preparation of polysaccharide-protein conjugates of vi...

Preparation of polysaccharide-protein conjugates of Vi negative Salmonella Typhi

as potential candidates for vaccines

Submitted in partial fulfillment of

PhD

By

Muhammad Salman

2014

Department of Biotechnology (NIBGE)

Pakistan Institute of Engineering and Applied Sciences

Nilore-45650 Islamabad Pakistan

In the name of Allah, the most gracious, the most merciful

National Institute for Biotechnology and Genetic Engineering

P. O. BOX 577, Jhang Road, Faisalabad.

(Affiliated with PIEAS, Islamabad)

Declaration of Originality

I hereby declare that the work presented in this thesis is the result of my own research carried

out in the Health Biotechnology Division of the National Institute for Biotechnology and

Genetic Engineering. This thesis has not been published previously nor does it contain any

material from published resources that can be considered as a violation of international

copyright law. Furthermore, I also declare that I am aware of the terms “copyright” and

“plagiarism” and if any copyright violation is found in this work I will be held responsible for

the consequences of any such violation.

Signature: _______________

Name of the Student: Muhammad Salman Registration No. 10-7-1-010-2008

Date: 03-06-2014 Place: NIBGE, Faisalabad

Dedicated to

My Parents

I have reached here and will go ahead because of them

And

My Grand Mother*

She is the lady who encouraged and inspired me all the way in my life

* Mrs. Abdul Hameed

ACKNOLEDGEMENTS

ItwasapleasantmorningwhenmyAllahsentmetothisworld,IaskedHim:O‘AllahwhatIwilldohere,Iknownothing.Herepliedme,don’tworry,trustme,startyourjourneyandgoahead.Iastonishedtoseetwohostsonarrival,myparents, theyevenknewthatIamnothing for thembut still theywelcomedme like the honorable guest. Later on theytaughtmehowtowalk,howtotalk,andhowtolive.TheyaskedeverythingfromAllahjustformeevenforgettingthemselves;theyprayedforme,weptformeincoldestwinternightswhenIwassleepingdeeply.HowcanIforgetalltheirefforts?WhyIshouldn’tprayfortheirlongest lives?Howcan I stopmy tearsbecause I don’t knowhow to acknowledge them?MayAllahblessthemwithlonglifeandblessmewiththeirobedience.MyLordincreasedhis bounty andmademeMuhammadi, I lovemy prophetMuhammad (Sallallaho AlihiWasallam)morethanmyparents,mykidsandwholeoftheuniverse.HeistheExcellencywhoprovidedleadershipformyentirelifeandneverleftmealoneinthisworld.Itwasthetime to exploreworld somy father broughtme to school, thatwas a newworld forme,everyteacherlovedmeandprovidedmethetreasuresofknowledgebutIcan’tforgettwoexcellencesMunawarsahibatprimaryandAbdulRabsahibathighschooltheyprovidedmemilestoneswhichwillguidemetill theendofmylife.ThenIwenttoMardanCollegewhere I metprofessorBahadurKhan who polished my taught and today I loveUrdubecauseofhim.IclimbedonthemountainsofMalakandandtheUniversityofMalakandprovidedmeanewlifewhereIenjoyedmycolleaguesfromthewholeprovinceandIwillalways remember thehistorical teachingofDr.NisarAhmad(DNA)who introducedmewithDNA.

It was April 2008 when fortune knocked at my wisdom’s door and NationalInstitute forBiotechnologyandGeneticEngineering (NIBGE) attractedme to explorethe science; I was unaware from the tiny creation (bacteria) of Allah, but my teachersuniquely primedmy concept on those unseen believing, I am really grateful to each andeveryoneofthem.IofferspecialgratitudetoHigherEducationCommissionofPakistanforprovidingfinancialsupporttomystudiesandmakingmydreamscometrue.Iamreallythankful to Dr. Shahid Mansoor, Director NIBGE, for providing outstanding researchfacilities, friendly environment and personal compassion, furthermore, I extend mygratitudetoDr.SohailHameedandDr.ZafarM.Khalid,Ex‐DirectorsNIBGE.Iamdeeplyindebted to Dr. Shahid Mehmood Baig (Head of HBD) not just for his cooperation,encouragementandfacilitationbutalsoforhismoralandpersonalsupport.

OneoftheshiningerasofmylifewaswhichIspentinentericpathogenslaboratory;nodoubtitwasjustbecauseofmyhonorablesupervisorDr.AbdulHaque,itismyutmostpleasure topayheartiest gratitude to him. I amgrateful to him for his personal interest,ample support and valuable guidance during my research work and writing of thisdissertation. The Excellency who added accurate colors to my research work, to mypresentationsandeventomylife isDr.MoazurRahmanwhonotonlyco‐supervisedmebutownedme likehispersonal friend. I amproudandgrateful tohim that I learnthardworking,kindnessandetiquettesfromhim.ThereisabigcontributionofDr.AamirAliinpractical guidanceofmy labwork,myarticles,manuscriptwrite‐upandmysocial life aswell. Ishallalwaysbethankful tohimforhisaffectionatebehavior towardsme.Basic labtechniques and gradual guidance all were provided to me with honesty by Dr. YasraSarwar, I am really grateful for her gracious attitude. Respectful appreciation toMrs.FouziaIsmatforhereverkindguidanceandfacilitation.Dr.MuhammadImrannot

just enlightenedmy knowledge regarding protein but also guidedme in practical benchwork,Iamverythankfultohim.

IwishtoexpressmydeepsenseofgratitudetoDr.AndrewD.Coxwhohostedmeat National Research Council, Ottawa, Canada. He made a great contribution for thesuccessfulcompletionofthiswork.Hisskilfuladvicesandsincerecooperationenabledmetocomplete thiswork. I learnta lot fromMr.FrankSt.Michael,hehasbeenreallyveryfrankandpolite.Iamreallygratefultohimforprovidingexcellentscientificenvironment.Iam grateful toMrs.ChantelleCairns, themost punctual lady, for her nice teaching andpracticalguidance.IreallyenjoyedthecompanyofDr.HayAlexander;Ilearntverymuchfromhim,Iamthankfultohim.

I am very thankful to Dr. Muhammad Afzal Ghauri for kind suggestions andencouragement in extracurricular activities. Dr.Mazhar Iqbal was always a source ofinspiration,guidanceandencouragementforme.Iamthankfultohimfromthecoreofmyheart. A bundle of thanks toDr. FazliRabbi for his valuable guidance and help in theinterpretation of ELISA results. Cheerful gratitude toMr. Abdul Tawab for his utmostsuggestionsandsincereadvices.MycordialthankstoallmylabfellowsatEntericPathogensLaboratoryandStructuralBiologyLaboratory speciallyMuhammadAsifHabeeb,AbdulGhaffar,Abdul Jabbar,Amna Afzal, Tyyaba Iftikhar, Sadia Liaquat, Samina Shaheen, Sanam Faryal, AsmaAhsan,RaheemUllah,MajidAli Shah and IkramAnwar who providedme a friendlyenvironmenttoperformexperimentsandsolvetheproblemsbydiscussion.ThankstoMr.Muhammad Tahir for providing consumables timely for the completion of this work.Ican’tforgettheservicesofpeopleofUniversityCell;theyallfacilitatedmycoursework,researchandmyfunding,manythankstoallofthem.

Relaxed and enjoyable moments outside lab were provided by friends andcolleaguesinHujra,NIBGECampusandhostel.Iamthankfulfortheireveravailablehelpand cooperation. I am grateful to supporting staff that helped me in all aspects. I amgratefultoImranSohail forencouragementandreviewofthisthesis. CheerfulthankstoandWaqasAshrafforhismemorablecompanyandunconditionalcooperation.IamreallygratefultoMr.MuhammadNisarwhohonoredmelikehisfamilymemberduringmystayatCanada

Iowethankstomygrandmotherforherevergreenprayerswhichwereasourceofhopeandkeytothesuccessfulcompletionofthiswork.IamreallyverygratefultomyuncleEngr. Abdul Ahad Khan, my brother and sisters as well as my sincere relatives whosupportedme in all aspects of life. I am really grateful to my wifeUmmeTameem forcreatingidealenvironmenttocompletethiswork.Shealwaysfacilitatesmetocompletealltasksofmylifewithcheer. IamgratefultoMuftiMuhammadNoman,MuhammadAtif,Egnr.GhayyoorAhmadandMuhammadJawadKhanformakingmyeveningwalkgleefulwithhealthydiscussionsatvillage.

Muhammad Salman

Mycordial thanks toallmy lab fellowsatEntericPathogensLaboratory andStructuralBiology Laboratory speciallyMuhammad AsifHabeeb, Abdul Ghaffar, Abdul Jabbar,Amna Afzal, Tyyaba Iftikhar, Sadia Liaquat, Samina Shaheen, Sanam Faryal, AsmaAhsan,RaheemUllah,Majid Ali Shah and Ikram Anwar who provided me a friendlyenvironmenttoperformexperimentsandsolvetheproblemsbydiscussion.ThankstoMr.Muhammad Tahir for providing consumables timely for the completion of this work. Ican’t forgettheservicesofpeopleofUniversityCell; theyall facilitatedmycoursework,researchandmyfunding,manythankstoallofthem.

i

TABLE OF CONTENTS

List of Figures ................................................................................................................. vii

List of Tables .................................................................................................................. ix

List of Abbreviations .......................................................................................................... x

Abstract ................................................................................................................. xii

CHPTER 1: INTRODUCTION AND REVIEW OF LITERATURE ...................... 1

1.1 Salmonella ................................................................................................. 1

1.2 Taxonomy and nomenclature .................................................................... 1

1.3 Epidemiology ............................................................................................ 3

1.4 Genome of S. Typhi .................................................................................. 4

1.5 Pathogenesis .............................................................................................. 5

1.6 Clinical manifestations .............................................................................. 6

1.7 Diagnosis ................................................................................................... 7

1.7.1 Microbiological culture ............................................................................. 7

1.7.2 Serology .................................................................................................... 8

1.7.3 Modified diagnostic methods .................................................................... 9

1.7.4 PCR base diagnosis ................................................................................... 9

1.8 Treatment ................................................................................................ 10

1.8.1 Treatment in non-endemic region ........................................................... 10

1.8.2 Treatment in endemic region ................................................................... 10

1.9 Drug resistance ........................................................................................ 11

1.10 Virulence factors ..................................................................................... 12

1.10.1 Plasmids .................................................................................................. 12

1.10.2 Prophages ................................................................................................ 12

1.10.3 Flagella .................................................................................................... 13

1.10.4 Fimbria .................................................................................................... 13

1.10.5 Outer membrane vesicles ........................................................................ 13

1.10.6 Pathogenic islands ................................................................................... 13

1.10.7 Type III secretion system ........................................................................ 14

1.11 Vi capsular polysaccharide ...................................................................... 14

1.12 Vi negative S. Typhi emergence ............................................................. 15

ii

1.13 Lipopolysaccharides (LPS) ..................................................................... 15

1.14 Vaccines against typhoid ......................................................................... 19

1.14.1 Inactivated whole cell vaccines ............................................................... 20

1.14.2 Live attenuated Ty21a vaccines .............................................................. 20

1.14.3 Vi polysaccharide vaccines ..................................................................... 21

1.15 Immunogenicity of bacterial polysaccharides ......................................... 23

1.16 Conjugate vaccines .................................................................................. 24

1.16.1 Licensed conjugate vaccines against bacterial diseases .......................... 26

1.16.1.1 Haemophilus influenza b conjugate vaccine ........................................... 26

1.16.1.2 Neisseria meningitidis conjugate vaccine ............................................... 26

1.16.1.3 Streptococcus pnemoniae ........................................................................ 27

1.17 Vi conjugate vaccines .............................................................................. 28

1.18 OSP conjugate vaccines .......................................................................... 29

1.19 Proteins used in conjugate vaccines ........................................................ 30

1.20 Exotoxin A .............................................................................................. 30

1.21 Human serum albumin ............................................................................ 32

1.22 Conjugation chemistry ............................................................................ 33

1.23 Objectives ................................................................................................ 35

CHAPTER 2: MATERIALS AND METHODS .......................................................... 36

PART A Purification and antigenic evaluation of lipopolysaccharides and

O-specific polysaccharides of Vi negative Salmonella Typhi ............ 36

2.1 Bacterial isolates ..................................................................................... 36

2.2 Biochemical identification ...................................................................... 36

2.2.1 TSI agar slants ......................................................................................... 36

2.2.2 Remel kit for S.Typhi identification ........................................................ 37

2.2.3 API 20 E kit for P. aeruginosa identification ......................................... 37

2.3 Molecular identification .......................................................................... 38

2.3.1 DNA extraction ....................................................................................... 38

2.3.2 DNA quantification ................................................................................. 39

2.3.3 Duplex PCR for identification of S. Typhi (Vi negative isolates) .......... 39

2.3.3.1 PCR Reaction mixture ............................................................................. 39

iii

2.3.3.2 Thermal cycler profile ............................................................................. 39

2.3.3.3 Agarose gel electrophoresis .................................................................... 40

2.4 Fermentation ............................................................................................ 40

2.4.1 Media preparation ................................................................................... 40

2.4.2 Inoculum and growth .............................................................................. 40

2.4.3 Killing and harvesting of bacteria ........................................................... 41

2.5 Phenol extraction of Lipopolysaccharides (LPS) from S. Typhi ............ 41

2.5.1 Estimation of nucleic acids contamination in LPS .................................. 42

2.6 Core hydrolysis of LPS to purify O-specific polysaccharides (OSP) ..... 43

2.7 SDS-PAGE .............................................................................................. 43

2.8 Silver staining for detection of LPS after SDS-PAGE ............................ 44

2.9 Alditol acetate assay for determination of sugars in S. Typhi ................. 44

2.10 Immunodiffusion assay ........................................................................... 45

2.10.1 Inoculation of plates ................................................................................ 45

2.10.2 Staining and de-staining of plates ........................................................... 46

PART B Production and use of recombinant Exoprotein A of Pseudomonas

aeruginosa as carrier protein for conjugation .................................... 46

2.11 Identification of Pseudomonas aeruginosa ............................................. 46

2.11.1 Biochemical identification of P. aeruginosa strains…………..………..46

2.11.2 Identification of P. aeruginosa isolates by multiplex PCR ..................... 46

2.11.2.1 M-PCR master mix.................................................................................. 46

2.11.2.2 Thermal cycler profile ............................................................................. 47

2.11.2.3 DNA sequencing ..................................................................................... 48

2.12 Plasmid harboring recombinant exoprotein A (rEPA) gene ................... 48

2.12.1 Amplification of rEPA gene (full length) ............................................... 48

2.12.2 Purification of PCR product .................................................................... 48

2.13 Restriction of vector DNA and amplified gene product ......................... 49

2.13.1 Excision and purification of desired bands from gel ............................... 49

2.13.2 Dephosphorylation of vector DNA sequence .......................................... 50

2.13.3 Quantification of DNA on gel ................................................................. 50

2.14 Ligation ................................................................................................... 50

iv

2.15 Preparation of bacterial competent cells ................................................. 51

2.15.1 OmniMax competent cells ...................................................................... 51

2.15.2 BL21 (DE3)-C41 competent cells ........................................................... 51

2.16 Transformation in competent cells .......................................................... 51

2.17 Confirmation of transformation .............................................................. 52

2.17.1 Plasmid isolation and digestion ............................................................... 52

2.17.2 DNA sequencing and sequence analysis ................................................. 52

2.18 Expression of rEPA protein..................................................................... 53

2.18.1 Optimization of induction with different temperatures ........................... 53

2.18.2 Optimization of expression with IPTG concentration ............................. 53

2.18.3 Expression optimization with post induction time .................................. 53

2.19 Purification of recombinant exoprotein A (rEPA) of P. aeruginosa ...... 53

2.19.1 Purification from soluble fraction ........................................................... 54

2.19.2 Purification from insoluble fraction (Inclusion bodies) with imidazole . 54

2.20 SDS-PAGE for Protein............................................................................ 56

2.21 Determination of protein concentration .................................................. 56

2.21.1 Bradford assay for protein ....................................................................... 56

2.21.2 Bicinchoninic acid assay (BCA) for protein determination .................... 57

2.22 Matrix assisted laser desorption ionization (MALDI) analysis of rEPA 57

2.23 Removal of His-tag from protein ............................................................ 58

2.23.1 Cleavage of rEPA using TEV protease ................................................... 58

2.23.2 Removal of TEV protease from cleavage Reactions .............................. 58

2.24 Western Blot analysis .............................................................................. 58

2.24.1 Transfer of rEPA on PVDF membrane by semi-dry blotting ................. 58

2.24.2 Blotting .................................................................................................... 59

2.25 Structural analysis of rEPA ..................................................................... 59

PART C Preparation of Vi negative Salmonella Typhi OSP conjugates with

carrier proteins ...................................................................................... 60

2.26 Conjugation strategies ............................................................................. 60

2.27 Conjugation by reductive amination ....................................................... 61

2.27.1 Separation of HMW conjugates by 6B column ...................................... 61

v

2.28 Derivatization of Vi negative S. Typhi OSP with ADH ......................... 62

2.28.1 TNBS assay for determination of hydrazide group ................................. 62

2.28.2 NMR for determination of derivatized OSP with ADH .......................... 63

2.29 Conjugation by cyano dimethyl amino pyridinium-tetrafloroborate

(CDAP) method....................................................................................... 63

2.30 Determination of protein concentration by BCA .................................... 64

2.31 Dubois assay for carbohydrate concentration estimation ........................ 64

2.32 MALDI-TOF analysis of conjugates ....................................................... 64

2.33 SDS-PAGE for conjugates ...................................................................... 64

2.34 Western blotting for conjugates .............................................................. 64

2.35 Immunogenicity evaluation of vaccine candidates ................................. 64

2.35.1 Description of adjuvant used in vaccine preparation .............................. 64

2.35.2 Preparation of vaccine candidate ............................................................. 65

2.36 Mice ......................................................................................................... 65

2.36.1 Immunization schedule and route of immunization ................................ 65

2.37 ELISA...................................................................................................... 65

2.39 Statistics .................................................................................................. 66

3.40 Comparison off all conjugates ................................................................. 66

CHAPTER 3: RESULTS ............................................................................................... 68

PART A Purification and antigenic evaluation of lipopolysaccharides and

O-specific polysaccharides of Vi negative S. Typhi ............................ 68

3.1 Biochemical identification of S. Typhi ................................................... 68

3.2 Duplex PCR for confirmation of Vi negative S. Typhi isolate ............... 68

3.3 Purification of lipopolysaccharides (LPS) from S. Typhi ....................... 68

3.4 Purification of O-specific polysaccharides (OSP) of S. Typhi ................ 69

3.5 Analysis of purified LPS and OSP .......................................................... 69

PART B Production and use of recombinant exoprotein A of Pseudomonas

aeruginosa as a carrier protein for conjugation ................................. 69

3.6 Identification of P. aeruginosa isolate .................................................... 69

3.7 Amplification of rEPA gene (full length) ............................................... 70

3.9 Expression and puirfication of the rEPA protein .................................... 70

vi

3.10 MALDI analysis of rEPA ........................................................................ 70

3.11 Removal of His-tag from rEPA protein .................................................. 70

PART C Preparation and immunological evaluation of Vi negative S. Typhi

OSP- protein conjugates ....................................................................... 72

3.12 Conjugates prepared by reductive amination .......................................... 72

3.13 Conjugates prepared by CDAP method .................................................. 72

3.14 Protein and OSP concentration in prepared conjugates .......................... 73

3.15 MALDI-TOF analysis of conjugate ........................................................ 73

3.16 SDS-PAGE and Western blot of conjugates ........................................... 73

3.17 Immunogenicity of OSP conjugates in mice ........................................... 74

3.18 Statistical analysis ................................................................................... 74

CHAPTER 4: DISCUSSION ...................................................................................... 110

4.1 O-specific polysacchrides purification and antigenic evaluation .......... 112

4.2 rEPA protein purification ...................................................................... 113

4.3 Conjugate Vaccines Candidates ............................................................ 115

Future prospects..............................................................................…...119

CHAPTER 5: REFERENCES .................................................................................... 120

APPENDICES ............................................................................................................... 144

Appendix 1 Preparation of Tryptic soy broth (TSB) ................................................ 144

Appendix 2 Preparation of Macconkey agar medium .............................................. 144

Appendix 3 Preparation of Triple sugar iron (TSI) agar ........................................... 145

Appendix 4 remel kit identification results ............................................................... 146

Appendix 5 Reagents for DNA extraction ................................................................ 147

Appendix 6 Reagents for agarose gel electrophoresis .............................................. 149

Appendix 7 Preparation of Polyacrylamind gel electrophoresis ............................... 150

Appendix 8 Solutions of silver staining .................................................................... 152

Appendix 9 DNA sequencing protocol ..................................................................... 153

Appendix 10 LB growth / expression media .............................................................. 154

Appendix 11 Solutions preparation for plasmid isolation .......................................... 155

Appendix 12 ELISA.................................................................................................... 156

PUBLICATIONS AND PRESENTATIONS

vii

LIST OF FIGURES

Figure 1.1: General overview of the current classification of Salmonella enterica ........... 2

Figure 1.2: Dissemination and complications of Salmonella Typhi .................................. 6

Figure 1.3: Schematic diagram of lipopolysaccharide (LPS) structure ............................ 17

Figure 1.4: Structure of the O-specific polysaccharides of S. Typhi ................................ 19

Figure 1 5: New model for antigen processing and presentation of conjugate ................. 25

Figure 1.6: Structure of exoprotein A of Pseudomonas aeruginosa ................................ 31

Figure 1.7: Structure model of Human serum albumin protein ........................................ 33

Figure 1.8: Reductive amination of proteins and carbohydrates ...................................... 34

Figure 2.1: Flow chart diagram for expression and purification of rEPA protein ............ 55

Figure 2.2: Flow chart for elucidation of conjugation strategies ...................................... 60

Figure 3.1: Salmonella Typhi on MacConkey agar plate ................................................. 75

Figure 3.2: Biochemical identification of Salmonella Typhi on TSI slants ..................... 75

Figure 3.3: Remel kit analysis of S. Typhi........................................................................ 76

Figure 3.4: Duplex PCR for S. Typhi Vi positive and Vi negative strains ....................... 76

Figure 3.5: Silver staining of LPS of S. Typhi .................................................................. 77

Figure 3.6: OSP purification on Sephadex G-25 ............................................................. 77

Figure 3.7: Alditol acetate assay for Sugar determination in S. Typhi OSP .................... 78

Figure 3.8: Double Immunodiffusion assay of S. Typhi LPS samples ............................ 78

Figure 3.9: Pseudomonas aeruginosa on nutrient agar plate ............................................ 79

Figure 3.10: API 20 E results for Pseudomonas aeruginosa ............................................ 79

Figure 3.11: Multiplex PCR for identification of P. aeruginosa ...................................... 80

Figure 3.12: Sequences of multiplex PCR genes submitted in GenBank ......................... 81

Figure 3.13: rEPA gene product ....................................................................................... 82

Figure 3.14: Strategy for cloning of rEPA in pET-28a-TEV............................................ 83

Figure 3.15: E. coli cells transformed with pMSE 5 plasmid ........................................... 84

Figure 3.16: Restriction analysis of pMSE 5 recombinant clone ..................................... 84

Figure 3.17: DNA sequence of rEPA gene ....................................................................... 85

Figure 3.18: Expression of rEPA-His6 in E. coli strain at 37 °C with 1mM IPTG. ......... 86

Figure 3.19: Optimization of expression at different temperature .................................... 87

viii

Figure 3.20: Optimization of expression by varying IPTG concentration ........................ 88

Figure 3.21: Optimization at of expression with extending post-induction time. ............ 89

Figure 3.22: Purification of His-tagged rEPA from supernatant ...................................... 90

Figure 3.23: Purification of His-tagged rEPA from pellet ................................................ 91

Figure 3.24: Purification of His-tagged rEPA from pellet by pH gradient ....................... 92

Figure 3. 25: MALDI-TOF analysis of rEPA ................................................................... 93

Figure 3. 26: PAGE and Western blot for rEPA cleavage ................................................ 94

Figure 3. 27: Translation of DNA sequence to protein ..................................................... 95

Figure 3. 28: Structure of rEPA protein ............................................................................ 96

Figure 3.29: 1H-NMR spectrum of ADH linked OSP ...................................................... 97

Figure 3.30: MALDI for Conjugate 1 (OSP – HSA) ........................................................ 98

Figure 3. 31: Coomassie staining and Western blot analysis of OSP – HSA conjugate .. 99

Figure 3.32: Coomassie staining and Western blot analysis of OSP – rEPA conjugate 100

Figure 3.33: Coomassie staining and Western blot of OSPADH-HSA conjugate ............ 101

Figure 3.34: Coomassie staining and Western blot of OSPADH-rEPA conjugate ........... 102

ix

LIST OF TABLES

Table 2.1: Primers used in this study ................................................................................ 47

Table 2.2: Table for illustration of indirect ELISA on Plates ........................................... 67

Table 3.1: Summary of IgG ELISA readings for all conjugates..................................... 104

Table 3.2: Nucleic acid and protein concentration in Vi negative S. Typhi LPS ........... 105

Table 3.3: TNBS assay to determine of OSP - ADH linkage ......................................... 106

Table 3.4: Determination of protein concentration in S. Typhi Vi negative OSP .......... 107

Table 3.5: Determination of OSP concentration in S.Typhi OSP conjugates ................. 108

Table 3.6: Immunogenicity of Salmonella OSP alone and conjugates ........................... 109

x

LIST OF ABBREVIATIONS

AA Alditol acetate

ANOVA Analysis-of-variance

APS Ammonium per sulfate

BPB Bromophenol blue

BCA Bicinchoninic acid assay

CDAP 1-cyano-4-dimethylaminopyridinium tetrafluoroborate

CTAB Cetyl trimethylammonium bromide

DNA Deoxy ribonucleic acid

DT Diphtheria toxoid

E. coli Escherichia coli

EDC 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride

EDTA Ethylene diamine tetra acetic acid

ELISA Enzyme linked immunosorbent assay

GC Gas chromatography

HMW High molecular weight

HSA Human serum albumin

IgG Immunoglobulin G

IgM Immunoglobulin M

IPTG Isopropyl-β-D-thiogalactoside

KDO 3-deoxy-D-manno-oct-2-ulosonic acid

LC Liquid chromatography

LMW Low molecular weight

LPS Lipopolysaccharides

MALDI-TOF

MDR Multidrug resistance

MLST Multi locus sequence typing

MS Mass spectrometry

MSE 4-morpholineethane sulfonic acid

MW Molecular weight

Matrix Assisted Laser Desorption Ionization - Time of Flight

xi

Ni-NTA Nickel- Nitrilotriacetate agarose

NMR Nuclear Magnetic Resonance

OD Optical density

OSP O-specific polysaccharides

PAGE Polyacrylamide gel electrophoresis

PBS Phosphate buffered saline

PCR Polymerase chain reaction

PFGE Pulsed field gel electrophoresis

PMSF Phenyl methyle sulfonyl fluoride

PVDF Polyvinylidene fluoride

rEPA Recombinant exoprotein A of Pseudomonas aeruginosa

RFLP Restriction fragment length polymorphism

RI Refractive index

RNA Ribonucleic acid

rpm Rounds per minute

S. Typhi Salmonella enterica serovar Typhi

SDS Sodium dodecyl sulfate

TBST Tris-buffered saline tween

TEA Tri-ethylamine

TEMED Tetra methyl ethylene diamines

TEV Tobacco etch virus

TFA Trifloro acetic acid

TNBS Trinitro benzene sulfonic acid

TSB Tryptic soy broth

TSI Triple sugar iron

xii

ABSTRACT

Salmonella enterica serovar Typhi (S. Typhi) is the cause of typhoid fever in humans.

Although typhoid fever has almost vanished from developed countries, it is still a major

cause of morbidity and mortality in the developing world. Its global annual incidence has

increased from 21 million cases to 26.9 million cases during the period 2000 to 2010.

Typhoid fever is curable with high dose of several antimicrobials but the treatment is

time consuming and expensive. Vaccines are the eventual source of prevention from

typhoid fever. At present, licensed typhoid vaccines are based on Vi polysaccharides.

These vaccines are not useful for children of less than 2 years of age and are ineffective

against the infections caused by Vi negative S. Typhi strains. O-Specific polysaccharides

(OSP) from lipopolysaccharides (LPS) are universally present in both Vi positive and Vi

negative S. Typhi and their conjugation with a potential immunogenic protein can make

them useful for children below 2 years of age and to elicit humoral as well as cellular

immune response. Therefore, we planned to prepare polysaccharide-protein conjugates of

Vi negative S. Typhi as potential vaccine candidates. Initially, we purified OSP from the

extracted LPS of a local Vi negative S. Typhi isolate and checked its antigenicity against

polyclonal mice antisera. To conjugate a carrier protein with the purified OSP, we used

the recombinant exoprotein A of Pseudomonas aeruginosa (rEPA) and human serum

albumin (HSA). For production of recombinant rEPA, full length rEPA gene was cloned

in expression vector. Protein expression was optimized using different isopropyl-β-D-

thiogalactoside (IPTG) concentrations, various temperatures and post-induction time. The

expressed protein was purified on Ni-NTA chromatography column from soluble fraction

as well as from inclusion bodies. His-tag was removed from rEPA using tobacco etch

virus (TEV) protease. Polyacrylamide gel and Western blot procedures were performed

to check the purity of the protein. We synthesized four glycoconjugate vaccine candidates

of Vi negative S. Typhi OSP using sodium cyanoborohydride (reductive amination) and

1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP). Each of the conjugate

was injected to mice on day 1, day 21 and day 42. The immune response (IgG) against

prepared conjugates were determined using enzyme-linked immunosorbent assay

xiii

(ELISA) and the results were interpreted by one way ANOVA using all conjugate groups

vs. OSP control group. The conjugate 2 elicited significantly high (P = 0.0001) antibody

titer, while the titers produced by conjugate 1 (P = 0.037), conjugate 3 (P = 0.302) and

conjugate 4 (P = 0.416) were not significantly higher than that of the control group. We

conclude that the conjugate 2 (OSP-rEPA) has the potential to be evaluated further and

recommended for the clinical trials.

1

CHAPTER 1

Introduction and review of literature

1.1 Salmonella

Salmonella are Gram negative, motile, facultative anaerobic, non-spore forming,

flagellated bacilli, ranging from 2 to 3 µm in length and 0.4 to 0.6 µm in diameter.

Salmonella mainly infect human and cause typhoid fever which is also known as enteric

fever (Crump and Mintz, 2010). Typhoid means typhus-like, while typhus is from Greek

word “Typhos” which means smoke, it was believed that the cause of typhoid was

smoke. Typhoid fever was first discovered by Willis in 1643. The genus name

Salmonella is in tribute of Dr. D.E. Salmon, who discovered Salmonella from the pig

intestine (Agbaje et al., 2011).

1.2 Taxonomy and nomenclature

Genus Salmonella belongs to family enterobacteriaceae. Various systems of

nomenclature have been adopted. they divide the genus into species, subspecies,

subgenera, groups, subgroups and serovars (Brenner et al., 2000). Salmonella is

comprised of two distinct species: Salmonella bongori and Salmonella enterica.

