publications presentations -...

Publications &

Presentations

List of presentation and publications

136

A. List of publication No. Title of the Paper Name of the

Journal Author

Year,

Volume & Page

No.

ISSN/ISBN No.

1 Isolation and identification of extracellular cholesterol oxidase producing microorganisms from various sources.

International Journal of

Pharmacy & Life sciences

(IJPLS)

Parekh &

Desai

2012; 3(7)

ISSN

0976-7126

2 Media optimization using orthogonal array technique for cholesterol oxidase production by Streptomyces sp.

International Journal of Applied

Microbiology Science (IJAMS)

Parekh S.N.

and Desai P.B.

2012; 1(2); 32-43

ISSN

2277-6079

3 Extracellular cholesterol oxidase production by Streptomyces sp. isolated from compost.

Proceedings of National

Conference on “Advanced

Trends in Applied

Sciences and Technology”

(ATAST)

Parekh S.N.

and Desai P.B.

2012

ISBN 978- 81-

923514-0-7

4 Isolation and identification of extracellular cholesterol oxidase producing Arthrobacter sp. from waste of regional oil mill.

International Journal of Universal

Pharmacy and Bio Sciences

(IJUPBS)

Parekh S.N.

and Desai P.B.

2013; 2(1)

ISSN 2319-8141

5 Isolation and characterization of extracellular cholesterol oxidase producing Microbacterium sp. from waste of regional oil mill

International Journal of

Advanced Life Sciences (IJALS)

Parekh S.N.

and Desai P.B.

2013; 6(2)

ISSN

2277-758X

6 Purification and characterization of extracellular cholesterol oxidase from Streptomyces sp. RO-10

World Journal of Microbiology

& Biotechnology

(WJMB)

Parekh S.N.

and Desai P.B.

Submitted

List of presentation and publications

137

B. List of presentation

No. Title of the Paper Name of the Event Author & Year

Oral/Poster

1 Extracellular cholesterol oxidase production by Streptomyces sp. isolated from compost.

National Conference on

“Advance Trends in Applied Sciences and Technology”

(ATAST-2012) SRICEAS, Surat

Parekh S.N.

and Desai P.B.

(2012)

Oral

2 Isolation and characterization of extracellular cholesterol oxidase producing Aspergillus sp.

National Symposium

on Entrepreneurshi p in Microbial

Technlogy & 2 nd

National Level Poster

Competition on Applied Sciences & Technololgy. SRICEAS, Surat

Parekh S.N. and

Desai P.B. (2013)

Poster

3 Purification of cholesterol oxidase from Streptomyces sp.

National seminar on “Recent Advances in Applied

Sciences” (RAAS). SANPPGI, Anand

Parekh S.N. and

Desai P.B. (2013)

Poster

Research Article [Parekh & Desai, 3(7): July, 2012]

CODEN (USA): IJPLCP ISSN: 0976-7126

Int. J. of Pharm. & Life Sci. (IJPLS), Vol. 3, Issue 7: July: 2012, 1807-1811 1807

INTERNATIONAL JOURNAL OF PHARMACY & LIFE SCIENCES

Isolation and identification of extracellular cholesterol oxidase

producing microorganisms from various sources S. N. Parekh* and P.B. Desai

Department of Microbiology, Shree Ramkrishna Institute of Computer Education and Applied Sciences, Athawalines, Surat, (Gujarat) - India

Abstract Cholesterol oxidase (EC1.1.3.6; CHO) is an enzyme, which catalyzes the oxidation of cholesterol and converts 5-cholesten-3β-ol into 4- cholesten-3-one. The objective of this study is to isolate extracellular cholesterol oxidase (CHO) producing microorganisms to obtain an abundant source of cholesterol oxidase (CHO) for industrial and medicinal needs. Cholesterol oxidase producing bacteria were isolated from waste of regional oil mill, soil and compost. Twenty-five isolates are tested for cholesterol oxidase activity by screening method. As the result of the screening, CHO producer strain was isolated and identified as Streptomyces sp., Arthrobacter sp. and Aspergillus sp. CHO activity of isolates were measured by spectroscopic assay method. Purification and characterization of CHO enzyme is under way.

Key-Words: Cholesterol oxidase, 4-cholesten-3-one, Horseradish peroxidase

Introduction Cholesterol oxidase (CHO) is an enzyme which catalyzes the oxidation of Cholesterol and converts 5-Cholesten-3β- ol into 4-Cholesten 3-one1. Many bacteria can produce this enzyme including members of the genera Arthrobacter, Brevibacterium, Pseudomonas, Nocardia, Rhodococcus, Streptomyces, Corynebacterium and Shizophylum 2, 3. Cholesterol oxidase enzyme has many applications in medicine 4, agriculture, and pharmaceutical 5 and so on. For instance, it can be used for production of diagnostic kits to detect blood Cholesterol 6, biological insecticide 7 and precursors for steroid hormones 8. This enzyme can be secreted from a bacterium in 3 types including intracellular, extracellular and membrane-bound. Due to wide spectrum applications of Cholesterol oxidase, screening and isolation of bacterial strains producing extracellular form of Cholesterol oxidase is of great importance 9. Many microorganisms have been determined which produced extracellular Cholesterol oxidase including Rhodococcus equi, Rhodococcus erythropolis10, Streptomyces sp, Arthrobacter simplex, Brevibacterium sterolicum, Strerptomyces lividanse, Schizophylum commune, Micrococcus sp etc 11, 12,13 .

* Corresponding Author E.mail: [email protected] Mob.: +91 9427576142 Tel.: 0261- 2240172 Fax: 0261- 2240170

Enzymatic properties of cholesterol oxidase from Rhodococcus strains (some of which named formerly as Nocardia) are particularly suitable for use in the analytical determination of cholesterol, in which the hydrogen peroxide formed is used in a chromogenic reaction catalyzed by horseradish peroxidase. In the present study, Streptomyces sp., Arthrobacter sp. and Aspergillus sp was isolated from waste of regional oil mill, soil and compost. The type of CHO enzyme produced by isolates was determined using an enzyme activity assay on supernatant of culture medium. Material and Methods Isolation of microorganisms Cholesterol oxidase producing microorganisms were isolated by following procedure. 1 g of various samples was suspended in 100 ml of distilled water. The suspension was vigorously shaken for 30 min. A volume of 100 µl of supernatant was inoculated in medium (medium A) containing cholesterol as the sole carbon source. A medium contained (g/l): agar, 3.0 %; K2HPO4, 0.25; NH4NO3, 17; MgSO4.H2O 0.25%; FeSO4, 0.001; NaCl, 0.005; cholesterol, 0.1% and Tween 80, 0.5 ml. The pH of medium was adjusted to 7.0. The inoculated plates were incubated at 30oC for 7-12 days. After incubation period was completed, abscission colonies were appeared on the plate surface. For fast growing and generating, larger colonies were sub cultured in secondary medium (medium B) containing cholesterol as the only source of carbon as




well as yeast extract 9, 14 . This medium contained yeast extract, 0.3 g; (NH4)2HPO4, 0.1 g; cholesterol, 0.15; Tween 80, 0.05 ml; pH – 7; agar, 3.0 % and distilled water, 100 ml. Each colony on medium A was cultured in medium B and incubated at 30oC for 24 h. Then, larger colonies generated on medium B were used for further identification. Identification of isolated microorganisms was performed by microbiological examination and biochemical tests 9,11 . Screening of CHO producing organism CHO is able to convert Cholesterol into Cholest-4-en-3-one and hydrogen peroxide. CHO producing colonies were selected on cholesterol oxidase indicator plates. These plates were prepared by adding 1.0 g Cholesterol, 1.0 g Triton X-100, 0.1g o-dianisidine and 1000 Units of peroxidase to 1 liter of agar medium. Bacterial colonies were cultured on these plates and incubated at 30°C. Cholesterol penetrates into bacterial cells where it can be converted into hydrogen peroxide by Cholesterol oxidase. Reagents that exist in the medium react with hydrogen peroxide (H2O2) to form azo compound which turns the color of medium into intense brown color 15, 17, 18. Identification of isolates Identification of isolates was carried out by studying their morphological, cultural, biochemical and molecular characteristics by standard method. Bacterial and fungal isolates were identified by using Bergey’s manual of systematic bacteriology, 2nd edition and llustrated genera of imperfect fungi, 4th edition by Barnet &Hunter respectively. Determination of CHO activity CHO activity was measured by centrifuge the medium at 10,000 rpm for 20 min. at 4oC by modified method based on the study of Allain et.al 4, 12. In this reaction, hydrogen peroxide generated during Cholesterol oxidation process was coupled with 4-aminoantipyrine and phenol by peroxidase to produce quinoneimine dye with maximum absorption in 500nm. The reaction mixture was consisted of 1mM 4-aminoantipyrine , 5 mM phenol, 5 U/ml of horseradish peroxidase and sodium phosphate buffer (20 mM, pH 7.0). 50 µL of 6 g/L Cholesterol dissolved in dimethyl formamide containing 5% (v/v) Triton X-100 was added to 1ml of reaction mixture, Which was then pre incubated for 3 min. at 30°C. The reaction was initiated by adding 20 µL of enzyme sample and was continued for 5 min at 30°C. The assay mixture was boiled in a water bath for 2 min. to stop the reaction, and then place in an ice bath for 2 min. Absorbance of the reaction solution was monitored at 500 nm. (Systronic 2203, Japan). The assay mixture containing inactivated enzyme was used as the blank. One unite of CHO activity was defined as

the amount of enzyme that converts 1µmol of cholesterol in to 4-cholesten - 3 - one per minute at 30°C. Cholesterol + O2 4- cholesten-3-one + H2O2

2H2O2 + 4 - aminoantipyrene + Phenol Quinoneimine dye + 4H2O

Results and Discussion A 25 samples each from three different sources (waste of regional oil mill, compost and soil) were collected. 20 isolates were obtained from these samples on their capability on growing on isolation medium A containing cholesterol as the sole carbon source. Among them 2 isolates from each sample were found to secrete extracellular CHO were detected by cholesterol oxidase indicator plate. The result of microscopic observation and growth characteristics of these isolates is shown in table-1. Two isolates of waste from regional oil mill RO-3 & RO-10 were identified as Arthrobacter sp. and Streptomyces sp. respectively from their gram staining, morphological, biochemical and colony characteristics. The results of microbiological and biochemical properties of RO-3 is shown in table-2. The cells of RO-3 were irregular rods but eventually presented as coccoid forms as growth continued. The result of growth on medium B is shown in figure-1. Cholesterol oxidase from Streptomyces hygroscopicus and the recombinant enzyme from Brevibacterium sterolicum expressed in Escherichia coli have been characterized for their chemical, physical, and biochemical properties by Giovanni Gadda et al. 16.Isolates C-7 and C-4 from compost was identified as Streptomyces sp. from their gram staining, morphological and colony characteristics. The results of screening for CHO producing organism on cholesterol indicator plate was shown in figure-2. Two fungal isolates from soil S-2 and S-6 were identified as Aspergillus sp. CHO activity of isolates was performed by modified method based on the study of Allain et.al. 4, 12 . Among the six isolates RO-10 shows the highest activity of 1.6 U/ml. Result of activity is shown in table-3. Cholesterol oxidase is an enzyme of great commercial value widely employed by laboratories routinely devoted to the determination of cholesterol in food, serum and other clinical samples. A diversity of micro-organisms, which are capable of producing high levels of this enzyme have been isolated. Our preliminary work led to the conclusion that Streptomyces sp. might be considered as potentially interesting source of extra cellular cholesterol oxidase for clinical and commercial purposes.




