e at SciVerse ScienceDirect

Theriogenology 79 (2013) 660–666

Contents lists availabl

Theriogenology

journal homepage: www.theriojournal .com

Production of cloned embryos from caprine mammary epithelial cellsexpressing recombinant human b-defensin-3

Jun Liu, Yan Luo, Qingqing Liu, Liming Zheng, Zhongcai Yang, Yongsheng Wang, Jianmin Su,Fusheng Quan, Yong Zhang*

College of Veterinary Medicine, Northwest A&F University, Key Laboratory of Animal Biotechnology of the Ministry of Agriculture, Yangling, Shaanxi, China

a r t i c l e i n f o

Article history:Received 22 July 2012Received in revised form 20 November 2012Accepted 25 November 2012

Keywords:Transgenic goatMammary epithelial cellHuman b-defensin-3Somatic cell nuclear transfer

* Corresponding author. Tel.:þ86 029 87080085; faE-mail address: zhangylab@yahoo.com.cn (Y. Zh

0093-691X/$ – see front matter � 2013 Elsevier Inchttp://dx.doi.org/10.1016/j.theriogenology.2012.11.02

a b s t r a c t

Transgenic animals that express antimicrobial agents in their milk can inhibit bacterialpathogens that cause mastitis. Our objective was to produce human b-defensin-3 (HBD3)transgenic embryos by nuclear transfer using goat mammary epithelial cells (GMECs) asdonor cells. Three GMEC lines (GMEC1, GMEC2, and GMEC3) were transfected with a HBD3mammary-specific expression vector byelectroporation. Therewas a difference (P< 0.05) inthe rate of geneticin-resistant colony formation among cell lines GMEC1, GMEC2, andGMEC3 (39 and 47 vs. 19 colonies per 3 � 106 cells, respectively). After inducing expression,the mRNA and protein of HBD3 were detected by reverse transcription polymerase chainreaction and Western blot analysis in transgenic cells. Transgenic clonal cells expressingHBD3wereused as donor cells to investigate development of cloned embryos. Therewere nosignificant differences in rates of cleavage or blastocyst formation of cloned embryos fromtransgenic (GMEC1T2 and GMEC2T3) and nontransgenic (GMEC1 and GMEC2) GMECs (72.3� 5.0%, 69.5� 2.3%, 61.8� 4.8%, and 70.0� 2%; and 16.8� 0.5%,17.5� 0.7%,16.7� 0.9%, and17.5 � 0.6%, respectively). However, the fusion rate, cleavage rate, and blastocyst formationrate of cloned embryos from a transgenic clonal cell line (GMEC2T6, 50.7� 2.1%, 55.5� 2.0%,and 11.1� 0.6%)were lower than those of other groups (P< 0.05).We concluded that geneticmodification of GMECs might not influence the in vitro development of cloned embryos, butthat some of the transgenic clonal cells were not suitable for nuclear transfer to producetransgenic goats, because of low developmental rates. However, transgenic GMECsexpressing HBD3 might be used as donor cells for producing transgenic goats that expressincreased concentrations of b-defensins in their milk.

� 2013 Elsevier Inc. All rights reserved.

1. Introduction

Human b-defensin-3 (HBD3), a kind of antimicrobialpeptide, is widely expressed in many tissues [1,2]. Humanb-defensin-3 has broad-spectrum antimicrobial activityagainst bacteria, fungi, and enveloped viruses, and has animportant role in immunity [3]. In previous studies,transgenic livestock expressing some kinds of antimicrobialpeptides in milk inhibited bacterial pathogens causing

x:þ86 029 87080085.ang).

. All rights reserved.1

mastitis [4–6]. Therefore, HBD3 might be a candidate genefor enhancing mastitis resistance. In addition, recombinantHBD3 purified from the milk might be useful for medicalresearch and clinical applications.