Salmonella enterica is further divided into six subspecies; Salmonella enterica subspecies

enterica (type I), Salmonella enterica subspecies salamae (type II), Salmonella enterica

subspecies arizonae (type IIIa), Salmonella enterica subspecies diarizonae (type IIIb),

Salmonella enterica subspecies houtenae (type IV) and Salmonella enterica subspecies

indica (type VI). Furthermore, each subspecie has various divisions known as serovars or

serotypes. At the DNA level, both S. bongori and S. enterica are 95-99% identical (Lahiri

et al., 2010). Serovars are based on somatic (O), flagellar (H) and capsular (Vi) surface

antigens of Salmonella (Scheelings et al., 2011; Kisiela et al., 2012). The terms “O"

stands for “ohne Hauch” [Ger. without film], "H" for “Hauch” and "K" for “Kapsel”. A

variety of antigens combinations within S. enterica subspecies enterica has resulted in

1500 serovars while 1000 serovars have been formed by its combination with S. bongori

(Achtman et al., 2012). More than 2500 Salmonella serovars have been identified

IntroductionandReviewofLiterature Chapter1

2

globally (Figure 1.1). Serovars are usually recognized by chain of the antigens, denoted

as the “antigenic formula” (Hendriksen et al., 2009).

Figure 1.1 : General overview of the current classification of Salmonella enterica

The classification provides information that S. Typhi is the lonely cause of typhoid fever in human. Figure adopted from Achtman et al. (2012).

The names of Salmonella serovars are based on diseases or animals from which

the organisms are isolated, such as S. Typhi and S. Typhimurium or by the geographical

locality where the strain is first reported, such as S. London and S. Panama (Agbaje et al.,


3

2011). The serovar which causes typhoid in human is known as Salmonella enterica

subspecie enterica serovar Typhi (S. Typhi).

Last common ancestor of S. enterica and Escherichia coli was found

approximately 15,000–150,000 years ago and S. Typhi is almost 50,000 years old

(Kidgell et al., 2002).

1.3 Epidemiology

Salmonella serovars have a wide host range. These are prevalent in warm-blooded

animals, wild birds, cold blooded animals, free living terrestrial and aquatic turtles.

Majority of Salmonella strains belonging to subspecies I (S. enterica subsp. enterica) are

pathogenic to humans (Agbaje et al., 2011). Enteric fever is one of the immense public

health problems globally (Crump and Mintz, 2010). Although typhoid fever has vanished

from developed countries, however it is still a serious issue in the developing world.

Global estimate for typhoid fever was reported by WHO in 2000, when more than 21

million typhoid fever cases appeared annually and led to approximately 216,000 deaths

per year (Crump and Mintz, 2010). However in year 2010, the estimated total number of

typhoid fever episodes was 13.5 million, while estimate for low blood cultures sensitivity

were 26.9 million cases. Affected population mainly contains infants, children of school

age and adolescents. South-central and South-eastern Asia experienced the greatest

burden of illness (Crump et al., 2004; Crump and Mintz, 2010).

In the initial years of this century, enteric fever has emerged in the African, Asian,

and Latin American regions. Frequent typhoid outbreaks reported zone is sub-Saharan

Africa. In this outbreak large numbers of patients attain severe stage of typhoid and

diagnose with intestinal perforations (Muyembe-Tamfum et al., 2009). In sub-Saharan

Africa, typhoid is not well characterized, however, studies based on hospitals of these

regions show that non-Typhi serotypes of Salmonella such as S. Enteritidis, S.

Typhimurium, S. Paratyphi and S. Typhi are the cause of bloodstream infection. Typhoid

rate in Latin America and sub-Saharan Africa is 50 cases per 100,000 population (Mweu

and English, 2008; Reddy et al., 2010).

In the typhoid affected population, morbidity and mortality rate is as higher as

90% in Asia (Crump et al., 2004). A large population-based prospective study was

conducted in 2008 in Asia (Ochiai et al., 2008). Standardized surveillance methods were


4

used in this study to estimate typhoid fever rate in China, Pakistan, India, Indonesia and

Vietnam. The study confirmed high incidence rate of typhoid fever in these regions,

particularly among children and adolescents. Average incidence rate of typhoid fever

recorded was as follows: 451.7 cases in Pakistan, 214.2 cases in India, 81.7 cases in

Indonesia, 43.6 cases Vietnam and 15.3 cases in China per 100,000 people annually. The

data show that the highest affected region is South Asia (Pakistan and India) and

specially Pakistan (Ochiai et al., 2008).

In another study, Southeast Asia was found as the third highest typhoid affected

region, where estimated typhoid incidence was 110 cases per 100,000 population and

Pakistan is located in this zone (Siddiqui et al., 2006). While recent survey indicated that

the number of cases exceed 700 / 100,000 (Buckle, Walker et al. 2012).

Usually the typhoid rate remains very high in urban slums. One study reveals that

in Karachi (Pakistan), Kolkata (India) and North Jakarta (Indonesia) the occurrence of

blood-confirmed typhoid fever cases ranged 180 - 494 cases per 100,000 among children

having age 5 to 15 years (DeRoeck et al., 2007), while in urban slum of Dhaka

(Bangladesh) the incidence of bacteremic typhoid fever was 390 people per 100,000 of

population. For pre-school kids, the determined risk rate was 9-fold higher than that in

older people (Brooks et al., 2005).

Last typhoid outbreak took place in the Democratic Republic of Congo (27

September 2004 to early January 2005), where 42564 typhoid fever cases were reported

with 214 deaths and 696 peritonitis and intestinal perforations (Muyembe-Tamfum et al.,

2009).

1.4 Genome of S. Typhi

Complete genome sequence of individual species, subspecies, serovars and

different isolates facilitate the characterization of microbes (Deng et al., 2003; Parkhill et

al., 2001). Hence, genetic blueprint of the bacteria can discriminate phenotypically

similar isolates from closely related microbes. Generally genome of the S. Typhi consists

of about 5 million base pairs which encode 4000 genes, out of which more than 200

genes are non-functional. Comparison of S. Typhi isolates from all over the world

signifies that they are highly related and come out from a single origin. S. Typhi has

recently acquired some genes by horizontal gene transfer such as Vi antigen encoding


5

genes. Complete DNA sequences of two different S. Typhi isolates are accessible in

public databases. One is Ty2 strain (classic S. Typhi type) and other is CT18 strain, a

multidrug-resistant (MDR) isolate collected in Vietnam in 1992 (Baker and Dougan,

2007).

S. Typhi Ty2 genome contains 4.791961 mega bp, as a single circular chromosome with

almost 52.05% GC content. C/G distribution in bacteria switches its polarity at both the

origin and the terminal ends. There are 4339 Open reading frames (ORFs), 206

pseudogenes and 101 RNA genes predicted in Ty2. These have 910 bp average length

and cover 88% of the genome (Deng et al., 2003). While total genome size of CT 18 is

4.809037 mega bp which encode about 4600 genes and it harbors two plasmids pHCM1

and pHCM2 which are absent in Ty2. Functions of 20% encoded genes of the genome are

completely unknown (Parkhill et al., 2001; Deng et al., 2003).

1.5 Pathogenesis

S. Typhi enters the body by faeco-oral route. Contaminated water and food are the

important sources for its transmission. Infectious quantity of S. Typhi dose ranges from

1000 to 1,000,000 bacteria. Typical incubation period of S. Typhi is 7 – 14 days (Parry et

al., 2002). Naturally, low gastric pH is the preliminary defence mechanism against

bacteria. However, S. Typhi combats the unfavourable conditions, survives and reaches

the small intestine. In small intestine, S. Typhi adheres to mucosa, travels across the

epithelial cells and reaches the M cells (special epithelial cells present on Peyer’s

patches). These M cells are the internalization sites for S. Typhi. Peyer’s patches are

aggregated lymphoid nodules of the terminal ileum; their main function is transportation

to the lymphoid tissues. Following contact with M cells, S. Typhi get internalized and are

detected by antigen presenting cells (APC), where they are phagocytised and neutralized

(de Jong et al., 2012).

The infected phagocytes become pathological lesions, surrounded by normal

tissue. Failure of pathological lesions formation results in abnormal growth and

dissemination of the bacteria in the infected tissues (Kaur and Jain, 2012). Once the

bacteria penetrate the mucosal barrier, they arrive at the intestinal lymphoid follicles and

flow with mesenteric lymph nodes. Some bacteria reach the reticuloendothelial cells of

the liver; the place where S. Typhi is killed by macrophages, however, they are capable to


6

survive and multiply (Parry et al., 2002). In bacteremic phase of disease it is widely

dispersed throughout the body and is known as dissemination of the organisms.

Frequently affected sites for secondary infection of S. Typhi are gallbladder, liver, spleen,

bone marrow and Peyer’s patches in the terminal ileum. Gallbladder is prominent

reservoir for chronic infection of S. Typhi. The bacterium can reinvade the intestinal wall

by secretion from bile (Shukla et al., 2000).

Figure 1.2: Dissemination and complications of Salmonella Typhi

Diagram illustrates complete circle of S. Typhi inside human body, adopted from de Jong et al. (2012).

1.6 Clinical manifestations

Typhoid fever is an ailment with sever clinical toxicity and possibly leads to

death. The clinical symptoms and severity of the disease vary with the affected

population. Hospitalized typhoid patients are mainly children or 5 – 25 years old adults

(Parry et al., 2002).

In first week, typical disease characteristics include bacteraemia, fever and

nonspecific symptoms such as chills, headache, anorexia, sore throat, myalgia, psychosis


7

and mental confusion in 5 – 10% of patients. A coated tongue, hepatomegaly,

splenomegaly and tender abdomen are also frequent (Kaur and Jain, 2012).

In second week, several rose spots and blanching erythematous maculopapular

lesions appear on abdomen and chest while seldom on the back, arms, and legs. The

lesion size is usually 2 – 4 mm in diameter. These lesions occur in 5 – 30% cases. Some

of the patients may affect with bradycardia combined with fever, constipation or diarrhea.

If typhoid patients are not diagnosed correctly or treated properly, as a result the

disease may enter to the third week. The inflammatory lesions become severe in Peyer’s

patches and intestinal lamina propria (with abundant monocytes, macrophages and

lymphocytes). A lymphoid hyperplasia (abnormal cell count increase) in the ileocecal

(the cavity in which the large intestine begins and into which the ileum opens) area is

followed by ulceration and necrosis (cellular death) which ultimately leads to

gastrointestinal bleeding or intestinal perforation.

Usually the fever declines in 4th week of the disease and 90% of the patients

survive even without antibiotic therapy. Nevertheless, patient feels weakness and weight

loss for few months (Parry et al., 2002; Kaur and Jain, 2012).

1.7 Diagnosis

Diagnosis of the typhoid fever is often difficult in the regions where it is common,

because symptoms of typhoid overlap with febrile illness caused by other pathogens such

malaria, dengue fever, leptospirosis, rickettsioses and melioidosis (Baker et al., 2010).

1.7.1 Microbiological culture

Identification of S. Typhi from blood culture is regular and reliable diagnostic

method since 1900 (Wain and Hosoglu, 2008). For microbiological assay, 5 – 10 mL of

S. Typhi culture is usually required to grow in 30 - 50 mL of broth. The chance of

bacterial detection increases with blood volume, therefore this is not an appropriate

method for children. Using blood culture technique, only 45 – 70% of patients can be

diagnosed with typhoid fever (Zhou and Pollard, 2012). Recent antibiotic administration

in typhoid patient during bacteremic level can fail to identify bacteria because of

bactericidal action in blood. Furthermore, quality of the culture medium and incubation

period can affect the sensitivity of the microbes (Wain et al., 2008). During sample


8

isolation, if S. Typhi resides intracellular, it slows down the growth rate in blood culture.

One study reveals that more than 50% of the bacteria remain intracellular during culture

(Wain et al., 2001). Identification of S. Typhi from blood culture takes 2 to 5 days which

delay the appropriate antibiotic dose administration (Zhou and Pollard, 2012).

In the developed world, the procedure followed for blood culture is semi-

automated and is performed under the surveillance of integrated system. It has better

specificity and standardization. On contrary, in the developing countries blood culture

facilities are available in limited number of hospitals and are not automated. Therefore

main disadvantage of semi-automated blood culture facility is cost effectiveness in poorer

regions (Baker et al., 2010). Additionally in a single tropical geographical region, blood

culture may exhibit results confusing with other microbes (streptococci), parasites

(plasmodium) and viruses (dengue) (Murdoch et al., 2004; Zimmerman et al., 2008).

Bone marrow culturing is very much sensitive than blood culture but again this is

not a straightforward technique because sampling need expertise (Baker et al., 2010).

After the onset of infection, immune system of the body produces antibodies which

neutralize the pathogenic effect of S. Typhi.

1.7.2 Serology

Widal was the first test, developed in 1896, to identify typhoid fever and is still in

use. This technique is dependent on agglutination in which antibodies produced against S.

Typhi are detected in-vitro. Widal’s test is based on visual identification of antibody

interaction with S. Typhi so there are many chances of artifacts. Members of

Enterobacteriaceae family other than S. Typhi produce similar surface antigens and

induce identical antibodies that lead to cross-reactivity which decrease the sensitivity and

specificity (Parry et al., 2002).

Several commercial serology based kits are available for typhoid diagnosis such

as Typhidot and Tubex (Prakash et al., 2007; Lim and Thong, 2009) but their results have

similar problems like Widal’s test. These assays were evaluated in different countries but

sensitivity and specificity of Tubex was 70% and that of Typhidot was 80% in all

locations (Dutta et al., 2006; Ochiai et al., 2008).


9

1.7.3 Modified diagnostic methods

Molecular techniques are helpful in early detection of the disease because they

target the pathogen directly instead of antibodies produced against it. DNA hybridization

was the first molecular biology technique applied for the typhoid diagnosis (Tsang and

Wong, 1989). The specificity of the hybridization technique was up to 99% but the

sensitivity was quite poor and it could not detect bacteria less than 500 /mL (Rubin et al.,

1989). Phage typing method is used to identify different strains of bacteria within a single

species. This method is useful to trace the source of infection outbreaks (Baggesen et al.,

2010). In one study, Salmonella strains taken from different origins were differentiated

by phage-typing method; 75 phage types were produced and all results were reproducible

even after a few months, on contrary just 5% strains were classified with serological

assay (Castro et al., 1992).

Indirect enzyme-linked immunosorbent assay (ELISA) is also a diagnostic

method used for Salmonella detection. In one report, group D Salmonella antigen 9

specific monoclonal antibodies were used in indirect ELISA to check the antigens in

typhoid patients’ samples collected in Jakarta, Indonesia. Sensitivity of the ELISA was

95% in samples collected from blood; sensitivity from stool specimens was 73% and

samples isolated from bone marrow exhibited 40% sensitivity (Chaicumpa et al., 1992).

There are various other molecular techniques used to detect Salmonella, for example

fluorescently labeled amplified-fragment length polymorphism (FAFLP) (Lindstedt et al.,

2000), pulsed-field gel electrophoresis (PFGE), antibiogram and automated ribotyping

(Kim et al., 2009), multilocus sequence typing (MLST) (Achtman et al., 2012) and

fluorescence is situ hybridization (FISH) (Almeida et al., 2013).

1.7.4 PCR base diagnosis

Nowadays, PCR is considered as the most authentic method for detection of

pathogens. The introduction of PCR technology in laboratories provided incredible

sensitivity and specificity for diagnosis of S. Typhi by amplifying fliC gene (Song et al.,

1993). A PCR assay was developed for amplification of H1-d flagellin gene, the

amplified product was 486 bp with good sensitivity and specificity (Chaudhry et al.,

1997). Sensitivity of regular PCR reported by Song et al.(1993) was improved 10 fold by

Haque et al. (Haque et al., 1999), the report also showed that sensitivity of the nested


10

PCR is suitable to detect as less as 5 bacteria /mL. The amplification of fliC gene proved

that this is an excellent choice for diagnosis of S. Typhi in patient samples (Haque et al.,

2001).

Ali et al. (2009) developed a nested multiplex PCR targeting five different genes (prt,

tyv, viaB, fliC-d and fliC-a) for the diagnosis of typhoidal pathogens. The PCR was

optimized to detect just 10 bacteria /mL and applied on clinical blood samples. Forty two

blood samples were positive with multiplex PCR, 26 were Vi-positive, 9 were Vi-

negative S. Typhi, 2 were S. Paratyphi A, and 5 patients were diagnosed with mixed

infection while only 17 Salmonella were culture positive. The developed multiplex PCR

based on detection of Salmonella from blood samples was specific, sensitive and rapid.

1.8 Treatment

1.8.1 Treatment in non-endemic region

In countries where S. Typhi is not resistant to drugs; chloramphenicol,

trimethoprim–sulfamethoxazole and amoxicillin are appropriate antibiotics for the

typhoid treatment. These drugs are inexpensive, available commonly and have rare side

effects. The administration of these antibiotics subside the symptoms of fever within five

to seven days. Required dose is usually 4 times a day for 2 to 3 weeks of treatment. Cure

rate is 95%, convalescent excretion rate is 2 – 10% and relapse rate is 1 – 7% (Parry et

al., 2002).

1.8.2 Treatment in endemic region

In endemic typhoid fever areas; almost 60 – 90% of the typhoid cases are handled

at home with appropriate antibiotic therapy and bed rest. However, careful attention is

necessary along with antibiotics for indoor patients at hospitals to avert death.

Fluoroquinolones are the most appropriate antibiotics against typhoid fever in endemic

regions. These drugs are safe and effective in all age groups even with short courses (3 to

7 day) of treatment (Parry et al., 2007; Chinh et al., 2000). These drugs subside typhoid

fever within 4 days, cure rate is more than 96% and only 2% of the treated individuals

face persistent faecal carriage problem or relapse. Severe typhoid is characterized by

obtundation, stupor, delirium, coma and shock in adults and children. In such cases,

fluoroquinolones are recommended for at least 10 days. There are rare reports regarding


11

full fluoroquinolone resistance, therefore, fluoroquinolones are the drugs of choice for

typhoid treatment in infrequent quinolone-resistant areas. However, there are three major

limitations concerning the use of fluoroquinolones in the treatment of enteric fever; they

are expensive, affect children with potential toxicity and resistance may emerge against

it. Cephalosporins (ceftriaxone, cefotaxime, cefixime, and cefoperazone) as well as

azithromycin are effective drugs against typhoid (Parry et al., 2002).

Prompt administration of dexamethasone is beneficial in severe cases of typhoid.

In one study involving Indonesian adults and children affected with S. Typhi, the patients

were treated with dexamethasone infusion at initial dose of 3 mg /kg for 30 minutes

followed by 1 mg of dexamethasone per kg after every 6 hours for 8 doses, consequently

the death rate was reduced from 50 – 10% (Rogerson et al., 1991). There is little data

available on treatment of typhoid fever affecting pregnant women; however beta lactam

antibiotics are considered safe in this case (Carles et al., 2002).

1.9 Drug resistance

In 2008, five Asian countries (Pakistan, India, Vietnam, China and Indonesia)

were selected to study typhoid fever (Ochiai et al., 2008). A total of 441435 persons were

kept under surveillance for one year. During the observation, 21874 peoples were

detected with fever lasting for 3 days and 475 persons were found S. Typhi positive on

blood culture. On antimicrobial therapy S. Typhi isolates were susceptible in all sites

except Pakistan; 127 out of 189 isolates (67%) were analyzed in Pakistan and were tested

using all six susceptibility tests. Sixty percent of these 127 isolates were resistant to

ampicillin, chloramphenicol, trimethoprim-sulfamethoxazole and nalidixic acid. S. Typhi

isolates from China and Indonesia were susceptible to all antibiotics used. MDR isolates

observed in Pakistan were 83 (65%), 9 (7%) in India, 4 (22%) in Vietnam. No MDR was

reported in isolates from China or Indonesia. Nalidixic acid resistance was 75 (59%) in

Pakistan, 8 (44%) in Vietnam and 69 (57%) in India. However no resistance was

observed against the drug in China and Indonesia. In India, 2 isolates (1.6%) were found

resistant to ciprofloxacin (Ochiai et al., 2008).

Fluoroquinolones are known as primary antibiotics in the therapy for invasive

salmonellosis. However, high prevalence and wide distribution of MDR among

Salmonella strains leads to resistance against fluoroquinolones. Excessive use of


12

fluoroquinolones is also a cause of decreased susceptibility of S. Typhi to the drug

(Bhutta, 1996). A chromosomal mutation in gyrA gene (quinolone resistance determining

region) may results in decreased ciprofloxacin susceptibility. Patients exposed to the

mutated S. Typhi showed decreased ciprofloxacin susceptibility, leading to prolonged

fever clearance time (Parry et al., 2002).

1.10 Virulence factors

Virulence factors are the surface expressed and secreted elements responsible for

pathogenesis of the bacterium. Infection caused by virulence factors leads to specific

diseases in host. Each serovar of Salmonella has prominent virulence factors which can

distinguish one serovar from others (Sabbagh et al., 2010).

1.10.1 Plasmids

Plasmid is a double-stranded DNA molecule that can be exchanged between

bacteria by horizontal gene transfer. Bacteria pass on or receive desired genes that help in

enhancement of virulence or produce antimicrobial resistance in the recipient (Ehrbar and

Hardt, 2005). S. Typhi also contains virulence-associated plasmids. The pR (ST98)

plasmid harbour genes concerned with drug resistance and apoptosis (Wu et al., 2010).

Furthermore, a linear plasmid of S. Typhi strains known as pBSSB1 contain fljBz66 gene,

it encodes for H: z66 flagellin antigen (Baker et al., 2007; Phan and Wain, 2008; Phan et

al., 2009). S. Typhi spread of antimicrobial resistance via plasmids containing genes

(such as cat, dhfr7, dhfr14, sul1, and blaTEM-1) have been well described (Phan et al.,

2009) S. Typhi can exchange multidrug resistance R-plasmids with other enteric bacteria

such as E. coli (Phan et al., 2009; Holt et al., 2011).

1.10.2 Prophages

Some bacteriophages are usually integrated in loci of bacteria and contribute to

the diversity in bacterial genomes (Brussow et al., 2004). Salmonella genomes have

several prophages or prophage remnants with similarit

y to the lambda, Mu, P2 and P4 families (Thomson et al., 2004). The prophage genome

contributes to serovar variation and covers most of the variations in genes among strains

of the same serovar (Vernikos et al., 2007). S. Typhi harbours seven distinct prophage-

Plasmids


13

like elements, sized 180 kb that are generally conserved between strains. Some prophages

contain nonessential cargo genes. These cargo genes are responsible for fitness and

virulence including type III secretion system (de Jong et al., 2012).

1.10.3 Flagella

Flagellum is a helical filament linked with rotary motors embedded within outer

membrane. Flagella enable Salmonella to reach the epithelial barrier after ingestion. In S.

Typhi, the major subunit of flagella is encoded by fliC gene which is related with variants

of the H antigen (Silverman and Simon, 1980). At a specific time a single type of

flagellin can be expressed by phase variation mechanism. Flagellin up-regulates the pro-

inflammatory cytokines in-vitro in tissue culture (de Jong et al., 2012).

1.10.4 Fimbria

Fimbriae (pili) are virulence factors found on the surface of bacteria. They are

considered to play an important role in formation of biofilm, colonization and attachment

of to the bacterium to host cells. Salmonella serovars harbour a unique combination of

fimbrial operons. However there is not much information available about true virulence

potential of fimbriae (Ibarra and Steele-Mortimer, 2009; Sabbagh et al., 2010).

1.10.5 Outer membrane vesicles

Recently it has been identified that Salmonella can also transfer its virulence

factors into the cytoplasm of host cell by bacterial outer membrane vesicles (OMV)

(Yoon et al., 2011). In S. Typhi OMVs usually hold ClyA (a pore-forming cytotoxin) and

later on release this cytotoxin to the extracellular environment (Wai et al., 2003).

Furthermore, OMVs possess antigenic and pro-inflammatory functions and can stimulate

activation of dendritic cells, and hence OMVs are attractive vaccine candidates (Alaniz et

al., 2007).

1.10.6

Salmonella has various virulence-associated genes found within clusters in its

genome, termed as Salmonella pathogenicity islands (SPIs). These SPIs are assumed to

Flagella

Fimbriae

Pathogenic Islands


14

be recent horizontal acquisitions and they encode genes which are important for survival

of S. Typhi in host. To date, 21 SPIs are recognized in Salmonella (Vernikos and

Parkhill, 2006; Fuentes et al., 2008; Blondel et al., 2009), however, SPIs-19, 20 and 21

are absent in S. Typhi (Blondel et al., 2009; Sabbagh et al., 2010).

Most studied SPIs are 1 and 2. SPI-1 contains genes for T3SS1, which is

important for the invasion of non-phagocytic cells such as M cells in the gut lumen and

activation of pro inflammatory responses (Galan, 1999). SPI-2 contains T3SS2; it plays a

vital role during the second phase of invasion and intracellular survival in macrophages

(Hensel et al., 1998).

SPI-7 is the largest identified island present in S. Typhi (Bueno et al., 2004). Size

of SPI-7 is 134 kb which harbors 150 genes inserted between duplicated pheU tRNA

sequences (Pickard et al., 2003). This island consists Vi capsule biosynthesis genes,

including a type IV pilus, which helps the bacterial attachment to eukaryotic cells and the

sopE prophage (Phan et al., 2009), which contain a gene encoding an effector protein

secreted through type III secretion system within its tail fiber genes. Furthermore, SPI-7

bears viaB operon, which encodes genes for the synthesis and transportation of virulence

capsule (Parkhill et al., 2001). The viaB operon is found only in bacteria which are able

to produce Vi polysaccharide.(de Jong et al., 2012).

1.10.7 Type III secretion system

Salmonella enterica spp. contain two “type III secretion system” (T3SS). These

T3SS, encoded by clusters of genes, are secretion apparatus which function like a

molecular syringe. The T3SS release effector proteins in cytosol which influence host-

cell signalling cascades. These effector proteins have multiple activities within host cells

which stimulate fluid secretion and are also involved in Salmonella containing vacuole

(SCV) formation (Ibarra and Steele-Mortimer, 2009).

1.11 Vi capsular polysaccharide

Vi capsular polysaccharide is an important antigen found in S. Typhi. Vi plays a

crucial role in virulence and is encoded by two loci: viaA and viaB (Kolyva et al., 1992).

The viaB locus is present on SPI-7 and consists of two operons: tviABCDE and

vexABCDE. Functions of Vi capsule are inhibition of complement activation, resistance


15

to phagocytosis and is involved with survival of the bacterium inside phagocytes (Miyake

et al., 1998). The viaB locus decreases the invasiveness of the S. Typhi towards epithelial

cells (Zhao et al., 2001). The tviA gene represses the flagellin secretion, which prevents

the production of interleukin-8 in the intestinal mucosa, consequently it reduces the

chances of recognition and activation of Toll-like receptor (TLR)-5 (Raffatellu et al.,

2008). Vi facilitates the systemic dissemination of S. Typhi in human host by crossing

intestinal cells without activating the immune response. It also resists killing by serum

and allows the bacterium to survive inside phagocytes (Raffatellu et al., 2008). Vi is a

protective antigen and has been used as candidate for typhoid fever vaccine.

1.12 Vi negative S. Typhi emergence

Vi capusular polysaccharide antigen is a unique feature of S. Typhi. However Vi

negative isolates of S. Typhi have been found infrequently from Asian countries (Baker et

al., 2005; Wain et al., 2005; Ali et al., 2012). S. Typhi strains lacking Vi capsular

polysaccharide antigen have been reported for several decades worldwide. Vi negative

strains were found in Jamaica in 1970’s (French et al., 1977), in Indonesia (Sanborn et

al., 1979), New Zealand, and Malaisia (Jegathesan, 1983). Vi negative isolates have also

been reported in India and China (Arya, 2000b). In one study it was found that Vi

negative S. Typhi isolates were responsible for an epidemic of MDR typhoid fever in

India (Saha et al., 2001). S. Typhi strains have been detected in patients from Pakistan

(Baker et al., 2005; Wain et al., 2005). A vary recent microbiological report from

Kathmandu, Nepal shows that naturally occurring Vi negative (acapsulate) S. Typhi may

cause typhoid fever which is identical to the disease caused by Vi positive (Capsulated)

bacteria. They confirmed the typhoid causing Vi negative strains by a novel multiplex

PCR assay and individual PCR analyses targeting 14 genes involved in synthesis,

regulation and transportation of the Vi capsular polysaccharide formation (Pulickal et al.,

2013).

1.13 Lipopolysaccharides (LPS)

All bacterial cytoplasmic membranes are usually surrounded by cell wall;

comprised of peptidoglycan (murein) which gives solid shape to the cells. However,

Gram negative bacteria contain an additional outer membrane which encloses


16

peptidoglycan. The outer membrane consists of phospholipid bilayer; internal part of

phospholipid bilayer is made of glycerophopholipids whereas external portion is shaped

by lipopolysaccharides (LPS). Main function of the outer membrane is to decrease the

permeability of hydrophobic compounds and hydrophilic compounds of higher molecular

weight across the cell. LPS occupy about 75% of the outer surface (Raetz and Whitfield,

2002). It plays main role in host–bacterium interactions which include recognition,

adhesion, colonization, virulence and survival under harsh conditions. The remaining

space of outer membrane is filled up by integral membrane proteins like porin (channels

for the entrance and exit of hydrophilic small molecules) and lipoproteins (Silipo, 2010).

Bacterial cells that produce smooth O-glossy colony morphology are designated

as ‘smooth’ LPS while those bacterial strains which lack O-antigen are termed as ‘rough’

LPS. Formally the term LPS was used only for those molecules which contained the O-

antigen polysaccharide, the molecules that lack O-antigen were designated as

lipooligosaccharide or LOS such as Neisseria. Based on the fine structure of OSP,

serologically distinct strains of bacterial species are classified into O-serovar or O-

serotypes (Whitfield et al., 2003).

Surface of bacterial cell wall is the first line of defense against antimicrobial

drugs (Gajdus et al., 2009). Outer membrane of Salmonella lipopolysaccharides (LPS)

provides virulence functions to the bacterium. Structurally, LPS is characterized by a

terminal lipid A group at the 3-deoxy-D-manno-oct-2-ulosonic acid (KDO) terminus of

the conserved core polysaccharide (Heinrichs et al., 1998). The serovar-specific OSP

region extends as a repeating polymer from the distal end of the core. O-antigens are

important component of outer membrane of Salmonella. These are repeated units of

polysaccharides and consist of repeat oligosaccharides known as O-units which have

generally 2 - 6 sugar residues. O-specific antigens are extremely variable; the variation is

based on the nature, order and linkage of the different sugars within the polysaccharide

(Samuel and Reeves, 2003).

Chemical composition of LPS is similar in all Gram negative bacteria and has

three domains: hydrophobic lipid A region, hydrophilic O-antigen repeats and the

interconnecting core oligosaccharide (Raetz and Whitfield, 2002). The lipid A


17

constitutes the external membrane while the sugar moiety protrudes from the surface up

to 10 nm (Raetz and Whitfield, 2002) (Figure 1.3).

Figure 1.3: Schematic diagram of lipopolysaccharides (LPS) structure

LPS consists of Lipid A, internal Oligosaccharide and O-specific chain (O-SP). R: Rough type LPS don’t contain O-SP SR: Semi Rough Type a single repetitive unit of OSP and S: smooth type contains two or more repetitive units of O-SP. Adopted from Pupo et al. (2009).