Acknowledgements The authors wish to thank management and staff of Shree RamKrishna Institute of Computer Education and Applied Sciences, Surat for providing laboratory facility for this work. References

1. Murooka, Y., Ishizaki, T., Nimi, O. and Maekawa, N., (1986). Cloning and expression of a Streptomyces cholesterol oxidase gene in Streptomyces lividans with plasmid pIJ 702, Appl Environ Microbiol., 52:. 1382-1385.

2. Yazdi, M. T., Yazdi, Z. T., Zarrini, Gh. and Ghasemian, A., (2008). Purification and characterization of extra-cellular cholesterol oxidase from Rhodococcus sp. PTCC 1633, Biotechnology., 7 (4): 751-6.

3. Fujishiro, K., Uchida, H., Shimokava, K., Nakano, M., Sano, F., Ohta, T., Nakahara, N. and Aisak, K.,Uwajima T., ( 2002) .Purification and properties of a new Brevibacterium sterolicum cholesterol oxidase produced by E. coli MM294/pnH10, FEMS. Microbiol. Lett., 215: 243–248.

4. Allain, C.C., Poon, L.S., Chan, C.S.G., Richmond, W. and Fu, P.C., (1974). Enzymatic determination of total serum cholesterol, Clin. Chem., 20: 470- 475.

5. Ahmad, S., Garg, S.K. and Johri, B.N., ( 1992). Biotransformation of sterols: selective cleavage of the side chain, Biotechnol., Adv. 10: 1–67.

6. Noma, A. and Nakayama, K., (1976).Comparative studies on cholesterol oxidases from different sources, Clin. Chim. Acta., 73, 487–496.

7. Purcell, J.P., Greenplate, J.T., Jennings, M.G., Ryerse, J.S., Pershing, J.C., Sims S.R., Prinsen, M.J., Corbin, D.R., Tran, M and Sammons, R.D., (1993). Cholesterol oxidase: a potent insecticidal protein active against boll weevil larvae, Biochem. Biophys. Res. Commun., 196: 1406–1413.

8. Bell, K.S., Philp, J.C., Aw, D.W.J. and Christofi, N., (1998). A review of The genus Rhodococcus, Department of Biological Science, Napier University, Edinburgh, UK 6545/01/98.

9. Yazdi1 M. T., Malekzadeh F. , Zarrini1 Gh., Faramarzi M.A. , Kamranpour N. and Khaleghparast, Sh., (2001). Production of cholesterol oxidase by a newly isolated Rhodococcus sp, World journal of microbiology and biotechnology, 17(7): 731-737.

10. Sojo M, Bru R, López-Molina D, García-Carmona F, Argüelles JC, (1997). Cell-linked and extracellular cholesterol oxidase activities from Rhodococcus erythropolis. Isolation and physiological characterization. Appl Microbiol Biotechnol, 47:583-589.

11. Lee, S. Y., Rhee, H. I., Tae, W. C., Shin, J . C. and Park B. K. ( 1989). Purification and characterization of cholesterol oxidase from Pseudomonas sp. and taxonomic study of the stain, Applied Microbiology and Biotechnology., 31: 542-546.

12. MacLachlan, J., Wotherspoon, A.T.L., Ansell, R.O. and Brooks, C.J.W. ,( 2000). Cholesterol oxidase: sources, physical properties and analytical applications, J. Steroid. Biochem. Mol. Biol,. 72: 169–195.

13. R. Kanchana, Delcy Correia, Sangeeta Sarkar, Prachi Gawde and Aifa Rodrigues, (2011). Production and partial characterization of cholesterol oxidase from Micrococcus Sp. Isolated from Goa, India. International Journal of Applied Biology and Pharmaceutical Technology, 2: 393-398.

14. H. Lashkarian, J. Raheb, K. Shahzamani, H. Shahbani and M. Shamsaram (2010). Extracellular Cholesterol Oxidase from Rhodococcus sp.: Isolation and Molecular Characterization. Iran. Biomed. J, 14: 49-57.

15. Nishiya, Y., Harada, N., Teshima, S., Yamashita, M., Fujii, I., Hirayama, N. and Murooka, Y. (1997).Improvement of thermal stability of Streptomyces cholesterol oxidase by random muta- genesis and a structural interpretation, Protein Engineering., 10: 231–235.

16. Ghasemian, A., Tabatabaei, Y.M., Sepehrizadeh, Z., Tabatabaei, Y.Z. and Zarrini, G.H. ,(2009). Overexpression, one-step purification, and characterization of a type II cholesterol oxidase from a local isolate Rhodococcus sp. PTCC 1633. World J. Microbiol. Biotechnol. 25(5):773-77.

17. Drzyzga, O., J. M. Navarro Llorens, L. Fernańdez de las Heras, E. García Fernańdez, and J. Perera.. ,(2011).Cholesterol Degradation by Gordonia cholesterolivorans. Applied and Environmental Microbiology, 77 ( 14): 4802–4810.

18. Fernańdez de las Heras, L., et al. (2011). ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014. Microbiol. Res. 166: 403–418.




Fig. 1: Growth of isolate C-7 and RO-10 on medium B

Fig. 2: Growth on Cholesterol oxidase indicator plates




Table 1: Morphological and colonial characteristics of isolates from waste of regional oil mill,compost and soil

Sample Isolate No.

Medium Colony / growth characteristics

Morphology Figure

waste of regional oil mill

RO-3

Medium B

Small, creamy white, elevated

colony

Gram positive, short coco bacilli rods.

RO-10 White, cottony,

raised and chalky colony

Gram positive, filamentous organism

Compost C-4 Off white, cottony,

raised and dry colony


C-7 White, cottony,

raised and chalky colony


Soil S-2 Green mycelia

colony Conidiophore with septate mycelium

S-3 Brown mycelia

colony Conidiophore with septate mycelium

Table 2: Biochemical and microbiological properties of isolate RO-3. Test Result Test Result

Catalase Positive Motility Non motile Gelatinase Positive Endospore absent

Indole production Negative Lactose Acid & Gas production MR Negative Sucrose Acid & Gas production VP Negative Maltose Acid & Gas production

Citrate utilization Positive Mannitol Acid & Gas production Nitrate reduction Positive Xylose Acid & Gas production

Urease Negative Glucose Acid & Gas production H2S production Negative

Table 3: Extracellular CHO activity of isolates

Isolate Activity (Units/ ml) RO-3 0.91 RO-10 1.6

C-4 1.1 C-7 1.26 S-2 1.03 S-3 0.97

Parekh et al.

International Journal of Applied Microbiology Science 2012; 1(2); 32-43 32

ISSN-2277-6079

MEDIA OPTIMIZATION USING ORTHOGONAL ARRAY

TECHNIQUE FOR CHOLESTEROL OXIDASE

PRODUCTION BY STREPTOMYCES SP.

Parekh SN*, Desai PB

Department of Microbiology, Shree Ramkrishna Institute of Computer Education and

Applied Sciences, Athawalines, Surat-395 001, Gujarat, India.

* Corresponding Author:

Parekh S.N.

Department of Microbiology,

Shree Ramkrishna Institute of Computer Education and Applied Sciences,

Athawalines, Surat- 395 001, Gujarat, India

E-mail ID : [email protected]

Abstract

The present study focuses on optimization of media components to enhance cholesterol oxidase

(CHO) production by Streptomyces sp. isolated from waste of regional oil mill using Taguchi

orthogonal array design. One factor-at-a-time method was used to investigate the effect of

carbon sources, nitrogen sources and initial pH on biomass growth and enzyme production. A

three-level Taguchi orthogonal array design of L9 (34) was employed to select the effect of

medium components on cholesterol oxidase production. The optimum composition of

fermentation medium as obtained by statistical analysis was starch 2 % w/v, peptone 0.9 %

w/v, yeast extract 0.3 % w/v, Tween 80 0.1 % v/v and employed for cholesterol oxidase

production. The optimized medium exhibited 1.76-fold increase in enzyme activity as compared

to the non-optimized medium (2.82 U/ml and1.6 U/ml, respectively) at shake flask level.

Keywords: Cholesterol oxidase optimization, Streptomyces sp., Taguchi orthogonal array

design.

Sci

ence

In

stin

ct P

ub

lica

tion

s

mailto:[email protected]

Parekh et al.


Introduction

holesterol oxidase (CHO) is an enzyme which catalyzes the oxidation of Cholesterol and

converts 5-Cholesten-3β- ol into 4-Cholesten 3-one [1]. Many bacteria can produce this

enzyme including members of the genera Arthrobacter, Brevibacterium, Pseudomonas,

Nocardia, Rhodococcus, Streptomyces, Corynebacterium and Shizophylum [2, 3]. Cholesterol

oxidase enzyme has many applications in medicine [4], agriculture, and pharmaceuticals [5]

and so on. For instance, it can be used for production of diagnostic kits to detect blood

Cholesterol [6], as biological insecticide [7] and as precursors of steroid hormones [8]. This

enzyme can be secreted from a bacterium in 3 forms including intracellular, extracellular and

membrane-bound. Due to wide spectrum applications of cholesterol oxidase, screening and

isolation of bacterial strains producing extracellular form of cholesterol oxidase is of great

importance [9]. In the present study, medium optimization for its production by Streptomyces

sp. isolated from waste of regional oil mill was carried out.

