production of cellulases by rhizopus stolonifer from glucose … · 2017. 3. 24. · spore...

J. Microbiol. Biotechnol.

J. Microbiol. Biotechnol. (2017), 27(3), 514–523https://doi.org/10.4014/jmb.1608.08048 Research Article jmbReview

Production of Cellulases by Rhizopus stolonifer from Glucose-ContainingMedia Based on the Regulation of Transcriptional Regulator CREYingying Zhang1, Bin Tang1,2*, and Guocheng Du1

1School of Biotechnology, Jiangnan University, Wuxi 214000, P.R. China2College of Biochemical Engineering, Anhui Polytechnic University, Wuhu 241000, P.R. China

Introduction

Cellulases are composed of endoglucanases (E.C. 3.2.1.4),

cellobiohydrolases (E.C. 3.2.1.91; E.C. 3.2.1.176), and β-

glucosidases (E.C. 3.2.1.21) [1, 2]. They are widely applied

in textile processing, printing and dyeing, food and brewery

production, detergent production, and biorefinery [2, 3].

However, a low yield with a poor specific activity is a

bottleneck in the application of cellulases. Generally,

industrial cellulase production relies on cellulosic substrates

that induce the secretion of cellulases from filamentous

fungi, the disadvantage of which is the long production

cycle with lower substrate utilization [4]. Much of the

research has examined that cellulase biosynthesis is mainly

adjusted by the induction and the repression of degradation

products. Cellulose, cellobiose, sophorose, lactose, and

derivative cellulose have been shown to be effective in

inducing the formation of Trichoderma cellulases [5-8].

Thus, the bottleneck can be broken if simple carbon sources

like monosaccharide or disaccharides could be utilized to

activate the synthesis of cellulases with a rapid development

of cells, of which the prerequisite is to overcome the carbon

metabolism repression.

Carbon catabolite repression is a crucial regulation

mechanism in microorganisms, preventing the expression

of enzymes required for the utilization of complex carbon

sources when simple carbon sources like glucose are

present in the medium [9]. The transcription factor

responsible for the repression of glucose-regulated genes

has been found in the filamentous fungi; namely, cre1/creA,

which was highly conserved [10-12]. CRE1 can repress the

transcription of cellulases-encoding genes by binding to the

CCCCAC region in the promoter fragment of those genes

[13]. Specifically, CRE1 indirectly regulates the expression

of cbh2 by adjusting another transcription factor, XYR1 [13].

In addition, transport of the inducer sophorose could be

suppressed owing to the presence of glucose [14]. However,

the characteristic of carbon metabolism repression that

regulates cellulases synthesis in Rhizopus has not been

investigated.

In this paper, we studied the regulation of CRE from

Rhizopus stolonifer TP-02, and compared it with the transcription

Received: August 24, 2016

Revised: October 25, 2016

Accepted: November 16, 2016

First published online

November 23, 2016

*Corresponding author

Phone: +86-553-2871210;

Fax: +86-553-2871091;

E-mail: [email protected]

pISSN 1017-7825, eISSN 1738-8872

Copyright© 2017 by

The Korean Society for Microbiology

and Biotechnology

Carbon catabolite repression is a crucial regulation mechanism in microorganisms, but its

characteristic in Rhizopus is still unclear. We extracted a carbon regulation gene, cre, that

encoded a carbon catabolite repressor protein (CRE) from Rhizopus stolonifer TP-02, and

studied the regulation of CRE by real-time qPCR. CRE responded to glucose in a certain range,

where it could significantly regulate part of the cellulase genes (eg, bg, and cbh2) without cbh1.

In the comparison of the response of cre and four cellulase genes to carboxymethylcellulose

sodium and a simple carbon source (lactose), the effect of CRE was only related to the

concentration of reducing sugars. By regulating the reducing sugars to range from 0.4% to

0.6%, a glucose-containing medium with lactose as the inducer could effectively induce

cellulases without the repression of CRE. This regulation method could potentially reduce the

cost of enzymes produced in industries and provide a possible solution to achieve the large-

scale synthesis of cellulases.

Keywords: Cellulases, carbon catabolite repressor, transcriptional regulation, Rhizopus stolonifer

Cellulase Production Based on Regulation of CRE 515

March 2017⎪Vol. 27⎪No. 3

of four cellulase genes (eg, bg, cbh1, and cbh2) responding to

the cellulosic carbon source carboxymethylcellulose sodium

(CMC) and a simple carbon source (glucose and lactose).