Lipid A comprises a disaccharide bisphosphate backbone, which carries O-acyl

groups. It is structurally conserved within the genus or even family; it consists of two

glucosamines, two phosphate esters and five to seven fatty acids (Raetz and Whitfield,

2002). Lipid A is essential for the survival of bacteria and is a potent inflammatory

mediator. Hence it is considered as a main target for the development of antibiotics and

anti-inflammatory agents. Lipid A moiety is responsible for endotoxic activity. The KDO

linkage connects the lipid A to the core region (Figure 3.1) (Raetz and Whitfield, 2002;

Caroff and Karibian, 2003). KDO is the only monosaccharide residue that is always

present at first position in LPS of bacteria and is the unique feature of LPS (Silipo, 2010).

The core oligosaccharide is built of several different monosaccharides which are

arranged in either linear or branched form and composed of up to 15 sugar residues. Core

is generally a (highly) negatively charged domain in the LPS (Silipo, 2010). There are


18

two divisions of core; inner core (less variable region) and outer core which usually

consists of hexoses and is the most variable region exposed to the external pressure

(Silipo, 2010).

A polysaccharide portion of the LPS called O-specific polysaccharide (OSP) is

either a homopolymer or a regular heteropolymer which is built up of oligosaccharide

(from di- to octa-saccaharide) repeating units (O-units). OSP are present only in smooth-

type Gram negative bacteria. These OSP are used as fingerprint for bacteria because they

are highly specific for each bacterial serotype. The specificity of OSP depends on the

different combinations of monosaccharides, arrangement of glycosidic linkage,

substitution and configuration of sugars and also on the genetic variation of organisms.

OPS plays a major role in the escape of bacteria from the lytic action of the complement

complex by a ‘‘shielding’’ process (Raetz and Whitfield, 2002). They also provide more

protection to the smooth-type bacteria from the effect of antibiotics as compared to

rough-type bacteria (Banemann et al., 1998). Composition of OSP of S. Typhi is based on

five monosaccharide sugars; Glucose, Galactose, Rhamnose, Mannose and Tyvelose

(Rahman et al., 1997). (Figure 1.4)

LPS are amphipathic in nature and form aggregates; as a result their structures

and molecular weights are difficult to be determined clearly. In addition to hydrophobic

behavior they also form intermolecular cross linking of acid groups such as phosphates,

pyrophosphates and acid sugars using divalent cations (Caroff et al., 1993). SDS-

Polyacrylamide gel electrophoresis give good resolution of LPS molecular weight but

still there is no appropriate molecular weight standard available. Mass spectrometry is the

high throughput technique which is used for the precise molecular mass determination of

native LPS molecules, however natural heterogeneity of LPS preparations set hurdles in

the interpretation of their spectra (Caroff and Karibian, 2003).

LPS (Endotoxins) can be extracted from Gram negative bacteria by several

methods such as aqueous butanol, cold ethanol, triton /Mg+2 and extraction in water at

100 °C. However hot phenol extraction is the most effective method and is useful

especially for higher yield and lesser protein contaminates (Delahooke et al., 1995;

Nurminen and Vaara, 1996; Perdomo and Montero, 2006; Rezania et al., 2011; Davis and

Goldberg, 2012).


19

O

OH

H

H

HO

HO

H

H

OH

Galactose

Mannose

OH

H

HO

HO

OH

H

H

H3C

O

H

HOH3C

HOOH

H

H

H3C

Rhamnose

Tyvelose

O

HHO

H

OH

H

HO

H

H

OH

Glucose

O

H

HO

HOH

H

H

H

O

OH

yv 1

D-Man-1 L-Rha-1

DGal-

DGlu 1

Figure 1.4: Structure of the O-specific polysaccharides of S. Typhi

Sugars involve in synthesis of O-SP in S. Typhi contain Tyvelose, mannose, Rhamnose, Galactose and Glucose, figure adopted from Rahman et al. (1997).

1.14 Vaccines against typhoid

Although S. Typhi is resistant to antibiotics in developing world especially in

Pakistan, however, typhoid fever is treatable with high dose of antibiotics. Treatment is

expensive and time consuming, therefore the use of vaccines can overcome these

problems (Cook et al., 2008). The journey of typhoid vaccines started in 1896. In past,

three vaccines were introduced: out of these two are widely available commercially and

no new vaccines have been licensed since 1990s. Current licensed typhoid vaccines are

Vi capsular polysaccharide and a Ty21a live-attenuated vaccines (Martin, 2012).


20

1.14.1 Inactivated whole cell vaccines

The synthesis of whole cell inactivated vaccines consists of heat killed, phenol

preserved and acetone killed vaccine. Typhoid acetone killed vaccine is better because it

preserves Vi polysaccharide, while hot-phenol killed vaccine does not protect Vi

polysaccharide (Fraser et al., 2007). In 1960, trials of acetone killed vaccines were

conducted in USSR, Yugoslavia, Guyana and Poland. Although they were efficacious but

they caused local inflammation, pain, malaise and systemic fever like symptoms in 9-

34% of the recipients. Thus whole cell inactivated vaccine were not suitable for public,

therefore they are no longer available in the market (Begier et al., 2004). Due to side

effects of killed vaccines, live inactivated vaccines seem to be more appropriate.

1.14.2 Live attenuated Ty21a vaccines

S. Typhi strain Ty2 was mutated randomly by chemical mutagenesis and it

resulted in Ty21a, a highly attenuated strain lacking Vi and galE genes. It was licensed in

1989 (Germanier and Fiirer, 1975). Live oral attenuated Ty21a vaccines are generally

more suitable because they are easier to be administered into recipients and have

minimum side effects (Levine, 2003). Currently Ty21a live-attenuated vaccines are

available in liquid formulation and enteric coated capsules; each capsule contains 2 - 6 ×

109 lyophilized live bacteria. The vaccines are administered orally; one hour before

meals in three doses every other day in endemic region and 3 to 4 doses in travelers

within a period of 1 week (Dietrich et al., 2003). In one report these vaccines induced

mucosal antibody (IgA), serum antibody (IgG) and cell mediated immunity. After three

doses strong IgG and IgA responses were observed against O-antigens (Viret et al.,

1999). Cell mediated immune response also increased and provided protection against

intracellular pathogens. They gave 60 – 70% protection for more than 7 years against

typhoid (Salerno-Goncalves et al., 2002). The vaccines also provided herd protection in

endemic regions. These vaccines were licensed in 56 countries of Asia, Africa, USA and

Europe. However, they were also administered in travelers to endemic countries (Martin,

2012).

There are few concerns with Ty21a vaccines; they are only efficacious in 5 years

of age or older. A single vaccine dose requires high numbers (109) of bacteria to obtain

adequate immunity. The attenuated bacteria are acid-labile so the stomach acidity


21

neutralized Ty21a after oral feeding. Thermal instability affects potency of the vaccine; a

cold chain is required to keep the vaccines effective. Its shelf life is 2 weeks at 37 °C, 12

weeks at 25 °C and 18 – 24 months at 2 – 8 °C. Packaging of the vaccines in capsular

forms limits its use in the very young children. Although optimum booster immunization

schedule is evaluated, however, revaccination is recommended at 5 – 7 year intervals

(Ohtake et al., 2011).

Clinical field trials of Ty21a liquid formulation were carried out in Egypt. They

confirmed immunogenicity and showed 96% efficacy and provided protection for a

period of three years. Field trial of enteric coated formulation were conducted in Chile in

1980s which showed 67% efficacy (Levine et al., 1987). Another field trial in Indonesia

compared liquid and capsule formulation of this vaccine and proved to be 53% and 42%

efficient respectively. But these formulations were not effective against S. Paratyphi A or

B (Simanjuntak et al., 1991). Four doses were administered and it was observed that

fourth dose significantly enhanced protection. This vaccine provided protection for a

period of 17 – 21 months, therefore, liquid formulation was preferred to use (Levine et

al., 1989b). Protective efficacy of these vaccines was observed to be 67 – 80% for a

period up to 7 years. However, protection was not efficient for all individuals (Levine et

al., 1990). Thus Vi capsular polysaccharide vaccines are anticipated to compensate the

shortcomings of the existing vaccines.

1.14.3 Vi polysaccharide vaccines

To overcome the limitations of previously described vaccines, an idea of utilizing

specific antigenic parts as vaccines was proposed. It has been observed that specific

antigenic parts on Salmonella capsule can induce immune response against these antigens

in a better way.

Vi (virulence) antigen is considered to play a crucial role in S. Typhi pathogenesis

(Marshall et al., 2012: Ahmadi et al., 2013). Vi capsular antigens is good immunogenic

candidate. Chemical structure of Vi antigen is [alpha]1-4,2-deoxy-2-N-acetyl

galacturonic acid, which is partially O-acetylated at carbon 3 and forms a capsule that

protects the bacteria against phagocytosis and complement the mediated lysis (Richards

et al., 2010; Szu and Bystricky, 2003). Vi capsular polysaccharides were purified by

different methods and used as vaccines (Cui et al., 2010; Micoli et al., 2011; Micoli et


22

al., 2012b). These vaccines are available in multidose vials package and prefilled

syringes for subcutaneously or intramuscular delivery. Single dose of the vaccines

containing 25 µg of Vi antigen is administered; revaccination is required after every two

years (Arnold et al., 1992; Hessel et al., 1999; Khan et al., 2012). Vi polysaccharides

vaccines had been licensed in 1994. Now they are available in more than 93 countries

worldwide. However till date they are not enlisted in vaccination program of developing

countries.

Vi polysaccharide vaccine trials were done in several Asian countries, where

campaigns were established for vaccination in schools and communities and the results

showed reduction in severe febrile illness and death rate. Vi vaccination was also

demonstrated to be cost effective in these trials (Delahooke et al., 1995; Khan et al.,

2012). In Kolkata, a cluster randomized Vi vaccination trial showed significant reduction

in transmission and provided herd protection to unvaccinated individuals (Arya and

Agarwal, 2009; Cook et al., 2009). Trials in Nepal and South Africa indicated 64 – 72 %

efficiency and provided protection for at least 17 – 21 months. Immunization of Vi

vaccination induce more than 85% protection in adults and 70% in children up to 3 years

and older children (Levine et al., 1989a; Levine et al., 1990)

Beside advantages, Vi capsular polysaccharide have some shortcomings. It was

observed in clinical trials that mucosal immunity was not activated due to parenteral

administration, therefore, booster effect was not observed. This happens because

polysaccharides do not trigger T cells immune response and subsequently immunological

memory cannot establish. Furthermore, this vaccine is not effective in infants because of

limited protective duration, so revaccination doses are required for persistent protection

(Levine, 2006). It has been observed that Vi vaccines are hypo responsive therefore they

are not providing protection against S. Paratyphi A (Arya, 1997; Froeschle and Decker,

2010). Domestically manufactured Vi polysaccharide vaccines are accepted in private

pediatric practices in India and China, however they are only prescribed in the national

vaccination programs (Dong et al., 2010; John et al., 2011). In order to overcome the

limitations of Vi polysaccharide vaccines, a new concept of conjugate vaccine was laid in

front. Conjugate vaccine for typhoid fever diseases seems to be a promising area of

research.


23

1.15 Immunogenicity of bacterial polysaccharides

Every year more than 2.5 million infants die from bacteremia, diarrhoeal and

respiratory diseases on global scale (Klein Klouwenberg and Bont, 2008). A few bacterial

and viral pathogens are main cause of this burden of disease among neonates and

children. Most of the pathogenic bacteria are encapsulated; such as Streptococcus

pneumoniae, Staphylococcus aureus, Streptococcus pyogenes, Haemophilus influenza,

Neisseria meningitidis and Salmonella Typhi. Bacterial capsule is formed by a

polysaccharide coat which is immunogenically potent, it blocks complement binding and

opsonization which leads to phagocyte killing. This immune response of host provides

protection against disease in adults but the youngest have weak immune response to these

capsular bacteria due to thymus independent (TI) nature of these bacteria (Klein

Klouwenberg and Bont, 2008).

Generally there are two types of humoral immune responses to antigens: one is

thymus dependent (TD) and other is thymus independent (TI) response (Mosier et al.,

1977). TD antigens are usually soluble proteins and peptides. These antigens interact with

major histocompatibility complex (MHC) molecules at the surface of antigen presenting

cell (APC) and allow APC to cooperate with CD4 helper T cells. On the other hand, TI

antigens induce immune response without interaction of T cells (Vos et al., 2000). As a

result TI antigens either do not induce or just poorly induce immunological memory. On

the basis of interaction with B cells, TI antigens have further two categories: type 1 (TI-

1) and type 2 (TI- 2) antigens. TI- 1 antigens induce proliferation and differentiation of B

cells. These are able to induce immune responses in adults as well as in neonates. On the

contrary, TI- 2 antigens can induce weaker immune response in children below two years

of age; however these TI- 2 antigens can activate B cells and produce sufficient

antibodies in older children and adults. TI- 1 antigens are lipopolysaccharides of Gram

negative bacteria cell wall, while TI- 2 antigens are encapsulated bacterial

polysaccharides such as S. Typhi H. influenza and N. meningitis. The immune responses

of neonates and infants are sufficient against TI- 1 antigen and low in adults (Levy et al.,

2000). Immunological response in neonates is weaker than the TI- 2 antigens and

therefore they are at risk (Rijkers et al., 1998).


24

In developing countries medical care unusually decreases after the first year of

life. There is a need of effective infant immunization program. Special care is required to

induce immune system against TI-2 antigens. Antibody responses of neonates and infants

to vaccines are of short duration and decline within a few months. In this case infection

may arise again; therefore, administration of repeated vaccinations is necessary in second

year of life (Pihlgren et al., 2006; Klein Klouwenberg and Bont, 2008).

In order to improve the immune system of the infants and children against

polysaccharide, these polysaccharides are subjected to conjugate with a highly

immunogenic protein.

1.16 Conjugate vaccines

Conjugate vaccines are semi-synthetic products created through multiple chemical

reactions. As the bacterial LPS is non-immunogenic in infants, but its covalent linkage

(conjugation) to a protein makes it a potent immunogen. Conjugate vaccines are among

the safest and most efficient vaccines developed till date. They are abundantly used

against H. influenzae type b, Pneumococcus and Neisseria meningitidis pathogens every

year.

History of the conjugates study begin in 1920s, when the pneumococcal

polysaccharide was recognized as target for antibodies and conjugated it to a protein, this

polysaccharide could able to evoke immune response and produced antibodies. Later on,

conjugates were developed against Pneumococcus and Salmonella Typhimurium (Simon

and Levine, 2012).

Conjugates are made up of polysaccharide antigen of particular pathogen and a

carrier protein. These conjugates can be differentiated on the basis of chemistry used in

their preparation; polysaccharides attachment positions to the proteins, length of

polysaccharide chain and polysaccharide-to-protein ratio (Goldblatt, 2000). Today, all

current polysaccharide vaccines registered for children below two years of age are

conjugate vaccines.

According to the current conviction, LPS plays role as T cell–independent antigen

since they cannot dock in major histocompatiblity (MHC) product cleft because of its

hydrophilic nature. Therefore, LPS are unable to be presented to T cells of MHC on the


25

surface of antigen presenting cells (APC). As B cells recognize LPS using surface IgM

however, they are not capable to get help from T cells.

Recently Avci et al. discovered a new working model of conjugates (Figure 1.6).

According to this hypothesis APC process conjugate vaccine, present it to MHC II, T

cells recognize the carbohydrate epitopes and finally these epitopes recruit T helper cells

for the induction of adaptive immune responses to these vaccines (Avci et al., 2011).

Conjugates transform bacterial polysaccharides from a T-cell idependent (TI-2)

antigen into a T-cell dependent (TD) antigen and induce immune response and

immunological memory in neonates (Adkins et al., 2004). Conjugate vaccines are

capable to induce most relevant antibodies that bind to the LPS and engage complement

system which ultimately kill bacteria by complement-mediated lysis otherwise trigger

bacterial uptake by opsonization using phagocytosis.

Figure 1 5: New model for antigen processing and presentation of conjugate vaccine

In protein-polysaccharide conjugate construct; peptides facilitate the attachment of sugar (saccharide) epitopes to MHC and allow presentation of saccharide epitopes to polysaccharide-specific T cells. Figure adopted from Avci et al. (2011).


26

Characteristics of conjugate vaccines include: defined chemical composition and

structure, having consistent physical and chemical properties, they are clinically safe with

no inherent toxicity, they induce high avidity functional antibody and induces

immunologic memory to respond to the native polysaccharides. Conjugate vaccines have

major role in prevention and control of numerous infectious diseases. Vaccination with

conjugate vaccines is also helpful in herd immunity; it can eliminate transmission of the

pathogen from mucosal surfaces of vaccinated individuals to unvaccinated individuals.

1.16.1

1.16.1.1 Haemophilus influenza b conjugate vaccine

Haemophilus influenza b (Hib) is an important cause of meningitis and bacterial

pneumonia in children. Conjugate vaccines of Hib were introduced in early 1990s. Hib

polysaccharide is also known as polyribosylribitol phosphate (PRP) polysaccharide.

Several proteins were conjugated to polysaccharides of Hib such as tetanus toxoid, outer

membrane proteins of Neisseria meningitidis group B and genetically engineered non-

toxic diphtheria toxin (Perry, 2013).

The reported efficacy of Hib vaccine conjugate ranged from 94% in children of 2-

3 years of age to 99% for infants below 1 year of age. These vaccines produced immunity

against meningitis and epiglottitis. In Brazil, the trial of conjugate vaccine decreased the

rate of Hib meningitis from 2.39 to 0.06 cases per 100,000 population (98%) overall.

Similarly the disease rate was decreased from 60.9 to 3.1 cases per 100,000 populations

(95%) in children younger than one year of age. Hib conjugate vaccines were helpful in

reduction of carriage of H. influenza; this resulted in lower transmission rates to

unimmunized children (Klein Klouwenberg and Bont, 2008; Avci et al., 2011).

1.16.1.2 Neisseria meningitidis conjugate vaccine

N. meningitidis is a major cause of meningitis, pneumonia, septic arthritis,

meningococcemia and sepsis on global level (Caugant, 2008). It is one of the leading

causes of morbidity and mortality in the world even in the 21st century. In Sub-Saharan

Africa, 1000 new cases appear per 100,000 people in epidemic period of the year (Caesar

et al., 2013). The affected population contain adolescents and young adults up to 29 years

of age, however, young children are most susceptible (Caugant, 2008).

Licensed conjugate vaccines against bacterial diseases


27

N. meningitidis species have 13 serotypes, but five (A, B, C, W-135, and Y) are

clinically relevant. Presently there are two purified protein conjugate vaccines available

which target serogroups A, C, W-135, and Y. It was assumed that vaccination against

serogroup B in not possible, however, currently two vaccines are in development to be

efficacious against serotype B (Caesar et al., 2013).

Conjugate vaccines based on type A and C are efficacious, well tolerated and safe

in young children. In Spain, the efficacy of meningococcal C vaccine (MCC) was 98%

in infants immunized at 2, 4 and 6 months of age, whereas, the affectivity was increased

to 99% when vaccinated after 7 months of age. In England, effectiveness of the vaccines

was 66% in infants immunized at 2, 3 and 4 months of age and 83% in children

immunized in 7 months of age (Klein Klouwenberg and Bont, 2008).

1.16.1.3 Streptococcus pnemoniae

Pneumococci cause various diseases such as pneumonia, otitis media, meningitis,

sinusitis and bronchitis. There is an unconjugated 23-valent vaccine licensed for children

over 2 years of age but not efficacious in younger children (Lesinski and Westerink,

2001).

Conjugate vaccine based on polysaccharide and protein interactions are called 7-

valent (PCV-7). PCV-7 has been introduced for immunization of children below the age

of 2 years. PCV-7 covers 65 – 80% of serotypes that cause invasive pneumococcal

infections. Recently PCV-13 (Prevenar 13) vaccines have been prepared by conjugation

of 13 capsular Streptococcus pneumoniae polysaccharide serotypes with nontoxic

diphtheria protein (CRM197) (CDC, 2013).

In a randomized phase III trials, infants of 2 – 6 months were immunized with

PCV13. Immune response of PCV-13 was similar to PCV-7 because seven serotypes

were common in both. A booster dose of PCV-13 was given to children between 11 and

15 months of age and it elevated the immune response against all 13 serotypes in

previously vaccinated children either with PCV-13 or PCV-7 during the primary

vaccination phase (Singleton et al., 2013).

The conjugate vaccines decreased the rate of invasive pneumococcal disease by

94% with coverage rate of just 68% (Black et al., 2000). In USA from 2000 – 2004, the


28

pneumonia indoor admission rates has declined by 39% for children younger than two

years of age (Grijalva et al., 2007).

1.17 Vi conjugate vaccines

Vi capsular polysaccharide of the S. Typhi was conjugated with nontoxic

recombinant exoprotein A (rEPA) of P. aeruginosa (Szu et al., 1994). The purpose of

conjugation was to enhance immunogenicity against Vi antigen in adults as well as in 5

to 14 years old children. The prepared conjugates (Vi-rEPA) also elicited a booster

response in children of 2 to 4 years of age. In order to elicit a booster response, two

injections of the Vi-rEPA conjugates were administrated in 2 to 4 years old children. The

doses were containing Vi-rEPA conjugate or a saline placebo; each dose was given six

weeks apart. Efficacy of all vaccine groups was compared with placebo group in the

attack rate of typhoid. The Vi-rEPA conjugate was found immunogenic and safe.

Efficacy of the vaccine was 92% in 2-5 years old children (Lin et al., 2001).

Diphtheria toxoid (DT) is a licensed protein - used as vaccine for infant

immunization. In one study this DT was conjugated with Vi of S. Typhi (Cui et al.,

2010). Five lots of Vi-DT vaccines were prepared in which all conjugates were similar in

protein polysaccharide ratio, moreover, the antigenicity and yield of vaccines were also

similar. Primary injection of Vi-DT vaccines elicited higher level of serum antibodies as

compared to Vi alone, while boosting dose of the vaccines produced prominent IgG level

as compared to prime dose. Higher dose of the vaccine elicited higher immune response

and the results were consistent as in earlier studies (Lin et al., 2001; Canh et al., 2004).

Several formulations and immunization schedules were also prepared to explore the

immunological memory response of the vaccines. There were lesser safety concerns with

the new conjugate vaccines because both DT and Vi were already licensed vaccines. New

facilities were not adopted for conjugate production because both vaccines were already

produced locally, moreover, no new modified protein was introduced in this study.

Production of DT was economical and good Anti-DT immune response was detected

(Cui et al., 2010).

Micoli et al. (2011) developed a modified method for purification of Vi

polysaccharide from Citrobacter instead from S. Typhi because structure of Vi from both

organisms are similar (Canh et al., 2004). Furthermore, Citrobacter is a biosafty level-1


29

(BSL-1) organism which is a safer source of Vi in comparison to Vi of S. Typhi which is

BSL-3. In this method they precipitated Vi antigen from culture supernatant with cetyl

trimethylammonium bromide (CTAB) which resulted in CTA-Vi salt. Vi was solubilized

with ethanol followed by exchange of CTA+ with Na+. The purified Vi was O-acetylated

and conjugated with CRM197 (a non-toxic mutant of diphtheria toxin) via an adipic

dihydrazide (ADH) linker. Vaccines were based on chemical linkage produced by N-(3-

Dimethylaminopropyl)-N`-ethylcarbodiimide (EDAC) coupling chemistry (Micoli et al.,

2011). The conjugation reaction was optimized by derivatization of CRM197, ratio of Vi

to CRM197, molar ratio of Vi to EDAC, concentration of reagents used, reaction time and

pH for production of vaccines at pilot scale. Either native or derivatized CRM197 was

conjugated with Vi. Conjugation ratio of Vi and CRM197 was fixed at 1:1. Even without

the addition of adjuvant Vi-CRM197 conjugate showed that they are safe and

immunogenic. In preclinical study CRM197 has advantage of manufacturing and

registration with respect to other possible carrier proteins (Hale et al., 2006). CRM197 was

used in conjugation because it is licensed and safe for all age groups including infants

(Hsieh, 2000).

1.18 OSP conjugate vaccines

E. coli 0157:H7 is the cause of severe enteritis and the extra intestinal

complication of hemolytic-uremic syndrome (HUS). The highest rate of HUS is in

children. LPS of the E. coli O 157: H 7 was detoxified by hydrolysis with acetic acid and

designated as OSP, furthermore the LPS was detoxified with hydrazine and designated as

DeA-LPS. Both types of polysaccharides were then bound covalently to P. aeruginosa

recombinant exoprotein A (rEPA), Clostridium welchii exotoxin C (Pig Bel toxoid [CW])

and bovine serum albumin (BSA). The conjugation reaction was carried out by

carbodiimide-mediated condensation. The prepared conjugates demonstrated

immunogenicity and bactericidal activity. Highest amount of antibody titer of IgG was

observed against LPS conjugates (Konadu et al., 1994).

Recently, Ali et al conjugated OSP of S. Typhi with diphtheria toxoid (DT). They

used adipic acid dihydrazide (ADH) linker to combine two different molecules. The

prepared OSP-AH-DT conjugates were evaluated in mice to check the immunogenicity.

ELISA titers of the conjugates were significantly higher (P = 0.0241 and 0.0245) than


30

free lipopolysaccharides. Immunization schedules including three injections with 4-

weeks interval induced higher immune responses than the schedule based on three

injections with 2-weeks interval. They concluded that diphtheria toxoid is a good carrier

protein; suitable for conjugation with OSP of S. Typhi (Ali et al., 2012).

Most recently Micoli et al. introduced a new conjugation chemistry in which they

first activated O-specific polysaccharide (O : 2) of S. Paratyphi A using the terminus 3-

deoxy-D-manno-octulosonic acid (KDO), leaving the O : 2 chain unmodified and

conjugated this O-chain with carrier protein CRM197. The prepared conjugates were

evaluated for immunogenicity in mice and compared with other OSP-CRM197 conjugates.

They found that the newly developed conjugates were more immunogenic and produced

stronger bactericidal activity against S. Paratyphi A (Micoli et al., 2012a).

1.19 Proteins used in conjugate vaccines

Some carrier proteins have been used to develop conjugate vaccines. TT (Tetanis

toxid) obtained from Clostridium tetani, diphtheria toxoid (DT) and CRM from

Corynebacterium diphtheriae, rEPA from P. aeruginosa, outer membrane protein (OMP)

from N. meningitidis and non-typeable outer membrane protein D (OMPD) of H.

influenzae have been used as carrier proteins to conjugate with Vi and OSP of various

Gram negative bacteria (Croxtall and Keating, 2009).

1.20 Exotoxin A

Exotoxin A (ETA) is one of the major pathogenic proteins produced by

Pseudomonas aeruginosa. The bacterium usually occurs in lungs of children and adults

with cystic fibrosis and in necrotic skin patients of severe burns, it is also isolated from

urine, blood, wound and sputum samples of nosocomial infections. ETA helps the

bacterium to invade animal and human tissues. ETA has an LD50 of 0.2 µg / mice on

intraperitoneal injection. It is toxic for mammalian cells in-vitro and is fatal for various

animal species. ETA is 10,000 times more lethal for mice than lipopolysaccharides of P.

aeruginosa (Wolf and Elsasser-Beile, 2009).

Genetically ETA is made up of 1917 base pairs, code for a single polypeptide

(69 kDa) having 638 amino acid residues. It contains 25 residues N-terminal sequence


31

which usually detach before secretion outside from cell and results in 613 residues (66

kDa) native toxin.

Figure 1.6: Structure of Exoprotein A of Pseudomonas aeruginosa

ETA is a single polypeptide having three structural domains. Domain I is divided into structurally adjacent but discontinuous domain Ia (blue; residues 1–252) and domain Ib (green; 365– 404), domain II (yellow; 253–364), domain III (red; 405–613) lies at C-terminus. Figure adopted from Weldon and Pastan, (2011). ETA is an intoxicating cytotoxic protein associated with well-characterized

family of bacterial ADP-ribosylating toxins. ETA enters eukaryotic cells by receptor-

mediated endocytosis with the cytoplasm as its end destination, where it catalyzes the

transfer of ADP-ribose from NAD to eukaryotic elongation factor 2 (eEF2), this

modification of ADP-ribose on diphthamide residue of eEF2 leads to inhibition of protein

synthesis and eventual causes cell death (Driscoll et al., 2007).

The X-ray crystallographic structure of native ETA revealed three major

structural domains (Allured et al., 1986). Receptor-binding (domain I), translocation

(domain II) and catalysis (domain III). The N-terminal domain I is divided into


32

nonsequential but structurally adjacent domains Ia (residues 1–252) and Ib (365–404).

The residues between domains Ia and Ib comprise domain II (253–364) and the

remaining C-terminal residues make up domain III (405–613), (Figure 1.4) (Weldon and

Pastan, 2011).

Previous studies reveals that immunization against ETA alone cannot prevent

Pseudomonas infection, however, the antibody response against ETA is important in

prevention of various pathology associated with Pseudomonas infections and therefore

this protein may be an important component of any multicomponent vaccine. (Wolf and

Elsasser-Beile, 2009).

Glutamic acid at 553 positions is an integrated active-site residue in ETA.

Deletion of the glutamic acid by oligonucleotide-directed mutagenesis produces mutant

toxoid. The purified toxoid is stable, highly immunoreactive and able to block toxin

receptors. Cytotoxic and ADP- ribosyltransferase activities of the toxoid are as minimum

as 106-fold of wild-type ETA, hence, 50 µg (~ 400 lethal doses of ETA) of toxoid

injection in mice cannot cause illness. However this toxoid can elicit high level of anti-

ETA antibodies in mice, consequently, it protects against 100 µg of authentic ETA (~ 600

lethal doses) (Lukac et al., 1988). The toxoid is useful vaccines tool against pseudomonas

infection as well as it has been used in preparation of conjugate vaccines against typhoid

(Lin et al., 2001; Qian et al., 2007)

1.21 Human serum albumin

Human serum albumin (HSA) is a single polypeptide, having 585 amino acids

with molecular mass of 66.5 kDa. It is the most abundant protein in human plasma and is

60 – 65% of the total plasma protein (Kragh-Hansen et al., 2013). HSA is highly soluble

in aqueous media therefore, its concentration in plasma is 0.6 mM (4% w/w), but for

clinical use it can be used as 20% (w/w) solution. HSA is produced in hepatocytes

without prosthetic groups, bound covalently to lipid or carbohydrate and released at a rate

of 14 g/day continuously. Adults contain 120 g of albumin in blood circulation (Kragh-

Hansen et al., 2013).

The three-dimensional structure of HSA protein has been determined by

crystallography (Sugio et al., 1999). HSA has 67% α-helix but has no β-sheet and it


33

contains three homologous domains (I–III) that assemble to form a heart-shaped

molecule (Zunszain et al., 2003).

Figure 1.7: Structure model of human serum albumin protein

HSA contains three domains; Domain I, domain II, and domain III, elaborated with blue, yellow, and cyan pigmentation respectively. Figure adopted from Hettick et al. (2012).

1.22 Conjugation chemistry

At present there are various methods used for polysaccharides and protein

conjugation such as reductive amination, cyanylation chemistry and periodate oxidation

(Lees et al., 1996). Sodium cyanoborohydride is a reducing agent used for reductive

amination of aldehyde to proteins. It is stable in water, do not react with aldehydes, but

react with iminium ions. This reducing agent keeps equilibrium between aldehyde and

lactol form of sugars which results in low concentration of free aldehyde. It favors high

concentration of water in aqueous buffer which don’t allow the water to get released and

ultimately iminium ion formation takes place (Frasch, 2009). In reductive amination


34

aldehyde groups of polysaccharides condense with eposlon amino groups of protein, this

process is slower and take few day to complete (Frasch, 2009).