Somatic cell nuclear transfer (SCNT) is an efficientmethod for producing recombinant therapeutic proteins inthe milk of transgenic animals. Because fetal fibroblast cellsgrow rapidly and have more proliferative ability, they havebeen commonly used as sources of donor nuclei to producetransgenic animals [7–11]. However, mammary-specificexpression vectors cannot be evaluated in transgenicfibroblast cells. Therefore, if the transgene is integrated ina transcriptionally silent region of chromatin, it will not be

Fig. 1. Schematic representation of the recombinant plasmid pEBB. The pEBB plasmid was constructed by inserting the 2.2 kb promoter region (C5, including the1.7 kb 50-flanking sequence, exon 1 and part of intron 1) and 0.6 kb 30-untranslated region (C3, including part of the last intron and exon) of the bovine beta-casein gene (GenBank: X14711), and 1156 base pair (bp) human b-defensin-3 DNA sequence (GenBank: 55894) into a pEGFP-C1 plasmid.

J. Liu et al. / Theriogenology 79 (2013) 660–666 661

expressed correctly in transgenic animals, (so-called chro-mosomal position effect [12–14]). Mammary epithelial cells(MECs) can be used as a model for directly monitoring theexpression of mammary-specific vector before SCNT [15].The use of genetically modified MECs expressing highlevels of recombinant protein for SCNT will produce highlevels of the recombinant protein in the milk of transgeniccloned offspring. Moreover, a previous study indicated that

Fig. 2. Isolation and transfection of goat mammary epithelial cells (GMECs). (A) GMcytokeratin 18 (green) and nuclei labeled with 40 ,6-diamidino-2-phenylindole (bluegreen fluorescent protein under a bright field (C1) and fluorescence (C2) (magnipolymerase chain reaction. M represents the DNAmarker; lane 1, plasmid pEBB (poscell lines (GMEC1T2, GMEC1T3, GMEC2T3, GMEC2T5, and GMEC2T6).

goat MECs at 25 to 27 passages can support cloned embryodevelopment to term [16]. However, little is known aboutthe developmental competence of cloned embryos derivedfrom genetically modified MECs.

Our objective was to establish an upstream system forproducing increased expression of HBD3 in the milk oftransgenic goats. Goat MECs were transfected with a HBD3expression vector by electroporation. The transgenic clonal

ECs at passage 1 (magnification �40). (B) Immunofluorescence staining of) (magnification �100). (C) Geneticin-resistant colony expressing enhancedfication �100). (D) Amplification of the human b-defensin-3 transgene byitive control); lane 2, GMECs (negative control); lanes 3 to 7, transgenic clonal

J. Liu et al. / Theriogenology 79 (2013) 660–666662

cells expressing HBD3 were used as donor cells to investi-gate development of cloned embryos.

2. Materials and methods

Unless otherwise indicated, all chemicals and reagentswere purchased from Sigma Chemical Company (St. Louis,MO, USA), and the culture media and fatal bovine serum(FBS) used in preparation of donor cells were obtained fromGibco (Grand Island, NY, USA). All trials were conducted inaccordance with the Guidelines for the Care and Use ofAnimals of College of Veterinary Medicine, Northwest A&FUniversity.

2.1. Isolation of goat mammary epithelial cells

Goat mammary epithelial cells (GMECs) were isolatedfrom the mammary gland of a lactating Saanen dairy goat,as described [15]. Mammary tissues were cut into 1 mm3

pieces and washed with Dulbecco’s phosphate bufferedsaline solution several times. Then the explants wereplaced in 60-mm culture dishes with 1 mL culture medium(Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12[1:1] with 10% FBS and 10 ng/mL EGF and 1% insulin,transferrin, and sodium selenite solution [ITS Liquid MediaSupplement] plus 200 IU/mL penicillin and 200 mg/mLstreptomycin). The next day, 3 mL culture medium wasadded and changed every 3 days. In primary culture,fibroblasts and mammary epithelial cells appeared inculture dishes. However, there was a clear line betweenfibroblasts andmammary epithelial cells, so that fibroblastscould be removed with a cell scraper. Mammary epithelialcells were detached with 0.25% trpysin-0.02% EDTA andtransferred into 60-mm culture dishes. The first passageGMECs were used for immunofluorescence staining ofcytokeratin 18 according to a previous study [17]. The puremammary epithelial cells were used for transfection.