Based on the characters of transcriptional regulator CRE,

we produced cellulases from R. stolonifer by a glucose-

containing medium without the repression of CRE. Moreover,

we discuss the synthesis and regulation mechanism of

cellulases, which could enrich the knowledge of related

fields and provide some basis to engineering and biological

process designs.

Materials and Methods

Strains and Reagents

R. stolonifer TP-02 was isolated in our laboratory and stored in

the China General Microbiological Culture Collection Center

(CGMCC No. 11119). The PCR product purification kit and

plasmid extraction kit were purchased from Sangon Biotech Co.,

Ltd. (China); the RNA extraction kit, cDNA reverse transcription

kit, fluorescence quantitative PCR kit, Pfu DNA polymerase, and

T4 DNA ligase were purchased from Takara Biotechnology Co.,

Ltd. (China).

Identification of Carbon Catabolite Repressor Protein-Encoding

Genes

R. stolonifer TP-02 was cultured in PDA liquid medium and

shaken for 24 h at 30°C (200 rpm). The mycelia were harvested

and freeze-dried. Standard protocols for extraction of the genomic

DNA from the straw enrichment using the CTAB method were

used [15]. Amplification of the DNA fragment encoding CRE was

done by using the primers P1: 5’-CCGGAATTCATGAAGTTT

ATTACTATTACGTC-3’ and P2: 5’-ATAAGAATGCGGCCGCTT

TATTTTCTTGAACAACCT GTC-3’. The amplification protocol

included 30 cycles, and each cycle consisted of an initial pre-

degeneration cycle of 5 min at 95°C followed by a 30 sec denaturing

step at 94°C, a 45 sec annealing step at 54°C, and finally a 50 sec

polymerization cycle at 72°C. The amplification was then switched

to a 10 min polymerization at 72°C. The PCR product was purified

by kit and sequenced by Sangon Biotech Co., Ltd. (China).

Homology alignment of the primary structure between CRE and

other enzymes was carried out in the GenBank database using the

BLAST program, together with the MegAlign program and

ClustalW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/).

Construction of R. stolonifer Δcre

The full-length hygromycin resistance gene hyg was inserted

into cre by overlapping PCR [16]. This constructed gene was

connected with the pUCm-T carrier (purchased from Sangon

Biotech Co., Ltd.) and transformed into E. coli DH5α. The positive

clones were screened and identified by sequencing the plasmid

extracted by kit. This plasmid was added into the pretreatment

spore suspension of R. stolonifer (germinated for 8 h), and placed

on ice for 10 min before being shifted into the pole cup. After

shocking at 1,500 V, the solution was immediately added into 1 ml

of pre-cooled PDA on ice for 20 min, and then cultured at 30°C,

100 rpm for 90 min. Then, it was coated to hygromycin plates

(160 μg/ml) and incubated at 30°C. The positive clones were

screened and identified by amplifying cre and hyg from genomic

DNA. For preparation of the germinated spores, the spores were

rinsed with sterile water, filtrated by two layers of gauze, inoculated

into PDA liquid medium, and cultured at 30°C at 180 rpm for 8 h

until spore germination. Scanning electron microscopy (SEM) was

used to determine the spore germination time.

Real-Time qPCR

Freeze-dried mycelia were rapidly grinded in a prechilled

mortar (180°C, dried 6 h to destroy RNAase) [17, 18]. Total RNA

was extracted by kit, which eliminated the genomic DNA for

synthesis of single-strand cDNA as a template by the reverse

transcription kit. Primers of qPCR were designed according to the

cellulase genes obtained previously (Table 1). The cDNA solution

was diluted 20-fold as a template to amplify the target strip with

the fluorescent dye SYBR. The reaction system contained cDNA

2 μl, SYBR premix Ex TaqII 10 μl, Primer mix 2 μl, and ddH2O 6 μl.

The reaction conditions were pre-incubation at 95°C for 30 sec, 2-

step amplification for 45 cycles (95°C for 10 sec, 58°C for 30 sec),

and melting (95°C for 10 sec, 65°C for 60 sec, 97°C for 1 sec). The

seed cultured in PDA liquid medium and shaken for 24 h at 30°C

(200 rpm) was the reference condition used for comparison as a

fold-change = 1. 18S rRNA was used as the reference gene. Data

analysis was carried out using LightCycler 96 and the mRNA

levels were calculated using the 2-ΔΔCT method [19].