Figure 1.8: Reductive amination of proteins and carbohydrates Free reducing end of sugars covalently attached to protein amino- groups via reductive amination, which make equilibrium mixture composed of the cyclic hemiacetal form (lactol) and the open chain aldehyde form. Then amine groups condense with the aldehyde to form an iminium ion which reduces to amine. The process results in ring opening of the reducing end monosaccharide. Diagram adopted from Gildersleeve et al. (2008).

Activation of polysaccharide is a very important part towards conjugation because

these make a chemical linkage with protein. Soluble polysaccharides are mainly activated

with 1-cyano-4-dimethylaminopyridine tetrafluoroborate (CDAP), an organic cyanylating

reagent, the cyanylated polysaccharides conjugate with proteins via spacer molecule such

as adipic acid dihydrazide (ADH). However CDAP activated polysaccharides are able to

bind protein without linker molecule (Lees et al., 1996; Shafer et al., 2000).

Considerable features of conjugate vaccines are the formulation of vaccines, dose

schedule and comparative analysis of prime and boosting properties of LPS, comparison

of antibody response before or after injected with conjugates. These characteristics were

determined for typhoid, meningococcal and pneumococcal vaccines (Borrow et al.,

2001a; Borrow et al., 2001b; Cui et al., 2010).


35

1.23 Objectives

A. Purification and antigenic evaluation of lipopolysaccharides and O-specific

polysaccharides of Vi negative Salmonella Typhi.

B. Production and use of recombinant Exoprotein A of Pseudomonas aeruginosa as

carrier protein for conjugation.

C. Preparation of Vi negative Salmonella Typhi OSP-protein conjugates.

36

CHAPTER 2

MATERIALS AND METHODS

PART A

Purification and antigenic evaluation of lipopolysaccharides and O-specific

polysaccharides of Vi negative Salmonella Typhi

2.1 Bacterial isolates

Salmonella enterica serovar Typhi (S. Typhi) (both Vi positive [AS1], Vi

negative [AS7]) isolates and Pseudomonas aeruginosa (P. aeruginosa) isolate MS6 were

taken from already preserved glycerol stocks stored at – 20 °C. These were acclimatized

to room temperature, inoculated (50 µL) in test tube containing 3 mL of tryptic soya

broth (TSB, Merck, Germany) 30g /liter (w/v) and incubated at 37 °C overnight to revive

the isolates.

A sterilized wire loop was dipped into TSB growth overnight culture (Appendix

1) of each of the S. Typhi isolate and streaked on a separate MacConkey agar plate (65g /

liter [w/v]) while P. aeruginosa was streaked on nutrient agar plate and incubated at 37

°C overnight. MacConkey agar is a differential medium recommended for isolation and

differentiation of lactose fermenting bacteria from non-lactose fermenting bacteria

(Appendix 2). A well isolated bacterial colony from the MacConkey agar plate was used

for its biochemical identification. P. aeruginosa was streaked on nutrient agar plate.

2.2 Biochemical identification

2.2.1 TSI agar slants

Triple sugar iron agar (Merck, Germany) slants were prepared according to the

manufacturer’s instructions (Appendix 3). Glass tubes containing 3 mL TSI media were

autoclaved. The molten agar was solidified in a 30° angle slant position. The proportion

of slant and butt was kept equal. A single bacterial colony was picked from MacConkey

agar plate and inoculated into the triple sugar iron agar slant with stab and streak method.

The tubes were incubated at 37 °C for 16 hours and observations were made according to

manufacturer’s guidelines.

MaterialsandMethods Chapter2

37

2.2.2 Remel kit for S. Typhi identification

The bacterial isolates were identified and confirmed using Remel kit (RapID

ONE) (Thermo Fisher Scientific, Lenexa, USA) according to the manufacturer’s

instructions. Remel kit is specifically used for characterization of enteric bacteria. The

results obtained were interpreted using software ERIC (Electronic RapID Compendium),

(Thermo Fisher Scientific, Lenexa, USA).

Remel kit reagents

RapIDTM One Panels, RapIDTM Inoculation Fluid, RapIDTM One Reagent,

RapIDTM Spot Indole Reagent, MacConkey agar, sterile distilled water (SDW), No.2

McFarland turbidity standards.

Procedure

An isolated bacterial colony was picked from MacConkey agar plate and

suspended into RapID Inoculation Fluid (sterilized distilled water 2 mL) to attain a visual

turbidity equivalent to No. 2 McFarland turbidity standards. Lid of the panel was peeled

back by pulling the tab from the upper right hand corner over the inoculation port. Test

suspension was poured off to that corner of the panel with the help of a pipette followed

by resealing the lid over inoculation port of the panel. The panel was gently rocked from

side to side to distribute the inoculum uniformly. The inoculum was skewed steadily

onward to the reaction cavities until it poured down the reaction cavities. The inoculated

panels were incubated at 37 °C for four hours. Results were recorded in the data notebook

and the data was analyzed using Eric software (Appendix 4).

2.2.3 API 20 E kit for P. aeruginosa identification

The Analytical Profile Index API-20E 20 100 (bio Merieux, Inc., France) test was

used for identification of P. aeruginosa. The strip was consisting of 21 miniaturized

biochemical tests with dehydrated substrate and database.

Five mL sterile distilled water was distributed in incubation box to create the

humid atmosphere, the strip was removed from packaging and placed in incubation box.

A single colony was taken from nutrient agar plate (18 hours old) and suspended in 5 mL

of homogenized in API suspension medium. Bacterial suspension was distributed in strip

with single pipette, tip of the pipette was placed against wall of the capsule to avoid


38

bubble formation. Several tubes were completely filled (CIT, VP and GEL), while other

tubes were overlaid with mineral oil to create anaerobic reactions condition (ADH, LDC,

ODC, H2S, URE). Boxes were closed and incubated at 37 °C for 24 hours, results were

determined according to manufacturer database.

2.3 Molecular identification

2.3.1 DNA extraction

Total genomic DNA was isolated from the overnight cultures of biochemically

identified S. Typhi and P. aeruginosa isolates by phenol-chloroform method as described

earlier (Sambrook, 2001).

Reagents

TE buffer, sodium dodecyl sulfate (SDS) 10% (w/v), sodium acetate (3 M), salt

saturated phenol (SSP), isomyl alcohol, isopropanol, ethanol (70% and 100%), sterile

distilled water.

Procedure

Overnight bacterial culture (3 mL) in TSB was centrifuged at 10,000 rpm for 5

min. The supernatant was discarded while the pellet was dissolved in 200 µL of T buffer

in eppendorf tubes. Tubes were centrifuged at 10,000 rpm for 5 min, supernatant was

discarded again and added 700 µL of 10% SDS to the pellet and dissolved well by

repeated pipetting. The eppendorf tubes were incubated at 65 °C for two hours (mixed

after 1 hour by inversion) and cooled at room temperature; 700 µL of phenol:

chloroform: isomyl alcohol (25:25:1) was added, mixed by intensive shaking and

centrifuged at 12,000 rpm for 4 min. The upper aqueous layer was transferred carefully to

a new eppendorf tube without disturbing the middle layer. Phenol: chloroform: isomyl

alcohol and centrifugation steps were repeated twice and added 100 µL of 3 M sodium

acetate [pH 4.8] to the supernatant, followed by addition of 700 µL chilled isopropanol.

The mixture was homogenized gently by inversion and incubated at - 20 °C overnight or

at -70 °C for 20 min. Tubes were centrifuged at 12,000 rpm for 4 min, supernatant was

discarded and pellet was washed with 70% ethanol followed by centrifugation at 12,000

rpm for 4 min. Finally, pellet was dried and dissolved in 50 µL T buffer or sterile distilled


39

water. The DNA was stored at 4 °C until utilized. (All solutions were prepared according

to Appendix 5).

2.3.2 DNA quantification

Integrity of the DNA samples was checked by electrophoresis on 1% agarose gel

and the concentration of the genomic DNA was determined by spectrophotometer (Smart

Spec Plus, BIORAD, USA). Samples were diluted 10 /100 in sterile distilled water and

absorbance was measured at 260 nm after calibrating the machine against sterile distilled

water. An O D260 of 1 is equivalent to 50 µg /mL of DNA.

2.3.3 Duplex PCR for identification of S. Typhi (Vi negative isolates)

Duplex PCR was performed using two sets of primers: One set of primers fliC-F /

fliC-R was used for amplification of fliC gene and other set Vi-F / Vi-R (Table 2.1) was

used to amplify tviA gene, present on viaB operon. The fliC gene was used as a signature

sequence for the confirmation of S. Typhi while tviA gene used to confirm the isolate as

Vi negative S. Typhi for further use for purification of lipopolysaccharides.

2.3.3.1 PCR Reaction mixture

Polymerase chain reactions for the amplification of DNA fragments from

genomic DNA were set up as instructed by the manufacturer (Fermantas, USA) using

Taq DNA polymerase. Fifty μl of the PCR reaction mixture was prepared containing 5 μl

of 10 X PCR buffer (Fermantas, USA), 1.5 mM MgCl2, 0.4 mM dNTPs, 0.5 μM of each

primer, 1.25 U Taq DNA polymerase (Fermantas, USA), 21.50 μl of TE buffer and

finally, 10 μl of diluted (1:20) template DNA (~25 ng) was added.

2.3.3.2 Thermal cycler profile

Conditions for the duplex PCR were: Initial denaturation at 94 °C for 5 min

followed by 30 cycles of denaturation at 94 °C for 1 min, primer annealing at 53 °C for 1

min, and extension at 72 °C for 1 min. A step of a final extension step was done at 72 °C

for 7 min.


40

2.3.3.3 Agarose gel electrophoresis

Biotechnology grade agarose (Biotools B & M labs, Spain) 2% [w/v] was taken

in 50 mL of 1X TAE running buffer (20 mM Tris acetate and 0.5 mM EDTA [pH 8.0])

in a 250 mL conical flask (Appendix 6) and boiled in microwave (Waves, Korea) for 1-2

min. The melting agarose was allowed to cool and then added the ethidium bromide (2

mg /mL [final conc. 0.5 µg /mL]). The appropriate comb was fixed in the gel casting tray,

poured the gel and allowed to solidify.

To visualize the amplified products, 10 µL of it was mixed with 5 µL of 6 X

loading buffer (50% glycerol, 50 mM EDTA [pH 8.0] and 0.05% bromophenol blue dye)

and loaded on agarose gel and co-electrophoresed along with a 100 bp DNA ladder

(Fermentas, USA) for comparison. The DNA bands were visualized under UV

transilluminator and documentation system (Viopro platinum, Uvitech, Cambridge, UK).

The bacterial isolate AS-7 confirmed as Vi negative S. Typhi by both biochemical and

molecular methods was used for large scale fermentation and purification of

lipopolysaccharides.

2.4 Fermentation

2.4.1 Media preparation

Three sixty grams of TSB was added to 12 L distilled water with heating and

mixing to produce homogenous medium. The prepared media was dispensed in 20 L

fermentor (Biostat®C). Eighty mL of antifoam was drizzled on media using funnel via

inlet. The media was autoclaved in the fermenter for 15 min at 121 °C.

2.4.2 Inoculum and growth

Typical colonies of S. Typhi were inoculated in TSB and incubated overnight at

37 °C and 1200 mL inoculum was added to 12 L media in the fermenter at the rate of

10% (v/v) and fermentation was allowed at 32 °C at pH 6.7 for 11 hours. The

fermentation was carried out with stirring rate of 400 rpm. After 7 hours of growth,

autoclaved 600 mL of 25% glucose solution was added to fermenter to increase the yield

of carbohydrate production of the cells.


41

2.4.3 Killing and harvesting of bacteria

After 11 hours of fermentation, bacterial cells were killed by adding 120 mL of

formalin solution (40% formaldehyde, 10% methanol and 50% distilled water) and

reduced stirring to 200 rpm overnight. After overnight killing of cells, growth was

harvested from fermenter and cell pellet was obtained by centrifugation at 7,000 g at 4 °C

for 40 min.

2.5 Phenol extraction of lipopolysaccharides (LPS) from S. Typhi

Reagents

Phenol (90%), sodium acetate (1 M), calcium chloride (1 M), ethanol (99%),

NaOH (1N), deionized distilled water.

Procedure

1. One forty grams S. Typhi pellet was dissolved in 1200 mL of distilled water and

kept with mild stirring at 4 °C overnight. Next day 1 kg of phenol (Cat. 16016,

Ricdel deHean, Germany) was equilibrated at 68 °C in water bath (previously

equilibrated at 68 °C) and 110 mL of deionized distilled water was added to make

90% phenol, pH was adjusted to 7.0 with 1 N NaOH (6 mL) then added it to the

suspension of S. Typhi pellet.

2. The mixture was stirred in a large (10 L) glass jar at 68 °C for 30 min using

inverted stirrer. Temperature of the mixture was decreased to 10 °C by transferring

jar to a large vessel containing ice and maintained the stirring.

3. Cold mixture was centrifuged at 7,300 xg for 50 min at 10 °C. The upper clear

water layer containing LPS was collected using pipette and transferred to a clean

flask (measured volume) and added similar amount of water to the brownish bottom

layer.

4. The step 2 and 3 were repeated twice and all three water layers were combined

and re-centrifuged at 8,000 xg for 50 min, the upper water layer was collected and

leaved precipitated contaminations. The combine water layer was brought to 10 mM

sodium acetate (MW 82.03 g /mol), 2 mM CaCl2 (MW 147.02 g /mol) and 25%

ethanol followed by mixing for 20 min at room temperature and then stored at 4 °C

overnight.


42

5. The suspension was centrifuged at 9000 rpm (14,300 xg) at 10 °C for 1 hour to

precipitate the nucleic acids and supernatant was store at 4 °C overnight.

6. To precipitate the LPS, 75% ethanol was added to supernatant, mixed at room

temperature for 20 min and kept at 4 °C overnight.

7. The supernatant was removed by centrifugation at 7,300 xg at 4 °C for 1 hour and

pellet was collected. Pellet was dissolved in appropriate amount of deionized

distilled water and dialyzed (cut off 6,000 – 8,000) for 2 days against deionized

distilled water with two water changes per day. The dialyzed pellet was lyophilized

and named as crude LPS.

8. The crude LPS were dissolved in deionized distilled water and dispensed into

dialysis tube and equilibrated against buffer (2 mM MgSO4 – 50 mM Tris, pH 7.6) at

37 °C for 2 hours. After equilibration, DNase (200 µg/mL) and RNase (50 µg /mL)

were added whereas protease (200 µg /mL) was added after 6 hrs and kept the

dialysis at 37 °C overnight.

9. Next day the dialysis buffer was replaced with deionized water and dialyzed at 4

°C for 2 days with 2 times water changes per day.

10. The dialyzed suspension was centrifuged at 5500 rpm for 30 min, pellet was

discarded and the supernatant was stored at 4 °C.

11. The supernatant was ultracentrifuged at 96,000 xg for 5 hours at 4 °C. The pellet

was suspended in appropriate amount of deionized water, stirred for 2 hours at 4 °C

and transferred to round bottom flasks and stored at -70 °C and lyophilized as

purified LPS.

2.5.1 Estimation of nucleic acids contamination in LPS

Lipopolysaccharides (LPS) were dissolved in 1% Sodium dodecyl sulfide solution

(1 mg /mL). Samples were transferred to a 1 cm quartz cuvette and scanned at 260 nm

using 1% SDS as blank solution. The nucleic acids concentration was analyzed by using

the following formula:

[Nucleic acid] = Absorbance 260 x100% = Absorbance 260 x 5%


43

2.6 Core hydrolysis of S. Typhi LPS to purify O-specific polysaccharides (OSP)

The purified LPS were dissolved @ 10 mg /mL in 1% glacial acetic acid. Samples

were placed in at 100 °C reacti-block (boiling water bath) for 90 min (with stirring). The

mixture was cooled to ambient temperature. Samples were distributed in Corex tubes and

centrifuged at 8000 rpm for 20 min. Supernatant was passed through the chromatography

column (1.5 by 34 cm) using G-25 Sephadex (lot 308158, Amursham Biosciences, USA)

against distilled water using defrectometer (R403, Waters). Sensitivity of the fractions

collector was 30 X and flow rate was 20 cm /hour. For taking readings, chromatogram

fraction collector was set to collect 80 drops per tube (4 mL each). Chromatograph

pointed out O-specific polysaccharides (OSP) containing fractions in void volume and

column volume (blank medium) did not show any peaks. The void volume fractions (11

to 20) were pooled in a round bottom flask, freezed with dry ice for 5 min and

lyophilized. The nucleic acids and protein concentration was analyzed as mentioned

earlier (Section 2.5.1). Purified OSP was stored at -20°C.

2.7 Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE)

Reagents

Sample loading buffer (BioRad, USA Cat No. 161-0737), β-mercaptoethanol

(BioRad, USA Cat No.161-0710), Laemmeli SDS-PAGE running buffer (BioRad, USA

Cat No. 161-0732), BLUeye Prestained Protein Ladder (Cat No. PM007-0500). (Please

see appendix 7 for SDS-PAGE solutions preparation)

Procedure

One mg of LPS was dissolved in 1 mL of Milli-Q water and 1:1 laemmli sample

loading buffer was added to the LPS solution. Samples were boiled for 5 min at 100 °C.

A 7.5 X Mini-protean TGX precast gel (BioRad, USA) was taken out from 4 °C. The

cassette was assembled in running module of mini protean tetra system with short plate

facing inward and 200 mL of 1 X Lemmeli SDS-PAGE running buffer was loaded in gel

tank. Twenty µL sample and 5 µL BLUeye prestained protein ladder (Cat No. PM007-

0500) was loaded via gel loading tip in the wells. Empty wells were filled with Laemmlli

buffer and samples were allowed to settle down in wells. The lid of the apparatus was


44

closed and plugged in electric power; the running voltage was 180 Volts for 45 min. On

completion, the gel was removed gently and staining was done according to the protocol.

2.8 Silver staining for detection of LPS after SDS-PAGE

Reagents Please see Appendix 8

Procedure

Polyacrylamide gel was removed from the apparatus on completion of

electrophoresis and carefully placed into the fixing solution in a clean glass dish

overnight (glass plates used in silver staining were cleaned with absolute nitric acid and

thoroughly rinsed with deionized water). Next day, fixing solution was replaced with

oxidizing solution and placed on mild shaking for 60 min. Gel was washed three times

for 15 min in Milli-Q water with mild shaking. Gel was transferred to fresh prepared

staining solution and agitated vigorously for 30 min, followed by rinsing with Milli-Q

water three times (each for 10 min) with mild shaking. Water was replaced with

developing solution, mildly agitated till the development of dark brown LPS bands. Stop

solution was added to terminate the development when the stain reached the desired

intensity. A snapshot of the gel was captured with digital camera and it was stored in

Milli-Q water at room temperature.

2.9 Alditol acetate assay for determination of sugars in Vi negative S. Typhi

Reagents

Trifloro acetic acid, Nitrogen (N2) stream, Sodium tetrahydridoborate, glacial

acetic acid, 2% acetic acid in Methanol, Dichloromethane (CH2Cl2)

Procedure

One mg sample was dissolved in 1 mL of 2 M trifloro acetic acid (TFA). The

sample was placed at 100 C for 3 hours followed by drying under N2 stream, 750 µL of

deuterium oxide (D2O) was added and vortexed. Sodium tetrahydridoborate NaBH4 (or

Na BD4) was carefully added in traces to break the double bonds of sugars, samples were

incubated over night at room temperature. Next day 7 drops of glacial acetic acid were

added, vortexed and dried under N2 stream. One mL of 2% acetic acid in methanol was

added followed by vortexing and drying under N2 stream. Acetic acid addition step was


45

repeated twice. One mL of acetic anhydride was added and it was placed at 100 C for 2

hours followed by drying under N2 stream. Sample was dissolved in 1 mL of

dichloromethane (CH2Cl2) and run through column (made up of Pasteur pipette with

cotton plug). The residue was collected and dried. The sample was injected in GC-MS.

The Gas chromatography (GC) was outfitted with 30 M DB-17 capillary column (180-

260 C at 3.5 C /min) and Mass spectrometer (MS) was operated on electron-impact

mode using Varian Saturn II mass spectrometer.

2.10 Immunodiffusion assay

Ouchterlony double immunodiffusion (also called passive double

immunodiffusion or agar gel immunodiffusion) is a serological technique in which

antigen and antibody solutions are allowed to diffuse toward each other through agarose

gel matrix; interaction is determined by a precipitated line for each system. One percent

agarose gel was used for immunodiffusion assay according to Ouchterlony and Nilson

1986 with minor modifications.

Requirements

Glass slides, 1 N Saline, vacuum sucker, filter paper, fine tissue papers, LPS

dilutions, OSP dilutions (antigens) and mice serum dilutions (antibodies).

Procedure

2.10.1

Sterile glass slides were placed on clean, leveled surface and pre-coated with

0.1% agarose in deionized water. A clear colorless solution of agarose was prepared (1%)

in saline by boiling and 6 mL was applied to the pre-coated slides gradually and

constantly. The agarose was allowed to solidify on slides at room temperature for 30 min.

Circular wells were made in the gel and desired patterns were designed by vacuum

sucking apparatus. Each well was filled with appropriate volume (10 ~15 µL) of antibody

and antigen needed according to the pattern of experiment. All loaded slides were

incubated at 4 °C overnight in moist environment.

Inoculation of plates


46

2.10.2 Staining and de-staining of plates

The slides were washed with 1 N saline twice for 30 min. Slides were transferred

to plan surface and covered with wrinkle free filter paper and few layers of fine tissue

paper. Gel was dried by pressing under heavy books for 2 hours with one paper towels

change followed by drying under air at room temperature. Slides were soaked in staining

solution for 5 min, shifted to the de-staining solution and rocked for 10 min till the

background became clear. The slides were air dried at room temperature and snapshot

was taken with digital camera on a light box.

PART B

Production and use of recombinant Exoprotein A of Pseudomonas aeruginosa as

carrier protein for conjugation

2.11 Identification of Pseudomonas aeruginosa

2.11.1 Biochemical identification of P. aeruginosa strains

Pseudomonas aeruginosa isolate MS6 was taken from NIBGE stock,

biochemically identified by TSI slants as mentioned earlier (Section 2.2.1).

2.11.2 Identification of P. aeruginosa isolates by multiplex Polymerase Chain

Reaction

Initially, PCR amplification conditions were optimized for each of the four genes

(gyrB, ETA, oprL and Pa16S) individually and then for the multiplex PCR (M-PCR)

using Taq DNA polymerase.

2.11.2.1 M-PCR master mix

A typical reaction mixture of the M-PCR of 50 µL was as following: Five µL of

10X Taq buffer, 1.5 mM MgCl2, 0.4 mM of each dNTP, 5 U of Taq DNA polymerase

(Fermentas, USA), 0.5 μM of each of the primers targeting gyrB, ETA and Pa16S gene

fragments, 0.75 μM of the primers targeting oprL gene (Table 2.1) and 20 ng of DNA

template.


47

2.11.2.2 Thermal cycler profile

The thermal cycler (PTC 06, ICCC, Pak) conditions for the multiplex PCR were:

initial denaturation heating at 94 °C for 5 min followed by 35 cycles of denaturation at 94

°C for 1 min, primer annealing at 58 °C for 1 min, extension at 72 °C for 1.5 min and a

final extension step at 72 °C for 7 min. The PCR product was stored at 4 ºC.

Table 2.1: Primers used in this study

Primers Sequences (5/ - 3/) Genes Amplicons

(bp)

References

gyrB-F

gyrB-R

CCTGACCATCCGTCGCCACAAC

CGCAGCAGGATGCCGACGCC

gyrB 222 (Motoshima et al.,

2007)

ETA-F

ETA-R

GACAACGCCCTCAGCATCACCA

CGCTGGCCCATTCGCTCCAGCG

ETA 397 (Khan and

Cerniglia, 1994)

oprL-F

oprL-R

ATGGAAATGCTGAAATTCGGC

CTTCTTCAGCTCGACGCGACG

oprL 504 (De Vos et al.,

1997)

Pa16S-F

Pa16S-R

GGGGGATCTTCGGACCTCA

TCCTTAGAGTGCCCACCCG

16S

rDNA

618 (Spilker et al.,

2004)

pMSEPL5-F

pMSEPL5-R

GGGCAACATATGAAAAAGACAGCT

ATCGCG

CCGGTCGGAATTCTTACTTCAGG

rEPA 1917 This study

fliC-F

fliC-R

TATGCCGCTACATATGATGAG

TTAACGCAGTAAAGAGAG

fliC 495 Song et al.,1993

Vi-F

Vi-R

GTTATTTCAGCATAAGGAG

ACTTGTCCGTGTTTTACTC

tviA 599 (Hashimoto et al.,

1995)


48

2.11.2.3 DNA sequencing

Selected DNA amplified fragments were purified using a QIAquick DNA

purification Kit (Cat. 2806 Qiagen, Hilden, Germany) and sent to Macrogen (South

Korea, Appendix 9) for sequencing with gene specific primers. The sequence

chromatographs were analyzed with Seqman software (DNASTAR, Inc. Wisconsin,

USA) before submission to Genbank.

2.12 Plasmid harboring recombinant exoprotein A (rEPA) gene

The expression plasmid, pVC45D /PE553D, was provided by Dr. Ira Pastan NIH,

USA. The plasmid was harboring full-length mutant rEPA gene of P. aeruginosa,

deficient in glutamic acid (amino acid No. 553 of the polypeptide). The mutation had

converted the toxin to toxoid.

2.12.1

Amplification of the recombinant Exoprotein A (rEPA) gene fragment from

pVC45D clone was set up with a pair of primers pMSEPL5-F and pMSEPL5-R (Table

2.1) using Pfu polymerase (Fermentas, USA).

A typical reaction mixture of the PCR of 50 µL was as following: 5 mM of 10 X Pfu

polymerase buffer, 0.8 µM of (pMSEPL5-F and pMSEPL5-R) primers of 0.4 mM

dNTPS, 5 mM MgSO4, 100 ng of DNA template, 1U Pfu DNA polymerase and 23 µL of

sterile distilled water.

PCR reaction was done on PTC 06 (ICCC, Pak) machine. Thermal cycler

conditions for PCR were: activation of Pfu polymerase by heating at 95 ºC for 3 min

followed by 30 cycles of denaturation at 95 °C for 30 sec, annealing at 55 °C for 30 sec

and extension at 72 °C for 3: 30 min. The final extension was done at 72 ºC for 15 min

and the amplified DNA was stored at 4 °C.

2.12.2 Purification of PCR product

PCR product (80 – 100 µL) was taken and 5 volumes of buffer QG were added to

the product using QIA quick PCR Purification Kit. A spin column was placed in a 2 mL

collection tube and centrifuged at 11,000 rpm for 30 – 60 sec. Flow-through was

discarded and placed the column back into the same tube, 750 µL PE Buffer was added to

Amplification of rEPA gene (full length)


49

the column and centrifuged at 11,000 rpm for 30–60 sec. Flow-through was discarded

and column was inserted back in the same tube. The column was further centrifuged for

60 sec at 14,000 rpm and transferred to a clean 1.5 mL eppendorf tube. Elution buffer (50

µL) was added to the center of the column membrane and column was left to stand

vertically for 1 min. Finally the DNA was eluted by centrifugation at 11,000 rpm for 2

min.

2.13 Restriction of vector DNA and amplified gene product

Restriction of the amplified DNA fragment and pET-28a-TEV vector was

performed as follows: Each (50 µL) reaction mixture consisted of 10 µg of PCR

amplified DNA, 5 µL of 10 X appropriate buffer, 5 µL of restriction endonucleases 10 U

/μl and volume made up with sterile distilled water. The restriction reaction was prepared

in eppendorf tube and incubated at 37 °C overnight. The restricted fragment was

separated by loading on agarose gel, electrophoresed and visualized under UV light.

DNA bands were quantified by comparing with its fluorescence intensity with the known

ratio of 100 bp plus DNA ladder (Fermentas, USA).

2.13.1

The restricted DNA fragments were excised from the low melting agarose gel

with a clean, sharp scalpel and purified with QIAquick Gel Extraction Kit (Cat. 2806

Qiagen, Hilden, Germany) following the instructions of the manufacturers. The gel slice

was weighted after placing in an eppendorf tube. Three volumes of Buffer QG were

added to 1 volume of gel. Tubes were incubated at 50 °C for 10 min or until the gel slice

had completely dissolved. The tubes were vortexed after every 2 – 3 min during the

incubation. Color of the mixture was turned yellow by the end of the complete

dissolution of the gel. One gel volume of isopropanol was added to the sample and

mixed. Samples were transferred to spin column and centrifuged for 60 sec at 13,000 rpm

to bind the DNA. Flow-through was collected in a 2 mL collection tube and discarded.

Column was placed back in the same collection tube. Buffer QG 500 µL was added to

column and it was centrifuged for 1 min at 13000 rpm followed by addition of Buffer PE

750 µL to the column and centrifugation for 1 min at 13000 rpm to wash the DNA. Flow-

through was discarded and column was centrifuged for an additional 1 min. Column was

Excision and purification of desired bands from gel


50

shifted to a clean eppendorf tube. DNA was eluted by addition of 30 µL elution buffer to

the center of the column membrane. Column was allowed to stand for 1 min and then

centrifuged for 2 min.

2.13.2 Dephosphorylation of vector DNA sequence

Shrimp alkaline phosphatase (SAP) was used to dephosphorylate the 5/ end of

pET-28a-TEV vector DNA sequence. The reaction was performed according to the

instructions of manufacturer (Fermentas, USA). A typical dephosphorylation reaction (50

µL) was performed as following: 40 µL of pET-28a-TEV (vector DNA) [10 pmol of 5`

ends], 5 µL of 10 X reaction buffer, 5 µL of diluted SAP (1U /µL) and 1 µL of sterile

distilled water. Promaga biomath calculator was used to convert the linear DNA

(http://www.promega.com/a/apps/biomath/index.html?calc=ugpmols) to picomoles of the

ends. The reaction mixture was incubated at 50 °C following by inactivation of SAP for

15 min at 65 °C. To remove the buffers from the phosphorylated DNA, it was treated

with Qiagen DNA purification kit (Cat. No. 28106 Qiagen, Hilden, Germany).

2.13.3

For quantification of DNA in nanograms, 2 µL of DNA sample and 5 µL of DNA

quantification ladder were loaded on 1.5% gel. Brightness of the sample and ladder bands

was determined and divided by 2 to get estimated quantified values. For example, our

desired band had brightness 60 therefore concentration of DNA was 30 ng.

2.14 Ligation

Insert to vector molar ratio of ends were determined for ligation using Promaga

biomath calculator (http://www.promega.com/techserv/tools/biomath/calc06.htm).

Length of the insert in kb was divided by length of the vector in kb multiplied with

nanograms of vector which gave the value of nanograms of insert needed for 1: 1 molar

ratio. The molar ratio of vector: insert used was 1: 1 and 1: 3. Ligation was performed

using T4 DNA ligase (Fermentas, USA). Typical reaction of ligation (20 µL) consisted

of 50 ng of restricted vector and insert DNA, 2 µL T4 DNA ligase, 10 X buffer, 1 µL of

T4 DNA ligase (5 U /µL) and sterile distilled water to make up the final volume. The

ligation mixtures were kept in ligation chamber at 16 °C overnight for 14 – 16 hours.