2.2. Transfection and selection of GMECs

The mammary-specific expression plasmid pEBB con-tained 2.2 kb promoter region bovine beta-casein gene and0.6 kb 30-untranslated region (GenBank: X14711), 1156 basepair (bp) HBD3 DNA sequence (GenBank: 55894), selectedgene Neo, and reporter gene enhanced green fluorescentprotein (EGFP) (Fig. 1). Goat mammary epithelial cellsgrown to 70% to 80% of confluence were digested by 0.25%trypsin-EDTA and washed with 4 mL Opti-MEM (Invi-trogen). The cells were resuspended in electroporationbuffer (BTX) and 20 mg/mL plasmid DNA was added. Then

Table 1Transfection efficiency of pEBB in various GMECs.

Cell lines Cells transfected, N Geneticin-positive colonies, N

GMEC1 3 � 106 39a

GMEC2 3 � 106 47a

GMEC3 3 � 106 19b

Abbreviation: GMECs, goat mammary epithelial cells.a,b Within a column, means without a common superscript differed (P < 0.05

200 mL transfection media was added into a 2-mm gapelectroporation cuvette and transfected by BTX Electro cellmanipulator system 2001 (180 V, 15 ms, 1 pulse). The cellsuspension was carefully transferred from the cuvette intoa 90 mm culture dish, and 10 mL culture medium wasadded. After 24 hours, the cells were exposed to 400 mg/mLof geneticin (G418) for 7 days, and after that 200 mg/mL ofG418 was used during the selection process to obtain cellcolonies. Only EGFP-positive epithelial clonal cells werepicked up, expanded, and frozen.

2.3. Detection of transgene integration by PCR

Genomic DNA from GMECs and transgenic clonal cellswas extracted, and polymerase chain reaction (PCR)amplification was performed using one set of primers thatamplified 1156 bp HBD3. The PCR primer sequences were50AGCAGCTATGAGGATCCATTATCTT30 and 50TCTAGATTTTATTTCTTTCTTCGGCATT30 (Fig. 1, P1 and P2). The PCR ampli-fication conditions were 94 �C for 5 minutes, then 94 �C for30 seconds, 58 �C for 30 seconds, 72 �C for 1minute, 72 �C for7 minutes, and 4 �C for 1 hour. A total of 31 cycles wereperformed. After amplification, products were analyzed ona 1% agarose gel stained with ethidium bromide.

2.4. Chromosome analysis

The number of chromosomes in the transgenic cellclones was determined by standard techniques. Briefly,actively dividing cells were synchronized with 0.05 mg/mLof colcemid for 4 to 6 hours. The cells were harvested andincubated with 6 mL hypotonic solution (0.075 mol/L KCl)for 20 minutes at 38 �C, then 1 mL fixative solution(methanol:acetic acid 3:1) was added and centrifugedimmediately. Cells were resuspended in fixative solutionfor 2 hours. The cells were spread onto slides and stainedfor 15 minutes with 2% Giemsa at room temperature.Images of chromosomal spreads were taken using brightfield microscopy with a 100� objective. More than 30metaphase chromosome spreads were analyzed in eachcell line. Cells with 60 chromosomes were classified asnormal cells.

2.5. In vitro-induced expression of HBD3 transgene intransfected GMECs

When transfected GMECs had grown to 80% confluence,the culture medium was replaced by inductive medium(DMEM/F12 with 10 ng/mL EGF and 1% ITS LiquidMedia Supplement and 5 mg/mL prolactin and 1 mg/mL

Enhanced green fluorescentprotein-positive colonies, N (%)

Expanded colonies/coloniespicked up, N

11 (27.8 � 1.8)a 2/714 (29.5 � 0.2)a 3/126 (30.3 � 5.3)a 0/5

).

Fig. 3. Expression of human b-defensin-3 (HBD3) in transgenic goatmammary epithelial cells (GMECs). mRNA expression of HBD3 (A) andb-casein (B) in transgenic and nontransgenic cells were measured by reversetranscription polymerase chain reaction. M represents the marker; lane 1,nontransgenic cells; lanes 2 to 4, transgenic cells (GMEC1T2, GMEC2T3, andGMEC2T6). Protein expression of HBD3 (C) and b-casein (D) were detectedby Western blot analysis. Lane 1 shows HBD3 standard (positive control);lane 2, nontransgenic cells (negative control); and lanes 3 to 5, transgeniccells (GMEC1T2, GMEC2T3, and GMEC2T6).