Production of Cellulases by a Glucose-Containing Medium

Both the R. stolonifer parent and Δcre strains were grown on

Table 1. The sequences of primers for qPCR.

Gene Primers Sequences (5’-3’)Size

(bp)

18S RNA 18S-F GTAGTCATATGCTTGTCTC 19

18S-R ATTCCCCGTTACCCGTTG 18

eg EG2-F TTATTGGGTTTGTTGTCAGGC 21

EG2-R GTGCTTTGAATTGATTGCTCC 21

bg BG3-F CGAGGACATTGCCTTGCTGA 20

BG3-R GTTTGTGGAGGGAATAGTGGG 21

cbh1 CBH1-F CTTATTGTGGAGGCGGTTGC 20

CBH1-R CAGGTGGTATCGGTGGAGC 19

cbh2 CBH2-F CCTGGCTATCCCATCCCTC 19

CBH2-R CGTTCTGGGCTTTGATGTCG 20

xyr1 XYR1-F CGTCAGCTCCTACAGCGAC 19

XYR1-R CTACGAATCTCCGCATGAG 19

cre CRE-R CCACTTCCACTATGGCTTCG 20

CRE-F GTGCGGATATGTCTCGTTTGG 21

516 Zhang et al.


Fig. 1. Results of the multiple alignments of CRE and its similar sequences from other filamentous fungi (GenBank No. O94166,

EHA22819, and GAA82303, respectively).



PDA plates. The spores of these two strains were inoculated on

the fermentation medium in 3 L fermenters and cultured under

the same conditions. By sampling every 6-12 h, the concentration

of reducing sugars was recorded and the FPA activity of the

cellulases was measured by the DNS method described previously

[20]. A unit of enzyme activity was defined as the amount of

enzyme releasing 1 μmol of glucose equivalents per minute. The

concentration of total proteins was determined by the Bradford

method with the kit purchased from Sangon Biotech Co., Ltd. The

fermentation medium consisted of 1% glucose, 1% inducer (CMC

or lactose), 0.5% NH4Cl, 0.5% KH2PO4, 0.4% MgSO4.7H2O, 0.4%

CaCl2, 0.025% PEG4000, trace element solution, Tween-80, 1.2%

methionine, and 0.6% yeast extract.

Results

Characteristics of CRE Response to Glucose

The transcription factor CreA contains two zinc finger

domains and is the main regulator responsible for carbon

repression in filamentous fungi [21, 22]. Previous studies of

the zinc finger protein have emphasized its crucial role in

the transcriptional regulation of eukaryotes [23]. In this

study, the carbon repressor gene cre was cloned from

R. stolonifer (GenBank No. KP702729). The gene is 1,284 bp

long, and encodes a 428-amino-acid protein, CRE. The

ClustalW2 alignment showed that CRE contains two

analogous C2H2 zinc finger domains that are similar to

the CREA (GenBank No. O94166) in Aspergillus aculeatus

(Fig. 1A). The percent identity (calculated by MegAlign)

between CRE and CREA was 88.9% (Fig. 1B). Analysis of

the PROSITE and CDD engine indicated that there were

multiple functional domains in CRE, in which the main

structure was the zinc finger from Thr68 to Pro327 that

could bind to DNA.

To study the response characters of CRE, the transcription

level of cre was measured after cultivating the cells in

different concentrations of glucose that ranged from 0.2%

to 1%. The results showed that transcription levels of cre in

all the samples peaked at 4 h (Fig. 2A), which was selected

as the sampling point for the following research. In order

to build a complete response curve of CRE, the sugar

concentration was expanded to 4%. The relative mRNA

expression of CRE peaked in 0.8% glucose and decreased

gradually as the concentration of sugars increased to 2%

(Fig. 2B). Unexpectedly, the transcription of cre began to

level off when the concentration of glucose was above 2%.

It indicated that a higher glucose concentration does not

lead to a higher level of expression of cre, only if the

concentration was less than 0.8%.

Effect of CRE on the Transcription Level of Cellulase

Genes

It has been confirmed that CRE participates in the

regulation of expression of cellulase-coding genes. In this

paper, we intended to study the regulation of CRE on

cellulase genes responding to the concentration of glucose.