Quantification of DNA on gel


51

2.15 Preparation of bacterial competent cells

2.15.1 OmniMax competent cells

Luria–Bertani (LB) agar plates (Appendix 10) containing tetracycline 5 µg /mL

were prepared, streaked by Omnimax stock stored at – 80 °C and incubated at 37 °C

overnight. Next day, a single colony was picked and inoculated in a test tube of LB broth,

with tetracycline (5 µg /mL) and incubated at 37 °C overnight (12 – 16 h) in shaking

incubator (New Brunswick Scientific, USA). On third day, 2% inoculum from day-2

culture was transferred to 60 mL (250 mL flask) LB broth with tetracycline (5 µg /mL)

and incubated in shaking incubator at 37 °C for 2 – 3 hours. Growth was checked by

reading OD600 nm after each 30 min, till the OD600 reached to 0.4 – 0.5 (ideally 0.47).

The culture was transferred to 50 mL falcon tubes and placed on ice for 30 min.

The culture was centrifuged at 2,000 rpm at 4 °C for 8 min and supernatant was

discarded. The pellet was dissolved in 2 mL (0.1 M MgCl2) solution and volume was

made up to 20 mL in a falcon tube. The falcon tubes were incubated on ice for 30 min,

and centrifuged at 2,000 rpm at 4 °C for 5 min. The pellet was dissolved in 2 mL of 0.1

M CaCl2 solution and volume was made up to 20 mL. Falcon tubes were placed on ice

for 30 min, centrifuged at 2,500 rpm for 5 min, and after discarding supernatant, the

pellet was dissolved in 2 mL CaCl2 containing 15% glycerol. The stock was aliquoted in

200 µL fractions in 1.5 mL eppendorf tubes. The aliquots were preserved at -70 °C until

used.

2.15.2 BL21 (DE3)-C41 competent cells

BL21 (DE3)-C41 cells were also prepared as mentioned above (Section 2.15.1)

but the only difference was that these cells had no antibiotics for selection.

2.16 Transformation in competent cells

Transformation is the uptake of genetically engineered plasmid DNA by

competent bacterial cells. An aliquot of 200 µL OmniMax competent cells was thawed

on ice. The plasmid DNA or the ligated product was added (30 ng approximately) to a

vial of 200 µL of competent cells and mixed gently. Vials were incubated on ice for 30

min followed by heat-shock at 42 °C in water bath for 90 sec. Vials were placed on ice

for 5 min and allowed the cells to recover, subsequently 200 µL of pre-warmed LB


52

Medium were added to each vial. Vials were capped tightly and shaken horizontally at 37

°C for 1 hour at 225 rpm in a shaking incubator followed by centrifugation at 3,000 rpm

for 3 min. Supernatant was discarded and saved 50 µL culture in bottom. Transformation

mixtures were spread on a pre-warmed selective agar plate. All plates were inverted and

incubated at 37 °C overnight.

2.17 Confirmation of transformation

2.17.1 Plasmid isolation and digestion

(Please see Appendix 11 for solution preparation)

Overnight LB growth of bacterial colonies (1 to 5 mL cultures) having antibiotics

(kanamycin 25 mg/mL) were taken, centrifuged at 5,000 rpm for 10 min and the

supernatant was discarded. Solution I (150 µL) was added to the tube, pellet was re-

suspended by vortexing followed by addition of 1 μl RNase (10 μg /mL). The mixture

was transferred to eppendorf tubes and 150 µL of solution II was added followed by 5 – 6

times inversion and left for 1 – 2 min. Two hundred µL of solution III was added and

inverted few times. Eppendorf tubes were centrifuged at 12,000 rpm for 10 min at room

temperature and supernatant was transferred to a new tube. One mL of 100% ethanol

(stored at – 20 ºC) was added to each tube and incubated at – 20 °C for 30 min. The

mixture was inverted few times and centrifuged at 13,000 rpm for 13 min at room

temperature. The supernatant was discarded, 200 µL of 70% ethanol was added side wise

and supernatant was removed from the center. The pellet was dried and resuspended in

20 μl sterile distilled water.

The plasmid was cleaved with appropriate restriction endonuclease as

mentioned earlier (Section 2.13).

2.17.2 DNA sequencing and sequence analysis

The cloned rEPA gene fragment was sequenced as mentioned earlier (Section

2.1.7.2) and the sequence chromatographs were analyzed with Seqman software

(DNASTAR, Inc. Wisconsin, USA).


53

2.18 Expression of rEPA protein of P. aeruginosa

One loopful culture of pMSE5 in BL21 (DE3)-C41 glycerol stock was streaked

on LB agar plate containing kanamycin (20 µg /mL) and incubated at 37 °C overnight.

Next day 4 to 5 colonies were inoculated from plate in 50 mL LB broth containing

kanamycin (20 µg /mL), incubated overnight. Next day, 2% inoculum was transferred to

500 mL LB broth in 2 liter flask (total 4 flasks caped with foam plugs) and grown in

incubator at 30 °C with continuous shaking at 225 rpm. The OD600 was measured at

density meter plus (Eppendorf, Germany) after every 40 min till it was between 0.5 – 0.6.

Initially rEPA protein was expressed at 37 °C and 1Mm isopropyl-1-thio-β-D-

galactopyranoside (IPTG) from soluble and inclusion bodies (Figure 2.1)

2.18.1

To optimize further, expression was carried out at three different temperatures i-e

18 °C, 28 °C and 37 °C. The protein expression yield was promising at 28 °C.

2.18.2 Optimization of induction with IPTG concentration

After optimization of the expression at suitable temperature, the cultures

were induced at 28 °C with 0, 0.25, 0.5, 0.75 and 1mM isopropyl-1-thio-β-D-

galactopyranoside (IPTG) concentrations (Sigma-Aldrich, Canada) with continuous

shaking at 225 rpm (Control Environment incubator shaker, Burnswich, USA) for 4 hours

to produce recombinant Exoprotein A of P. aeruginosa linked to a hexa-histidine tag

(His6-TEV-rEPA). Cells were centrifuged at 4,000 rpm for 20 min at 4 °C (Backman

Centrifuge, USA). The cell pellet was weighed and kept at -20 °C till further processing.

2.18.3 Expression optimization with post induction time

The protein expression was further optimized by fine tuning the post induction

time. After raising the OD600 to 0.6, the cultures were induced with optimized IPTG

concentration at optimized time. Samples were taken after different time intervals until

24 hours.

Optimization of expression with different temperatures


54

2.19 Purification of recombinant exoprotein A of P. aeruginosa (rEPA)

2.19.1 Purification from soluble fraction

One liter cells pellet of BL21 (DE3)-C41 harboring pMES5 was re-suspended in

40 mL resuspension buffer (20 mM Tris-Cl, pH 8.0, 100 mM NaCl, 2 mM β-ME and

1mM PMSF). The dissolved pellet was passed from cell disrupter followed by

centrifugation at 10,000 rpm (11,000 to 12,000 xg) for 30 min at 4 °C. The supernatant

(soluble fraction) was mixed with 1mL (0.5 mL bed vol) Ni-NTA resin and incubated for

2 hour at 4 °C with rocking. The column was equilibrated with 10 column volume (CV)

of resuspension buffer. The mixture of supernatant and Ni-NTA resin was passed from

the column 2-3 times and collect the flow through as single fraction. Bound proteins were

washed with 35 CV (17.5 mL) of wash buffer (20 mM Tris-Cl, pH 8.0, 300 mM NaCl, 2

mM β-ME 1mM PMSF and imidazole was added 0, 5, 10 and 20 mM respectively) and

faction were collected in 1.5 mL eppendorf tubes equal to bed volume of resin (0.5 mL).

The desired protein was eluted with 10 CV (5 mL) of elute buffer (20 mM Tris-Cl, pH

8.0, 100 mM NaCl and 300 mM imidazole) and collected in fractions equal to bed

volume of resin (0.5 mL).

2.19.2

For purification of protein from inclusion bodies, similar protocol was adopted as

mentioned earlier (Section 2.19.1) however 8 molar Urea was added to each of the

resuspension, wash and elution buffers.

Cells pellet of BL21 (DE3)-C41 harboring pMES5 was re-suspended in lysis

buffer (20 mM Tris-Cl, pH 8.0, 100 mM NaCl, 2 mM β-ME, 1mM PMSF and 8 M Urea),

stirred for 30 min on magnetic stirrer followed by centrifugation at 10,000 rpm (11,000 to

12,000 xg) for 30 min at 4 °C. Ni-NTA bound proteins were washed with 35 CV (17.5

mL) of wash buffer (20 mM Tris-Cl, pH 8.0, 300 mM NaCl, 2 mM β-ME 1mM PMSF, 8

M Urea and imidazole was added 10, 20 and 20 mM respectively) and faction were

collected in 1.5 mL eppendorf tubes equal to bed volume of resin (0.5 mL). The desired

protein was eluted with 10 CV (5 mL) of elute buffer (20 mM Tris-Cl, pH 8.0, 100 mM

NaCl, 8 M Urea and imidazole added were 50, 100 and 300 mM respectively) and

collected fractions equal to bed volume of resin (0.5 mL).

Purification from insoluble fraction (Inclusion bodies) with imidazole


55

Figure 2.1: Flow chart diagram for expression and purification of rEPA protein

2.19.3 Purification from Inclusion bodies with pH gradient

The protein was also purified from inclusion bodies with pH gradient. Cells pellet

of BL21 (DE3)-C41 harboring pMES5 was re-suspended in lysis buffer (100 mM

Na2HPO4.H2O, 10 mM Tris, 8 M Urea, pH 8.0) and followed protocol as mentioned

above (Section 2.19.2). Ni-NTA bound proteins were washed with 35 CV (17.5 mL) of

wash buffer (100 mM Na2HPO4.H2O, 10 mM Tris, 8 M Urea pH 6.3) and faction were

collected in 1.5 mL eppendorf tubes equal to bed volume of resin (0.5 mL). The desired

protein was eluted with 10 CV (5 mL) of elute buffer I (100 mM Na2HPO4.H2O, 10 mM

Tris, 8 M Urea pH 5.9) followed by incorporate low pH elution buffer II (100 mM

Na2HPO4.H2O, 10 mM Tris, 8 M Urea pH 4.5) and collected fractions equal to bed

volume of resin (0.5 mL).


56

Absorbance of protein purified from all purification methods was measured at 280

nm while elution buffer was taken as blank. Purified fractions were kept at 4 °C. The

protein was quantified with Bradford protein assay and molecular size was determined on

SDS-PAGE.

2.20 SDS-PAGE for Protein

SDS-PAGE was run as described above with minor modifications. Twenty five

(25) percent of sample loading dye (4 X) and 75% of sample were mixed and boiled at 80

°C for 10 min followed by a short spin. A pair of glass plates of PAGE apparatus was

assembled in plate holder. Twelve% resolving gel was prepared, loaded between both

plates followed by addition of isopropanol on gel surface and allowed to solidify. Later

on isopropanol was removed and mixture of staking gel was loaded above resolving gel

followed by placing well preparing comb on the top of gel. Running buffer was added to

gel tank. The protein samples were loaded and SDS-PAGE was run according to protocol

as mentioned earlier (Section 2.7).

2.21 Determination of protein concentration

2.21.1 Bradford assay for protein

Bradford is a simple and accurate procedure for determining concentration of

protein. It involves the addition of an acidic solution of Coomassie blue to protein

solution which shifts the absorbance from 465 – 595 nm when binding to protein occurs.

Spectrophotometer or microplate reader was used for absorbance analysis.

Procedure

Twenty (20) µL of the sample was taken in an eppendorf tube and 1 mL of

Bradford reagent (quick start BSA standard set Cat No. 500-0207) was added, inverted

few times and kept at room temperature for 5 min. Absorbance was checked using

disposable plastic cuvette in an eppendorf Biophotometer plus at 595 nm.


57

2.21.2 Bicinchoninic acid Assay (BCA) for protein determination

Reagents

BCA protein assay kit (Thermo scientific USA, cat No 23225), BCA reagent A,

BCA reagent B, BSA 2 mg /mL in 0.9% saline and 0.05% sodium azide and phosphate

buffer saline (PBS).

Procedure

ELISA plate was taken and labeled for samples dilutions. The reagents A and B

were taken 50: 1 and mixed in appropriate vial. Standard BSA protein was taken (25 µL/

well) in various concentrations (2, 1.5,1, 0.75, 0.5, 0.2 and 0.1 mg /mL) and incorporated

in wells in triplicate according to labels starting from B1 (A 1 was read as blank)

followed by unknown protein dilutions. Two hundred µL of reagents were put in each

well starting from A1. All the mixtures were homogenized by tabing plate for 30 sec,

bubbles were removed and incubated at 37 °C for 30 min. Samples were cooled to room

temperature and reading was taken with Dynatech lab MR 500 at 562 nm. The result was

interpreted using the Microsoft excel sheet. The unknown protein concentration was

determined by comparing it with the standard curve graph.

2.22 Matrix assisted laser desorption ionization (MALDI) analysis of rEPA

The TEV-His6-rEPA sample was analyzed using Voyager DE-Pro MALDI-TOF

mass spectrometer (Applied Biosystems) operated in the linear /positive-ion mode with

the following configurations: Accelerating voltage: 25000; Grid voltage: 92%; Guide

wire voltage: 0.30%; Delay time: 200 nsec; Low mass gate: 2000 Da. The matrix was

made by dissolving sinapinic acid (Fluka, 78867) as 10 mg /mL followed by addition of

concentrated acetonitrile and 0.1% trifluoro acetic acid in a ratio of 30: 70. Mixture was

centrifuged to sediment the un-dissolved sinapinic acid.

Standard was made by placing 1 µL of the BSA standard (Applied Biosystems, 2-

2158-00) mixed with 10 µL of matrix; 1.2 µL was spotted on the sample plate (100 spot

plate, Applied Biosystems, V700666) and left to dry. Similarly, 5 µL of each sample was

mixed with 10 µL of matrix and 1.2 µL was spotted on the plate and left to dry. Hundred

shots per spectrum were taken at a laser power of 2300 (m /z) in a range of 20 kDa to 200

kDa. The spectrum was labeled using Microsoft Power point.


58

2.23 Removal of His-tag from protein

2.23.1 Cleavage of rEPA using TEV protease

The components (10 U ProTEV plus enzyme, ProTEV Buffer 5 μl, 20 X 100 mM

DTT 1 μl and 20 μg of 6x His-tag attached purified protein were assembled in an

eppendrof tube and made up the volume to 100 µL with sterile distilled water. Reaction

mixture was incubated at 30 °C for 9 hours. An appropriate SDS-PAGE sample buffer

was added to the digested protein and 10 to 20 μl of prepared samples were loaded on

SDS-PAGE to determine the cleavage by monitoring the disappearance of the full-length

fusion protein and appearance of the cleaved products.

2.23.2

6x His-tag was present at the N-terminus ProTEV Plus protein. After cleaving

TEV-His6-rEPA, ProTEV Plus was removed from the mixture by incubating with Ni-

NTA resins on ice followed by centrifugation at 5000 rpm for 10 min; the rEPA was

found in the supernatant.

2.24 Western blot analysis

After the removal of 6x his-tag from protein, an SDS-PAGE was performed as

mentioned earlier (Section 2.20).

2.24.1 Transfer of rEPA on PVDF membrane by semi-dry blotting

An extra thick filter paper and polyvinylidene fluoride (PVDF) membrane were

cut according to the size of gel and dipped in transfer buffer (wearing gloves). Two sheets

of buffer-soaked extra thick filter paper were placed onto the platinum anode (Biorad

trans-blot semi-dry SD cell) and air bubbles were gently removed with glass rod.

Membrane was placed on filter papers, air bubbles were removed and the gel was placed

on membrane. Other sheets of pre-soaked filter paper were placed above the gel and

again air bubbles were removed. Finally, the cathode was placed onto the stack and then

safety cover on the unit. The unit was plugged into the power supply and voltage was set

to12 V for one hour.

Removal of TEV protease from cleavage Reactions


59

2.24.2 Blotting

The PVDF membrane was dipped in methanol. The membrane was blocked with

1% BSA-TBST and rocked for 30 min. It was transferred to 10 mL of primary antibody

diluted (1: 1000, stock 50 µL in 10 mL) in 1% BSA-TBST and rocked for 60 min. The

membrane was washed with 20 mL of TBST for 3 times (10 min for each). Then the

membrane was transferred to 10 mL of secondary antibody (1: 500, 2 µL in 10 mL) and

rocked for 30 min. Membrane was washed again with 20 mL of TBST for 3 times (10

min for each). Development Reagent A (100 µL) and Reagent B (100 µL) of BioRad AP

conjugate substrate kit AP were mixed with 9.8 mL alkaline phosphatase buffer (the

substrate was made just prior to use and protected from light). The substrate was added to

the bottom of the dish and then slowly tilted to cover the membrane. Development was

stopped by washing the membrane with sterile distilled water for 10 min and changed

water once. Finally, the membrane was air dried and took snapshot with digital camera.

2.25 Structural analysis of rEPA

The sequenced rEPA gene fragment (Section 2.17.2) was translated to amino acid

sequence using expasy database (http://www.expasy.org/translate). The provided protein

sequence was subjected to determine molecular weight, estimation of half-life, instability

index (II) as well as number of lysine residue which were necessary for conjugation

reaction. The required information was obtained from expasy proparam

(http://www.expasy.org/ protparam).

Sequence similarity was determined by comparing (Blast) the sequences to other

closely related sequences in the database (http://www.ncbi.nlm.nih.gov/BLAST/). Final

sequences were submitted to GenBank database (http://www.ncbi.nlm.nih.gov/genbank).

Multiple sequence alignments were performed using Clustal X (Thompson, 1997) and

PyMol software was used to see Lys residues and over all fold of the protein. The PDB

file used for PyMol was 1IKQ_A.


60

PART C

Preparation of Vi negative Salmonella Typhi OSP conjugates with carrier proteins

2.26 Conjugation strategies

Vi negative S. Typhi OSP was conjugated with proteins either directly by

reductive amination using sodium cyanoborohydride or it was derivatized with ADH

linker and then the derivatized OSP (OSPADH) was conjugated with proteins using cyano

dimethyl amino pyridiniom-tetrafloroborate (CDAP) chemistry. Both methods were tried

using Human Serum Albumin (purchased from SigmaAldrich, USA) and recombinant

exoprotein A (rEPA) of P. aeruginosa expressed and purified in house during this study

(Figure 2.2).

Figure 2.2: Flow chart for elucidation of conjugation strategies

CONGUATION

ReductiveAmination

OSP –HSA

Conjugate 1

OSP –rEPA

Conjugate 2

CDAPMethod

OSPADH –HSA

Conjugate 3

OSPADH‐rEPA

Conjugate 4


61

2.27 Conjugation by Reductive Amination

Reagents

Human Serum Albumin (HSA; 1 mg /mL solution) (Mol Wt. 66500 Da) (St.

Louis, MI, USA), Recombinant Exoprotein A of P. aeruginosa (rEPA), S. Typhi OSP,

Sodium cyanoborohydride (NaBH3CN), Sodium phosphate (Na2HPO4) buffer (200 mM,

pH 8.0).

Procedure

Five mg of protein (HSA or rEPA) and 75 mg of Vi negative S. Typhi OSP were

dissolved in 5 mL of sodium phosphate (Na2HPO4) buffer and sonicated for 2 – 5 min to

dissolve well. Twenty five mg of sodium cyanoborohydride (NaBH3CN) was dissolved in

500 µL of sodium phosphate buffer without pipetting. The OSP-protein mixture was

passed from 0.22 µm sterile filter unit (Millipore, Ireland) using 10 mL disposable

syringe inside the laminar air flow (the plunger was avoided to touch the level of

mixture). Mixture was kept at 37 °C for 72 hours.

2.27.1 Separation of HMW conjugates by 6B column

Reagents

Sepharose 6B GE healthcare lot 31050, size exclusion column (Pharmacia

column, Sweden), Phosphate buffer saline (PBS) Gibco, Sodium citrate (C6 H5 Na3 O7)

10mM, Refrectometer 401 (Waters, USA).

Procedure

The container having PBS citrate buffer was placed upside the 6 B column. The

differential Refrectometer Electric unit was switched on (403009289 Millipore) and chart

marker was set on 5 mV polarity positive mode 20 cm /h, glass tubes were placed in rack

to collect the void fractions and reference was adjusted. The Vi negative S. Typhi OSP

conjugate was loaded onto Sepharose 6 B column using 10 mL syringe. The column was

allowed to settle there after connecting the channels to start the flow. The void volume

fractions of high molecular weight (HMW) were collected and pooled. To remove the

impurities, conjugate was loaded on 30,000 MW cut (Millipore) spin columns along with

phosphate buffer saline (PBS) and centrifuged at 5,000 rpm at 10 °C for 20 min; this step


62

was repeated twice. All conjugates were concentrated to 1 mL and protein and

carbohydrate concentration was determined.

2.28 Derivatization of Vi negative S. Typhi OSP with adipic acid dihydrazide

(ADH)

The derivatization of S. Typhi Vi negative OSP was performed according to

Konadu et al with minor modifications (Konadu et al., 1996).

Reagents

Milli-Q water, 1 cyano-4-dimethyl amino pyridinium tetrafloroborate (CDAP)

solution (100 mg/mL) in acetonitrile, Tri-ethylamine 0.2 M solution in water, adipic acid

dihydrazide (ADH) 0.8 M in NaH2CO3, 1 N pyrogen free saline.

Procedure

Ten mg OSP was dissolved in 1 mL saline (pH 5.0 – 6.0) with 1 N NaOH

followed by addition of 50 µL of CDAP solution slowly. pH of the mixture was adjusted

with Tri-ethylamine (TEA) between 7.5 to 8.5. Exactly after two min, 550 µL of ADH

solution was added and pH was maintained between 8.0 – 8.5. The mixture was dialyzed

against water overnight at room temperature. Dialyzed mixture was lyophilized and

designated as derivatized OSP. ADH amount of the derivatized OSP was determined by

TNBS assay.

2.28.1 Trinitrobenzene sulfonic acid (TNBS) assay for determination of hydrazide

group

Reagents

ADH 2 mg/mL in NaH2CO3, 0.1 M NaH2CO3, trinitrobenzene sulfonic acid

(TNBS) 10mM in Milli-Q water.

Procedure

Two mg /mL ADH standard stock solution was diluted in Milli-Q water to make a

0.01 mg /mL solution. Standard curve dilutions of ADH were made in duplicate as 0.2,

0.4, 0.8, 1.0, 1.2, 1.6, 2.0, 3.0, 4.0 μg /mL (0.5 mL each) in Milli-Q water. The 0.5 mL of

saturated sodium borate solution was added to the blank, standard dilutions and samples.

It was followed by addition of 150 μl of TNBS solution to each tube at 30 sec interval

and absorbance was read at 490 nm exactly after 5 min with 30 sec intervals. The


63

standard curve was plotted and sample concentrations were calculated by multiplying

with dilution folds (as the samples have single hydrazine group attached, while the ADH

has two, therefore, all the results generated by standard curve was multiplied by 2).

2.28.2

NMR tube were taken and rinsed with 500 µL dutrium oxide (D2O). Five mg of

each OSP-ADH as sample and OSP as standard were dissolved in D2O, and solutions

were transferred to NMR tubes and labeled properly. Before entering the NMR

laboratory, all metals were removed from body. NMR tubes were leveled at center in

NMR tube window and incorporated in NMR machine individually (Viron). NMR

operation conditions were: frequency 400 mHz, temperature 25 °C, acquired time 2.5 sec,

relax 0.05 sec, pulse 45°, repetitions 8 total, time 36 sec NMR active and nuclei was 1H.

The data were analyzed by computer software.

2.29 Conjugation by cyano dimethyl amino pyridinium-tetrafloroborate (CDAP)

method

The OSP of the Vi negative S. Typhi were derivatized with adipic acid

dihydrazide (ADH) and then this derivatized OSP was conjugated with HSA and rEPA

respectively.

Reagents:

Human serum albumin (HSA; 1 mg /mL solution) (Mol Wt. 66500 Da) (St. Louis,

MI, USA), recombinant Exoprotein A of Pseudomonas aeruginosa (rEPA), derivatized

S.Typhi OSP, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC), 4-

morpholineethanesulfonic acid (MES).

Procedure:

Ten mg of protein (HSA or rEPA) was dissolved in 0.5 mL of MES, and 50 mM

solution of EDC was made in 0.5 mL of Milli-Q water. Protein was placed on stirring in

acetylation vial. The derivatized OSP (OSPADH) was added to the protein solution. pH of

the mixture was maintained at 5.2 for 20 min and placed at 4 °C overnight. Conjugate

mixtures were passed from 30,000 MW cut spin column and centrifuged at 5000 rpm for

20 min in PBS three times to remove impurities. The purified conjugates were passed

from 6 B column for separation of HMW and LMW fractions.

NMR for determination of derivatized OSP with ADH


64

2.30 Determination of protein concentration by Bicinchoninic acid assay (BCA)

Protein concentrations of all conjugates were determined by Bicinchoninic acid

assay as mentioned earlier (Section 2.21.2).

2.31 Dubois assay for carbohydrate concentration estimation

Hundred μl of each sample (or column fractions) was placed in test tubes, (100 μl

water or column effluent was used as control). Two hundred μl of 5% phenol was added

to samples and vortexed (dispensed several volumes of phenol to waste before adding to

analytical sample). Two mL concentrated sulfuric acid was added to each tube and

carefully vortexed (dispensed several volumes of H2SO4 to waste before adding to

analytical sample). Reaction mixtures were cooled for 30 min and OD was taken at 490

nm (higher the reading, higher the amount of carbohydrate). The negative control was set

to zero absorbance.

2.32 MALDI-TOF analysis of conjugates

The prepared conjugate 1 (OSP-HSA) was analyzed with MALDI-TOF mass

spectrometer as per protocol mentions earlier (Section 2.22).

2.33 SDS-PAGE for conjugates

One mg /mL HSA and 1 mg /mL Vi negative S. Typhi OSP were taken as

standards. Samples of LPS and protein conjugates were taken in appropriate

concentration, standards and conjugates were mixed 1:1 with Leammali sample buffer.

The SDS polyacrylamide gel was run as mentioned earlier (Section 2.20).

2.34 Western blotting for conjugates

The protocol for Western blotting was performed as mentioned earlier (Section

2.24)

2.35 Immunogenicity evaluation of vaccine candidates

2.35.1 Description of adjuvant used in vaccine preparation

Sigma adjuvant system (Sigma, USA) was used to prepare conjugate vaccines

candidates. Each vial of the adjuvant was containing 0.5 mg lipid A of Salmonella

minnesota, 0.5 mg of trehalose dicorynomyclate (analog of trehalose dimycolate of


65

tubersle bacillus), 44 µL of squalene oil, 0.2% Tween 80 and sterile distilled water

making total volume to 2.5 mL.

2.35.2

The seal of adjuvant vial was broken and thawed in water bath at 37 °C. One mL

of PBS citrate was added to the vial at room temperature followed by vigorous vortexing

to mix the squalene oil completely. The prepared Vi negative S. Typhi OSP and protein

conjugate were placed in an eppendorf tube and PBS citrate was added in appropriate

amount. Finally, an equal amount of adjuvant was added to the mixture in 1:1 ratio. The

vaccine candidates were carried to animal house in ice box.

2.36 Mice

Female Balb /C mice 6 to 8 weeks old were purchased from Charles River mice,

Canada and acclimatized for one week in IBS-NRC M-54 campus at animal facility. All

protocols of animal experiments were approved by the NRC Animal Care and Use

Committee.

2.36.1

Groups of five mice were intra-peritoneally immunized with four Vi negative S.

Typhi OSP protein-conjugates: Conjugate 1 (OSP-HSA), Conjugate 2 (OSP-rEPA),

Conjugate 3 (OSPADH-HSA) and Conjugate 4 (OSPADH-rEPA). Additionally three mice

were immunized with OSP alone as control. Each mouse received 2 µg of carbohydrate

in 0.2 mL adjuvant per injection. Mice were boosted on days 21 and 42 with

corresponding amount of conjugated vaccine candidates. Sera were recovered on days 0

and 35 from facial jugular vein while terminal sample was taken from heart puncture on

day 56.

2.37 ELISA

Indirect ELISA was done to determine titration curves for mouse blood sera.

Reagents

Coating antigens, controls, primary antibodies, secondary antibodies and

substrate.

Preparation of vaccine candidate

Immunization schedule and Route of immunization


66

Buffers

1% BSA-PBS, PBS + 0.05% TWEEN 20 (PBST) (Please see appendix 12 for

details)

Procedure

A 96 well Nunc MaxiSorp plate was coated with the OSP of Vi negative S. Typhi

(0.5 µg /well) in 0.05 M carbonated buffer, pH 9.8 containing 0.02 Mg Cl2. The plate was

covered with acetate plate cover, incubated at 37 °C for 3 hours and stored at 4 °C

overnight. The plate was blocked with 100 µL of 1% BSA-PBS, covered with plate lid

and incubated for 1 hour at room temperature. The mouse sera (primary antibodies) and

positive control were diluted in 1% BSA-PBS. Serial dilutions of sera were made in 1%

BSA-PBS as 1:10, 1:20, 1:40, 1:80, 1:160, 1:320, 1:640 1:128 and 1:2560. Samples were

added to the plate (50 µL /well) according to map lay out (as ELISA plate No 1 and 2)

and incubated at room temperature for 1 hour. The plate was washed with PBST three

times and tap dried. Fifty µL of the goat anti-mouse IgG (H+L)- alkaline phosphatase (1:

500 in 1% BSA-PBS) was added according to map layout and incubated at room

temperature for one hour. Plates were washed with PBST three times and tap dried.

Hundred µL of pNPP (p-Nitrophenyl phosphate) substrate was added in each well (1

tablet pNPP, 1 mL of DEA and 4 mL dH2O) and allowed to develop color in one hour at

room temperature and observed the OD at 405nm. The results were obtained from plotted

reader and prepared graph using Graph pad prism 4.0.

2.38 Statistics

Geometric means analysis for IgG anti-OSP titer were noted for each group

followed by comparison using one way ANOVA by statistical software GraphPad Instat

version 3.00 (GraphPad software, San Diego California, USA).

2.39 Comparison of all conjugates

Immunogenicity of all conjugates was compared in two ways: firstly on the basis

of protein used and secondly on the basis of chemistry used. HSA protein was used in

preparation of conjugate 1 (OSP-HSA) and conjugate 3 (OSPADH-HSA) whereas rEPA

protein was used in synthesis of conjugate 2 (OSP-rEPA) and conjugate 4 (OSPADH-


67

rEPA). On the other hand reductive amination chemistry was used in conjugates 1 and 2

whereas CDAP chemistry was used in conjugates 3 and 4.

Table 2.2: Table for illustration of indirect ELISA on plates

ELISA Plate

Mice 1 Mice 2 Mice 3 Mice 4 Mice 5 Mice 6 Mice 7 Mice 8 Mice 9 Mice 10

1

2

IgG

3

IgG

4

IgG

5

IgG

6

IgG

7

IgG

8

IgG

9

IgG

10

IgG

11

IgG

12

A Blank 1:20 1:20 1:20 1:20 1:20 1:20 1:20 1:20 1:20 1:20

B Positive control

1:40 1:40 1:40 1:40 1:40 1:40 1:40 1:40 1:40 1:40

C Negative control

1:80 1:80 1:80 1:80 1:80 1:80 1:80 1:80 1:80 1:80

D Blank 1:160 1:160 1:160 1:160 1:160 1:160 1:160 1:160 1:160 1:160

E Blank 1:320 1:320 1:320 1:320 1:320 1:320 1:320 1:320 1:320 1:320

F Blank 1:640 1:640 1:640 1:640 1:640 1:640 1:640 1:640 1:640 1:640

G Blank 1:1280 1:1280 1:1280 1:1280 1:1280 1:1280 1:1280 1:1280 1:1280 1:1280

H Blank 1:2560 1:2560 1:2560 1:2560 1:2560 1:2560 1:2560 1:2560 1:2560 1:2560

Results Chapter3

68

CHAPTER 3

RESULTS

PART A

Purification and antigenic evaluation of lipopolysaccharides and O-specific

polysaccharides of Vi negative S. Typhi

3.1 Biochemical identification of S. Typhi

S. Typhi Vi positive and S. Typhi Vi negative isolates (AS1 and AS7

respectively) were revived in TSB (Section 2.2). Smooth, transparent round (2-3 mm)

and moist colonies were observed on MacConkey agar plates (Section 2.2, Figure 3.1).