J. Liu et al. / Theriogenology 79 (2013) 660–666 663

hydrocortisone). Concomitantly, the nontransgenic GMECswere cultured in the same medium as controls. After 24-hour induction, the cells and supernatants were collectedand used to analyze the expression of HBD3 transgene.

Total RNA of the cells was extracted with Trizol reagent(Invitrogen) according to the manufacturer’s protocol. ThePrimeScript RT Reagent Kit (TaKaRa) was used to synthe-size cDNA. The mRNA expression of HBD3 (210 bp) wasamplified by PCR using the primers 50AGCAGCTATGAGGATCCATTATCTT30 and 50TCTAGATTTTATTTCTTTCTTCGGCATT30,and the b-casein mRNA (278 bp) as an internal control (theprimers 50AGCGGGAAATCGTCCGTGAC30 and 50CCGTGTTGGTAGAGGT30). Nontransgenic GMECs were used as negativecontrols.

The supernatants after inductionwere concentrated andsubjected to Western blot analysis by standard protocol.The 1mLmediawas freeze-dried and dissolved in 200 mL ofsodium dodecyl sulfate sample buffer, and 15 mL of eachsample was separated on a 17.5% Tricine/SDS-PAGE.Proteins were transferred onto polyvinylidene-fluoridemembranes in a Bio-Rad Trans-Blot Cell (Bio-Rad,Hercules, CA, USA). After blocking, the membranes werereacted with rabbit anti-HBD3 antibody (Sigma) at a 1:100dilution, and then incubated in alkaline phosphataseconjugated goat anti-rabbit IgG (Beyotime Institute ofBiotechnology, Shanghai, China) at a 1:1000 dilution.Membranes were washed extensively and exposed toKodak XBT-1 film in a dark room. HBD3 standard productwas used as a positive control.

2.6. Nuclear transfer

The nuclear transfer (NT) procedures were performed aspreviously described by our lab [18,19]. Goat mammaryepithelial cells at 4 to 6 passages and transgenic GMECsafter expansion in culture, which grew to 100% confluencefor 2 to 4 days, were used as donor cells for NT. Briefly,oocytes with the first polar body were selected forenucleation after 22 to 24 hours of in vitro maturation. Thepolar body and the metaphase plate were removed, andthen a single round donor cell was injected into the peri-vitelline space of each enucleated oocyte. The karyoplast-cytoplast couplets were fused by electrofusion. Coupletswere incubated for 2 to 3 hours in TCM-199 supplementedwith 10% FBS and 7.5 mg/mL cytochalasin B. The fusedembryos were activated by 5 mM ionomycin and 2 mM6-dimethylaminopurine. After activation, embryos werewashed extensively and cultured in 200 mL modifiedsynthetic oviduct fluid mediumwith 10% FBS covered withmineral oil at 38.5 �C, 100% humidity, and 5% CO2 in air. Theembryos were cultured in modified synthetic oviduct fluidmedium for 7 days to evaluate developmental rate.

2.7. Statistical analysis

All experiments were replicated at least three times. Alldata were analyzed using SPSS 16.0 statistical software(IBM Corporation, Somers, NY, USA). Data were tested byone-way ANOVA and least-significant difference tests, andreported as mean � SEM. For all analyses, P < 0.05 wasconsidered significant.

3. Results

3.1. Introduced pEBB plasmid into GMECs

Three GMEC lines (GMEC1, GMEC2, and GMEC3) wereobtained from the fresh biopsy of different dairy goats.After removing the fibroblasts with a cell scraper, most ofthe cells were epithelial-like cells in the first passage

Table 2In vitro development of cloned embryos from transgenic clonal cells.