Conventional optimization procedures involve altering of one parameter at a time keeping all

other parameters constant, which enables one to assess the impact of those particular

parameters on the process performance. These procedures are time consuming, cumbersome,

require more experimental data sets and cannot provide information about the mutual

interactions of the parameters [10].Alternative to conventional optimization procedures,

design of experiments (DOE) and statistical tools help to gain more information about the

optimization conditions in a few trials [11]. Statistical experimental design methods provide a

systematic and efficient plan for bioprocess optimization considering the interactive effects

among the control factors. Many control factors can be simultaneously studied and optimized

by statistical experimental designs [12, 13]. Among various statistical experimental designs,

Taguchi experimental design offers distinct advantages because many factors can be

examined simultaneously and more quantitative information can be extracted with a few

experimental trials [14, 15]. The basic principle of this method serves as screening filters

which examine the effects of many process variables and identify those factors which have

major effects on process using a few experiments [16].Taguchi method of DOE involves

establishment of large number of experimental situations described as orthogonal arrays to

reduce experimental errors and to enhance their efficiency and reproducibility of the

laboratory experiments [11].

Materials and methods

Isolation of microorganisms

Cholesterol oxidase producing microorganisms were isolated by the following procedure:

1 g samples of waste from regional oil mill of Gujarat state, India were suspended in 100

ml of distilled water, the suspension was vigorously shaken for 30 min, 100 μl volume of

the supernatant was inoculated in a medium (medium A) containing cholesterol as the sole

carbon source. Medium A contained: agar, 3.0 %; K2HPO4 , 0.25 g/l; NH4NO3, 17 g/l;

MgSO4.H2O 0.25 g/l; FeSO4, 0.001 g/l; NaCl, 0.005 g/l; cholesterol, 0.1% and Tween 80,

0.5 ml. The pH of medium was adjusted to 7.0. The inoculated plates were incubated at

30oC for 7-12 days. After incubation period was completed, abscission colonies were

appeared on the plate surface. For generating fast growing, larger colonies sub culturing

was done in a secondary medium (medium B) containing cholesterol along with yeast

extract as the source of carbon [9,17]. This medium contained yeast extract, 0.3 g;

(NH4)2HPO4, 0.1 g; cholesterol, 0.15; Tween 80, 0.05 ml; pH – 7; agar, 3.0 % and distilled

water, 100 ml. Each colony on medium A was cultured in medium B and incubated at 30oC

for 24 h. Then, larger colonies generated on medium B were used for further identification.

C

Parekh et al.


Screening of CHO producing organism

CHO is able to convert Cholesterol into Cholest-4-en-3-one and hydrogen peroxide. CHO

producing colonies were selected on cholesterol oxidase indicator plates. These plates were

prepared by adding 1.0 g Cholesterol, 1.0 g Triton X-100, 0.1g o-dianisidine and 1000

Units of peroxidase to 1 liter of agar medium. Selected isolated colonies were cultured on

these plates and incubated at 30°C. Cholesterol penetrates into bacterial cells where it can

be converted into hydrogen peroxide by cholesterol oxidase. Reagents that exist in the

medium then react with hydrogen peroxide (H2O2) to form azo compound which turns the

color of medium into intense brown color [18, 19, 20].

Identification of isolates

Identification of isolates was carried out by studying their morphological, cultural,

biochemical and molecular characteristics. Bacterial and fungal isolates were identified using

procedures as in Bergey’s manual of systematic bacteriology, 2nd

edition and Illustrated

genera of imperfect fungi, 4th

edition by Barnet &Hunter respectively.

Determination of CHO activity

CHO activity was measured in the supernatant of the medium obtained by centrifugation

(10,000 rpm for 20 min. at 4oC) using modified method based on the study of Allain et.al

[4, 21]. In this reaction, hydrogen peroxide generated during Cholesterol oxidation process

was coupled with 4-aminoantipyrine and phenol by peroxidase to produce quinoneimine

dye with a maximum absorption at 500nm. The reaction mixture consisted of 1mM 4-

aminoantipyrine , 5 mM phenol, 5 U/ml horseradish peroxidase and sodium phosphate

buffer (20 mM, pH 7.0). 50 μL of 6 g/L Cholesterol dissolved in dimethyl formamide

containing 5% (v/v) Triton X-100 was added to 1ml of the reaction mixture, which was

then pre incubated for 3 min. at 30°C. The reaction was initiated by adding 20 μL of the

enzyme sample and continuing it for 5 min at 30°C. The assay mixture was boiled in a

water bath for 2 min. to stop the reaction, and then placed in an ice bath for another 2 min.

Absorbance of the reaction solution was monitored at 500 nm (Systronic 2203, Japan). The

assay mixture containing inactivated enzyme was used as the blank. One unite of CHO

activity was defined as the amount of enzyme that converts 1μmol of cholesterol in to 4-

cholesten - 3 - one per minute at 30°C.

Optimization of fermentation medium using one factor-at-a-time method

The one factor-at-a-time method was used to determine the effect of fermentation time,

inoculums age and concentration, medium components (carbon and nitrogen source) and

pH on biomass and CHO production. The study was carried out in 250 ml Erlenmeyer

flasks containing 100 ml. liquid medium B, on a rotary shaker at 200 rpm at 30oC for 72

hrs. The medium was inoculated with 10% (v/v) of 48 hrs. old culture grown in the same

medium. In the present study, Dry cell weight (DCW) was determined by centrifugation of

fermentation broth at 10,000 rpm for 15 min. and washing twice with distilled water; the

recovered biomass was dried to a constant weight at 80oC for 24 hrs.

In order to investigate the optimum fermentation time for CHO production, a series of

flasks were inoculated and harvested for 24 to 120 hrs. at time interval of 12 hrs. The

parameters monitored were pH, biomass and CHO activity. The effect of inoculums

concentration and age were monitored by inoculating medium with different concentrations

(3,5,7,10,12,15 % v/v) of inoculums of different ages (12,24,36,48,60,72 hrs ). 1 gm% of

Parekh et al.


Glucose, Lactose, Sucrose, Maltose, Glycerol and Starch, were studied as an alternative

source of carbon. Cholesterol (0.002%) as an inducer of CHO was added, in suspended

form in 1ml of 5% Tween 80 solution, to the medium B. Cells were cultivated in the

medium B containing various organic and inorganic nitrogen sources, including meat

extract, yeast extract, malt extract, peptone, ammonium sulfate, ammonium phosphate and

ammonium nitrate. In the study, yeast extract and ammonium phosphate present in the basal

medium at a concentration of 0.3% (w/v) and 0.1% (w/v) respectively, were replaced with

different nitrogen source at a concentration of 0.5% (w/v). To investigate the effect of

initial pH of medium on CHO production, fermentation runs were carried out by adjusting

initial pH of the medium B in the pH range of 5 to 8.5, and analyzing the samples for CHO

production.

Taguchi orthogonal array design

An L9 (34) orthogonal array method was used for screening the most significant fermentation

parameters influencing CHO production. The design for the L9 orthogonal array was

developed and analyzed using “MINITAB 15” software (Pennsylvania State University,

University Park, Pennsylvania). The levels of the factors studied and the layout of the L9

Taguchi’s orthogonal array are shown in Tables 1 and 2. The experimental results were

analyzed to extract independently the main effects of the factors. The controlling factors were

identified, with the magnitude of effects qualified and the statistically significant effects

determined. Accordingly, the optimal conditions were determined by combining the levels of

factors that had the highest main effect value. All experiments were performed in triplicates.

The validation of data was done by using optimized parameters of fermentation media

components and levels in the shake flask.

Table 1. Factors and their levels employed in the Taguchi’s experimental design for

CHO production by Streptomyces sp.

No. Factor Level 1 Level 2 Level 3

1 Starch (gm%) 0.5 2.0 3.5

2 Peptone (gm %) 0.3 0.6 0.9

3 Yeast extract (gm %) 0.3 0.6 0.9

4 Tween 80 (%v/v) 0.05 0.1 0.15

Parekh et al.


Table 2. L9 (34) orthogonal array of Taguchi experimental design and corresponding

CHO production by Streptomyces sp.

Run Starch

(gm %)

Peptone

(gm %)

Yeast extract

(gm %)

Tween 80

(%v/v)

CHO Activity (U/ml)

Experimental Predicted

1 0.5 (1) 0.3 (1) 0.3 (1) 0.05 (1) 0.59 ± 0.01 0.57

2 0.5 (1) 0.6 (2) 0.6 (2) 0.1 (2) 0.81 ± 0.02 0.78

3 0.5 (1) 0.9 (3) 0.9 (3) 0.15 (3) 1.4 ± 0.03 1.41

4 2 (2) 0.3 (1) 0.6 (2) 0.15 (3) 1.25 ± 0.01 1.23

5 2 (2) 0.6 (2) 0.9 (2) 0.05 (1) 2.02 ± 0.07 2.0

6 2 (2) 0.9 (3) 0.3 (1) 0.1 (2) 2.82 ± 0.04 2.83

7 3.5 (3) 0.3 (1) 0.9 (3) 0.1 (2) 0.75 ± 0.04 0.73

8 3.5 (3) 0.6 (2) 0.3 (1) 0.15 (3) 0.89 ± 0.05 0.90

9 3.5 (3) 0.9 (3) 0.6 (2) 0.05 (1) 1.73 ± 0.05 1.76

Values in the parenthesis indicate the level.

Results and Discussion

Isolation and screening of CHO producing microorganisms.

Samples from waste of regional oil mill were collected. 20 isolates were obtained from these

samples depending on their capability to grow on isolation medium A containing cholesterol

as the sole carbon source. Among them one of the isolates RO-10 was found to secrete

extracellular CHO, detected by cholesterol oxidase indicator plate. The result of growth on

medium B and indicator plate is shown in Figure -1. RO-10 was identified as Streptomyces

sp. from the results of microscopic observation, growth characteristics and 16sRNA

sequencing as shown in Table 3.

Fig. 1. Growth of RO-10 on medium B (i) and indicator plate (ii).

(i) (ii)

Parekh et al.


Table 3. Characteristics of RO-10.