On TSI agar slants, the S. Typhi isolates produced yellow pigment in butt (due to acid

production) and showed pink slant surface (due to alkali production). Small amount of

blackening of the medium was observed due to H2S production however no gas

production was recorded (Section 2.2.1, Figure 3.2). These typical biochemical reactions

as well as remel kit observations identified both of the isolates as S. Typhi (Section 2.2.2,

Figure 3.3).

3.2 Duplex PCR for confirmation of Vi negative S. Typhi isolate

Genomic DNAs of S. Typhi Vi positive and S. Typhi Vi negative isolates were

used as template for duplex PCR (Section 2.3.3). Amplified products of both fliC (495

bp) and tviA (599 bp) gene fragments were found in Vi positive S. Typhi isolate (AS1)

while Vi negative S. Typhi (AS7) showed amplification product of fliC (495 bp) gene

fragment only. No PCR amplification was found in case of negative controls (Section

2.3.3, Figure 3.4). This confirmed S. Typhi (AS7) as Vi negative. It was processed further

for polysaccharide extraction and subsequent conjugation with carrier proteins.

3.3 Purification of lipopolysaccharides (LPS) from S. Typhi

Vi negative S. Typhi isolate was grown in TSB using large scale (20 L) fermenter

and yielded 25 grams of wet pellet per liter of culture (Section 2.4). LPS were extracted

and purified from the cell pellet as 500 mg of purified LPS per 100 grams of cell pellet

Results Chapter3

69

(Section 2.4). In crude LPS, nucleic acid contamination was found as 9.38% while the

proteins impurities were detected to be 9.78%. After DNase, RNase and protease

treatment (Section 2.5.1), the nucleic acid and protein contaminations were reduced to

0.06% and 0.07% respectively (Table 3.2). The purified LPS were checked on SDS-

PAGE (Section 2.7) followed by silver nitrate and zinc-imidazole staining which showed

characteristic multiple repetitive bands pattern (Section 2.8, Figure 3.5).

3.4 Purification of O-specific polysaccharides (OSP) of S. Typhi

Core hydrolysis of the purified LPS followed by size exclusion chromatography

and lyophilization resulted in lipid A removal and yielded the purified OSP as 54 mg per

100 mg of purified LPS (Section 2.6, Figure 3.6). The nucleic acid contamination was

0.04% and protein contamination was 0.03% (Table 3.2).

3.5 Analysis of purified LPS and OSP

The alditol acetate assay (Section 2.9) showed that the LPS and OSP samples of

Vi negative S. Typhi contained galactose, mannose, rhamnose and tyvelose sugars,

(Figure 3.7). The immunodiffusion assay (Section 2.10) showed a clear precipitin line

between antigens (LPS /OSP) and antibodies (Figure 3.8) which confirmed that LPS/OSP

were antigenically active and can further be used for conjugation with carrier protein to

make potential immunogenic conjugate vaccines candidates.

PART B

Production and use of recombinant exoprotein A of Pseudomonas aeruginosa as a

carrier protein for conjugation

3.6 Identification of P. aeruginosa isolate

P. aeruginosa isolate showed large, greenish and translucent colonies on nutrient

agar plate (Section 2.1, Figure 3.9). Biochemically, API 20E kit identified it as P.

aeruginosa (Section 2.2.3, Figure 3.10). Multiplex PCR assay of the isolate confirmed it

as P. aeruginosa by the amplification of gyrB (222 bp), ETA (397 bp), oprL (504 bp) and

16S rDNA (618 bp) genes along with internal control products (284 bp) (Figure 3.11).

GenBank provided accession numbers to submitted sequenced genes (Section 2.11.2) as

Results Chapter3

70

GenBank: JN717229, GenBank: JN717230, GenBank: JN717231 and GenBank:

JN717232 respectively (Figure 3.12).

Comparison of the amplified gene sequences with relevant sequences present in

NCBI database using BLAST search showed that the gyrB gene fragment was 99%

identical with PAO1 [GenBank: AE004091.2] and 98% identical with NCGM2

[GenBank: AP012280.1]. The ETA gene was 99% identical with PAO1 [GenBank:

AE004091.2] and 98% identical with NCGM2 [GenBank: AP012280.1]. The oprL gene

sequence was 99% identical with each of PAO1 [GenBank: AE004091.2] and M18

[GenBank: CP002496.1]. The 16S rDNA gene sequence was 97% identical with each of

ZDC-2 [GenBank: JQ249910.1] and CW512 [GenBank: FM207514.1].

3.7 Amplification of rEPA gene (full length)

Full length mutated exoprotein A (rEPA) gene was amplified from

pVC45D/PE553D plasmid using pMSE5-F and pMSE5-R primers (Table 2.1) which

resulted in 1917 bp gene product (Section 2.12.2, Figure 3.13)

3.8 Cloning of rEPA gene in pET-28a-TEV and structure analysis

PCR product of rEPA gene was purified, cloned into pET-28a-TEV vector

(Section 2.13 – 2.16) and resultant construct was designated as pMSE5. Insertion of

rEPA gene into transformed construct was verified by restriction with NdeI and EcoRI

endonucleases which produced 1917 bp gene fragment and 5.2 kb vector product

(Section 2.17, Figures 3.14 – 3.16). Further, integrity of rEPA gene was confirmed by

nucleotide sequencing. (Section 2.17.2, Figure 3.17). For protein expression, the pMSE5

construct was isolated by miniprep from OmniMAXTM 2 T1 strain of E. coli (Section

2.17.1).

3.9 Expression and purification of the rEPA protein

Protein was expressed in BL21 (DE3)-C41 E. coli cells by following induction of

rEPA gene with 1mM IPTG at 37 °C. The protein was express both in supernatant and

inclusion bodies (Section 2.18, Figures 3.18). The expression trials were performed at 37,

28 and 18 °C. Though similar growth was observed at various temperatures, slightly

higher expression was achieved at 28 °C (Section 2.18.1, Figures 3.19 a and Figure 3.19

Results Chapter3

71

b). Using IPTG concentrations ranging from 0.1 – 1 mM at 28 °C (Section 2.18.2,

Figures 3.20). Somewhat higher expression level was obtained at 0.25 mM IPTG.

Further, expression level of the rEPA protein was monitored at various post-induction

time that resulted in excellent yield at ~ 16 hours (Section 2.18.3, Figure 3.21 a and

Figure 3.21 b)

For conjugate vaccine applications, the protein (His6-TEV-rEPA) was purified by

Nickel-trinitriloacetate chromatography by exploiting the presence of N – terminal His6-

tag. Initially protein was purified from soluble fraction of lysate but large amount of the

desired protein (rEPA) was lost in flow through/washing fractions and very less quantity

was left in elution fractions (Section 2.19.1, Figure 3.21). The reason was might be -

unexposed His6-tag of rEPA that did not bind tight enough to Nickel. To address this

problem, protein from inclusion bodies was denatured with 8 M Urea, washed with low

concentration of imidazole and eluted with gradual increase of imidazole concentration

(Section 2.19.2, Figure 3.22). This strategy yields the nicely purified protein in sufficient

quantity required for downstream applications. Furthermore, rEPA was purified from

inclusion bodies with pH gradient (Section 2.19.3, Figure 3.23) which also showed

similar results as purified with imidazole. Concentration of His6-TEV-rEPA was recorded

as 0.5 mg /L using BCA protein assay (Section 2.21.2).

3.10 MALDI analysis of rEPA

Integrity and full length of purified His6-TEV-rEPA was confirmed by mass

spectrometry (Section 2.22, Figure 3.24). MALDI-TOF analysis yielded a prominent

molecular ion peak corresponding to mass (mas/z) 70.841 kDa that is in close agreement

with actual molecular weight 71.41 of His6-TEV-rEPA. Difference of 0.6 kDa between

calculated and actual molecular mass might be due to degradation of few residues of the

protein and/or because of the limitation of MALDI-TOF mass spectrometry technique.

3.11 Removal of His-tag from rEPA protein

Prior to conjugation of rEPA with OSP, His-tag was removed by treating the

purified His6-TEV-rEPA with tobacco etch virus protease (TEV). TEV treated His6-TEV-

rEPA aliquots demonstrated molecular weight shift from 70 kDa to 69 kDa on SDS-

PAGE (Section 3.23, figure 3.25 a). Complete removal of His-tag was verified by

Results Chapter3

72

Western blot analysis that shows only signal for His-tagged rEPA. (Section 3.24, Figure

3.25 b).

3.12 rEPA amino acid sequence and structural model

The 1917 bp DNA sequence of the rEPA gene was translated to amino acid

sequence (Section 2.25, Figure 3.26) which resulted in 636 amino acid sequences

includiong the 17 lysine amino acid residues that are potential sites for O-SP conjugation.

The estimated of the protein is predicted to be more than 10 hours in E. coli. The

instability index (II) is 37.76 which showed that protein was stable. Bioinformatics

analysis was performed using ExPASy website (http://web.expasy.org/protparam/).

Protein model of rEPA was elaborated from X-ray structure of exoprotein A

(PDB ID: 1IKQ). rEPA structure consists of three structural domains I, II and III and

position of lysine residues is indicated (Section 2.25, Figure 3.27) that are possible sites

for conjugation of the protein with OSP.

PART C

Preparation and immunological evaluation of Vi negative S. Typhi OSP-protein

conjugates

3.13 Conjugates prepared by reductive amination

Two conjugates were prepared using sodium cyanoborohydride denoted as OSP-

HSA [Conjugate 1] and OSP-rEPA [Conjugate 2] (Section 2.27). Fractions of size

exclusion chromatography column resulted in a clear separation of high molecular weight

(HMW). Conjugated fractions (tubes 35 to 41) were separated from un-reacted proteins

and OSP column volume (Section 2.27.1). Fractions of both conjugates were pooled

separately and concentrated in MW 30k cut spin columns.

3.14 Conjugates prepared by Cyano dimethyl amino pyridiniom-tetrafloroborate

(CDAP) method

Initially, Vi negative S. Typhi OSP was activated by derivatization using ADH

(Section 2.28). The concentration of OSPADH linkage analyzed with trinitrobenzene

Results Chapter3

73

sulfonic acid (TNBS) assay was 22.1 µg /mL (Section 2.28.1, Table 3.3). The 1H NMR

spectra of OSP showed five signals: for anomeric carbon, the peak was between 4.5 –5

ppm, ring protons signals were located at 3.0 – 4.5 and two signals were at 1.0 – 2.0

which indicated the presence of methyl carbon of O-acetyl substituent. After

derivatization of OSP, new peaks were found between 2 – 3 ppm because of OSPADH

linkage (Section 2.28.2, Figure 3.28).

Two conjugate constructs of activated OSP were produced using 1-cyano-4-

dimethylaminopyridinium tetrafloroborate (CDAP) chemistry by incorporating two

different proteins i-e HSA and rEPA. The prepared conjugates were designated as

OSPADH-HSA [Conjugate 3] (Section 2.29) and OSPADH-rEPA [Conjugate 4] (Section

2.29). Both conjugates were passed through Sepharose 6B column using PBS citrate as

eluent to remove free OSP. Void volume fractions (tubes 51 to 75) were collected and

concentrated in MW30k cut spin column.

3.15 Protein and OSP concentration in prepared conjugates

Protein concentrations of all conjugates were determined by BCA protein assay as

mentioned before (Section 2.30). The results are summarized in Table 3.4. Dubois assay

was used to analyze carbohydrates in conjugates (Section 2.31). The concentrations are

shown in Table 3.5.

3.16 MALDI-TOF analysis of conjugate

MALDI-TOF analysis showed a clear peak in HSA sample which was used as

control, whereas multiple peaks were seen in case of OSP-HSA conjugate [conjugate 1]

sample. Since MALDI-TOF results were not very informative because of very high

molecular weight of conjugates, other three conjugates were not analyzed with this

technique. (Section 3.32, Figure 3.29).

3.17 SDS-PAGE and Western blot of conjugates

Increase in molecular weight was observed in synthesized conjugates based on

coupling of OSP and proteins. Protein load of conjugate was determined on 7.5% SDS-

PAGE in comparison to relevant protein (HSA and rEPA) controls (Section 2.33, Figures

3.30 a, 3.31 a, 3.32 a and 3.33 a) whereas, carbohydrate load was figured out by

Results Chapter3

74

comparing conjugates with OSP alone using carbohydrate specific antibody in Western

blot (Section 2.34, Figures 3.30 b, 3.31 b, 3.32 b and 3.33 b).

3.18 Immunogenicity of OSP conjugates in mice

Subsequent to primary and booster doses; serum IgG antibody titers (on day 56)

against all four prepared conjugates showed different immune responses (Section 2.36.1,

Table 3.1). ELISA titers of all conjugates showed prominent OD as compared to control

group (OSP alone). Out of all conjugates: geometric mean of conjugate 2 was best

(6.149), conjugate 1 (2.202) showed good immune response, while conjugate 3 (1.944)

and conjugate 4 (1.837) demonstrated less response. (Figure 3.34).

3.19 Statistical analysis

Overall analysis of all conjugates along with control using one way ANOVA

showed significant difference for these groups. This was further probed with a post hoc

analysis using Tukey-Kramer test, which showed significant differences (P < 0.05) for

IgG of some of conjugates. Conjugate 1 (P = 0.037) and conjugate 2 (P = 0.0001) were

significant to OSP control group. On contrary, conjugate 3 (P = 0.302) and conjugate 4 (P

= 0.416) although produced better antibody titer but the differences were not significant

relative to control group.

The Immune response of rEPA was better than HSA. ELISA titer was better for

reductive amination method than CDAP method. Therefore the conjugate 2 (OSP-rEPA)

was found most immunogenic among all the prepared conjugates and has the potential to

be evaluated further and then recommended for the clinical trials.

Results Chapter3

75

FIGURES AND TABLES

Figure 3.1: Salmonella Typhi on MacConkey agar plate

Non lactose fermenting small (2-3 mm), smooth, transparent, round, and moist colonies.

Figure 3.2: Biochemical identification of Salmonella Typhi on TSI slants

S. Typhi inoculated TSI agar manifested (A) pink slant containing blackening due to H2S production and yellow pigment on butt because of acid production, while (B) Un-inoculated control did not showed any change on TSI agar.

Results Chapter3

76

Figure 3.3: Remel kit analysis of S. Typhi

The inoculated remel kit with S. Typhi produced particular pigmentations in relevant wells.

Figure 3.4: Duplex PCR for S. Typhi Vi positive and Vi negative strains

S. Typhi genomic DNA of Vi positive and Vi negative isolates were amplified using primers of fliC and Vi genes. 1) Both genes were amplifed from Vi positive isolate where as 2) only fliC gene was amplified from Vi negative isolate 3) negative control did not showed any result. Lane M denotes 100 bp DNA ladder (Fermentas Cat No. SM323).

Results Chapter3

77

Figure 3.5: Silver staining of LPS of S. Typhi

Purified lipopolysaccharides (LPS) of known concentrations in each lane (2) 1 µg (3) 0.7 µg (4) 0.5 µg and (5) 0.25 µg were loaded on SDS- PAGE gel and stained with silver staining method, results were compared with (7 and 8) positive controls having 0.5 and 0.25 µg respectivily. Lane 1 and 6 show proteins of known molecular masses.

Figure 3.6: OSP purification on Sephadex G-25

After core hydrolysis of LPS, lipid A contaminations were removed from O-specific polysaccharide (OSP) by loading it on sephadex G-25 size exclusion chromatography column using phospate buffer saline (PBS) citrate as mobile phase. X-axis shows tube number and Y- axis denotes refrective index.

Ref

rect

ive

Ind

ex

Results Chapter3

78

Figure 3.7: Alditol acetate assay for Sugar determination in S. Typhi OSP

Vi negative S. Typhi LSP mixture was partially methylated with alditol acetates. Total ion chromatogram was examined by GC–MS for separation and quantification of LPS. Resulted sugar contents were 1. Tyvelose, 2. Rhamnose, 3. Mannose, 4. Glucose, 5. Galactose.

Figure 3.8: Double Immunodiffusion assay of S. Typhi LPS samples against particular anti-sera

In order to determine the antigen antibody interaction in-vitro, LPS of S. Typhi and mice serum (polyclonal antibodies) were loaded on immunodiffusion gel. Each well (1 and 3) shows 1 and 0.5 mg /mL LPS in 1N saline respectively, while well 2 shows mice serum.

Results Chapter3

79

Figure 3.9: Pseudomonas aeruginosa on nutrient agar plate

Smooth, transluscent, greenish, round and moist colonies.

Figure 3.10: API 20 E results for Pseudomonas aeruginosa

P. aeruginosa demonstrated arginine dihydrolase (ADH) reaction showing orange color, Citrate utilization (CIT) test showing blue-green pigmentation and test Gelatinase (GEL) reaction with diffusion of black pigment, other wells did not showed any change.

Results Chapter3

80

Figure 3.11: Multiplex PCR for identification of P. aeruginosa

Multiplex PCR of P. aeruginosa shows (1-3) amplicons of 16S rDNA (618 bp), oprL (504), ETA (397 bp), ivnA internal control (284 bp) and gyrB gene fragments (222 bp). Negative control (Proteus mirabilis) of multiplex PCR (4 and 5) manifests amplified product of internal control ivnA gene fragment (284 bp) only while Negative control (6) without template DNA did not amplify any product. Lane M denotes 100 bp DNA ladder (Fermentas Cat No. SM323).

Results Chapter3

81

GenBank: JN717229.1 CCTGACCATCCGTCGCCACAACAAGGTCTGGGAACAGGTCTACCACCACGGCGTTCCGCAGTTCCCACTGCGCGAAGTGGGCGAGACCGATGGCTCCGGCACCGAAGTTCACTTCAAGCCGTCCCCGGAGGCCTTCAGCAACATCCACTTCAGTTGGGACATCCTGGCCAAGCGCATCCGCAAGCTGTCCTTCCTCAACTCCGGCGTCGGCATCCTGCTGCG

Pseudomonas aeruginosa strain MS6 gyrB gene, partial sequence

GenBank: JN717230.1 GACAACGCCCTCAGCATCACCAGCGACGGCCTGACCATCCGCCTCGAAGGCGGCGTCGAGCCGAACAAGCCGGTGCGCTACAGCTACACGCGCCAGGCGCGCGGCAGTTGGTCGCTGAACTGGCTGGTGCCGATCGGCCACGAGAAGCCTTCGAACATCAAGGTGTTCATCCACGAACTGAACGCCGGTAACCAGCTCAGCCACATGTCGCCGATCTACACCATCGAGATGGGCGACGAGTTGCTGGCGAAGCTGGCGCGCGATGCCACCTTCTTCGTCAGGGCGCACGAGAGCAATGAGATGCAGCCGACGCTCGCCATCAGCCATGCCGGGGTCAGCGTGGTCATGGCCCAGGCCCAGCCGCGCCGGGAAAAGCGCTGGAGCGAATGGGCCAGCG

Pseudomonas aeruginosa strain MS6 ETA gene, partial sequence GenBank: JN717231.1 ATGGAAATTGTGAAATTCGGCAAATTTGCTGCGCTGGCTCTGGCCATGGCTGTGGCTGTGGGTTGCTCCTCCAAGGGCGGCGATGCTTCCGGTGAAGGTGCCAATGGCGGCGTCGACCCGAACGCAGGCTATGGCGCCAACAGCGGTGCCGTTGACGGCAGCCTGAGCGACGAAGCCGCTCTGCGTGCGATCACCACCTTCTACTTCGAGTACGACAGCTCCGACCTGAAGCCGGAAGCCATGCGCGCTCTGGACGTACACGCGAAAGACCTGAAAGGCAGCGGTCAGCGCGTAGTGCTGGAAGGCCACACCGACGAACGCGGCACCCGCGAGTACAACATGGCTCTGGGCGAGCGTCGTGCCAAGGCCGTTCAGCGCTACCTGGTGCTGCAGGGCGTTTCGCCGGCCCAGCTGGAACTGGTTTCCTATGGTAAAGAGCGTCCGGTCGCTACCGGCCACGACGAGCAGTCCTGGGCTCAGAACCGTCGCGTCGAGCTGAAGAAG

Pseudomonas aeruginosa strain MS6 oprL gene, partial sequence

GenBank: JN717232.1 CGGGGGTGGATAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACGTCGGGCGCTAATACCGCATACGTCCGGAAACCTGAGGGAGAAAGTGGGGGATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGGGGTAAGGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAGAGTACGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGACCCCCCCGTT

Pseudomonas aeruginosa strain MS6 16S ribosomal DNA gene, partial sequence

Figure 3.12: Sequences of multiplex PCR genes submitted in GenBank

Results Chapter3

82

Figure 3.13: rEPA gene product

PCR amplified product of (1-4) Full length rEPA gene having 1.9 kb size. Lane M denotes 100 bp DNA ladder (Fermentas Cat No. SM323),

Results Chapter3

83

(A)

(B)

Figure 3.14: Strategy for cloning of rEPA in pET-28a-TEV

Figures illustrate both A) Circular and B) linear representations of rEPA gene in vector for over expression of the protein.

Results Chapter3

84

Figure 3.15: E. coli cells transformed with pMSE 5 plasmid

LB agar plate shows transformed E. coli (OmniMax) cells, large white colonies elucidate the uptake of pMSE5 plasmid.

Figure 3.16: Restriction analysis of pMSE 5 recombinant clone

Plasmid was double digested using enzymes NdeI and EcoRI. Each numbered lane (1-4) show the replicates of same clone, the uppermost band shows the unrestricted plasmid harboring vector pET-28a-TEV vector (7.2 kb), middle band denotes restricted clone pMSE 5 (5.2 kb) and lower band shows rEPA gene only (1.9 kb). Lane 1 shows DNA ladder.

Results Chapter3

85

5’-CATATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGGCCGCGAATTTGGCCGAAGAAGCTTTCGACCTCTGGAACGAATGCGCCAAAGCCTGCGTGCTCGACCTCAAGGACGGCGTGCGTTCCAGCCGCATGAGCGTCGACCCGGCCATCGCCGACACCAACGGCCAGGGCGTGCTGCACTACTCCATGGTCCTGGAGGGCGGCAACGACGCGCTCAAGCTGGCCATCGACAACGCCCTCAGCATCACCAGCGACGGCCTGACCATCCGCCTCGAAGGCGGCGTCGAGCCGAACAAGCCGGTGCGCTACAGCTACACGCGCCAGGCGCGCGGCAGTTGGTCGCTGAACTGGCTGGTACCGATCGGCCACGAGAAGCCCTCGAACATCAAGGTGTTCATCCACGAACTGAACGCCGGCAACCAGCTCAGCCACATGTCGCCGATCTACACCATCGAGATGGGCGACGAGTTGCTGGCGAAGCTGGCGCGCGATGCCACCTTCTTCGTCAGGGCGCACGAGAGCAACGAGATGCAGCCGACGCTCGCCATCAGCCATGCCGGGGTCAGCGTGGTCATGGCCCAGACCCAGCCGCGCCGGGAAAAGCGCTGGAGCGAATGGGCCAGCGGCAAGGTGTTGTGCCTGCTCGACCCGCTGGACGGGGTCTACAACTACCTCGCCCAGCAACGCTGCAACCTCGACGATACCTGGGAAGGCAAGATCTACCGGGTGCTCGCCGGCAACCCGGCGAAGCATGACCTGGACATCAAACCCACGGTCATCAGTCATCGCCTGCACTTTCCCGAGGGCGGCAGCCTGGCCGCGCTGACCGCGCACCAGGCTTGCCACCTGCCGCTGGAGACTTTCACCCGTCATCGCCAGCCGCGCGGCTGGGAACAACTGGAGCAGTGCGGCTATCCGGTGCAGCGGCTGGTCGCCCTCTACCTGGCGGCGCGGCTGTCGTGGAACCAGGTCGACCAGGTGATCCGCAACGCCCTGGCCAGCCCCGGCAGCGGCGGCGACCTGGGCGAAGCGATCCGCGAGCAGCCGGAGCAGGCCCGTCTGGCCCTGACCCTGGCCGCCGCCGAGAGCGAGCGCTTCGTCCGGCAGGGCACCGGCAACGACGAGGCCGGCGCGGCCAACGCCGACGTGGTGAGCCTGACCTGCCCAGTCGCCGCCGGTGAATGCGCGGGCCCGGCGGACAGCGGCGACGCCCTGCTGGAGCGCAACTATCCCACTGGCGCGGAGTTCCTCGGCGACGGCGGCGACGTCAGCTTCAGCACCCGCGGCACGCAGAACTGGACGGTGGAGCGGCTGCTCCAGGCGCACCGCCAACTGGAGGAGCGCGGCTATGTGTTCGTCGGCTACCACGGCACCTTCCTCGAAGCGGCGCAAAGCATCGTCTTCGGCGGGGTGCGCGCGCGCAGCCAGGACCTCGACGCGATCTGGCGCGGTTTCTATATCGCCGGCGATCCGGCGCTGGCCTACGGCTACGCCCAGGACCAGGAACCCGACGCACGCGGCCGGATCCGCAACGGTGCCCTGCTGCGGGTCTATGTGCCGCGCTCGAGCCTGCCGGGCTTCTACCGCACCAGCCTGACCCTGGCCGCGCCGGAGGCGGCGGGCGAGGTCGAACGGCTGATCGGCCATCCGCTGCCGCTGCGCCTGGACGCCATCACCGGCCCCGAGGAGGAAGGCGGGCGCGTGACCATTCTCGGCTGGCCGCTGGCCGAGCGCACCGTGGTGATTCCCTCGGCGATCCCCACCGACCCGCGCAACGTCGGCGGCGACCTCGACCCGTCCAGCATCCCCGACAAGGAACAGGCGATCAGCGCCCTGCCGGACTACGCCAGCCAGCCCGGCAAACCGCCGCGCGAGGACCTGAAGTAAGAATTC -3’

Figure 3.17: DNA sequence of rEPA gene

The amplified gene fragment was sequenced. The underline sequence denotes primer regions at 5’ and 3’ ends while six nucleotides at start and end demonstrate restriction sites (NdeI at 5’ and EcoRI 3’) respectively.

Results Chapter3

86

Figure 3.18: Expression of rEPA-His6 in E. coli strain BL21 (DE3)-C41 at 37 °C with 1mM IPTG.

Expression was obtained from culture harboring pMSE5 induced with indicated 1mM concentration of isopropyl-β-D-thiogalactoside (IPTG). Lane 1 denotes supernatant of IPTG induced rEPA, lane 2 shows pellet of IPTG induced rEPA, while lane 2 and 4 shows negative control containing pET-28a-TEV vector only. Lane M denotes protein marker of known molecular mass. SDS-polyacrylamide gel stained with Coomassie brilliant blue.

Results Chapter3

87

(A)

(B)

Figure 3.19: Expression of rEPA-His6 in E. coli strain BL21 (DE3)-C41 and optimization of expression at different temperature

The expression levels were obtained A) with 1 mM concentration of IPTG at 37 °C, 28 °C and 18 °C. Ten µg of each sample was loaded on gel. The inclusion body (I) and soluble (S) fractions of lysate obtained from culture harboring pMSE5, lane M shows protein marker of known molecular mass. SDS-polyacryl amide gel stained with Coomassie brilliant blue. B) Growth curve of BL21 (DE3)-C41/rEPA, monitored at three

different temperatures (37 °C, 28 °C and 18°C) for 4, 8, 12 and 16 hours respectively.

Results Chapter3

88

Figure 3.20: Expression of rEPA-His6 in E. coli strain BL21 (DE3)-C41 and optimization of expression by varying IPTG concentration

Expression was obtained from culture harboring pMSE5 induced with indicated (0 – 1 mM) concentration of isopropyl-β-D-thiogalactoside (IPTG), I insoluble (inclusion body), S soluble fraction of lysate and lane M denotes protein marker of known molecular mass. SDS-polyacryl amide gel stained with Coomassie brilliant blue.

Results Chapter3

89

(A)

(B)

Figure 3.21: Expression of rEPA-His6 in E. coli strain BL21 (C41) and optimization at of expression with extending post-induction time.

The expression level of culture harboring pMSE5 was determined A) with 0.25 mM concentration of IPTG. Each culture was harvested on indicated post induction time (4, 8, 12, 16, 20 and 24 hours) and loaded 15 µg on gel, I insoluble (inclusion body) and S (soluble) fractions, lane M shows protein marker of known molecular mass. SDS-polyacryl amide gel stained with Coomassie brilliant blue. B) Growth curve for BL21 (DE3)-C41 /rEPA, induced at 4 hours and monitored for 20 hours.

Results Chapter3

90

Figure 3.22: Purification of His-tagged rEPA from supernatant

Purification was performed by Ni-NTA chromatography from IPTG induced culture of BL21 (C41) harboring pMSE5. Samples of (1) resuspended cell culture pellet (2) unbound fraction from affinity column, non-specific proteins washed with buffer containing (3-5) fraction-2, 3 and 4 of 10 mM imidazole respectively, (6-8) fraction-2, 3 and 4 of 20 mM imidazole respectively and (9-11) fraction-2, 3 and 4 of 30 mM imidazole respectively. Whereas desired protein eluted with buffer containing (12-17) fraction 2, 3, 4, 5, 6 and 7 with 250 mM imidazole were subjected to SDS- PAGE followed by Coomassie blue staining. The motilities of marker proteins of known molecular mass are shown in lane M.

Results Chapter3

91

Figure 3.23: Purification of His-tagged rEPA from pellet

Purification was performed by Ni-NTA chromatography from IPTG induced culture of BL21 (C41) harboring pMSE5. Samples of (1) resuspended cell culture pellet (2) unbound fraction from affinity column, non-specific proteins washed with buffer containing (3-5) fraction-2, 3 and 4 of 10 mM imidazole respectively, (6-8) fraction-2, 3 and 4 of 20 mM imidazole respectively and (9-11) fraction-2, 3 and 4 of 30 mM imidazole respectively. Whereas desired protein eluted with buffer containing (12-17) fraction 2, 3, 4, 5, 6 and 7 with 250 mM imidazole were subjected to SDS- PAGE followed by Coomassie blue staining. The motilities of marker proteins of known molecular mass are shown in lane M.

Results Chapter3

92

Figure 3.24: Purification of His-tagged rEPA from pellet by pH gradient

Purification was performed by Ni-NTA chromatography from IPTG induced culture of BL21-C41 harboring pMSE5. Samples of (2) unbound fraction from affinity column, non-specific proteins washed with buffer containing (3) pH 6.3, desired protein eluted with buffer containing (4-5) pH 5.9 and (6) 4.5 were subjected to SDS- PAGE followed by Coomassie blue staining. The mobility of marker proteins of known molecular mass are shown in lane 1.