The transcription levels of four cellulase genes (eg, bg, cbh1,

and cbh2) were measured after cultivating the cells in

different concentrations of sugars for 4 h as described

before. The results showed that the regulation of CRE was

phased: When the concentration was lower than 0.6%, the

Fig. 2. Response characteristics of CRE to glucose.

(A) Time axis of the relative transcription levels of cre. The dotted line corresponds to the secondary ordinate. (B) Complete response curve of

CRE.

518 Zhang et al.


response of CRE was weak (Fig. 2B) and thus all the

cellulase genes were transcribed normally (Fig. 3), which

was named the control delayed period. When the

concentration ranged from 0.6% to 1%, CRE regulated the

Fig. 3. Relative transcription levels of four cellulase genes (eg, bg, cbh1, and cbh2) and xyr1 in cells cultivated in different

concentrations of sugars for 4 h.

All the tested genes, except cbh1, were repressed when the concentration of glucose was above 0.6%.



expression of cellulase genes (eg, bg, and cbh2) with an

obvious linear relationship, which was named the control

linear period. Once the concentration was higher than

1.2%, the regulation of CRE displayed stability control. It

means that CRE could effectively regulate the expression

of cellulases from R. stolonifer, except cbh1, when the

concentration of glucose was higher than 0.6%. To confirm

the indirect regulation of CRE on the expression of cbh2

by adjusting xyr1, the transcription level of xyr1 was

determined. Results in Figs. 3C and 3D show that there was

a significant correlation between xyr1 and cbh2 when the

glucose content was higher than 0.6%. In particular, the

transcription of xyr1 was most sensitive to CRE. In

addition, the expression of cbh1 was reported to be strictly

controlled by the carbon source, which could be increased

by above 1,000 times when cellulose was present in the

medium, and could be completely inhibited under the

condition of glucose [14]. However, there was no obvious

correlation between the transcription level of cre and cbh1

from R. stolonifer. The tendency of the transcription level

that cbh1 displayed was different from the other tested

genes, with an irregular fluctuation (Fig. 3E). However, it

Fig. 4. Construction and characterization of Rhizopus stolonifer Δcre.

(A) SEM photographs show that the spore morphology began to change in 8 h and hyphae were formed in 9 h. (B) Agarose gel electrophoresis of

cre and hyg amplified from R. stolonifer Δcre (Lines 1 and 2) and parent TP-02 (Lines 3 and 4). (C) Relative mRNA expression levels of CRE and

cellulases produced by R. stolonifer parent and Δcre strains.

520 Zhang et al.


seems positively related with the concentration of sugars,

which indicated that the carbon catabolite repression has a

weak regulation on cbh1. Consequently, there might be

another regulation approach of cbh1 present in the R.

stolonifer unlike with other filamentous fungi.

CreA can participate in the regulation of the transcription

and translation processes by binding to regulatory elements

in the promoters of target genes [23, 24]. Previous studies

suggested that CRE1 was partially involved in the negative

regulation of cellulase and hemicellulase genes from

Trichoderma. For cbh2, xyn2, and bgl1 gene expression, no

such direct regulatory effect caused by CRE1 could be

observed [25]. In order to further confirm the regulation of

CRE, we destroyed cre by inserting the full-length gene of

hygromycin, hyg, using overlapping PCR, and constructed

the R. stolonifer Δcre by homologous recombination using

R. stolonifer TP-02 as the parent strain. To obtain higher

transformation efficiency, the spore germination time was

optimized. The SEM photographs revealed that the

optimum germination time of spores was 8 h (Fig. 4A). The

end fragments of cre and hyg were used as probes to extract

target genes from the R. stolonifer TP-02 and Δcre strains,

respectively. The length of the gene extracted from Δcre by

the cre probe was 2,358 bp, which contained the hyg

sequence (1,074 bp). Moreover, the full length of hyg has

been cloned from the genomic DNA of strain Δcre instead

of the parent strain. These results showed that cre has been

successfully destroyed by inserting hyg (Fig. 4B). Both

R. stolonifer parent and Δcre strains were grown on the 0.8%

glucose-containing media for 4 h, in which the relative

mRNA expression of cre could be maximized. Transcription

levels of cellulases produced by R. stolonifer parent and

Δcre strains were assayed by qPCR. As shown in Fig. 4C,

all the tested genes, except cbh1, were significantly

downregulated in R. stolonifer parent. The transcription

levels of eg, bg, cbh1, cbh2, and xyr1 were repressed by CRE

by 67.1%, 75.2%, 15.2%, 71.6%, and 71.8%, respectively.

