUS A 2007;104:10158–63.

16. Gupta PB, Fillmore CM, Jiang G, Shapira SD, Tao K, Kuperwasser C, et al.Stochastic state transitions give rise to phenotypic equilibrium in popula-tions of cancer cells. Cell 2011;146:633–44.

17. Reynolds BA, Weiss S. Generation of neurons and astrocytes from isolatedcells of the adult mammalian central nervous system. Science1992;255:1707–10.

18. Reya T,Morrison SJ, ClarkeMF,Weissman IL. Stem cells, cancer, and cancerstem cells. Nature 2001;414:105–11.

19. Skorzewska A, Lal S, Waserman J, Guyda H. Abnormal food-seekingbehavior after surgery for craniopharyngioma. Neuropsychobiology 1989;21:17–20.

20. Uchida N, Buck DW, He D, Reitsma MJ, Masek M, Phan TV, et al. Directisolation of human central nervous system stem cells. Proc Natl Acad Sci US A 2000;97:14720–5.

21. Shibahara I, Sonoda Y, Saito R, Kanamori M, Yamashita Y, Kumabe T, et al.The expression status of CD133 is associatedwith the pattern and timing ofprimary glioblastoma recurrence. Neuro Oncol 2013;15:1151–9.

22. Zeppernick F, Ahmadi R, Campos B, Dictus C, Helmke BM, Becker N, et al.Stem cell marker CD133 affects clinical outcome in glioma patients. ClinCancer Res 2008;14:123–9.

23. Wei Y, Jiang Y, Zou F, Liu Y, Wang S, Xu N, et al. Activation of PI3K/Aktpathway by CD133-p85 interaction promotes tumorigenic capacity ofglioma stem cells. Proc Natl Acad Sci U S A 2013;110:6829–34.

24. Mak AB, Nixon AM, Kittanakom S, Stewart JM, Chen GI, Curak J, et al.Regulation of CD133 by HDAC6 promotes beta-catenin signaling tosuppress cancer cell differentiation. Cell Rep 2012;2:951–63.

25. Chen J, Li Y, Yu TS, McKay RM, Burns DK, Kernie SG, et al. A restricted cellpopulation propagates glioblastoma growth after chemotherapy. Nature2012;488:522–6.

26. Bao S, Wu Q, McLendon RE, Hao Y, Shi Q, Hjelmeland AB, et al. Gliomastem cells promote radioresistance by preferential activation of the DNAdamage response. Nature 2006;444:756–60.

27. Singh SK, Clarke ID, Terasaki M, Bonn VE, Hawkins C, Squire J, et al.Identification of a cancer stem cell in human brain tumors. Cancer Res2003;63:5821–8.

28. Son MJ, Woolard K, Nam DH, Lee J, Fine HA. SSEA-1 is an enrichmentmarker for tumor-initiating cells in human glioblastoma. Cell Stem Cell2009;4:440–52.

29. Beier D, Hau P, Proescholdt M, Lohmeier A, Wischhusen J, Oefner PJ, et al.CD133(þ) and CD133(-) glioblastoma-derived cancer stem cells showdifferential growth characteristics and molecular profiles. Cancer Res2007;67:4010–5.

30. Chen R, Nishimura MC, Bumbaca SM, Kharbanda S, Forrest WF, KasmanIM, et al. A hierarchy of self-renewing tumor-initiating cell types inglioblastoma. Cancer Cell 2010;17:362–75.

31. Al-Mayhani MT, Grenfell R, Narita M, Piccirillo S, Kenney-Herbert E,Fawcett JW, et al. NG2 expression in glioblastoma identifies an activelyproliferating population with an aggressive molecular signature. NeuroOncol 2011;13:830–45.

32. Verhaak RG, Hoadley KA, Purdom E, Wang V, Qi Y, Wilkerson MD, et al.Integrated genomic analysis identifies clinically relevant subtypes of glio-blastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, andNF1. Cancer Cell 2010;17:98–110.

33. Irizarry RA, Hobbs B, Collin F, Beazer-Barclay YD, Antonellis KJ, Scherf U,et al. Exploration, normalization, and summaries of high density oligo-nucleotide array probe level data. Biostatistics 2003;4:249–64.

34. Golub TR, Slonim DK, Tamayo P, Huard C, Gaasenbeek M, Mesirov JP,et al. Molecular classification of cancer: class discovery and class predictionby gene expression monitoring. Science 1999;286:531–7.

35. Hallett RM, Dvorkin-Gheva A, Anita B, Hassell JA. A gene signature forpredicting outcome in patients with basal-like breast cancer. Sci Rep2012;2:227.

36. Hallett RM, PondG,Hassell JA. A target based approach identifies genomicpredictors of breast cancer patient response to chemotherapy. BMC MedGenomics 2012;5:16.

37. Ben-Porath I, Thomson MW, Carey VJ, Ge R, Bell GW, Regev A, et al. Anembryonic stem cell-like gene expression signature in poorly differentiatedaggressive human tumors. Nat Genet 2008;40:499–507.

38. Lamb J, Crawford ED, Peck D, Modell JW, Blat IC, Wrobel MJ, et al. TheConnectivity Map: using gene-expression signatures to connect smallmolecules, genes, and disease. Science 2006;313:1929–35.

39. Wu G, Stein L. A network module-based method for identifying cancerprognostic signatures. Genome Biol 2012;13:R112.

40. WuG, Feng X, Stein L. A human functional protein interaction network andits application to cancer data analysis. Genome Biol 2010;11:R53.