Results Chapter3

93

Figure 3. 25: MALDI-TOF analysis of rEPA

The purified his-tagged rEPA protein (His6-TEV-rEPA) was determined on Matrix assisted laser desorption ionization – time of flight (MALDI-TOF) mass spectrometer using sinapinic acid matrix in linear /positive-ion mode, resulting in 70 kDa molecular mass. Human serum albumin (1mg /mL) was used as standard. Hundred shots per spectrum were taken at a laser power of 2300 (dbi) in a range of 20 kDa to 150 kDa.

Results Chapter3

94

SDS-PAGE Western blot

(A) (B) Figure 3. 26: PAGE and Western blot for rEPA cleavage

The purified his-tagged rEPA protein (His6-TEV-rEPA) was cleaved with tobacco etch virus (TEV) protease, (A) lane 2 shows his-tagged protein, lanes 3 and 4 show protein after his-tag detachment. The result was confirmed with Western blot (B) using antibodies against oligohistidine tag, lane 6 shows his-tagged protein, lane 7 and 8 show protein after his-tag detachment.

Results Chapter3

95

10 20 30 40 50 60 MKKTAIAIAV ALAGFATVAQ AANLAEEAFD LWNECAKACV LDLKDGVRSS RMSVDPAIAD 70 80 90 100 110 120 TNGQGVLHYS MVLEGGNDAL KLAIDNALSI TSDGLTIRLE GGVEPNKPVR YSYTRQARGS 130 140 150 160 170 180 WSLNWLVPIG HEKPSNIKVF IHELNAGNQL SHMSPIYTIE MGDELLAKLA RDATFFVRAH 190 200 210 220 230 240 ESNEMQPTLA ISHAGVSVVM AQTQPRREKR WSEWASGKVL CLLDPLDGVY NYLAQQRCNL 250 260 270 280 290 300 DDTWEGKIYR VLAGNPAKHD LDIKPTVISH RLHFPEGGSL AALTAHQACH LPLETFTRHR 310 320 330 340 350 360 QPRGWEQLEQ CGYPVQRLVA LYLAARLSWN QVDQVIRNAL ASPGSGGDLG EAIREQPEQA 370 380 390 400 410 420 RLALTLAAAE SERFVRQGTG NDEAGAANAD VVSLTCPVAA GECAGPADSG DALLERNYPT 430 440 450 460 470 480 GAEFLGDGGD VSFSTRGTQN WTVERLLQAH RQLEERGYVF VGYHGTFLEA AQSIVFGGVR 490 500 510 520 530 540 ARSQDLDAIW RGFYIAGDPA LAYGYAQDQE PDARGRIRNG ALLRVYVPRS SLPGFYRTSL 550 560 570 580 590 600 TLAAPEAAGE VERLIGHPLP LRLDAITGPE EEGGRVTILG WPLAERTVVI PSAIPTDPRN 610 620 630 VGGDLDPSSI PDKEQAISAL PDYASQPGKP PREDLK

Figure 3. 27: Translation of DNA sequence to protein

The rEPA contains 636 amino acid sequence, molecular weight is 69 kDa. The instability index (II) is 37.76 which seem that protein is stable.

Results Chapter3

96

Figure 3. 28: Structure of rEPA protein

The rEPA protein has three structural domains, Blue color shows domain I, Pink color indicates domain II and Green color denotes domain III while red protrude out sites denote lysine amino acid residues which are important for conjugation with O-SP. [protein model adopted from 1IKQ_A protein data base (PDB)]

Results Chapter3

97

Figure 3.29: Region of 1H-NMR spectrum of ADH linked OSP

Spectrum of the 1NMR was recorded in D2O at 25 °C and referenced to the HOD signal

at 1.5 - 2.5 ppm

Results Chapter3

98

Figure 3.30: MALDI for Conjugate 1 (OSP – HSA)

HSA used as control which shows 66.5 kDa while the OSP – HSA conjugate demonstrates 70401, 79558, 91608, 99543, 107687 and 117008 instead of a single peak. The results may elaborate the attachment of different chain length of OSP with HSA.

Results Chapter3

99

(A) (B)

Figure 3. 31: Coomassie staining and Western blot analysis of OSP – HSA conjugate

Conjugate 1 (OSP – HSA) was prepared using reductive amination a) Coomassie staining of samples. b) Western blot analysis of samples using anti OSP antibody at a dilution of 1:20000. Lanes 1, 2 and 3 denote OSP – HSA conjugate, OSP of S. Typhi and HSA 1mg /mL respectively, while lane M shows protein ladder of known molecular mass.

Results Chapter3

100

(A) (B)

Figure 3.32: Coomassie staining and Western blot analysis of OSP – rEPA conjugate

Conjugate 2 (OSP – rEPA) was prepared using reductive amination. A) Coomassie staining of samples. B) Western blot analysis of samples using anti OSP antibody at a dilution of 1:20000. Lanes 1, 2 and 3 denote OSP – rEPA conjugate, rEPA 1mg /mL and OSP of S. Typhi respectively, while lane M shows protein ladder of known molecular mass.

Results Chapter3

101

(A) (B)

Figure 3.33: Coomassie staining and Western blot analyses of OSPADH-HSA conjugate

Conjugate 3 (OSPADH-HSA) was prepared using Cyano dimethyl amino pyridiniom-tetrafloroborate (CDAP) chemistry. A) Coomassie staining of samples, lanes 2, 3 and 4 denote OSPADH-HSA conjugate, HSA 1mg /mL and OSP of S. Typhi respectively while B) Western blot analysis of samples using anti OSP antibody at a dilution of 1: 20000 contain OSPADH-HSA conjugate, OSP of S. Typhi and HSA 1mg /mL in lanes 2, 3 and 4 respectively, while Lane 1 shows protein ladder of known molecular mass.

Results Chapter3

102

(A) (B)

Figure 3.34: Coomassie staining and Western blot analyses of OSPADH-rEPA conjugate

Conjugate 4 (OSPADH-rEPA) was prepared using Cyano dimethyl amino pyridiniom-tetrafloroborate (CDAP) chemistry. a) Coomassie staining of samples. b) Western blot analysis of samples using anti OSP antibody at a dilution of 1:20000. Lanes 1, 2 and 3 denote rEPA 1 mg /mL, OSPADH-rEPA conjugate and OSP of S. Typhi respectively, while lane M shows protein ladder of known molecular mass.

Results Chapter3

103

Figure 3.34: OSP of S. Typhi conjugated with HSA and rEPA proteins to produce anti OSP IgG antibody titer.

Four groups of BALB/c mice (n = 5 per group) were intra prertonially immunized with

conjugate 1,2,3 and 4 on days 0, 21 and 42 as detailed in Table 3.1. Post-immune mice

sera were assessed on day 56 with ELISA at 405nm for anti-OSP IgG antibodies. Bars

denote geometric mean ELISA of respective groups.

Results Chapter3

104

Conjugate Name Mouse Name

ELISA Reading

IgG

Dilution 1:20

Conjugate 1 (OSP-HSA)

MSTV6 2.038

MSTV7 2.324

MSTV8 2.576

MSTV9 2.152

MSTV10 1.972

Conjugate 2 (OSP-rEPA)

MSAV1 4.608

MSAV2 7.520

MSAV3 5.842

MSAV4 7.204

MSAV5 6.026

Conjugate 3 (OSPADH-HSA)

MTHV 17 1.209

MTHV 18 2.521

MTHV 19 2.988

MTHV 20 1.204

MTHV 21 2.535

Conjugate 4 (OSPADH-rEPA)

MTXV1 1.423

MTXV2 3.488

MTXV3 2.568

MTXV4 1.138

MTXV5 1.443

OSP alone as Control group

MSTC14 1.112

MSTC15 2.124

MSTC16 1.876

Table 3.1: Summary of IgG ELISA readings for all conjugates

Results Chapter3

105

Sample

Nucleic acid

concentration

Protein

Concentration

Pre

Nuclease

treatment

Post

Nuclease

treatment

Pre

Protease

treatment

Post

Protease

treatment

S.Typhi

Vi negative LPS 9.38% 0.06% 9.78% 0.07%

OSP N/A 0.04% N/A 0.03%

Table 3.2: Nucleic acid and protein concentration in Vi negative S. Typhi LPS

Results Chapter3

106

S.

No.

Sample Average

OD at nm

Concentration

(µg/mL)

Dilution

factor

Final

concentration

(µg/mL)

1 OSPADH 0.11 2.21 1/10 22.1

Table 3.3: Trinitrobenzene sulfonic acid (TNBS) assay to determine OSP- ADH linkage

Results Chapter3

107

S. No.

Conjugate Name Tube No

Average OD at 495nm

Conc. (mg/mL)

Dilution factor

Final Conc.(mg/mL)

1 S. Typhi OSP-HSA (Conjugate 1)

35-41 0.171 0.148 1 0.148

2 S. Typhi OSP-rEPA (Conjugate 2)

35-42 0.166 0.06 1 0.06

3 S. Typhi OSPADH-HSA (Conjugate 3)

51-75 0.302 0.3 1/5 1.5

4 S. Typhi OSPADH-rEPA (Conjugate 4)

51-75 0.520 0.5 1/2 1

Table 3.4: Determination of protein concentration in S. Typhi Vi negative OSP using BCA protein assay

Results Chapter3

108

S. No.

Conjugate Name Tube No Average OD at 562nm

Conc. (µg/µL)

Dilution factor

Final conc.(mg/mL)

1 S. Typhi OSP-HSA (Conjugate 1)

35-41 0.71 0.58 1/5 2.91

2 S. Typhi OSP-rEPA (Conjugate 2)

35-42 0.152 0.12 1 0.12

3 S. Typhi OSPADH-HSA (Conjugate 3)

51-75 0.764 0.05 1/5 0.25

4 S. Typhi OSPADH-rEPA (Conjugate 4)

51-75 0.592 0.99 1 0.99

Table 3.5: Determination of OSP concentration in Vi negative S. Typhi OSP conjugates using Dubois assay

Results Chapter3

109

Table 3.6: IgG Immunogenicity of Salmonella OSP alone and conjugates after three injections and statistical parameters

S. No.

Conjugate Name

Geometric mean of Antibody titer

Standard Deviation (SD)

Standard Error of means (SEM)

Lower 95% confident limit

Upper 95% confident limit

P value when compare to OSP alone

1 S. Typhi OSP-HSA

(Conjugate 1) 2.202 0.243 0.108 1.911 2.514 0.037

2 S. Typhi OSP-rEPA

(Conjugate 2) 6.149 1.166 0.521 4.793 7.687 0.0001

3 S. Typhi OSPADH-HSA

(Conjugate 3) 1.944 0.833 0.372 1.063 3.132 0.298

4 S. Typhi OSP ADH-rEPA

(Conjugate 4) 1.837 0.990 0.442 0.782 3.241 0.447

5 S. Typhi OSP

as control group 1.560 0.474 0.212 1.031 2.209 N/A

Discussion Chapter4

110

CHAPTER 4

DISCUSSION

Typhoid fever, caused by Salmonella Typhi is a serious multisystemic disease,

prevalent in the developing world. S. Typhi remained a major human restricted pathogen

for thousands of years. Transmission of the disease usually occurs by faeco-oral route due

to poor sanitation conditions and crowding. Typical manifestation of the disease

comprises fever, malaise, constipation and diffuse abdominal pain. Severe and untreated

case of enteric fever may lead to delirium, obtundation, intestinal hemorrhage, bowel

perforation and death within few weeks of onset. Survivors after infection may be left

with long-term or permanent neuropsychiatric complications. Various complications of

typhoid fever make this disease an immense challenge.

Several Gram negative bacteria express a capsular polysaccharide (Vi) antigen

including S. Typhi, S. Paratyphi C, S. Dublin and Citrobacter freundii. These Vi

producing Salmonella also possess Salmonella Pathogenicity Island-7 (SPI-7), which is a

mobile and unstable region in S. Typhi genome (Nair et al., 2004). Generally it is

believed that Vi capsule is essential for infectivity and virulence of S. Typhi.

The onset of typhoid fever in human is because of Vi antigen (Wetter et al.,

2012). Therefore Vi capsular polysaccharides of S. Typhi have been widely used as

potential vaccine candidates. The prepared vaccines have been evaluated both in animal

and human trials (Micoli et al., 2011; Khan et al., 2012; Micoli et al., 2012b). S. Typhi

strains devoid of Vi capsular polysaccharide antigens have been reported from various

regions of the world since 1960’s (Baker et al., 2005). These strains have been detected

in patients from India, China and Pakistan (Arya, 2000a; Baker et al., 2005; Wain et al.,

2005; Zhang et al., 2008). Recent microbiology and molecular biology reports from

typhoid endemic countries suggest that acapsulate (Vi negative) S. Typhi occurs in nature

and causes typhoid fever which is indistinguishable from disease caused by capsulated

(Vi positive) strains. In a study in Faisalabad, Pakistan 60 fresh isolates from typhoid

patient’s blood were examined and 9 (15%) were found negative for both tviA and tviB

genes (Baker et al., 2005). In India, 10% of freshly isolated strains were also found to be

negative for Vi agglutination (Maurya et al., 2010). Very recently the prevalence of Vi

Discussion Chapter4

111

negative S. Typhi isolates were confirmed in children from Kathmandu, Nepal. Sixty

eight isolates were tested out of which 5.9% of total isolates were found negative for

capsular expression through slide agglutination tests (Pulickal et al., 2013).

Suppression of Vi expression enhances the capability of S. Typhi invasion in the

intestine and facilitate the destruction within Peyer’s patches, while high expression of Vi

leads to decrease in invasion by S. Typhi (Zhao et al., 2001). In recent years molecular

biology techniques successfully provided evidence and suggested that Vi negative strains

can be isolated by the excision of SPI-7, as well as these can be created by a spontaneous

base change in viaB operon (Bueno et al., 2004; Nair et al., 2004; Wain et al., 2005;

Pickard et al., 2013).

Typhoid fever is curable with high dose of several antimicrobials but the

treatment is time consuming and expensive. The use of vaccines can overcome these

problems (Cook et al., 2008). First inactivated whole-cell typhoid vaccine was developed

in 1896, but due to side-effects its usage was eventually discontinued. To date the

available US food and drug administration (FDA) approved licensed typhoid vaccines

include Live Oral Ty21a with commercial names Vivotif (Berna Biotech, Swiss) and

Typherix (GlaxoSmithKline, UK). This vaccine is efficacious in adults and children

greater than 6 years of age. The second licensed vaccine is Vi Polysaccharide with trade

name Typhim Vi manufactured by Sanofi Pasteur, USA. This vaccine is effective in

children of two years of age or older (Fraser et al., 2007). These available licensed

vaccines are efficacious only against Vi antigens and they are not effective against Vi

negative strains.

A solution to this problem is to use polysaccharide antigens which are universally

present in cell membranes of all S. Typhi isolates. In this study we focused on the

isolation of LPS from Vi negative S. Typhi followed by OSP purification and checked the

in-vitro immunogenicity by immunodiffusion assay. There was a need of carrier proteins

for the development of potential conjugate vaccines. We produced and purified

recombinant exoprotein A of P. aeruginosa in our laboratory while employing human

serum albumin as control. We conjugated both OSP and proteins by different chemistries

and evaluated the vaccine candidates in mice.

Discussion Chapter4

112

4.1 O-specific polysaccharides purification and antigenic evaluation

Lipopolysaccharides (LPS) are essential structural component of the outer cell

membrane of Salmonella species. These are considered as major virulence factors in S.

Typhi and have multiple roles in the pathogenesis of bacterial infection; lipid A is a toxic

component while O-antigen chains play an important role in resistance to serum

bactericidal action and phagocytosis. Smooth type LPS are responsible for adhesion and

invasion of S. Typhi processes which are critical for pathogenicity. LPS activates immune

response causing release of cellular cytokine which induces TLR-4 signaling pathway

(Raetz and Whitfield, 2002).

OSP antigen is commonly present in both Vi positive and Vi negative S. Typhi

isolates and these isolates cannot be differentiated by morphological or biochemical tests

(Baker et al., 2005). Pulickal et al. (2013) also recently suggested that phenotypically

similar capsulate (Vi positive) and acapsulate (Vi negative) S. Typhi do not have same

genotype. However, we successfully differentiated these two isolates using a duplex PCR

targeting fliC and Vi genes and found that Vi positive isolate harbor both fliC and Vi

genes whereas Vi negative isolates do not have Vi gene. Wain et al. (2005) also got

similar results using multiplex PCR.

We cultured Vi negative isolate (AS 7) and purified LPS by Westphal method

(which is still commonly used for high yield LPS extraction) with some modifications. It

has been previously reported that potential impurities containing membrane proteins and

nucleic acids may have high affinity to bind with LPS (Hitchcock, 1984). We removed

the impurities from LPS by DNase, RNase and proteinase K treatment; the contaminants

separated from LPS were removed by dialysis.

We determined the purified LPS by SDS-PAGE followed by silver staining,

smooth type LPS showed ladder like band pattern due to variety in chain length of OSP

in Vi negative S. Typhi. As the lipid A segment of LPS is toxic and cannot be used as

vaccine in human, so we detached it through core hydrolysis by breaking the heat labile

bond at KDO (Caroff and Karibian, 2003).

To determine the monosaccharide in OSP, we performed the alditol acetate assay

and found that structure of OSP consists of five sugars; glucose, galactose, rhamnose,

Discussion Chapter4

113

mannose and tyvelose. Similar results were found in an earlier report (Rahman et al.,

1997).

We analyzed immunogenicity of the purified LPS and OSP of Vi negative S.

Typhi isolate by double immunodiffusion assay in-vitro. OSP is a T-independent antigen

and it does not provoke immunological memory because of poor immunogenicity;

consequently it is not effective in infants. Usually boosting dose is needed at regular

intervals for low immunogenic antigens as antibody levels decline; nevertheless,

reinjection of OSP does not elicit a booster antibody titer. It is established that

conjugating of OSP with a potent carrier protein converts T-independent immune

response into T-dependent one. This conjugation method provides a long lasting

protection and better memory response. Repeated immunization of conjugate vaccines

elicits boost antibody response and confers immune protection in children of 2 years of

age or younger (Finn, 2004; Jones, 2005; Taylor et al., 2012). The purified OSP from Vi

negative S. Typhi may be a good candidate for vaccines after conjugation with

appropriate protein.

4.2 rEPA protein purification

Native exotoxin A of P. aeruginosa is toxic and its modification into toxoid form

by conventional detoxification methods may change its structural conformation that

influences its immunological properties. In the recombinant DNA technology, it is

possible to modify the function of a protein by deletion or alteration of specific amino

acid without changing the protein structure. It has been shown that the deletion of a single

amino acid, Glutamate -553 in the toxic domain of exotoxin A eradicates the toxicity of

the protein (Tanomand et al., 2013).

In genetic engineering, the Escherichia coli expression system is frequently used

for production of recombinant proteins because of simple culture conditions, low cost of

culture medium, rapid cell proliferation and high level expression of target gene (Terpe,

2006). Hence, if there is no need of post-translational modification for recombinant

protein, E. coli is the most suitable expression system. Exoprotein A is a prokaryotic

protein which does not need post-translational modification. Therefore, expression

system of E. coli was preferred for the production rEPA protein (Wang et al., 2010).

Discussion Chapter4

114

When a foreign gene is expressed in E. coli, it provides protein either in soluble

(supernatant) form or in inclusion bodies (pellet) (Swartz, 2001). Purification of

recombinant proteins from soluble fraction of bacterial lysate is comparatively easier but

yields less pure protein in most of cases. On contrary to this, purification from inclusion

bodies is relatively straightforward but laborious and cumbersome. It requires repeated

cycles of denaturation for proper protein refolding. If protein refolds successfully,

inclusion bodies provide better yield of purified protein (Wang et al., 2010).

In our study, we retrieved the gene sequence data from database, designed primers

to amplify a DNA segment from pVC 45 D plasmid by PCR and obtained 1.9 kb product

of exoprotein A gene. We cloned the exoprotein A gene in pET-28a-TEV vector between

NdeI and EcoRI restriction positions in multiple cloning site (MCS) region. The

prokaryotic expression vector pET-28a-TEV contains an N-terminal His-tag, TEV site

and T7 promoter. In our case we cloned the desired gene in cassette as follows: T7

promoter, His-tag, TEV sequence and rEPA gene to make an expression construct

pMSE5. Expression of the rEPA protein was optimized by several modification: in first

experiment, induction with 0.25 mM IPTG concentration at 28 °C gave better result

among 0.1 – 1.0 mM IPTG concentrations that were tested. In second phase, expression

studies were performed using 0.25 mM IPTG concentration at three different

temperatures (37, 28 and 18 °C) in which 28 °C showed high yield, while in third step

post-induction time was extended to 20 hours and the highest expression of the rEPA was

accomplished at 16 h.

The rEPA expressed in E. coli both in soluble and insoluble forms. First attempts

were made to purify rEPA from soluble fraction by exploiting the presence of N-terminal

oligohistidine using Nickel affinity chromatography, however, it did not lead to

successful purification despite several repetitions. This might be due the reason that

oligohistidine tag may not be exposed on surface of the protein or accessible to Ni-NTA

agarose beads. On contrary, the protein purified well from inclusion bodies (pellet) under

denaturing condition with negligible impurities as compared to that from soluble fraction

(supernatant) which had excessive amount of non-specific proteins. Elution was done

either with high concentration of imidazole or pH gradient. To solubilize and refold the

denatured protein properly, renaturing buffer was used, whereas dialysis was carried out

Discussion Chapter4

115

for removal of surplus denaturing agent. By creating favorable conditions the protein

refolded spontaneously.

Identity and full length of purified refolded rEPA were verified by Western

blotting and mass spectrometry, respectively. It is generally assumed that consecutives

histidine residues that are somewhat positively charged at physiological pH may exhibit

strong immunogenic properties. Thus, in order to avoid anticipated problem,

oligohistidine tag was removed by incubating the purified rEPA with TEV protease to

produce the native protein that was used for conjugation with OSP of Vi negative S.

Typhi.

4.3 Conjugate Vaccines Candidates

Preparation of conjugate vaccines involves coupling of the polysaccharide

antigens with a potential carrier protein. This conjugation strategy switches the T-cell

independent polysaccharide antigen into a T-cell dependent antigen, with long lasting

protection and better immune response. T-cell helps the immune system to elicit antibody

against polysaccharide-protein conjugate, generate immunological memory and affinity

maturation takes place in children younger than 2 years of age (Goldblatt, 2000).

Haemophilus influenzae type b (Hib) was the first glycoconjugate vaccine

licensed in 1987 for human use and shortly thereafter it was included in infant

immunization schedule in US (Goldblatt, 2000). To date the conjugate vaccines are

available against Haemophilus influenzae type b (Hib) with trade name ActHIB (Sanofi

Pasteur), Neisseria meningitides with trade name Menveo (Novartis Vaccines and

Diagnostics, Inc.) and Streptococcus pneumonia; a 13-valent conjugate with trade name

Prevnar 13 (Wyeth Pharmaceuticals). These vaccines are not just capable to prevent

serious disease, but they also protect from asymptomatic carriage as well as they confer

herd immunity (Frasch, 2009).

Various groups all over the world have been engaged in developing conjugate

vaccines against typhoid based on Vi capsular polysaccharide such as, Vi-rEPA, Vi –

diphtheria toxoid (Vi-DT) and a non-toxic variant of diphtheria toxin (Vi-CRM), but

none of them has been successful to be licensed so far (Martin, 2012). One reason may be

that Salmonella is not a first world disease and the Haemophilus influenzae,

meningicoccal and pneumococcal vaccines are certainly higher on the priority list.

Discussion Chapter4

116

Second reason might be the nonavailability of funds. Vi capsular polysaccharide of S.

Typhi has been conjugated with recombinant exoprotein A (rEPA) of P. aeruginosa. The

efficacy of this Vi-rEPA conjugate vaccine was checked in human trials involving 2 to 5

years old children. This vaccine was safe and immunogenic in more than 90% of children

{Lin, 2001 #1706}. However, this vaccine will not be effective in areas where Vi

negative strains cause typhoid (Baker et al., 2005; Pickard et al., 2013).

Many reports are available on conjugation of OSP with proteins against various

bacterial pathogens to make the neonatal immune responses stronger and long lasting.

OSP was conjugated with tetanus toxoid to produce vaccine against S. Typhi (Saxena and

Di Fabio, 1994), OSP of E. coli O157 was conjugated with bovine serum albumin (BSA),

exotoxin C and rEPA of Clostridium welchii was conjugated with OSP of S. Paratyphi

(Konadu et al., 1996). OSP of S. Typhi was conjugated with diphtheria toxoid and its

immunogenicity was evaluated in mice (Ali et al., 2012), and very recently OSP of S.

Paratyphi was conjugated with CRM197 (Micoli et al., 2012a). However the world is

waiting for promise of a universal typhoid conjugate vaccine with good safety and better

immunogenicity.

To date, there are various methodologies to prepare conjugate vaccines based on

OSP and proteins. Currently the most commonly used techniques include reductive

amination, periodate and CDAP chemistries (Frasch, 2009). We adopted two strategies

for conjugation reaction: in first strategy Vi negative S. Typhi OSP was conjugated with

HSA and rEPA via reductive amination using sodium cyanoborohydride for direct

coupling of OSP and proteins. Reductive amination is a simple, easier and reliable

method to prepare carbohydrates and protein conjugates (Gildersleeve et al., 2008). In

second conjugation strategy, primarily, OSP was derivatized with ADH linker to form

OSPADH molecule followed by conjugation of the derivatized OSP with HSA and rEPA

respectively using 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP).

Carbohydrate-protein conjugates are usually prepared by multi-step reactions

which involve carbohydrate modification such as by addition of a linker and oxidation of

hydroxyl groups thereafter allow coupling with carrier protein. Reductive amination is

one of the most interesting strategies; it involves direct coupling of polysaccharides to:

proteins in just a single step. Polysaccharides have a free reducing end, therefore, they

Discussion Chapter4

117

can be covalently attached to amino group of protein via reductive amination

(Gildersleeve et al., 2008).

CDAP is easier to use, it can activate the OSP at low pH in comparison to

cyanogen bromide (CNBr) (Lees et al., 1996). CDAP is an organic cyanylating reagent

used to activate polysaccharides, which can then react with spacer reagents or directly

with protein (Lees et al., 1996). It was observed that lysine, histidine and cysteine but not

tyrosine, methionine or serine could be conjugated to CDAP-activated OSP (Shafer et al.,

2000). Adipic dihydrazide (ADH) was used as linker between CDAP activated OSP and

proteins. ADH is essentially independent of pH during conjugation reaction. It can react

at pH 5, in contrast to hexanediamine which is highly pH dependent and has maximum

activity at pH 9.3 (Shafer et al., 2000).

We prepared two conjugates by reductive amination using cyanoborohydride. In

reductive amination, usually the lysine of the protein reacts with reducing end of the

sugars. The rEPA contains 40 lysine amino acids so there were chances of 40 OSP

attachments at every molecule whereas HSA has 57 lysine amino acids. The reaction was

performed in aqueous sodium phosphate buffer (pH 8.0) in the presence of 200 mM

NaBH3CN and the reagents were allowed to mix at 25 °C. To avoid the contamination,

mixture was filter sterilized and the reductive amination process was completed in 72 h at

37 °C. After the completion of reaction, we passed the mixture from 6B sepharose

column because there were chances of free proteins and free OSP along with prepared

conjugates. Pure conjugates came out first of the size exclusion column and were

analyzed with MALDI-TOF. The conjugates did not show a clear single peak because of

attachment of either various number of OSP or variety of chain length of OSP molecule.

Before starting the conjugation with CDAP chemistry, it was necessary for OSP to be

derivatized with adipic acid dihydrazide. For derivatization, OSP was activated with

slightly acidic CDAP (pH 5.0 – 6.0). The pH was maintained with TEA at 7.5 – 8.5 but

on addition of ADH it rose to almost 11, therefore, pH was decreased and maintained on

8.0 – 8.5. TNBS assay provided information about the attachment of ADH to OSP and 1H

NMR also showed extra peaks in OSP spectrum between 2 – 2.5 ppm. For conjugation,

first the protein was dissolved in MES and conjugation reaction was performed at acidic

pH. CDAP-activated OSP coupling with protein was rapid and whole reaction was

Discussion Chapter4

118

completed in 20 minutes. We observed polysaccharide activation under basic conditions

while protein activation under acidic conditions. The reaction completion time is

dependent on the degree of OSP and protein activation, concentration and pH of both

reagents (Lees et al., 1996).

All four conjugate constructs were analyzed under denaturing conditions of

sodium dodecyl sulfate (SDS)-PAGE to disaggregate the conjugates. We assumed the

molecular weight of OSP as 5 kDa, while molecular weight of HSA and rEPA were 66.5

kDa and 66 kDa respectively. The resulted conjugates were about 120 kDa. Furthermore,

we confirmed greater proportion of carbohydrate loading using anti LPS monoclonal

antibody in Western Blot pattern of the conjugates, 1 mg /mL of OSP and protein were

run as controls.

Conjugates were injected on day 1 in mice along with adjuvant, boosting doses

were given on day 21 and 42. The IgG titer was determined by indirect ELISA on day 56,

antibody titer of conjugate 2 [OSP-rEPA] was higher than that of conjugate 1 [OSP-

HSA] while the IgG titer response of conjugate 3 [OSPADH-HSA] was higher than that of

conjugate 4 [OSPADH-rEPA]. On the other viewpoint, reductive amination chemistry was

better that CDAP chemistry. In conclusion we can say that conjugate 2 produced

significantly higher (P = 0.0001) antibody titer as compared to that by control group and

has the potential to be recommended for clinical trials.

Discussion Chapter4

119

FUTURE PROSPECTS

1. To investigate the protective immunity produced by Vi-negative S. Typhi based

conjugate vaccine candidates for their efficiency against Vi- positive S. Typhi.

2. To investigate the immune response produced against rEPA after immunization of

OSP-rEPA based conjugate vaccine candidates in mice.

References Chapter5

120

CHAPTER 5

REFERENCES

Achtman, M., Wain, J., Weill, F.X., Nair, S., Zhou, Z., Sangal, V., Krauland, M.G., Hale, J.L.,

Harbottle, H., Uesbeck, A., Dougan, G., Harrison, L.H., Brisse, S., 2012. Multilocus

sequence typing as a replacement for serotyping in Salmonella enterica. PLoS. Pathog. 8,

21.

Adkins, B., Leclerc, C., Marshall-Clarke, S., 2004. Neonatal adaptive immunity comes of age.

Nat. Rev. Immunol. 4, 553-564.

Agbaje, M., Begum, R.H., Oyekunle, M.A., Ojo, O.E., Adenubi, O.T., 2011. Evolution of

Salmonella nomenclature: a critical note. Folia. Microbiol. 56, 497-503.

Ahmadi, H., Tabaraie, B., Maleknia, S., Shapouri, R., Nejati, M., Pour Mirza Gholi, F.,

Hedayati, M., Sadati, M., Zahednia, S., Sharifat Salmani, A., 2013. Immunological

evaluation of Vi capsular polysaccharide of Salmonella enterica subsp. Typhi vaccine by

serum bactericidal assay. J. Med. Microbiol. 62, 283-286.

Alaniz, R.C., Deatherage, B.L., Lara, J.C., Cookson, B.T., 2007. Membrane vesicles are

immunogenic facsimiles of Salmonella typhimurium that potently activate dendritic cells,

prime B and T cell responses, and stimulate protective immunity in vivo. J. Immunol.