Isolate No. RO-10

Medium Medium B

Colony characteristics White, cottony, submerged, and chalky colony

Gram reaction, morphology

& figure


16 sRNA Sequence

>RO10

GTACTCCACCAGGCGGGGGAACWTAAATGCGTTAGYTGCGGCACGGACGACGTGGA

ATGTCGCCCCACACCTAGTTCCCAAACGTTTACGGGCGTGGACTACCAGGGTATCTA

AATCMTGTTCGCTCCCCCACGCTTTCGCTCCTCAGCGTCAGTAATCGGCCCCAGAGAT

CCGCCTTCGCCACCGGTGTTCCTCCTGATATCTGCGCATCTTCACCCGCTACACCAGG

AAATTCCGATCTCCCCTACCGAACTCTAGCCCTGCCCGTATCGAAATGCAGACCCCG

GGGKTAAAGCCCCGGGCTTTCACATCCGACGCGACAAGCCGCCTACGAGCTCTTTAC

GCCCAATAATTCCGGACAACGCTTTGCGCCCTACGTATTACCGCGGCTGCTGGCACGT

AGTTAGCCGGCGCTTCTTCTGCAGGTACCGTCACTTGCGCTTCTTCCCTGCTGAAAGA

GGTTTACAACCCGAAGGCCGTCATCCCTCACGCGGCGTCGCTGCATCAGGCTTGCGC

CCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCAGTC

CCAGTGTGGCCGGTCGCCCTCTCAGGCCGGCTACCCGTCGTCGCCTTGGTAGGCCATT

ACCCCACCAACAAGCTGATAGGCCGCGGGCTCATCCTGCACCGCCGGAGCTTTCCAC

ACACAGACCATGCGGTCGTGTGTCATATCCGGTATTAGACCCCGTTTCCAGGGCTTGT

CCCAGAGTGCAGGGCAGATTGCCCACGTGTTACTCACCCGTTCGCCACTAATCCACC

CCGAAAGGGCTTCATCGTTCGACTTGCATGTGTTAAGCACGCCGCCAGCGTTCGTCCT

GAGCCAG

Optimization of fermentation medium One-factor-at-a-time method was used to optimize fermentation medium component and the

effect of other parameters on CHO production were also studied.Figure-2 shows the results of

optimum time required for enzyme production in medium B by Streptomyces sp. During this

study enzyme activity, DCW and pH were monitored at 12 hrs interval. When cells began to

lyse after 96 hrs the enzyme activity rose sharply, this is due to the secretion of intracellular

CHO by the strain. This was confirmed by rupturing the cells after 72 hrs fermentation and

assaying for CHO activity. Highest enzyme activity of 1.6 U/ml was obtained after 72 hrs

Parekh et al.


fermentation. So, all the experiments were carried out for 72 hrs Figure-3 shows the effect of

inoculums age on CHO production. 48 hrs old inoculums showed highest enzyme activity

with 0.95gm% DCW, while 72 hrs old inoculums exhibited low enzyme activity. Figure-4

shows the effect of different inoculums concentration on CHO production. Inoculums

concentration of more than 10% v/v showed highest enzyme activity.Figure-5 shows the

effect of different carbon sources on CHO production. Starch and glycerol gave CHO activity

of 1.68 and 1.3 U/ml respectively. 1% glucose and maltose yielded 0.97 U/ml enzyme

activities. The two carbon sources showed low activity of CHO among the screened carbon

sources. Figure-6 determines the effect of various nitrogen sources on enzyme production.

Inorganic nitrogen source gave poor enzyme activity as compared to organic nitrogen source.

Peptone and yeast extract increased the enzyme production among the organic nitrogen

sources. Figure-7 shows the effect of initial pH of the medium B on CHO production.

Streptomyces sp. exhibitewd high yield of enzyme when initial pH of the medium B was kept

at 7.5. Yazdi et. al. [9] Studied the effect of different initial pH on Rhodococcus sp. and

concluded pH 8 as optimal for the production of CHO, where as Lee et. al [22] found pH 7 as

optimal for enzyme production from Rhodococcus sp.

Fig.2. Effect of fermentation time on CHO production DCM & ph.

Fig. 3. Effects of inoculums age on CHO production and DCW.

24 36 48 60 72 84 96 108 120 12120 1120

12 24 36 48 60 72 72

Parekh et al.


Fig. 4. Effect of inoculums concentration on CHO production and DCW.

Fig. 5. Effect of different carbon source on CHO production and DCW.

Fig. 6. Effect of different nitrogen source on CHO production and DCW.

Parekh et al.


Fig.7. Effect of initial pH on CHO production and DCW.

Once the best carbon and nitrogen sources were selected by conventional one-factor-at-a-time

method, the medium was subjected to screening of the most significant parameters for CHO

production using the L9 orthogonal array. There was hardly to observe any variation between

software prediction and experimental values for CHO production. The responses for means

(larger is better) and for signal to noise (S/N) ratios obtained using the L9 orthogonal array

are shown in Table 4. The last two rows in the tables show delta values and ranks for the

system. Rank and delta values help in assessing which factors have the greatest effect on the

response characteristic of interest. Delta measures the size of the effect by taking the

difference between the highest and lowest characteristic average for a factor. A higher delta

value indicates a greater effect of that component. Rank orders the factors from the greatest

effect (on the basis of the delta values) to the least effect on the response characteristic. The

order in which the individual components affected the fermentation process were peptone >

starch > yeast extract > Tween 80 suggesting that starch and peptone had a major effect,

while Tween 80 had the least effect on CHO production by Streptomyces sp. The

experimental data revealed that selected level 2 values of starch and Tween 80, level 3

values of peptone and level 1 values of yeast extract in the medium are optimal for enzyme

production (Figure 8).

The optimum conditions for maximum CHO production was achieved using the medium

starch 2.0 gm%, peptone 0.9 gm%, yeast extract 0.3 gm%, Tween 80 0.1 % v/v at pH 7.5

with 12 % v/v inoculums. The validation of data was done at flask level with 100 ml medium

in which the activity observed was 2.82 U/ml, which was in good agreement with the

predicted results (2.83 U/ml) of software. This showed a significant 1.76-folds increase in

CHO activity in optimized medium than in non-optimized medium (1.6 U/ml). Figure-9

shows the batch profile of Streptomyces sp. with optimized medium.

Parekh et al.


Fig. 8. Impact of selected fermentation factors and their assigned level on CHO

production by Streptomyces sp. X-axis represents assigned levels of selected

factor and Y-axis represents CHO (U/ml).

Table 4. Response table for means and S/N ratio.

Level

Starch Peptone Yeast extract Tween 80

Mean S/N Mean S/N Mean S/N Mean S/N

1 0.9244 -1.3208 0.8467 -1.9179 1.4356 1.0878 1.4511 2.0416

2 2.0267 5.6453 1.2367 1.0363 1.2622 1.5536 1.4511 1.4191

3 1.1367 0.4569 2.0044 5.6629 1.3900 2.1400 1.1856 1.3206

Delta 1.1022 6.9661 1.1578 7.5808 0.1733 1.0522 0.2656 0.7209

Rank 2 1 3 4

Parekh et al.


Fig. 9. Batch profile of Streptomyces sp. with optimized medium.

Conclusion

Using one-factor-at-a-time and orthogonal array method, the most effective components were

selected to design a simple yet very effective medium for remarkably improved CHO

production. The selected orthogonal array was L9 and optimum factors for CHO production

were found to be peptone, starch and yeast extract. The optimum medium condition derived

was: starch 2.0 gm%, peptone 0.9 gm%, yeast extract 0.3 gm% , Tween 80 0.1 % v/v at pH

7.5 with 12 % v/v inoculums. At this optimum condition, the yield of CHO production by

Streptomyces sp. was found to be 2.82 U / ml.

References

[1] Murooka Y, Ishizak, T, Nimi O et al. Cloning and expression of a Streptomyces cholesterol oxidase

gene in Streptomyces lividans with plasmid pIJ 702. Appl Environ Microbiol 1986; 52:1382-1385.

[2] Yazdi, MT, Yazdi ZT, Zarrini GH, et al. Purification and characterization of extra-cellular cholesterol

oxidase from Rhodococcus sp. PTCC 1633. Biotech 2008; 7 (4): 751-6.

[3] Fujishiro K, Uchida H, Shimokava K, et al. Purification and properties of a new Brevibacterium

sterolicum cholesterol oxidase produced by E. coli MM294/pnH10, FEMS. Microbiol Lett 2002; 215:

243–248.

[4] Allain CC, Poon LS, Chan CSG, et al. Enzymatic determination of total serum cholesterol. Clin Chem

1974; 20: 470-475.

[5] Ahmad S, Garg SK, Johri BN. Biotransformation of sterols: selective cleavage of the side chain,

Biotechnol 1992; 10: 1–67.

[6] Noma A, Nakayama K. Comparative studies on cholesterol oxidases from different sources, Clin Chim

Acta 1976; 73, 487–496.

[7] Purcell JP, Greenplate JT, Jennings MG, et al. Cholesterol oxidase: a potent insecticidal protein active

against boll weevil larvae. Biochem Biophys Res Commun 1993; 196: 1406–1413.

[8] Bell KS, Philp JC, Aw DWJ, et al.. A review of The genus Rhodococcus, Department of Biological

Science, Napier University, Edinburgh, UK 1998; 6545/01/98.

[9] Yazdi1 MT, Malekzadeh F, Zarrini1 GH, et al. Production of cholesterol oxidase by a newly isolated

Rhodococcus sp, World J Microb Biot 2001; 17(7): 731-737.

[10] Beg QK, Sahai V, Gupta R. Statistical media optimization and alkaline protease production from

Bacillus mojavensis in a bioreactor. Process Biochem 2003; 39:203–209.

[11] Krishna Prasad K, Venkata Mohan S, Sreenivas Rao R et al. Laccase production by Pleurotus ostreatus

1804: Optimization of submerged culture conditions by Taguchi DOE methodology. Biochem Eng J

2005; 24: 17‐26.

[12] Rao RS, Prakasham RS, Prasad KK, et al. Xylitol production by Candida sp.: parameter optimization

using Taguchi approach Process Biochem 2004; 39: 951‐956

[13] Abdel‐Fattah YR, Saeed HM, Gohar YM et al. Improved production of Pseudomonas aeruginosa

uricase by optimization of process parameters through statistical experimental designs. Process

Bioche 2005; 40: 1707–1714.

Parekh et al.


[14] Stone RA, Veevers A. The Taguchi influence on designed experiments. J Chemometrics 1994; 8: 103–

110.

[15] Houng JY, Liao JH, Wu JY, et al. .Enhancement of asymmetric bioreduction of ethyl 4‐chloro

acetoacetate by the design of composition of culture medium and reaction conditions. Process Biochem

2006; 42: 1‐7.