These results indicated that CRE plays a key role in the

production of cellulases from R. stolonifer.

Features of the CRE Response to Different Substrates

Lactose has been widely utilized to induce the production

of cellulases in industry, which can also be digested into

glucose and galactose by the β-glucosidases [5]. Compared

with lactose, CMC is an artificial cellulose derivative with a

simple composition, which is used instead of complex and

insoluble celluloses such as microcrystalline cellulose, rice

straw, and straw to study the induction of cellulose

substrates on the cellulases. The relative mRNA expression

of CRE and cellulases was assayed in MA medium containing

1% CMC or 1% lactose as the inducer, respectively. The

results showed that the relative mRNA expression of

cellulases under the CMC condition was generally higher

than under lactose, with a longer induction period (Fig. 5).

The concentration of reducing sugars was determined,

which maintained at a lower level when CMC was used as

an inducer, resulting in a weak transcription of cre (Fig. 5A).

In contrast, the transcription of cre was stronger at the

initial induction stage of lactose, of which the relevant

reducing sugars was also higher than that of CMC (Fig. 5B).

Fig. 5. Relative mRNA expression levels of CRE and cellulases induced by CMC (A) and lactose (B).

The change of transcription level of cre was strongly correlated with the reducing sugar content. In addition, the transcription level of cellulase

genes peaked in 0.4%-0.6% reducing sugar content with lower repression by CRE.



The reducing sugars released from CMC are glucose and

cellobiose, whereas that released from lactose are glucose

and galactose. The change of transcription level of cre

has strong correlation with the reducing sugar content.

Furthermore, the relative mRNA expression of cre in

different reducing sugar contents was similar to the results

measured under the condition of glucose (Fig. 2B). These

indicated that the transcription of cre was only related with

the concentration of reducing sugars, no matter which

substrate was selected.

In addition, the transcription of cbh1 displayed a sensitivity

of the reducing sugars; namely, the reducing end was likely

to stimulate the transcription of cbh1. Moreover, there was

a significant effect of lactose on the induction of bg, and a

similar effect of CMC on the induction of eg. The presence

of reducing sugars at a high level greatly inhibited the

transcription of cellulase genes owing to the negative

regulation of CRE and the substrate inhibition. However,

this inhibition might be overcome if the concentration of

reducing sugars could be maintained at the range from

0.4% to 0.6%.

Production of Cellulases on Glucose-Containing Media

Because the fermentation time is generally long and the

production costs are high owing to the characteristics of the

strains and the factors of culture conditions, filamentous

fungi currently used in cellulase production are hardly

fast and efficient [26]. To produce more cellulases from

Fig. 6. Production of cellulases on glucose-containing media in 3 L fermenters.

(A) Non-cellulosic substrates also could induce cellulases in low levels. (B) Cellulase production in Rhizopus stolonifer by regulating the

concentration of glucose at around 0.5% after 30 h (TP-02-Regulate 1). R. stolonifer TP-02 cultured without regulating the glucose content acted as a

control group; the reducing sugars were determined as RS-Normal. (C) Regulating the glucose content at around 1% after 30 h (TP-02-Regulate 2)

or throughout the fermentation period (TP-02-Regulate 3). (D) The protein content was determined with the Bradford method.

522 Zhang et al.


R. stolonifer in a relatively short time, a glucose-containing

medium was utilized. Although the traditional substrates

for producing cellulases is cellulosic substrates, the non-

cellulosic substrates containing glucose, disaccharides, and

oligosaccharides usually attract the attention of the carbon

metabolic repression they caused, thereby ignoring the low

expression levels of cellulases under these conditions

(Fig. 6A) [27]. Based on the characteristics of CRE described

above, lactose was selected as the inducer of the glucose-

containing medium. Spores of R. stolonifer parent and Δcre

strains were inoculated on the medium mentioned before

in 3 L fermenters and cultured under the same conditions.

According to the change of reducing sugar concentration,

additional glucose was added into the fermenter of

R. stolonifer TP-02 at 30 h for keeping the concentration of

reducing sugars at around 0.5% (group TP-02-Regulate 1).