Donor cell Fused embryos, N (%)a Cleaved embryos, N (%)b Blastocysts, N (%)c Enhanced green fluorescentprotein-positive blastocysts, N (%)

GMEC1 154/215 (71.7 � 3.6)d 113 (72.3 � 5.0)d 26 (16.8 � 0.5)d 0GMEC2 160/228 (70.2 � 1.8)d 111 (69.5 � 2.3)d 28 (17.5 � 0.7)d 0GMEC1T2 189/290 (64.4 � 2.9)e 120 (61.8 � 4.8)d,e 31 (16.7 � 0.9)d 27 (86.6 � 3.1)d

GMEC2T3 201/274 (73.2 � 1.2)d 142 (70.0 � 2.6)d 35 (17.5 � 0.6)d 30 (86.0 � 1.4)d

GMEC2T6 126/250 (50.7 � 2.1)f 70 (55.5 � 2.0)e 14 (11.1 � 0.6)e 12 (85.0 � 7.6)d

GMEC1 and GMEC2 are nontransgenic cell lines.Abbreviation: GMEC, goat mammary epithelial cell.

a Fusion rate ¼ fused embryos/couplets.b Cleavage rate ¼ cleaved embryos/fused embryos.c Blastocyst rate ¼ blastocysts/fused embryos.d–f Within a column, means without a common superscript differed (P < 0.05).

J. Liu et al. / Theriogenology 79 (2013) 660–666664

(Fig. 2A). The GMECs were positive for immunofluores-cence staining of cytokeratin 18 (Fig. 2B). Three GMEC lineswere transfected by electroporation; 1 � 106 cells wereused each time (repeated three times). The efficiencies ofcolony formation, EGFP expression, and expanded cultureare shown (Table 1). The number of G418 resistant coloniesin groupsGMEC1 andGMEC2weremore than groupGMEC3(39 and 47 vs. 19; P < 0.05). When examined under anultraviolet/fluorescein isothiocyanate filter, there were nosignificant differences in the percentage of coloniesexpressing EGFP among the different cell lines (Fig. 2C). Thecolonies in each cell line were picked up and expanded toapproximately 2 � 106 cells. The percentage of expandedcolonies was low in all three cell lines.

After expanded culture, a portion of clonal cells wasfrozen andusedasdonor cells for SCNT, and the otherportionwas passaged routinely to determine the chromosomenumber and integration of the transgene. The percentage ofcells with normal chromosomal number (2n¼ 60) in the fivecell clones (GMEC1T2, GMEC1T3, GMEC2T3, GMEC2T5, andGMEC2T6) were similar (67.3%, 68.5%, 71.6%, 62.5%, and69.7%, respectively) to those in GMEC1 and GMEC2 (68.9%and 73.8%). Amplification with PCR verified that the trans-gene was stably integrated into the genome of transgenicGMECs (Fig. 2D).

3.2. Expression of HBD3 transgene in transfected GMECs

Three transgenic clonal cells (GMEC1T2, GMEC2T3,and GMEC2T6) were induced expression; expression of

Fig. 4. Cloned embryos expressed enhanced green fluorescent protein u

the HBD3 transgene is shown (Fig. 3). Human b-defensin-3 mRNA was present in the transgenic clonal cells, butnot in nontransgenic cells (Fig. 3A). In addition, Westernblot analysis confirmed that the recombinant HBD3 wasonly present in the supernatants of transgenic clonal cellsrather than in nontransgenic cells (Fig. 3C). The expres-sion of b-casein gene mRNA and protein were presentboth in transgenic and nontransgenic cells, used as aninternal control (Fig. 3B and D). We concluded that thetransgenic GMECs expressed recombinant HBD3, but thequantity of the protein was variable among transgenicclonal cells.

3.3. In vitro development of cloned embryos from transgenicGMECs expressing HBD3

After comprehensive examination, transgenic clonal celllines (GMEC1T2, GMEC2T3, and GMEC2T6) expressingHBD3 were used as donor cells to evaluate in vitro devel-opment of cloned embryos (Table 2). Nontransgenic cells(GMEC1 and GMEC2) were used as controls. There were nosignificant differences in cleavage rate and blastocystformation rate among groups GMEC1, GMEC2, GMEC1T2,and GMEC2T3 (72.3 � 5.0%, 69.5 � 2.3%, 61.8 � 4.8%, and70.0 � 2.6%, respectively; and 16.8 � 0.5%, 17.5 � 0.7%,16.7 � 0.9%, and 17.5 � 0.6%, respectively). However, ratesof fusion, cleavage, and blastocyst formation of clonedembryos from GMEC2T6 (50.7 � 2.1%, 55.5 � 2.0%, and11.1 � 0.6%, respectively) were lower than those of othergroups (P < 0.05). Most of the cloned blastocysts expressed

nder a bright field (A) and fluorescence (B), magnification �100.