[16] Dasu VV, Panda T, Chidambaram M. Determination of significant parameters for improved

griseofulvin production in a batch bioreactor by Taguchi’s method. Process Biochem 2003; 38:

877‐880.

[17] Lashkarian H, Raheb J, Shahzamani K et al. Extracellular Cholesterol Oxidase from Rhodococcus sp.:

Isolation and Molecular Characterization. Iran. Biomed J 2010; 14: 49-57.

[18] Nishiya Y, Harada N, Teshima S, et al. Improvement of thermal stability of Streptomyces cholesterol

oxidase by random muta- genesis and a structural interpretation, Protein Eng, 1997; 10: 231–235.

[19] Drzyzga, O, JM Navarro Llorens, L Ferna´ndez de las Heras, et al. Cholesterol Degradation by

Gordonia cholesterolivorans. Appl Environ Microbiol 2011; 77 ( 14): 4802–4810.

[20] Fernández de Las Heras L, Mascaraque V, García Fernández E, et al. ChoG is the main inducible

extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014. Microbiol Res 2011; 166:

403–418.

[21] MacLachlan, J, Wotherspoon ATL, Ansell RO et al. Cholesterol oxidase: sources, physical properties

and analytical applications, J Steroid Biochem Mol Biol 2000; 72: 169–195.

[22] Lee MT, Chen WC, Chou CC. Nutritional factors that affect the production of Cholesterol oxidasr by

Rhodococcus equi no. 23. Biotechnol Appl Biochem 1997; 3, 159-162.

International Standard Serial Number (ISSN): 2319-8141 International Journal of Universal Pharmacy and Bio Sciences 2(1): January-February2013

INTERNATIONAL JOURNAL OF UNIVERSAL

PHARMACY AND BIO SCIENCES

Bio Sciences Research Article……!!!

Received: 18-02-2013; Accepted: 22-02-2013

ISOLATION AND IDENTIFICATION OF EXTRACELLULAR

CHOLESTEROL OXIDASE PRODUCING ARTHROBACTER SP. FROM

WASTE OF REGIONAL OIL MILL

Parekh S.N*1. and Desai P.B.

2

1,2 Department of Microbiology, Shree Ramkrishna Institute of Computer Education and

Applied Sciences, Athawalines, Surat-395 001, Gujarat, India.

KEYWORDS:

Cholesterol Oxidase, 4-

Cholesten-3-one,

Indicator plate,

Horseradish Peroxidase.

For Correspondence:

Parekh S.N*

Address: Department of

Microbiology, Shree

Ramkrishna Institute of

Computer Education and

Applied Sciences,

Athawalines, Surat-395

001, Gujarat, India.

Email ID:

[email protected]

ABSTRACT

Cholesterol oxidase (EC1.1.3.6; CHO) is an enzyme, which

catalyzes the oxidation of cholesterol and converts 5-

cholesten-3β-ol into 4- cholesten-3-one. The objective of this

study is to isolate extracellular cholesterol oxidase (CHO)

producing microorganisms to obtain an abundant source of

cholesterol oxidase (CHO) for industrial and medicinal needs.

Cholesterol oxidase producing Arthrobacter sp. was isolated

from waste of regional oil mill. Twenty-five isolates were

tested for cholesterol oxidase activity by screening method.

As a result of the screening, isolate number RO-3 was

identified as Arthrobacter sp. by morphological, biochemical

and molecular methods. CHO activity of isolates was

measured by spectroscopic assay method.

01 Full Text Available On www.ijupbs.com

mailto:[email protected]

http://www.ijupbs.com/

International Standard Serial Number (ISSN): 2319-8141

1. INTRODUCTION :

Cholesterol oxidase (CHO) is an enzyme which catalyzes the oxidation of Cholesterol and

converts 5-Cholesten-3β- ol into 4-Cholesten 3-one [1]. Many bacteria can produce this

enzyme including members of the genera Arthrobacter, Brevibacterium, Pseudomonas,

Nocardia, Rhodococcus, Streptomyces, Corynebacterium and Shizophylum [2,3]. Cholesterol

oxidase enzyme has many applications in medicine [4]., agriculture, and pharmaceutical [5]

and so on. For instance, it can be used for production of diagnostic kits to detect blood

Cholesterol [6], biological insecticide [7] and precursors for steroid hormones [8]. This

enzyme can be secreted from a bacterium in 3 types including intracellular, extracellular and

membrane-bound. Due to wide spectrum applications of Cholesterol oxidase, screening and

isolation of bacterial strains producing extracellular form of Cholesterol oxidase is of great

importance [9]. Many microorganisms have been determined which produced extracellular

Cholesterol oxidase including Rhodococcus equi, Rhodococcus erythropolis [10],

Streptomyces sp, Arthrobacter simplex, Brevibacterium sterolicum, Strerptomyces lividanse,

Schizophylum commune, Micrococcus sp etc [11,12,13]. Enzymatic properties of cholesterol

oxidase from Rhodococcus strains (some of which named formerly as Nocardia) are

particularly suitable for use in the analytical determination of cholesterol, in which the

hydrogen peroxide formed is used in a chromogenic reaction catalyzed by horseradish

peroxidase. In the present study, Arthrobacter sp. was isolated from waste of regional oil mil.

The type of CHO enzyme produced by isolate was determined using an enzyme activity

assay on supernatant of culture medium.

2. MATERIALS AND METHODS:

2.1 Isolation of microorganisms:

Cholesterol oxidase producing microorganisms were isolated by following procedure. 1 g

of samples were suspended in 100 ml of distilled water. The suspension was vigorously

shaken for 30 min. A volume of 100 μl of supernatant was inoculated in medium (medium

A) containing cholesterol as the sole carbon source. A medium contained (g/l): agar, 3.0 %;

K2HPO4, 0.25; NH4NO3, 17; MgSO4.H2O 0.25%; FeSO4, 0.001; NaCl, 0.005; cholesterol,

0.1% and Tween 80, 0.5 ml. The pH of medium was adjusted to 7.0. The inoculated plates

were incubated at 30oC for 7-12 days. After incubation period was completed, abscission

colonies were appeared on the plate surface. For fast growing and generating, larger

colonies were sub cultured in secondary medium (medium B) containing cholesterol as the

only source of carbon as well as yeast extract [9,14] .




This medium contained yeast extract, 0.3 g; (NH4)2HPO4, 0.1 g; cholesterol, 0.15; Tween

80, 0.05 ml; pH – 7; agar, 3.0 % and distilled water, 100 ml. Each colony on medium A

was cultured in medium B and incubated at 30oC for 24 h. Then, larger colonies generated

on medium B were used for further identification [9, 11].

2.2 Screening of CHO producing organism

CHO is able to convert Cholesterol into Cholest-4-en-3-one and hydrogen peroxide. CHO

producing colonies were selected on cholesterol oxidase indicator plates. These plates were

prepared by adding 1.0 g Cholesterol, 1.0 g Triton X-100, 0.1g o-dianisidine and 1000

Units of peroxidase to 1 liter of agar medium. Bacterial colonies were cultured on these

plates and incubated at 30°C. Cholesterol penetrates into bacterial cells where it can be

converted into hydrogen peroxide by Cholesterol oxidase. Reagents that exist in the

medium react with hydrogen peroxide (H2O2) to form azo compound which turns the color

of medium into intense brown color [15, 16, 17].

2.3 Identification of isolates

Primary identification of isolates was carried out by studying their morphological, cultural

and biochemical characteristics by standard method. The phylogenetic analysis of isolate was

carried out on the basis of 16S ribosomal DNA (rDNA) partial sequences. The results of

primary identification and 16S rDNA sequences were used to identify the isolates. Bergey’s

manual of systematic bacteriology, 2nd

edition was used to identify bacterial isolates.

Taxonomic studies of the isolates was carried out by 16S rDNA partial sequencing at

Microbial culture collection, National center for cell science, Pune university campus, Pune

400011, India. The 16S rDNA was amplified using 8F 5’-AGAGTTTGATCCTGGCTCAG-

3’ and 907R 5’- CGTCAATTCMTTTRAGTTT-3’ as forward and reverse primer

respectively.

The nucleotide sequence of related organisms used for alignment and for calculating the

homology level was obtained from the NCBI (National Center for Biotechnology

Information) database and ClustalW2 programme was used to align the sequences. The

phylogenetic tree was constructed using MEGA 5.1 software using neighbor-joining method

(Tamura et al., 2011) [18, 19]. Bootstrap analysis was carried out to assess the reliability of

phylogenetic tree by the same software.16S rDNA sequence of isolate was deposited in

NCBI database and received accession number.




2.4 Determination of CHO activity

CHO activity was measured by centrifuge the medium at 10,000 rpm for 20 min. at 4oC by

modified method based on the study of Allain et.al [4,12]. In this reaction, hydrogen

peroxide generated during Cholesterol oxidation process was coupled with 4-

aminoantipyrine and phenol by peroxidase to produce quinoneimine dye with maximum

absorption in 500nm. The reaction mixture was consisted of 1mM 4-aminoantipyrine , 5

mM phenol, 5 U/ml of horseradish peroxidase and sodium phosphate buffer (20 mM, pH

7.0). 50 μL of 6 g/L Cholesterol dissolved in dimethyl formamide containing 5% (v/v)

Triton X-100 was added to 1ml of reaction mixture, Which was then pre incubated for 3

min. at 30°C. The reaction was initiated by adding 20 μL of enzyme sample and was

continued for 5 min at 30°C. The assay mixture was boiled in a water bath for 2 min. to

stop the reaction, and then place in an ice bath for 2 min. Absorbance of the reaction

solution was monitored at 500 nm. (Systronic 2203, Japan). The assay mixture containing

inactivated enzyme was used as the blank. One unite of CHO activity was defined as the

amount of enzyme that converts 1μmol of cholesterol in to 4-cholesten - 3 - one per minute

at 30°C.

Cholesterol + O2 4- cholesten-3-one + H2O2

2H2O2 + 4 - aminoantipyrene + Phenol Quinoneimine dye + 4H2O

3. RESULTS AND DISCUSSION

25 samples of waste of regional oil mill were collected. 20 isolates were obtained from these

samples on their capability on growing on isolation medium A containing cholesterol as the

sole carbon source. Figure 1 shows the growth of isolate RO-3 on medium A and B. RO-3

was found to secrete extracellular CHO were detected by cholesterol oxidase indicator plate

(Fig.2). The result of microscopic observation and growth characteristics of these isolates is

shown in table-1. The results of biochemical and enzymatic properties were shown in table 2.