The R. stolonifer in normal fermentation without additional

feeding was appointed as the control group. The activity of

cellulases produced by the R. stolonifer parent and Δcbs

strains was assayed. As shown in Fig. 6B, the FPA activity

of cellulases produced by R. stolonifer that was regulated by

additional glucose (3.75 IU/ml) feeding was significantly

higher than the one without additional feeding (1.96 IU/ml).

Moreover, the maximum activity of the samples that were

regulated was close to the value of Δcbs (4.16 IU/ml).

To study the cellulase production at higher glucose content,

two additional control groups were carried out (Fig. 6C).

One group was regulated to 1% glucose content at the same

time as group TP-02-Regulate 1 (TP-02-Regulate 2). The

other was regulated throughout the fermentation period to

maintain a 1% glucose content (TP-02-Regulate 3). The FPA

activity of cellulases produced by group TP-02-Regulate 2

(1.96 IU/ml) was significantly higher than that of TP-02-

Regulate 3 (0.72 IU/ml). However, the cellulase production

of group TP-02-Regulate 2 was similar to the control group

and lower than group TP-02-Regulate 1. Moreover, according

to the protein content (Fig. 6D), feeding fermentation could

obtain more total proteins. Besides this, it indicated that a

higher glucose level cannot achieve higher cellulase

production. These results suggested that a simple carbon

source could be used to effectively produce cellulases from

filamentous fungi without the repression of CRE, by

regulating the concentration of reducing sugar range at

0.4%-0.6%.

Discussion

Overcoming the carbon catabolite repression mechanism

is critical for utilizing simple carbon sources to produce

cellulases from filamentous fungi. For the first time reported,

we characterized the regulation of CRE on cellulase-

encoding genes responding to cellulosic substrates (CMC)

and simple carbon (glucose and lactose), which indicated

that the effect of CRE was only related to the concentration

of reducing sugars. CRE could effectively regulate the

expression of cellulases from R. stolonifer, except cbh1,

when the concentration of glucose was higher than 0.6%.

Based on the characteristics of CRE, we effectively produced

cellulases by a glucose-containing medium with lactose as

the inducer, by regulating the reducing sugar to range from

0.4% to 0.6% without the repression of CRE. With further

improvements, this regulation method could potentially

reduce the cost of enzymes produced in industries and

provide a possible solution to achieve large-scale synthesis

of cellulases, since a simple carbon source can be utilized to

activate the synthesis of cellulases with a rapid development

of cells.

Acknowledgments

This work was financially supported by the National

Natural Science Foundation of China (No. 31270135).

References

1. Kuhad RC, Deswal D, Sharma S, Bhattacharya A, Jain KK,

Kaur A, et al. 2016. Revisiting cellulase production and

redefining current strategies based on major challenges.

Renew. Sustain. Energy Rev. 55: 249-272.

2. Payne CM, Knott BC, Mayes HB, Hansson H, Himmel ME,

Sandgren M, et al. 2015. Fungal cellulases. Chem. Rev. 115:

1308-1448.

3. Juturu V, Wu JC. 2014. Microbial cellulases: engineering,

production and applications. Renew. Sustain. Energy Rev. 33:

188-203.

4. Hidenoa A, Inouea H, Tsukahara K, Yanoa S, Fang X, Endo

T, et al. 2011. Production and characterization of cellulases

and hemicellulases by Acremonium cellulolyticus using rice

straw subjected to various pretreatments as the carbon

source. Enzyme Microb. Technol. 48: 162-168.

5. Bischof R, Fourtis L, Limbeck A, Gamauf C, Seiboth B,

Kubicek CP. 2013. Comparative analysis of the Trichoderma

reesei transcriptome during growth on the cellulase inducing

substrates wheat straw and lactose. Biotechnol. Biofuels 6: 127.

6. Chen S, Wayman M. 1992. Novel inducers derived from

starch for cellulase production by Trichoderma reesei. Process

Biochem. 27: 327-334.

7. Mandels M, Parrish FW, Reese ET. 1962. Sophorose as an

inducer of cellulase in Trichoderma viride. J. Bacteriol. 83: 400-

408.



8. Nogueira KMV, Costa MN, de Paula RG, Mendonça-

Natividade FC, Ricci-Azevedo R, Silva RN. 2015. Evidence

of cAMP involvement in cellobiohydrolase expression and

secretion by Trichoderma reesei in presence of the inducer

sophorose. BMC Microbiol. 15: 195.