41. Mahendram S, Kelly KF, Paez-Parent S, Mahmood S, Polena E, Cooney AJ,et al. Ectopic gamma-catenin expression partially mimics the effects of






stabilized beta-catenin on embryonic stem cell differentiation. PloS One2013;8:e65320.

42. VenugopalC, LiN,WangX,ManoranjanB,HawkinsC,Gunnarsson T, et al.Bmi1marks intermediate precursors during differentiation of humanbraintumor initiating cells. Stem Cell Res 2012;8:141–53.

43. Kreso A, vanGalen P, PedleyNM, Lima-Fernandes E, FrelinC,Davis T, et al.Self-renewal as a therapeutic target in human colorectal cancer. Nat Med2014;20:29–36.

44. Murat A, Migliavacca E, Gorlia T, Lambiv WL, Shay T, Hamou MF, et al.Stem cell-related "self-renewal" signature and high epidermal growthfactor receptor expression associated with resistance to concomitant che-moradiotherapy in glioblastoma. J Clin Oncol 2008;26:3015–24.

45. SubramanianA, TamayoP,Mootha VK,Mukherjee S, Ebert BL,GilletteMA,et al. Gene set enrichment analysis: a knowledge-based approach forinterpreting genome-wide expression profiles. Proc Natl Acad Sci U S A2005;102:15545–50.

46. Madhavan S, Zenklusen JC, Kotliarov Y, Sahni H, Fine HA, Buetow K.Rembrandt: helping personalized medicine become a reality throughintegrative translational research. Mol Cancer Res 2009;7:157–67.

47. Sachlos E, Risueno RM, Laronde S, Shapovalova Z, Lee JH, Russell J, et al.Identification of drugs including a dopamine receptor antagonist thatselectively target cancer stem cells. Cell 2012;149:1284–97.

48. Skrtic M, Sriskanthadevan S, Jhas B, Gebbia M, Wang X, Wang Z, et al.Inhibition ofmitochondrial translation as a therapeutic strategy for humanacute myeloid leukemia. Cancer Cell 2011;20:674–88.

49. Vanner RJ, Remke M, Gallo M, Selvadurai HJ, Coutinho F, Lee L, et al.Quiescent sox2(þ) cells drive hierarchical growth and relapse in sonichedgehog subgroup medulloblastoma. Cancer Cell 2014;26:33–47.

50. Li B, Fei DL, Flaveny CA, Dahmane N, Baubet V, Wang Z, et al. Pyrviniumattenuates Hedgehog signaling downstream of Smoothened. Cancer Res2014;74:4811–21.

51. Xu W, Lacerda L, Debeb BG, Atkinson RL, Solley TN, Li L, et al. Theantihelmintic drug pyrvinium pamoate targets aggressive breast cancer.PLoS One 2013;8:e71508.

52. Brescia P, Ortensi B, Fornasari L, Levi D, Broggi G, Pelicci G. CD133 isessential for glioblastoma stem cell maintenance. Stem Cells 2013;31:857–69.

53. Wang R, Chadalavada K,Wilshire J, Kowalik U, Hovinga KE, Geber A, et al.Glioblastoma stem-like cells give rise to tumour endothelium. Nature2010;468:829–33.

54. Ricci-Vitiani L, Pallini R, Biffoni M, Todaro M, Invernici G, Cenci T, et al.Tumour vascularization via endothelial differentiation of glioblastomastem-like cells. Nature 2010;468:824–8.

55. Thorne CA, Hanson AJ, Schneider J, Tahinci E, Orton D, Cselenyi CS, et al.Small-molecule inhibition of Wnt signaling through activation of caseinkinase 1alpha. Nat Chem Biol 2010;6:829–36.

56. Huang SM, Mishina YM, Liu S, Cheung A, Stegmeier F, Michaud GA, et al.Tankyrase inhibition stabilizes axin and antagonizes Wnt signalling.Nature 2009;461:614–20.

57. Shlush LI, Zandi S, Mitchell A, Chen WC, Brandwein JM, Gupta V, et al.Identification of pre-leukaemic haematopoietic stem cells in acute leukae-mia. Nature 2014;506:328–33.

58. Zhu Z, Khan MA, Weiler M, Blaes J, Jestaedt L, Geibert M, et al.Targeting self-renewal in high-grade brain tumors leads to loss ofbrain tumor stem cells and prolonged survival. Cell Stem Cell 2014;15:185–98.

59. Venerando A, Girardi C, Ruzzene M, Pinna LA. Pyrvinium pamoate doesnot activate protein kinase CK1, but promotes Akt/PKB down-regulationand GSK3 activation. Biochem J 2013;452:131–7.

60. Gupta PB, Onder TT, Jiang G, Tao K, Kuperwasser C, Weinberg RA, et al.Identification of selective inhibitors of cancer stem cells by high-through-put screening. Cell 2009;138:645–59.


Venugopal et al.




Published OnlineFirst July 7, 2015.Clin Cancer Res Chitra Venugopal, Robin Hallett, Parvez Vora, et al.

Initiating Cells−Tumor Pyrvinium Targets CD133 in Human Glioblastoma Brain

Updated version

10.1158/1078-0432.CCR-14-3147doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2015/07/14/1078-0432.CCR-14-3147.DC1Access the most recent supplemental material at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://clincancerres.aacrjournals.org/content/early/2015/09/30/1078-0432.CCR-14-3147To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-14-3147

http://clincancerres.aacrjournals.org/content/suppl/2015/07/14/1078-0432.CCR-14-3147.DC1

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://clincancerres.aacrjournals.org/content/early/2015/09/30/1078-0432.CCR-14-3147


pyrvinium targets cd133 in human glioblastoma …...2015/09/30 · cancer therapy: preclinical...

Documents