The cells of RO-3 were gram positive, irregular rods but eventually presented as coccoid

forms as growth continued changed. The partial sequence of 16S rDNA (834 bp) was shown

in table 3 of RO-3. Which shows 99% identity with 16S rDNA partial sequence of

Arthrobacter polychromogenes DSM 20136 and Arthrobacter scleromae YH-2001 (NCBI

accession No. NR 026192.1 & NR 041824.1 respectively) (Fig. 3).




RO-3 was identified as Arthrobacter sp. from their gram staining, morphological,

biochemical and molecular characteristics. Extra cellular CHO activity of RO-3 was found to

be 0.91 units/ml and measured by harvesting the cells grown in the medium B on rotary

shaker at 150 rpm and 30oC for 72 hrs. Cholesterol oxidase from Streptomyces hygroscopicus

and the recombinant enzyme from Brevibacterium sterolicum expressed in Escherichia coli

have been characterized for their chemical, physical, and biochemical properties by Giovanni

Gadda et al. [20]. The Optimum activity and stability of CHO from Streptomyces fradiae and

Brevibacterium sp.were rerpoted at 50°C and 53°C for 30 min. respectively by Yazdi M. et

al., 2001 and Fujishiro et al., 2002 [21,3].

Figure 1 Growth of isolate RO-3 on medium A and B.

Figure 2: Growth of RO-3 on Cholesterol oxidase indicator plates

Table 1: Morphological and colonial characteristics of RO-03.

Sample Isolate

No.

Medium Colony / growth

characteristics

Morphology Figure

waste of

regional

oil mill

RO-3

Medium B

Small, circular,

slightly elevated,

smooth opaque, non

pigmented colony

Gram positive, motile,

short coco bacilli rods

arranged in irregular

clumps.

Table 2: Biochemical and enzymatic properties of RO-3.

Test Result Test Result

Indole production Negative Maltose fermentation Positive

Methyl Red test Negative Mannitol fermentation Positive

Vogus Proskaur test Negative Xylose fermentation Positive

Citrate utilization test Positive Glucose fermentation Positive

Nitrate reduction reduction test Positive Catalase Positive Urease production test Negative Gelatinase Positive H2S production test Negative Oxidase Positive Lactose fermentation Positive Amylase and Lipase Negative Sucrose fermentation Positive Caseinase Positive




Table 3: Partial sequence of 16S rDNA of RO-3

Isolate

No.

16S rDNA Sequence

RO-3 >RO3

CATTTGAGTTTTAGCCTTGCGGCCGTACTCCCCCAGGCGGGGCACTTAATGCGTTAGCTACGGCGCGGA

AAACGTGGAATGTCCCCCCACACCTAGTGCCCAACGTTTACGGCATGGACTACCAGGGTATCTAATCCT

GTTCGCTCCCCATGCTTTCGCTCCTCAGCGTCAGTTAATGCCCAGAGACCTGCCTTCGCCATCGGTGTTC

CTCCTGATATCTGCGCATTTCACCGCTACACCAGGAATTCCAGTCTCCCCTACATCACTCTAGTCTGCCC

GTACCCACCGCAGATCCGGAGTTGAGCCCCGGACTTTCACGGCAGACGCGACAAACCGCCTACGAGCT

CTTTACGCCCAATAATTCCGGATAACGCTTGCGCCCTACGYMTTACCGCGGCTGCTGGCACGTAGTTAG

CCGGCGCTTCTTCTGCAGGTACCGTCACTTTCGCTTCTTCCCTACTGAAAGAGGTTTACAACCCGAAGGC

CGTCATCCCTCACGCGGCGTCGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCC

CGTAGGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCCGGTCACCCTCTCAGGCCGGCTACCCGTCGTC

GCCTTGGTAAGCCATTACCTCACCAACAAGCTGATAGGCCGCGAGTCCATCCAAAAACCACAATAAAG

CTTTCCACCCCCCACCATGCGATGAGGAGTCATATCCGGTATTAGACCCAGTTTCCCAGGCTTATCCCAG

AGTTAAAGGGCAGGTTACTCACGTGTTACTCACCCGTTTCGCCACTAATCCAGGAGCAAGCTCCCATCA

TCG

Figure 3: Phylogenetic tree showing position of isolate RO-3 with related organisms

based on 16S rDNA sequences. Scale bar represent 0.02 substitutions per nucleotide

position. E. coli was used as the out group. Bootstrap values are shown as percentages

on branches. Sequence accession numbers are listed in parentheses. The 16S rDNA

sequence of strain RO-3 was deposited in the NCBI database under the accession no.

KC415767.




4. CONCLUSION:

Cholesterol oxidase is an enzyme of great commercial value widely employed by laboratories

routinely devoted to the determination of cholesterol in food, serum and other clinical

samples. A diversity of micro-organisms, which are capable of producing high levels of this

enzyme have been reported. Our preliminary work led to the conclusion that Arthrobacter sp.

isolated from waste of regional oil mill might be considered as potentially interesting source

of extra cellular cholesterol oxidase for clinical and commercial purpose.

5. REFERENCES:

1. Murooka, Y., Ishizaki, T., Nimi, O. and Maekawa, N., (1986). Cloning and expres-

sion of a Streptomyces cholesterol oxidase gene in Streptomyces lividans with

plasmid pIJ 702, Appl Environ Microbiol., 52:. 1382-1385.

2. Yazdi, M. T., Yazdi, Z. T., Zarrini, Gh. and Ghasemian, A., (2008). Purification and

characterization of extra-cellular cholesterol oxidase from Rhodococcus sp. PTCC

1633, Biotechnology., 7 (4): 751-6.

3. Fujishiro, K., Uchida, H., Shimokava, K., Nakano, M., Sano, F., Ohta, T., Nakahara,

N. and Aisak, K.,Uwajima T., ( 2002) .Purification and properties of a new

Brevibacterium sterolicum cholesterol oxidase produced by E. coli MM294/pnH10,

FEMS. Microbiol. Lett., 215: 243–248.

4. Allain, C.C., Poon, L.S., Chan, C.S.G., Richmond, W. and Fu, P.C., (1974).

Enzymatic determination of total serum cholesterol, Clin. Chem., 20: 470- 475.

5. Ahmad, S., Garg, S.K. and Johri, B.N., ( 1992). Biotransformation of sterols: selective

cleavage of the side chain, Biotechnol., Adv. 10: 1–67.

6. Noma, A. and Nakayama, K., (1976).Comparative studies on cholesterol oxidases

from different sources, Clin. Chim. Acta., 73, 487–496.

7. Purcell, J.P., Greenplate, J.T., Jennings, M.G., Ryerse, J.S., Pershing, J.C., Sims S.R.,

Prinsen, M.J., Corbin, D.R., Tran, M and Sammons, R.D., (1993). Cholesterol

oxidase: a potent insecticidal protein active against boll weevil larvae, Biochem.

Biophys. Res. Commun., 196: 1406–1413.

8. Bell, K.S., Philp, J.C., Aw, D.W.J. and Christofi, N., (1998). A review of The genus

Rhodococcus, Department of Biological Science, Napier University, Edinburgh, UK

6545/01/98.

9. Yazdi1 M. T., Malekzadeh F. , Zarrini1 Gh., Faramarzi M.A. , Kamranpour N. and

Khaleghparast, Sh., (2001). Production of cholesterol oxidase by a newly isolated

Rhodococcus sp, World journal of microbiology and biotechnology, 17(7): 731-737.




10. Sojo M, Bru R, López-Molina D, García-Carmona F, Argüelles JC, (1997). Cell-

linked and extracellular cholesterol oxidase activities from Rhodococcus erythropolis.

Isolation and physiological characterization. Appl Microbiol Biotechnol, 47:583-589.

11. Lee, S. Y., Rhee, H. I., Tae, W. C., Shin, J . C. and Park B. K. ( 1989). Purification

and characterization of cholesterol oxidase from Pseudomonas sp. and taxonomic

study of the stain, Applied Microbiology and Biotechnology., 31: 542-546.

12. MacLachlan, J., Wotherspoon, A.T.L., Ansell, R.O. and Brooks, C.J.W. ,( 2000).

Cholesterol oxidase: sources, physical properties and analytical applications, J.

Steroid. Biochem. Mol. Biol,. 72: 169–195.

13. R. Kanchana, Delcy Correia, Sangeeta Sarkar, Prachi Gawde and Aifa Rodrigues,

(2011). Production and partial characterization of cholesterol oxidase from

Micrococcus Sp. Isolated from Goa, India. International Journal of Applied Biology

and Pharmaceutical Technology, 2: 393-398.

14. H. Lashkarian, J. Raheb, K. Shahzamani, H. Shahbani and M. Shamsaram (2010).

Extracellular Cholesterol Oxidase from Rhodococcus sp.: Isolation and Molecular

Characterization. Iran. Biomed. J, 14: 49-57.

15. Nishiya, Y., Harada, N., Teshima, S., Yamashita, M., Fujii, I., Hirayama, N. and

Murooka, Y. (1997).Improvement of thermal stability of Streptomyces cholesterol

oxidase by random muta- genesis and a structural interpretation, Protein

Engineering., 10: 231–235.

16. Ghasemian, A., Tabatabaei, Y.M., Sepehrizadeh, Z., Tabatabaei, Y.Z. and Zarrini,

G.H. ,(2009). Overexpression, one-step purification, and characterization of a type II

cholesterol oxidase from a local isolate Rhodococcus sp. PTCC 1633. World J.

Microbiol. Biotechnol. 25(5):773-77.

17. Drzyzga, O., J. M. Navarro Llorens, L. Ferna´ndez de las Heras, E. García

Ferna´ndez, and J. Perera.. ,(2011).Cholesterol Degradation by Gordonia

cholesterolivorans. Applied and Environmental Microbiology, 77 ( 14): 4802–4810.

18. Tamura et. al (2011). MEGA5: Molecular Evolutionary Genetics Analysis Using

Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods.

Mol. Biol. Evol. 28(10):2731–2739.

19. Tamura K, Nei M, Kumar S. ( 2004) . Prospects for inferring very large phylogenies

by using the neighbor-joining method. Proc Natl Acad Sci U S A. 101:11030–11035

20. Giovanni gadda et al. (1997). Characterization of cholesterol oxidase from

Streptomyces hygroscopicus and Brevibacterium sterolicum Eur. J. Biochem. 250,

3692376.