J. Liu et al. / Theriogenology 79 (2013) 660–666 665

EGFP under the blue light of a fluorescence microscope(Fig. 4). We inferred that genetic modification of GMECsmight not influence in vitro development of the clonedembryos, but that some of the clonal cells were notsuitable for NT to produce transgenic goats, because of lowdevelopmental rates.

4. Discussion

The use of genetically modified MECs expressing thetransgene for NT could ensure an appropriate expressionlevel of recombinant protein in the milk of transgeniccloned offspring. Here, three GMEC lines were transfectedusing a HBD3 mammary-specific expression vector. Thein vitro developmental potential of cloned embryos fromtransgenic GMECs expressing HBD3 was evaluated. Wedemonstrated that the genetic modification of GMECsmight not influence in vitro developmental potential of thecloned embryos. To our knowledge, this was the first re-port of successfully cloned embryos from HBD3 transgenicGMECs.

Live cloned offspring have been produced from MECs incattle [20], sheep [21], and goats [16]. The fusion rate andin vitro development of cloned embryos using MECs havebeen shown to be low compared with those using fibro-blast cells [21–23]. Similarly, here, the fusion rate andin vitro development from GMECs were lower than thosefrom fibroblast cells reported in our previous study [24].Moreover, we demonstrated that there were no differ-ences in the fusion rate and in vitro developmental ratesbetween transgenic GMECs and nontransgenic GMECs.However, some of the transgenic clonal cells were notsuitable for NT, because of low rates fusion and blastocystformation. Perhaps the cell membrane of some transgenicclonal cell lines changed under the drug selection, or thetransgenic clonal cells were derived from a special type ofcell in GMECs, because many morphologically differentcells exist in the whole population of GMECs [17]. Aprevious study indicated that not only different fibroblastcell lines, but also different transgenic clones derived fromone primary cell line, had different development whenused for NT [25]. Therefore, perhaps some of the trans-genic clonal cell lines were more suitable as donor cells forNT than others. Therefore, the in vitro development oftransgenic clonal GMECs should be tested before beingused for NT to produce transgenic goats. In addition,effects of epigenetic modification of donor cells and inte-gration of the vector into the genome cannot be entirelyexcluded [26].

The proliferative lifespan of primary cells has animportant role in producing transgenic animals. In thisapproach, cells were transfected, selected, and extended inculture; only cells with stable integrated transgenes can beused as donor cells, therefore, successful genetic modifi-cations and NT are only possible before the cells reachsenescence and die [27]. Although mammary epithelial celllines can provide a rapid and reliable indicator of geneexpression efficiency of transgenic animals, their shortlifespan greatly limits this application [28]. Here, viabletransgenic cells were derived from primary GMECs, andexpressed b-casein and recombinant HBD3 after inducing

expression. However, the efficiencies of transfection andexpanded culturewere low, becausemost of the clonal cellsbecome senescent. Although the replicative lifespan ofGMECs can be extended by transfecting with human telo-merase reverse transcriptase, immortalized cells cannot bedirectly used to generate genetically modified cells [28].Some studies have demonstrated that GMECs could becultured for a long time and successfully transfected withEGFP gene using lipofection [16,17]. Taken together, trans-genic GMECs expressing recombinant transgene could bederived from primary GMECs.

Antimicrobial peptides are small molecular weight pro-teins with broad-spectrum antimicrobial activity againstbacteria, viruses, and fungi [29]. It has been reported thatsome kinds of antimicrobial peptides play an important rolein innate immunity of the bovine mammary gland [30].Several investigations reported that b-defensins were diff-erentially expressed in epithelial tissues of the mammarygland, increased expression in response to mastitis, andprotected the body from the invasion of the bacteria [31,32].Moreover, previous studies have indicated that transgeniclivestock expressing some kinds of antimicrobial peptides inmilk can inhibit bacterial pathogens that cause mastitis[4,5,33]. Therefore, cloned embryos from transgenic GMECsexpressing appropriate levels of HBD3 might be useful forproducing mastitis-resistant dairy goats.