9. Ronne H. 1995. Glucose repression in fungi. Trends Genet.

11: 12-17.

10. Drysdale MR, Kolze SE, Kelly JM. 1993. The Aspergillus niger

carbon catabolite repressor encoding gene, creA. Gene 130:

241-245.

11. Lorito M, Mach RL, Sposato P, Strauss J, Peterbauer CK,

Kubicek CP. 1996. Mycoparasitic interaction relieves binding

of the Cre1 carbon catabolite repressor protein to promoter

sequences of the ech42 (endochitinase-encoding) gene in

Trichoderma harzianum. Proc. Natl. Acad. Sci. USA 93: 14868-

14872.

12. Strauss J, Mach RL, Zeilinger S, Hartler G, Stöffler G,

Wolschek M, et al. 1995. Cre1, the carbon catabolite

repressor protein from Trichoderma reesei. FEBS Lett. 376:

103-107.

13. Mach-Aigner AR, Pucher ME, Steiger MG, Bauer GE, Preis

SJ, Mach RL. 2008. Transcriptional regulation of xyr1,

encoding the main regulator of the xylanolytic and

cellulolytic enzyme system in Hypocrea jecorina. Appl.

Environ. Microbiol. 74: 6554-6562.

14. Ries L, Belshaw NJ, Ilmén M, Penttilä ME, Alapuranen M,

Archer DB. 2014. The role of CRE1 in nucleosome

positioning within the cbh1 promoter and coding regions of

Trichoderma reesei. Appl. Microbiol. Biotechnol. 98: 749-762.

15. Lipp M, Brodmann P, Pietsch K, Pauwels J, Anklam E. 1999.

IUPAC collaborative trial study of a method to detect

genetically modified soy beans & maize in dried powder. J.

AOAC Int. 82: 923-928.

16. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. 1989.

Site-directed mutagenesis by overlap extension using the

polymerase chain resction. Gene 77: 51-59.

17. Damsteegt EL, McHugh N, Lokman PM. 2016. Storage by

lyophilization - resulting RNA quality is tissue dependent.

Anal. Biochem. 511: 92-96.

18. Pearson G, Lago-Leston A, Valente M, Serrão E. 2006.

Simple and rapid RNA extraction from freeze dried tissue

of brown algae and seagrasses. Eur. J. Phycol. 41: 97-104.

19. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene

expression data using real-time quantitative PCR and the

2-ΔΔCT method. Methods 25: 402-408.

20. Miller GL, Blum R, Glennon WE, Burton AL. 1960. Measurement

of carboxymethylcellulase activity. Anal. Biochem. 1: 127-132.

21. Cubero B, Scazzocchio C. 1994. Two different, adjacent and

divergent zinc finger binding sites are necessary for CREA-

mediated carbon catabolite repression in the proline gene

cluster of Aspergillu nidulans. EMBO J. 13: 407-415.

22. Ruijter GJG, Visser J. 1997. Carbon repression in aspergilli.

FEMS Microbiol. Lett. 151: 103-114.

23. MacPherson S, Larochelle M, Turcotte B. 2006. A fungal

family of transcriptional regulators: the zinc cluster proteins.

Microbiol. Mol. Biol. Rev. 70: 583-604.

24. Yang F, Gong Y, Liu G, Zhao S, Wang J. 2015. Enhancing

cellulase production in thermophilic fungus Myceliophthora

thermophila ATCC42464 by RNA interference of cre1 gene

expression. J. Microbiol. Biotechnol. 25: 1101-1107.

25. Mach RL, Zeilinger S. 2003. Regulation of gene expression

in industrial fungi: Trichoderma. Appl. Microbiol. Biotechnol.

60: 515-522.

26. Berka RM, Grigoriev IV, Otillar R, Salamov A, Grimwood J,

Reid I, et al. 2011. Comparative genomic analysis of the

thermophilic biomass-degrading fungi Myceliophthora thermophila

and Thielavia terrestris. Nat. Biotechnol. 29: 922-929.

27. Hsieh CC, Cannella D, Jørgensen H, Felby C, Thygesen LG.

2014. Cellulase inhibition by high concentrations of

monosaccharides. J. Agric. Food Chem. 62: 3800-3805.

production of cellulases by rhizopus stolonifer from glucose … · 2017. 3. 24. · spore...

Documents