21. Yazdi M et al., (2001). Zahraei M, Aghaepour K, Kamranpour N (2001) Purification

and partial characterization of a cholesterol oxidase from Streptomyces fradiae.

Enzyme Microb Technol 8:410–414 .



Int. j. Adv. Lif. Sci., Available online on at www.

International Journal of Advanced Life Sciences (IJALS) ISSN

2277 – 758X

Parekh and Desai, IJALS, IJALS, Volume (6) Issue (2) Feb - 2013. RESEARCH ARTICLE

Int. J. Adv. Lif. Sci., Available online on at www. ijals.com

Page 1

`

Introduction

Cholesterol oxidase (EC1.1.3.6; CHO) catalyses

the first step of cholesterol degradation to 4-Charleston-

3-one with the reduction of oxygen at C-3 of hydrogen

peroxides. CHO is one of the key enzymes in microbial

sterol metabolism. The interest in this enzyme is due to

its industrial importance and its wide utilization in the

determination of cholesterol in blood serum and food

(Parra et al., 2007), and to its assumed potential in the

manufacture of diets with reduced cholesterol (Chenfeng

et al., 2002). Indeed, dietary cholesterol degradation is

considered as a means of protection against athero

sclerosis. Other possible applications of CHO are in the

production of precursors for the chemical synthesis of

pharmaceutical steroid hormones (Alexander et al.,

1995), and for its insecticidal activity that is vital for pest

control strategies employing transgenic crops (Shen

et al. 1997). CHO has been isolated from several microbial

sources, including species of Arthrobacter (Wenhsiung

et al., 1988), Bacillus (Kim et al., 2002), Brevibacterium

(Pornpen et al. 2006), Nocardia (Sojo et al., 1997),

Pseudomonas (Isobe et al., 2003), Rhodococcus (Elalami

et al., 1999), Streptomyces (Pornpen et al., 2006) and

Schizophyllum (Fukuyama et al., 1979). In this study,

CHO producing organisms were isolated from the waste

of a regional oil mill and characterize by microbiological

methods and evolutionary relationship with relevant

organisms were established.

Materials and Methods

Isolation of microorganisms

Cholesterol oxidase producing microorganisms

were isolated by following procedure : 1 gm of samples

Abstract

Cholesterol oxidase (EC1.1.3.6; CHO) is an enzyme, which catalyzes the oxidation of cholesterol and converts 5-cholesten-3β-ol into 4-cholesten-3-one. The objective of this study is to isolate extracellular cholesterol oxidase producing microorganisms to obtain an abundant source of cholesterol oxidase for industrial and medicinal needs. Cholesterol oxidase producing Microbacterium sp. was isolated from waste of regional oil mill. Twenty-five isolates were tested for cholesterol oxidase activity by screening method. As a result of the screening, isolate number RO-5 was identified as Microbacterium sp. by morphological, biochemical and molecular methods. A phylogenetic tree for the isolate was constructed by neighbor-joining method. Enzyme activity was measured by spectroscopic analysis.

Keywords: Microbacterium sp., enzyme, Cholesterol oxidase, 4-cholesten-3-one, phylogenetic, indicator plate and horseradish peroxidase,

Isolation and characterization of extracellular cholesterol oxidase producing Microbacterium sp. from waste of regional oil mill

S.N. Parekh and P.B. Desai

Department of Microbiology, Shree Ramkrishna Institute of Computer Education and Applied Sciences, Athawalines, Surat-395 001, Gujarat, India

Email : [email protected]

Corresponding Author S.N. Parekh

Department of Microbiology, Shree Ramkrishna Institute of Computer Education and Applied Sciences,

Athawalines, Surat-395 001, Gujarat, India

Email : [email protected] Article History

Received on 26 December, 2012; Revised in revised form 24 January, 2012; Accepted 8 February, 2013



2277 – 758X



Page 2

was suspended in 100 ml of distilled water. The

suspension was vigorously shaken for 30 min. A volume

of 100 µl of supernatant was inoculated in medium

(Medium - A) containing cholesterol as the sole carbon

source. A medium contained (gm/l): agar, 3.0 %;

K2HPO4, 0.25; NH4NO3, 17; MgSO4. H2O 0.25%; FeSO4,

0.001; NaCL, 0.005; cholesterol, 0.1% and Tween 80,

0.5 ml. The pH of the medium was adjusted to 7.0. The

inoculated plates were incubated at 30oC for 7- 12 days.

After incubation period was completed, abscission

colonies were appearing on the plate surface. For fast

growing and generating, larger colonies were sub cultured

in secondary medium (Medium - B) containing cholesterol

as the only source of carbon as well as yeast extract

(Yazdi1 et al., 2001, Lashkarian, 2010). This medium

contained yeast extract, 0.3 gm; (NH4)2HPO4, 0.1 gm;

cholesterol, 0.15; Tween 80, 0.05 ml; pH – 7; agar, 3.0

% and distilled water, 100 ml. Each colony on medium

A was cultured in medium B and incubated at 30oC for

24 hrs. Then, larger colonies generated on medium B were

used for further identification (Yazdi1 et al., 2001).

Screening of CHO is producing organism

CHO is able to convert Cholesterol into Cholest -

4-en-3-one and hydrogen peroxide. CHO producing

colonies were selected on cholesterol oxidase indicator

plates. These plates were prepared by adding 1.0 gM.

Cholesterol, 1.0 GM. O-dianisidine and 1000 Units of

peroxide to 1 liter of agar medium. Bacterial colonies

were cultured on these plates and incubated at 30°C.

Cholesterol penetrates into bacterial cells where it can

be converted into hydrogen peroxide by Cholesterol

oxidase. Reagents that exist in the medium react with

hydrogen peroxide (H2O2) to form azo compound which

turns the color of medium into intense brown color

(Ghasemian et al., 2009 and Drzyzga, 2011).

Identification of isolates

Primary identification of isolates was carried out

by studying their morphological, cultural and biochemical

characteristics by standard method. The phylogenetic

analysis of isolate was carried out on the basis of 16S

ribosomal DNA (RDNA) partial sequences. The results

of primary identification and 16S rDNA sequences

were used to identify the isolates. Bergey’s manual of

systematic bacteriology, 2nd edition was used to identify

bacterial isolates.

Taxonomic studies of the isolates was carried

out by 16S rDNA partial sequencing at Microbial culture

collection, National center for cell science, Pune university

campus, Pune 400011, India. The 16S rDNA was amplified

using 8F 5’ AGAGTTTGATCCTGGCTCAG-3’ and

907R 5’- CGTCAATTCMTTTRAGTTT-3’ as forward

and reverse primer respectively. The nucleotide sequence

of related organisms used for alignment and for

calculating the homology level was obtained from the

NCBI (National Center for Biotech- nology Information)

database and ClustalW2 programme- was used to align

the sequences. The phylogenetic tree was constructed

using MEGA 5.1 software using neighbor-joining

method (Tamura et al., 2011). Bootstrap analysis was

carried out to assess the reliability of phylogenetic tree

by the same software. 16S rDNA sequence of isolate

was deposited in NCBI database and received accession

number.

Determination of CHO activity

CHO activity was measured by centrifuge the

medium at 10,000 rpm for 20 min. at 4oC by modified

method based on the study of Allain et al. (1974) and

MacLachlan et al. (2000). In this reaction, hydrogen

peroxide generated during Cholesterol oxidation process

was coupled with 4-aminoantipyrine and phenol by

peroxidase to produce quinoneimine dye with maximum

absorption in 500nm. The reaction mixture was consisted

of 1mM 4-aminoantipyrine , 5 mM phenol, 5 U/ml of

horseradish peroxide and sodium phosphate buffer (20

mm, pH 7.0). 50 µL of 6 g/L Cholesterol dissolved in

dimethyl formamide containing 5% (v/v) Triton X-100



2277 – 758X



Page 3

was added to 1ml of reaction mixture, Which was then

pre-incubated for 3 min. at 30°C. The reaction was

initiated by adding 50 µL of enzyme sample and was

continued for 5 min at 30°C. The assay mixture was

boiled in a water bath for 2 min. to stop the reaction,

and then place in an ice bath for 2 min. Absorbance of

the reaction solution was monitored at 500 nm.

(Systronic 2203, Japan). The assay mixture containing

inactivated enzyme was used as the blank. One unite of

CHO activity was defined as the amount of enzyme that

converts 1µmol of cholesterol in to 4-cholesten - 3 -

one per minute at 30°C.

Results and Discussion

69 samples of waste of regional oil mill were

collected. 20 isolates were obtained from these samples

on their capability on growing on isolation medium A

containing cholesterol as the sole carbon source.

Figure - 1 shows the growth of isolate RO-5 on medium

A and B. RO-5 was found to secrete extracellular CHO

were detected by cholesterol oxidase indicator plate

(Fig.-2). The result of microscopic observation and

growth characteristics of these isolates is shown in table-1.

The results of biochemical and enzymatic properties

were shown in table - 2. The cells of RO-5 were gram

positive short rods. The partial sequence of 16S rDNA

(835 bp) is shown in table 3 of RO-5. Which shows

99% identity with 16S rDNA partial sequence of

Microbacterium paraoxydans CF 36 and Microbacterium

maritypicum DSM 12512 (NCBI accession No. NR

025548 & NR 042351 respectively) (Fig.- 3) . RO-5 was

identified as Microbacterium sp. from their gram staining,

morphological, biochemical and molecular characteristics.

Extra cellular CHO activity of RO-5 was found to be

1.02 units/ml and measured by harvesting the cells

grown in the medium B on rotary shaker at 150 rpm

and 30oC for 72 hrs. In contrast, Chengtao et al. (2005)

reported extracellular CHO production of Rhodococcus sp.

R14-2 is about 1.5 U/ml where as CHO production from

Rhodococcus sp. GKI (Elalami et al. 1999) is 0.38

U/ml after 90 h cultivation.

Table – 1. Morphological and colonial characteristics of RO-5

Sample Isolate No. Medium Colony / growth

characteristics Morphology Figure

Waste of regional oil

mill RO-5

Medium B

Small, round, raised, glistening, opaque, lemon yellow color pigmented colony

Gram positive, non motile, Short rods.

Table – 2. Biochemical and enzymatic properties of RO-5.