4.1. Conclusions

We demonstrated that the in vitro developmental abilityof cloned embryos from transgenic GMECs expressing HBD3was not affected when compared with nontransfectedcontrols. Therefore, it was possible to produce transgenicdairy goats for enhancing mastitis resistance by enablingthe cell of the mammary gland to express and secrete moreb-defensins.

Acknowledgments

This work was supported by the National Major Projectfor Production of Transgenic Breeding (2011ZX08007-004)and the National High Technology Research and Develop-ment Program of China (863 Program) (2011AA100303).

References

[1] Harder J, Bartels J, Christophers E, Schröder JM. Isolation and char-acterization of human b-defensin-3, a novel human induciblepeptide antibiotic. J Biol Chem 2001;276:5707–13.

[2] Dunsche A, Acil Y, Dommisch H, Siebert R, Schröder JM, Jepsen S.The novel human beta defensin 3 is widely expressed in oral tissues.Eur J Oral Sci 2002;110:121–4.

[3] Dhople V, Krukemeyer A, Ramamoorthy A. The human beta-defensin-3, an antibacterial peptide with multiple biological func-tions. BBA-Biomembranes 2006;1758:1499–512.

[4] Maga EA, Cullor JS, Smith W, Anderson GB, Murray JD. Humanlysozyme expressed in the mammary gland of transgenic dairygoats can inhibit the growth of bacteria that cause mastitis and thecold-spoilage of milk. Foodborne Pathog Dis 2006;3:384–92.

[5] Yang B, Wang J, Tang B, Liu Y, Guo C, Yang P, et al. Characterizationof bioactive recombinant human lysozyme expressed in milk ofcloned transgenic cattle. PLoS One 2011;6:e17593.

[6] Wall RJ, Powell AM, Paape MJ, Kerr DE, Bannerman DD, Pursel VG,et al. Genetically enhanced cows resist intramammary Staphylo-coccus aureus infection. Nat Biotechnol 2005;23:445–51.

J. Liu et al. / Theriogenology 79 (2013) 660–666666

[7] Schnieke AE, Kind AJ, Ritchie WA, Mycock K, Scott AR, Ritchie M,et al. Human factor IX transgenic sheep produced by transfer ofnuclei from transfected fetal fibroblasts. Science 1997;278:2130–3.

[8] McCreath KJ, Howcroft J, Campbell KHS, Colman A, Schnieke AE,Kind AJ. Production of gene-targeted sheep by nuclear transfer fromcultured somatic cells. Nature 2000;405:1066–9.

[9] Cibelli JB, Stice SL, Golueke PJ, Kane JJ, Jerry J, Blackwell C, et al.Cloned transgenic calves produced from nonquiescent fetal fibro-blasts. Science 1998;280:1256–8.

[10] Baguisi A, Behboodi E, Melican DT, Pollock JS, Destrempes MM,Cammuso C, et al. Production of goats by somatic cell nucleartransfer. Nat Biotechnol 1999;17:456–61.

[11] Lai LX, Prather RS. Progress in producing knockout models forxenotransplantation by nuclear transfer. Ann Med 2002;34:501–6.

[12] Ellis J. Silencing and variegation of gammaretrovirus and lentivirusvectors. Hum Gene Ther 2005;16:1241–6.

[13] Al-Shawi R, Kinnaird J, Burke J, Bishop JO. Expression of a foreigngene in a line of transgenic mice is modulated by a chromosomalposition effect. Mol Cell Biol 1990;10:1192–8.

[14] Spradling AC, Rubin GM. The effect of chromosomal position on theexpression of the Drosophila xanthine dehydrogenase gene. Cell1983;34:47–57.

[15] Zhao MT, Lin H, Liu FJ, Quan FS, Wang GH, Liu J, et al. Efficiency ofhuman lactoferrin transgenic donor cell preparation for SCNT.Theriogenology 2009;71:376–84.