Test Result Test Result

Indole production Negative Maltose fermentation Acid

Methyl Red test Negative Mannitol fermentation Negative

Vogus Proskaur test Negative Xylose fermentation Negative

Citrate utilization test Positive Glucose fermentation Acid

Nitrate reduction reduction test Negative Catalase Positive



2277 – 758X



Page 4

Fig – 2. Growth of RO-5 on Cholesterol oxidase indicator plates

Urease production test Negative Gelatinase Negative

H2S production test Positive Oxidase Positive

Lactose fermentation Positive Amylase and Lipase Negative

Sucrose fermentation Positive Caseinase Negative

Table - 3. Partial sequence of 16S rDNA of RO-5

Isolate No.

16S rDNA Sequence

RO-5 >RO-5 TGATCCTGGCTCAGGATGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGGTGAACACGGAGCTT GCTCTGTGGGATCAGTGGCGAACGGGTGAGTAACACGTGAGCAACCTGCCCCTGACTCTGGGATAAGCGC TGGAAACGGCGTCTAATACTGGATATGTGACGTGACCGCATGGTCTGCGTTTGGAAAGATTTTTCGGTTG GGGATGGGCTCGCGGCCTATCAGCTTGTTGGTGAGGTAATGGCTCACCAAGGCGTCGACGGGTAGCCGGC CTGAGAGGGTGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAGTGGGGAA TATTGCACAATGGGCGGAAGCCTGATGCAGCAACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACC TCTTTTAGCAGGGAAGAAGCGAAAGTGACGGTACCTGCAGAAAAAGCGCCGGCTAACTACGTGCCAGCAG CCGCGGTAATACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTC GCGTCTGCTGTGAAATCCCGAGGCTCAACCTCGGGCCTGCAGTGGGTACGGGCAGACTAGAGTGCGGTAG GGGAGATTGGAATTCCTGGTGTAGCGGTGGAATGCGCAGATATCAGGAGGAACACCGATGGCGAAGGCAG ATCTCTGGGCCGTAACTGACGCTGAGGAGCGAAAGGGTGGGGAGCAAACAGGCTTAGATACCCTGGTAGT CCACCCCGTAAACGTTGGGAACTAGTTGTGGGGTCCATTCCACGGATTCCGTGACGCAGCTAACG

Fig – 1. Growth of isolate RO-5 on medium A and B.

A B


International Journal of Advanced Life Sciences (IJALS)

Parekh and Desai, IJALS, IJALS,


Conclusion

Cholesterol oxidase is an enzyme of great

commercial value widely employed by laboratories

routinely devoted to the determination of cholesterol in

food, serum and other clinical samples. A diversity of

micro-organisms, which are capable of producing high

levels of this enzyme have been reported.

work led to the conclusion that Microbacterium

isolated from waste of regional oil mill might be a

promising source of extra cellular cholesterol oxidase

for clinical and commercial purpose.

Reference

Alexander, D.L. and Fisher, F. 1995. A convenient

synthesis of 7a-hydroxycholest-4-

hydroxyl-propyl-b-cyclodextrin-facilitated cholesterol

oxidase oxidation of 3b, 7acholest

Steroids., 60 : 290 – 294.

Fig. – 3. Phylogenetic tree showing position of isolate ROsequences. Scale bar represent 0.02 substitutions per nucleotide position. E. coli was used as the out group.

Bootstrap values are shown as percentages The 16S rDNA sequence of strain RO

database under the accession no. KC415768.


International Journal of Advanced Life Sciences (IJALS)

IJALS, Volume (6) Issue (2) Feb - 2013. RESEARCH ARTICLE

. Adv. Lif. Sci., Available online on at www. ijals.com

Cholesterol oxidase is an enzyme of great

commercial value widely employed by laboratories

devoted to the determination of cholesterol in

food, serum and other clinical samples. A diversity of

organisms, which are capable of producing high

levels of this enzyme have been reported. Our preliminary

Microbacterium sp.

isolated from waste of regional oil mill might be a

promising source of extra cellular cholesterol oxidase

F. 1995. A convenient

-en-3-one by the

facilitated cholesterol

7acholest-5- en-3,17 -diol.

Allain, C.C., Poon, L.S., Chan, C.S.G., Richmond, W.

and Fu, P.C. 1974. Enzymatic determination of

total serum cholesterol,

Chenfeng, L., Yixin, T.

Yili, C. and Shengli

cholesterol by extracellular cholesterol oxides from

Brevibacterium Sp.

Chengtao, W., Baoping

Optimization and kinetic analysis of cholesterol

oxidase production by Rhodococcus sp. R14

submerged cultures.

- 2157.

Drzyzga, O., Navarro Llorens,

L. Heras., García Fernańdez,

2011. Cholesterol Degradation by

cholesterolivorans.

Microbiolog.,, 77 ( 14): 4802

Phylogenetic tree showing position of isolate RO-5 with related organisms based on 16S rDNA sequences. Scale bar represent 0.02 substitutions per nucleotide position. E. coli was used as the out group.

Bootstrap values are shown as percentages on branches. Sequence accession numbers are listed in parentheses. The 16S rDNA sequence of strain RO-5 was deposited in the NCBI

database under the accession no. KC415768.

ISSN

2277 – 758X

RESEARCH ARTICLE

Page 5

Allain, C.C., Poon, L.S., Chan, C.S.G., Richmond, W.

nd Fu, P.C. 1974. Enzymatic determination of

total serum cholesterol, Clin. Chem., 20 : 470- 475.

., Longgang, W., Wenming, J.,

Shengli, Y. 2002. Bioconversion of yolk

cholesterol by extracellular cholesterol oxides from

Brevibacterium Sp. Food Chem., 77: 457-463.

, Baoping, J. and Yonghuan, Z. 2008.

Optimization and kinetic analysis of cholesterol

oxidase production by Rhodococcus sp. R14–2 in

submerged cultures. Food Ferment Ind., 24 : 2149

O., Navarro Llorens, J.M., Fernańdez de las,

García Fernańdez, E. and Perera, J.

Cholesterol Degradation by Gordonia

. Applied and Environmental

77 ( 14): 4802–4810.

5 with related organisms based on 16S rDNA sequences. Scale bar represent 0.02 substitutions per nucleotide position. E. coli was used as the out group.

on branches. Sequence accession numbers are listed in parentheses. 5 was deposited in the NCBI



2277 – 758X



Page 6

Elalami, A., Kreit, J. and Filali-Maltouf, A. 1999.

Characterization of a secreted cholesterol oxidase

from Rhodococcus sp. GKI (CIP 105335). World

J. Microbiol. Biotechnol., 15(5): 579 – 585.

Fukuyama, M. and Miyake, Y. 1979. Purification and

some properties of cholesterol oxidase from

Schizophyllum commune with covalently bound

flavin. Tokyo. J. Biochem ., 85(5):1183–1193.

Ghasemian, A., Tabatabaei, Y.M., Sepehrizadeh, Z.,

Tabatabaei, Y.Z. and Zarrini, G.H. 2009. Over

expression, one-step purification, and characterization

of a type II cholesterol oxidase from a local isolate

Rhodococcus sp. PTCC 1633. World J. Microbiol.

Biotechnol. 25(5):773-77.

Isobe, K., Shoji, K. and Nakanishi, Y.2003. Purification

and some properties of cholesterol oxides stable in

detergents from γ- Proteobacterium Y134. J.

Biosci Bioeng., 9(3) : 257 – 263.

Kim, K.P., Rhee, C.H. and Park, H.D.2002.

Degradation of cholesterol by Bacillus subtilis

SFF34 isolated from Korean traditional fermented

flatfish. Lett. Appl. Microbiol., 35(6) :468 – 472.

Lashkarian, H., Rehab, J., Shahzamani, K., Shahbani,

H. and Shamsaram, M.2010. Extracellular Cholesterol

Oxidase from Rhodococcus Sp.: Isolation and

Molecular Characterization. Iran. Biomed. J., 14 :

49 - 57.

MacLachlan, J., Wotherspoon, A.T.L., Ansell, R.O. and

Brooks, C.J.W. 2000. Cholesterol oxidase: sources,

physical properties and analytical applications, J.

Steroid. Biochem. Mol. Biol,. 72: 169–195.

Parra, A., Casero, E., Pariente, F., Va´zquez, L. and

Lorenzo E.2007. Bioanalytical device based on

cholesterol oxidase-bonded SAMmodified electrodes.

Anal. Bioanal. Chem., 388 (5 - 6): 1059 – 1067.

Pornpen, S., Jearanaikoon, P., Nuanchawee, W.,

Busarawan, S. and Martin, H. 2006. Application

of Streptomyces and Brevibacterium cholesterol

oxidase for total serum cholesterol assay by the

enzymatic kinetic method. Clin Chim Acta., 372 :

103 – 111.

Shen, Z., Corbin, D.R., Greenplate, J.T., Grebenok, R.J.

and Galbraith, D.W. 1997. Studies on the mode of

action of cholesterol oxides on insect midgut

membranes. Arch Insect Biochem., 34: 429 – 442.

Sojo, M., Bru, R., Lopezmolina, D., Garciacarmona, F.

and Arguelles, J.C. 1997. Cell-linked and extra-

cellular cholesterol oxidase activities from Nocardia

erythropolis: isolation and physiological characteri-

zation. Appl Microbiol Biotechnol., 47(5): 583 – 589.

Tamura, K., Peterson, D., Peterson, N., Stecher, G.,

Nei, M. and Kumar, S. 2011. MEGA5: molecular

evolutionary genetics analysis using maximum

likelyhood, evolutionary distance, and maximum

parsimony methods. Mol. Biol. Evol., 28(10) :

2731 - 9.

Wenhsiung, L., Menghsiao, M. and Kaidshun, C. 1988.

Purification and some properties of cholesterol

oxidases produced by an inducible and a

constitutive mutant of Arthrobacter simplex. Agric

Biol. Chem., 52(2) :413 - 418.

Yazdi1, M.T., Malekzadeh, F., Zarrini1 GH., Faramarzi,

M.A., Kamranpour, N. And Khaleghparast, SH.

2001. Production of cholesterol oxidase by a

newly isolated Rhodococcus sp, World journal of

microbiology and biotechnology., 17(7): 731-737.

Corresponding Author : S.N. Parekh, Department of Microbiology, Shree Ramkrishna Institute of Computer Education and Applied Sciences, Athawalines, Surat - 395 001, Gujarat, India. Email : [email protected], ©2013, IJALS. All Rights Reserved.

publications presentations -...

Documents