[16] Cheng Y, Yuan YG, Guo L, Ding GL, Bai YJ, Miao MX, et al. Cloned kidsderived from caprine mammary gland epithelial cells. Ther-iogenology 2009;72:500–5.

[17] Zheng YM, He XY, Zhang Y. Characteristics and EGFP expression ofgoat mammary gland epithelial cells. Reprod Domest Anim 2010;45:e323–31.

[18] Zhang YL, Liu FJ, Sun DQ, Chen XQ, Zhang Y, Zheng YM, et al.Phytohemagglutinin improves efficiency of electrofusing mammarygland epithelial cells into oocytes in goats. Theriogenology 2008;69:1165–71.

[19] Liu J, Li LL, Du S, Bai XY, Zhang HD, Tang S, et al. Effects of intervalbetween fusion and activation, cytochalasin B treatment, andnumber of transferred embryos, on cloning efficiency in goats.Theriogenology 2011;76:1076–83.

[20] Kishi M, Itagaki Y, Takakura R, Imamura M, Sudo T, Yoshinari M,et al. Nuclear transfer in cattle using colostrum-derived mammarygland epithelial, cells and ear-derived fibroblast cells. Theriogenol-ogy 2000;54:675–84.

[21] Wilmut I, Schnieke AE, McWhir J, Kind AJ, Campbell KHS. Viableoffspring derived from fetal and adult mammalian cells. Nature1997;385:810–3.

[22] Zakhartchenko V, Alberio R, Stojkovic M, Prelle K, Schernthaner W,Stojkovic P, et al. Adult cloning in cattle: potential of nuclei froma permanent cell line and from primary cultures. Mol Reprod Dev1999;54:264–72.

[23] Liu FJ, Zhang Y, Zheng YM, Zhao MT, Zhang YL, Wang YS, et al.Optimization of electrofusion protocols for somatic cell nucleartransfer. Small Ruminant Res 2007;73:246–51.

[24] Tang S, Liu J, Du S, Li LL, Zheng CY, Zhao MT, et al. Optimization ofembryo culture conditions in the production of cloned goatembryos, following somatic cell nuclear transfer. Small RuminantRes 2011;96:64–9.

[25] Kuhholzer B, Hawley RJ, Lai L, Kolber-Simonds D, Prather RS. Clonallines of transgenic fibroblast cells derived from the same fetus resultin different development when used for nuclear transfer in pigs.Biol Reprod 2001;64:1695–8.

[26] Blelloch R, Wang ZD, Meissner A, Pollard S, Smith A, Jaenisch R.Reprogramming efficiency following somatic cell nuclear transfer isinfluenced by the differentiation and methylation state of the donornucleus. Stem Cells 2006;24:2007–13.

[27] Denning C, Dickinson P, Burl S, Wylie D, Fletcher J, Clark AJ. Genetargeting in primary fetal fibroblasts from sheep and pig. CloningStem Cells 2001;3:221–31.

[28] He YL, Wu YH, He XN, Liu FJ, He XY, Zhang Y. An immortalized goatmammary epithelial cell line induced with human telomerasereverse transcriptase (hTERT) gene transfer. Theriogenology 2009;71:1417–24.

[29] Izadpanah A, Gallo RL. Antimicrobial peptides. J Am Acad Dermatol2005;52:381–90.

[30] Rainard P, Riollet C. Innate immunity of the bovine mammary gland.Vet Res 2006;37:369–400.

[31] Roosen S, Exner K, Paul S, Schröder JM, Kalm E, Looft C. Bovineß-defensins: identification and characterization of novel bovineß-defensin genes and their expression in mammarygland tissue.Mamm Genome 2004;15:834–42.

[32] Swanson K, Gorodetsky S, Good L, Davis S, Musgrave D,Stelwagen K, et al. Expression of a b-defensin mRNA, lingual anti-microbial peptide, in bovine mammary epithelial tissue is inducedby mastitis. Infect Immun 2004;72:7311–4.

[33] Zhang JX, Zhang SF, Wang TD, Guo XJ, Hu RL. Mammary glandexpression of antibacterial peptide genes to inhibit bacterial path-ogens causing mastitis. J Dairy Sci 2007;90:5218–25.