179, 7692-7701.

Ali, A., An, S.J., Cui, C., Haque, A., Carbis, R., 2012. Preparation and evaluation of

immunogenic conjugates of Salmonella enterica serovar Typhi O-specific

polysaccharides with diphtheria toxoid. Hum. Vaccin. Immunother. 8, 189-193.

Ali, A., Haque, A., Sarwar, Y., Mohsin, M., Bashir, S., Tariq, A., 2009. Multiplex PCR for

differential diagnosis of emerging typhoidal pathogens directly from blood samples.

Epidemiol. Infect. 137, 102-107.

References Chapter5

121

Allured, V.S., Collier, R.J., Carroll, S.F., McKay, D.B., 1986. Structure of exotoxin A of

Pseudomonas aeruginosa at 3.0-Angstrom resolution. Proc. Natl. Acad. Sci. U S A 83,

1320-1324.

Almeida, C., Cerqueira, L., Azevedo, N.F., Vieira, M.J., 2013. Detection of Salmonella enterica

serovar Enteritidis using real time PCR, immunocapture assay, PNA FISH and standard

culture methods in different types of food samples. Int. J. Food. Microbiol. 161, 16-22.

Arnold, W.S., Harcus, A.W., St Clair Roberts, J., Ward, A.E., 1992. Experience with Vi typhoid

capsular polysaccharide vaccine in the U.K. J. Infect. 25, 63-66.

Arya, S.C., 1997. Efficacy of Salmonella typhi Vi capsular polysaccharide vaccine in South

Africa. Vaccine. 15, 244.

Arya, S.C., 2000. Salmonella typhi Vi antigen-negative isolates in India and prophylactic typhoid

immunization. Natl. Med. J. India. 13, 220.

Arya, S.C., Agarwal, N., 2009. A cluster-randomized effectiveness trial of Vi typhoid vaccine in

India. N. Engl. J. Med. 361, 2191-2193.

Avci, F.Y., Li, X., Tsuji, M., Kasper, D.L., 2011. A mechanism for glycoconjugate vaccine

activation of the adaptive immune system and its implications for vaccine design. Nat.

Med. 17, 1602-1609.

Baggesen, D.L., Sorensen, G., Nielsen, E.M., Wegener, H.C., 2010. Phage typing of Salmonella

Typhimurium - is it still a useful tool for surveillance and outbreak investigation? Euro.

Surveill. 15, 19471.

Baker, S., Dougan, G., 2007. The genome of Salmonella enterica serovar Typhi. Clin. Infect.

Dis. 15, 29-33.

Baker, S., Favorov, M., Dougan, G., 2010. Searching for the elusive typhoid diagnostic. BMC

Infect. Dis. 10, 45.

References Chapter5

122

Baker, S., Hardy, J., Sanderson, K.E., Quail, M., Goodhead, I., Kingsley, R.A., Parkhill, J.,

Stocker, B., Dougan, G., 2007. A novel linear plasmid mediates flagellar variation in

Salmonella Typhi. PLoS Pathog 3.

Baker, S., Sarwar, Y., Aziz, H., Haque, A., Ali, A., Dougan, G., Wain, J., 2005. Detection of Vi-

negative Salmonella enterica serovar Typhi in the peripheral blood of patients with

typhoid fever in the Faisalabad region of Pakistan. J. Clin. Microbiol. 43, 4418-4425.

Banemann, A., Deppisch, H., Gross, R., 1998. The lipopolysaccharide of Bordetella

bronchiseptica acts as a protective shield against antimicrobial peptides. Infect. Immun.

66, 5607-5612.

Begier, E.M., Burwen, D.R., Haber, P., Ball, R., 2004. Postmarketing safety surveillance for

typhoid fever vaccines from the Vaccine Adverse Event Reporting System, July 1990

through June 2002. Clin. Infect. Dis. 38, 771-779.

Bhutta, Z.A., 1996. Impact of age and drug resistance on mortality in typhoid fever. Arch. Dis.

Child. 75, 214-217.

Black, S., Shinefield, H., Fireman, B., Lewis, E., Ray, P., Hansen, J.R., Elvin, L., Ensor, K.M.,

Hackell, J., Siber, G., Malinoski, F., Madore, D., Chang, I., Kohberger, R., Watson, W.,

Austrian, R., Edwards, K., 2000. Efficacy, safety and immunogenicity of heptavalent

pneumococcal conjugate vaccine in children. Northern California Kaiser Permanente

Vaccine Study Center Group. Pediatr. Infect. Dis. J. 19, 187-195.

Blondel, C.J., Jimenez, J.C., Contreras, I., Santiviago, C.A., 2009. Comparative genomic

analysis uncovers 3 novel loci encoding type six secretion systems differentially

distributed in Salmonella serotypes. BMC. Genomics. 10, 1471-2164.

Borrow, R., Goldblatt, D., Andrews, N., Richmond, P., Southern, J., Miller, E., 2001a. Influence

of prior meningococcal C polysaccharide vaccination on the response and generation of

References Chapter5

123

memory after meningococcal C conjugate vaccination in young children. J. Infect. Dis.

184, 377-380.

Borrow, R., Southern, J., Andrews, N., Peake, N., Rahim, R., Acuna, M., Martin, S., Miller, E.,

Kaczmarski, E., 2001b. Comparison of antibody kinetics following meningococcal

serogroup C conjugate vaccine between healthy adults previously vaccinated with

meningococcal A/C polysaccharide vaccine and vaccine-naive controls. Vaccine 19,

3043-3050.

Brenner, F.W., Villar, R.G., Angulo, F.J., Tauxe, R., Swaminathan, B., 2000. Salmonella

nomenclature. J. Clin. Microbiol. 38, 2465-2467.

Brooks, W.A., Hossain, A., Goswami, D., Nahar, K., Alam, K., Ahmed, N., Naheed, A., Nair,

G.B., Luby, S., Breiman, R.F., 2005. Bacteremic typhoid fever in children in an urban

slum, Bangladesh. Emerg. Infect. Dis. 11, 326-329.

Brussow, H., Canchaya, C., Hardt, W.D., 2004. Phages and the evolution of bacterial pathogens:

from genomic rearrangements to lysogenic conversion. Microbiol. Mol. Biol. Rev. 68,

560-602.

Bueno, S.M., Santiviago, C.A., Murillo, A.A., Fuentes, J.A., Trombert, A.N., Rodas, P.I.,

Youderian, P., Mora, G.C., 2004. Precise excision of the large pathogenicity island, SPI7,

in Salmonella enterica serovar Typhi. J. Bacteriol. 186, 3202-3213.

Caesar, N.M., Myers, K.A., Fan, X., 2013. Neisseria meningitidis serogroup B vaccine

development. Microb. Pathog. 57, 33-40.

Canh, D.G., Lin, F.Y., Thiem, V.D., Trach, D.D., Trong, N.D., Mao, N.D., Hunt, S., Schneerson,

R., Robbins, J.B., Chu, C., Shiloach, J., Bryla, D.A., Bonnet, M.C., Schulz, D., Szu, S.C.,

2004. Effect of dosage on immunogenicity of a Vi conjugate vaccine injected twice into

2- to 5-year-old Vietnamese children. Infect. Immun. 72, 6586-6588.

Carles, G., Montoya, Y., Seve, B., Rakotofananina, T., Largeaud, M., Mignot, V., 2002.

[Typhoid fever and pregnancy]. J Gynecol Obstet Biol. Reprod. 31, 495-499.

References Chapter5

124

Caroff, M., Deprun, C., Karibian, D., 1993. 252Cf plasma desorption mass spectrometry applied

to the analysis of underivatized rough-type endotoxin preparations. J. Biol. Chem. 268,

12321-12324.

Caroff, M., Karibian, D., 2003. Structure of bacterial lipopolysaccharides. Carbohydr. Res. 338,

2431-2447.

Castro, D., Morinigo, M.A., Martinez-Manzanares, E., Cornax, R., Balebona, M.C., Luque, A.,

Borrego, J.J., 1992. Development and application of a new scheme of phages for typing

and differentiating Salmonella strains from different sources. J. Clin. Microbiol. 30,

1418-1423.

Caugant, D.A., 2008. Genetics and evolution of Neisseria meningitidis: importance for the

epidemiology of meningococcal disease. Infect. Genet. Evol. 8, 558-565.

CDC, 2013. Progress in introduction of pneumococcal conjugate vaccine - worldwide, 2000-

2012. MMWR Morb. Mortal. Wkly. Rep. 62, 308-311.

Chaicumpa, W., Ruangkunaporn, Y., Burr, D., Chongsa-Nguan, M., Echeverria, P., 1992.

Diagnosis of typhoid fever by detection of Salmonella typhi antigen in urine. J. Clin.

Microbiol. 30, 2513-2515.

Chaudhry, R., Laxmi, B.V., Nisar, N., Ray, K., Kumar, D., 1997. Standardisation of polymerase

chain reaction for the detection of Salmonella typhi in typhoid fever. J. Clin. Pathol. 50,

437-439.

Chinh, N.T., Parry, C.M., Ly, N.T., Ha, H.D., Thong, M.X., Diep, T.S., Wain, J., White, N.J.,

Farrar, J.J., 2000. A randomized controlled comparison of azithromycin and ofloxacin for

treatment of multidrug-resistant or nalidixic acid-resistant enteric fever. Antimicrob.

Agents. Chemother. 44, 1855-1859.

Cook, J., Jeuland, M., Whittington, D., Poulos, C., Clemens, J., Sur, D., Anh, D.D., Agtini, M.,

Bhutta, Z., 2008. The cost-effectiveness of typhoid Vi vaccination programs: calculations

for four urban sites in four Asian countries. Vaccine. 26, 6305-6316.

References Chapter5

125

Cook, J., Sur, D., Clemens, J., Whittington, D., 2009. Evaluating investments in typhoid vaccines

in two slums in Kolkata, India. J. Health. Popul. Nutr. 27, 711-724.

Croxtall, J.D., Keating, G.M., 2009. Pneumococcal polysaccharide protein D-conjugate vaccine

(Synflorix; PHiD-CV). Paediatr. Drugs. 11, 349-357.

Crump, J.A., Luby, S.P., Mintz, E.D., 2004. The global burden of typhoid fever. Bull. World.

Health. Organ. 82, 346-353.

Crump, J.A., Mintz, E.D., 2010. Global trends in typhoid and paratyphoid Fever. Clin. Infect.

Dis. 50, 241-246.

Cui, C., Carbis, R., An, S.J., Jang, H., Czerkinsky, C., Szu, S.C., Clemens, J.D., 2010. Physical

and chemical characterization and immunologic properties of Salmonella enterica

serovar typhi capsular polysaccharide-diphtheria toxoid conjugates. Clin. Vaccine.

Immunol. 17, 73-79.

Davis, M.R., Jr., Goldberg, J.B., 2012. Purification and visualization of lipopolysaccharide from

Gram-negative bacteria by hot aqueous-phenol extraction. J. Vis. Exp. 28.

de Jong, H.K., Parry, C.M., van der Poll, T., Wiersinga, W.J., 2012. Host-pathogen interaction in

invasive Salmonellosis. PLoS Pathog 8, 4.

De Vos, D., Lim, A., Jr., Pirnay, J.P., Struelens, M., Vandenvelde, C., Duinslaeger, L.,

Vanderkelen, A., Cornelis, P., 1997. Direct detection and identification of Pseudomonas

aeruginosa in clinical samples such as skin biopsy specimens and expectorations by

multiplex PCR based on two outer membrane lipoprotein genes, oprI and oprL. J. Clin.

Microbiol. 35, 1295-1299.

Delahooke, D.M., Barclay, G.R., Poxton, I.R., 1995. A re-appraisal of the biological activity of

bacteroides LPS. J. Med. Microbiol. 42, 102-112.

References Chapter5

126

Deng, W., Liou, S.R., Plunkett, G., 3rd, Mayhew, G.F., Rose, D.J., Burland, V., Kodoyianni, V.,

Schwartz, D.C., Blattner, F.R., 2003. Comparative genomics of Salmonella enterica

serovar Typhi strains Ty2 and CT18. J. Bacteriol. 185, 2330-2337.

DeRoeck, D., Jodar, L., Clemens, J., 2007. Putting typhoid vaccination on the global health

agenda. N. Engl. J. Med. 357, 1069-1071.

Dietrich, G., Griot-Wenk, M., Metcalfe, I.C., Lang, A.B., Viret, J.F., 2003. Experience with

registered mucosal vaccines. Vaccine. 21, 678-683.

Dong, B.Q., Yang, J., Wang, X.Y., Gong, J., von Seidlein, L., Wang, M.L., Lin, M., Liao, H.Z.,

Ochiai, R.L., Xu, Z.Y., Jodar, L., Clemens, J.D., 2010. Trends and disease burden of

enteric fever in Guangxi province, China, 1994-2004. Bull. World. Health. Organ. 88,

689-696.

Driscoll, J.A., Brody, S.L., Kollef, M.H., 2007. The epidemiology, pathogenesis and treatment of

Pseudomonas aeruginosa infections. Drugs. 67, 351-368.

Dutta, S., Sur, D., Manna, B., Sen, B., Deb, A.K., Deen, J.L., Wain, J., Von Seidlein, L., Ochiai,

L., Clemens, J.D., Kumar Bhattacharya, S., 2006. Evaluation of new-generation serologic

tests for the diagnosis of typhoid fever: data from a community-based surveillance in

Calcutta, India. Diagn. Microbiol. Infect. Dis. 56, 359-365.

Ehrbar, K., Hardt, W.D., 2005. Bacteriophage-encoded type III effectors in Salmonella enterica

subspecies 1 serovar Typhimurium. Infect. Genet. Evol. 5, 1-9.

Finn, A., 2004. Bacterial polysaccharide-protein conjugate vaccines. Br. Med. Bull. 70, 1-14.

Frasch, C.E., 2009. Preparation of bacterial polysaccharide-protein conjugates: analytical and

manufacturing challenges. Vaccine. 27, 6468-6470.

Fraser, A., Goldberg, E., Acosta, C.J., Paul, M., Leibovici, L., 2007. Vaccines for preventing

typhoid fever. Cochrane. Database. Syst. Rev. 18.

References Chapter5

127

French, G.L., King, S.D., Louis, P.S., 1977. Salmonella serotypes, Salmonella typhi phage types,

and anti-microbial resistance at the University Hospital of the West Indies, Jamaica. J.

Hyg. 79, 5-16.

Froeschle, J.E., Decker, M.D., 2010. Duration of Vi antibodies in participants vaccinated with

Typhim Vi (Typhoid Vi polysaccharide vaccine) in an area not endemic for typhoid

fever. Vaccine 28, 1451-1453.

Fuentes, J.A., Villagra, N., Castillo-Ruiz, M., Mora, G.C., 2008. The Salmonella Typhi hlyE

gene plays a role in invasion of cultured epithelial cells and its functional transfer to S.

Typhimurium promotes deep organ infection in mice. Res. Microbiol. 159, 279-287.

Gajdus, J., Kaczynski, Z., Smietana, J., Stepnowski, P., 2009. Structural determination of the O-

antigenic polysaccharide from Salmonella Mara (O:39). Carbohydr. Res. 344, 1054-1057.

Galan, J.E., 1999. Interaction of Salmonella with host cells through the centisome 63 type III

secretion system. Curr. Opin. Microbiol. 2, 46-50.

Germanier, R., Fiirer, E., 1975. Isolation and characterization of Gal E mutant Ty 21a of

Salmonella typhi: a candidate strain for a live, oral typhoid vaccine. J. infect dis. 131,

553-558.

Gildersleeve, J.C., Oyelaran, O., Simpson, J.T., Allred, B., 2008. Improved procedure for direct

coupling of carbohydrates to proteins via reductive amination. Bioconjug. Chem. 19,

1485-1490.

Goldblatt, D., 2000. Conjugate vaccines. Clin. Exp. Immunol. 119,1-3.

Grijalva, C.G., Nuorti, J.P., Arbogast, P.G., Martin, S.W., Edwards, K.M., Griffin, M.R., 2007.

Decline in pneumonia admissions after routine childhood immunisation with

pneumococcal conjugate vaccine in the USA: a time-series analysis. Lancet. 369, 1179-

1186.

References Chapter5

128

Hale, C., Bowe, F., Pickard, D., Clare, S., Haeuw, J.F., Powers, U., Menager, N., Mastroeni, P.,

Dougan, G., 2006. Evaluation of a novel Vi conjugate vaccine in a murine model of

salmonellosis. Vaccine. 24, 4312-4320.

Haque, A., Ahmed, J., Qureshi, J.A., 1999. Early detection of typhoid by polymerase chain

reaction. Ann. Saudi. Med. 19, 337-340.

Haque, A., Ahmed, N., Peerzada, A., Raza, A., Bashir, S., Abbas, G., 2001. Utility of PCR in

diagnosis of problematic cases of typhoid. Jpn. J. Infect. Dis. 54, 237-239.

Heinrichs, D.E., Yethon, J.A., Whitfield, C., 1998. Molecular basis for structural diversity in the

core regions of the lipopolysaccharides of Escherichia coli and Salmonella enterica. Mol

Microbiol. 30, 221-232.

Hendriksen, R.S., Mikoleit, M., Carlson, V.P., Karlsmose, S., Vieira, A.R., Jensen, A.B.,

Seyfarth, A.M., DeLong, S.M., Weill, F.X., Lo Fo Wong, D.M., Angulo, F.J., Wegener,

H.C., Aarestrup, F.M., 2009. WHO Global Salm-Surv external quality assurance system

for serotyping of Salmonella isolates from 2000 to 2007. J. Clin. Microbiol. 47, 2729-

2736.

Hensel, M., Shea, J.E., Waterman, S.R., Mundy, R., Nikolaus, T., Banks, G., Vazquez-Torres,

A., Gleeson, C., Fang, F.C., Holden, D.W., 1998. Genes encoding putative effector

proteins of the type III secretion system of Salmonella pathogenicity island 2 are required

for bacterial virulence and proliferation in macrophages. Mol. Microbiol. 30, 163-174.

Hessel, L., Debois, H., Fletcher, M., Dumas, R., 1999. Experience with Salmonella typhi Vi

capsular polysaccharide vaccine. Eur. J. Clin. Microbiol. Infect. Dis. 18, 609-620.

Hitchcock, P.J., 1984. Analyses of gonococcal lipopolysaccharide in whole-cell lysates by

sodium dodecyl sulfate-polyacrylamide gel electrophoresis: stable association of

lipopolysaccharide with the major outer membrane protein (protein I) of Neisseria

gonorrhoeae. Infect. Immun. 46, 202-212.

References Chapter5

129

Holt, K.E., Phan, M.D., Baker, S., Duy, P.T., Nga, T.V., Nair, S., Turner, A.K., Walsh, C.,

Fanning, S., Farrell-Ward, S., Dutta, S., Kariuki, S., Weill, F.X., Parkhill, J., Dougan, G.,

Wain, J., 2011. Emergence of a globally dominant IncHI1 plasmid type associated with

multiple drug resistant typhoid. PLoS Negl. Trop. Dis. 5, 19.

Hsieh, C.L., 2000. Characterization of saccharide-CRM197 conjugate vaccines. Dev Biol 103,

93-104.

Ibarra, J.A., Steele-Mortimer, O., 2009. Salmonella--the ultimate insider. Salmonella virulence

factors that modulate intracellular survival. Cell. Microbiol. 11, 1579-1586.

Jegathesan, M., 1983. Phage types of Salmonella typhi isolated in Malaysia over the 10- year

period 1970–1979. J. Hyg. 90, 91-97.

John, T.J., Dandona, L., Sharma, V.P., Kakkar, M., 2011. Continuing challenge of infectious

diseases in India. Lancet. 377, 252-269.

Jones, C., 2005. Vaccines based on the cell surface carbohydrates of pathogenic bacteria. An.

Acad. Bras. Cienc. 77, 293-324.

Kaur, J., Jain, S.K., 2012. Role of antigens and virulence factors of Salmonella enterica serovar

Typhi in its pathogenesis. Microbiol. Res. 167, 199-210.

Khan, A.A., Cerniglia, C.E., 1994. Detection of Pseudomonas aeruginosa from clinical and

environmental samples by amplification of the exotoxin A gene using PCR. Appl.

Environ. Microbiol. 60, 3739-3745.

Khan, M.I., Soofi, S.B., Ochiai, R.L., Habib, M.A., Sahito, S.M., Nizami, S.Q., Acosta, C.J.,

Clemens, J.D., Bhutta, Z.A., 2012. Effectiveness of Vi capsular polysaccharide typhoid

vaccine among children: a cluster randomized trial in Karachi, Pakistan. Vaccine 30,

5389-5395.

References Chapter5

130

Kidgell, C., Reichard, U., Wain, J., Linz, B., Torpdahl, M., Dougan, G., Achtman, M., 2002.

Salmonella typhi, the causative agent of typhoid fever, is approximately 50,000 years old.

Infect. Genet. Evol. 2, 39-45.

Kim, S., Kim, S.H., Park, J.H., Lee, K.S., Park, M.S., Lee, B.K., 2009. Clustering analysis of

Salmonella enterica serovar Typhi isolates in Korea by PFGE, ribotying, and phage

typing. Foodborne. Pathog. Dis. 6, 733-738.

Kisiela, D.I., Chattopadhyay, S., Libby, S.J., Karlinsey, J.E., Fang, F.C., Tchesnokova, V.,

Kramer, J.J., Beskhlebnaya, V., Samadpour, M., Grzymajlo, K., Ugorski, M., Lankau,

E.W., Mackie, R.I., Clegg, S., Sokurenko, E.V., 2012. Evolution of Salmonella enterica

virulence via point mutations in the fimbrial adhesin. PLoS Pathog 8, 7.

Klein Klouwenberg, P., Bont, L., 2008. Neonatal and infantile immune responses to

encapsulated bacteria and conjugate vaccines. Clin. Dev. Immunol.. 628963.

Kolyva, S., Waxin, H., Popoff, M.Y., 1992. The Vi antigen of Salmonella typhi: molecular

analysis of the viaB locus. J. Gen. Microbiol. 138, 297-304.

Konadu, E., Robbins, J.B., Shiloach, J., Bryla, D.A., Szu, S.C., 1994. Preparation,

characterization, and immunological properties in mice of Escherichia coli O157 O-

specific polysaccharide-protein conjugate vaccines. Infect. Immun. 62, 5048-5054.

Konadu, E., Shiloach, J., Bryla, D.A., Robbins, J.B., Szu, S.C., 1996. Synthesis, characterization,

and immunological properties in mice of conjugates composed of detoxified

lipopolysaccharide of Salmonella paratyphi A bound to tetanus toxoid with emphasis on

the role of O acetyls. Infect Immun 64, 2709-2715.

Kragh-Hansen, U., Minchiotti, L., Galliano, M., Peters, T., Jr., 2013. Human serum albumin

isoforms: Genetic and molecular aspects and functional consequences. Biochim Biophys

Acta 2, 00120-00127.

Lahiri, A., Iyer, N., Das, P., Chakravortty, D., 2010. Visiting the cell biology of Salmonella

infection. Microbes. Infect. 12, 809-818.

References Chapter5

131

Lees, A., Nelson, B.L., Mond, J.J., 1996. Activation of soluble polysaccharides with 1-cyano-4-

dimethylaminopyridinium tetrafluoroborate for use in protein-polysaccharide conjugate

vaccines and immunological reagents. Vaccine 14, 190-198.

Lesinski, G.B., Westerink, M.A., 2001. Vaccines against polysaccharide antigens. Curr. Drug.

Targets. Infect. Disord. 1, 325-334.

Levine, M.M., 2003. Can needle-free administration of vaccines become the norm in global

immunization? Nat. Med. 9, 99-103.

Levine, M.M., 2006. Enteric infections and the vaccines to counter them: future directions.

Vaccine 24, 3865-3873.

Levine, M.M., Black, R.E., Ferreccio, C., Germanier, R., 1987. Large-scale field trial of Ty21a

live oral typhoid vaccine in enteric-coated capsule formulation. The Lancet 329, 1049-

1052.

Levine, M.M., Ferreccio, C., Black, R.E., Tacket, C.O., Germanier, R., 1989a. Progress in

vaccines against typhoid fever. Rev. Infect. Dis. 11, 552-567.

Levine, M.M., Ferreccio, C., Black, R.E., Tacket, C.O., Germanier, R., 1989b. Progress in

vaccines against typhoid fever. Rev. Infect. Dis. 11, S552-S567.

Levine, M.M., Ferreccio, C., Cryz, S., Ortiz, E., 1990. Comparison of enteric-coated capsules

and liquid formulation of Ty21a typhoid vaccine in randomised controlled field trial.

Lancet. 336, 891-894.

Levy, O., Sisson, R.B., Kenyon, J., Eichenwald, E., Macone, A.B., Goldmann, D., 2000.

Enhancement of neonatal innate defense: effects of adding an N-terminal recombinant

fragment of bactericidal/permeability-increasing protein on growth and tumor necrosis

factor-inducing activity of gram-negative bacteria tested in neonatal cord blood ex vivo.

Infect. Immun. 68, 5120-5125.

References Chapter5

132

Lim, B.K., Thong, K.L., 2009. Application of PCR-based serogrouping of selected Salmonella

serotypes in Malaysia. J. Infect. Dev. Ctries. 3, 420-428.

Lin, F.Y., Ho, V.A., Khiem, H.B., Trach, D.D., Bay, P.V., Thanh, T.C., Kossaczka, Z., Bryla,

D.A., Shiloach, J., Robbins, J.B., Schneerson, R., Szu, S.C., 2001. The efficacy of a

Salmonella typhi Vi conjugate vaccine in two-to-five-year-old children. N. Engl. J. Med.

344, 1263-1269.

Lindstedt, B.A., Heir, E., Vardund, T., Kapperud, G., 2000. Fluorescent amplified-fragment

length polymorphism genotyping of Salmonella enterica subsp. enterica serovars and

comparison with pulsed-field gel electrophoresis typing. J. Clin. Microbiol. 38, 1623-

1627.

Lukac, M., Pier, G.B., Collier, R.J., 1988. Toxoid of Pseudomonas aeruginosa exotoxin A

generated by deletion of an active-site residue. Infect. Immun. 56, 3095-3098.

Marshall, J.L., Flores-Langarica, A., Kingsley, R.A., Hitchcock, J.R., Ross, E.A., Lopez-Macias,

C., Lakey, J., Martin, L.B., Toellner, K.M., MacLennan, C.A., MacLennan, I.C.,

Henderson, I.R., Dougan, G., Cunningham, A.F., 2012. The capsular polysaccharide Vi

from Salmonella typhi is a B1b antigen. J. Immunol. 189, 5527-5532.

Martin, L.B., 2012. Vaccines for typhoid fever and other salmonelloses. Curr. Opin. Infect. Dis.

25, 489-499.

Maurya, P., Gulati, A.K., Nath, G., 2010. Status of Vi gene, its expression and Salmonella

Pathogenicity Island (SPI-7) in Salmonella Typhi in India. Southeast Asian J Trop Med

Pub. Health. 41, 913-919.

Micoli, F., Rondini, S., Gavini, M., Lanzilao, L., Medaglini, D., Saul, A., Martin, L.B., 2012a.

O:2-CRM(197) Conjugates against Salmonella Paratyphi A. PLoS. One. 7, 7.

Micoli, F., Rondini, S., Pisoni, I., Giannelli, C., Di Cioccio, V., Costantino, P., Saul, A., Martin,

L.B., 2012b. Production of a conjugate vaccine for Salmonella enterica serovar Typhi

from Citrobacter Vi. Vaccine. 30, 853-861.

References Chapter5

133

Micoli, F., Rondini, S., Pisoni, I., Proietti, D., Berti, F., Costantino, P., Rappuoli, R., Szu, S.,

Saul, A., Martin, L.B., 2011. Vi-CRM 197 as a new conjugate vaccine against

Salmonella Typhi. Vaccine. 29, 712-720.

Miyake, M., Zhao, L., Ezaki, T., Hirose, K., Khan, A.Q., Kawamura, Y., Shima, R., Kamijo, M.,

Masuzawa, T., Yanagihara, Y., 1998. Vi-deficient and nonfimbriated mutants of

Salmonella typhi agglutinate human blood type antigens and are hyperinvasive. FEMS

Microbiol. Lett. 161, 75-82.

Mosier, D.E., Mond, J.J., Goldings, E.A., 1977. The ontogeny of thymic independent antibody

responses in vitro in normal mice and mice with an X-linked B cell defect. J. Immunol.

119, 1874-1878.

Motoshima, M., Yanagihara, K., Fukushima, K., Matsuda, J., Sugahara, K., Hirakata, Y.,

Yamada, Y., Kohno, S., Kamihira, S., 2007. Rapid and accurate detection of

Pseudomonas aeruginosa by real-time polymerase chain reaction with melting curve

analysis targeting gyrB gene. Diagn Microbiol. Infect. Dis. 58, 53-58.

Murdoch, D.R., Woods, C.W., Zimmerman, M.D., Dull, P.M., Belbase, R.H., Keenan, A.J.,

Scott, R.M., Basnyat, B., Archibald, L.K., Reller, L.B., 2004. The etiology of febrile

illness in adults presenting to Patan hospital in Kathmandu, Nepal. Am. J. Trop. Med.

Hyg. 70, 670-675.

Muyembe-Tamfum, J.J., Veyi, J., Kaswa, M., Lunguya, O., Verhaegen, J., Boelaert, M., 2009.

An outbreak of peritonitis caused by multidrug-resistant Salmonella Typhi in Kinshasa,

Democratic Republic of Congo. Trav. Med. Infect. Dis. 7, 40-43.

Mweu, E., English, M., 2008. Typhoid fever in children in Africa. Trop. Med. Int. Health. 13,

532-540.

Nair, S., Alokam, S., Kothapalli, S., Porwollik, S., Proctor, E., Choy, C., McClelland, M., Liu,

S.L., Sanderson, K.E., 2004. Salmonella enterica serovar Typhi strains from which SPI7,

References Chapter5

134

a 134-kilobase island with genes for Vi exopolysaccharide and other functions, has been

deleted. J. Bacteriol. 186, 3214-3223.

Nurminen, M., Vaara, M., 1996. Methanol Extracts LPS from Deep Rough Bacteria. Biochemed.

Biophysic. Res. Commun. 219, 441-444.

Ochiai, R.L., Acosta, C.J., Danovaro-Holliday, M.C., Baiqing, D., Bhattacharya, S.K., Agtini,

M.D., Bhutta, Z.A., Canh do, G., Ali, M., Shin, S., Wain, J., Page, A.L., Albert, M.J.,

Farrar, J., Abu-Elyazeed, R., Pang, T., Galindo, C.M., von Seidlein, L., Clemens, J.D.,

2008. A study of typhoid fever in five Asian countries: disease burden and implications

for controls. Bull. World. Health. Organ. 86, 260-268.

Ohtake, S., Martin, R., Saxena, A., Pham, B., Chiueh, G., Osorio, M., Kopecko, D., Xu, D.,

Lechuga-Ballesteros, D., Truong-Le, V., 2011. Room temperature stabilization of oral,

live attenuated Salmonella enterica serovar Typhi-vectored vaccines. Vaccine 29, 2761-

2771.

Parkhill, J., Dougan, G., James, K.D., Thomson, N.R., Pickard, D., Wain, J., Churcher, C.,

Mungall, K.L., Bentley, S.D., Holden, M.T., Sebaihia, M., Baker, S., Basham, D.,

Brooks, K., Chillingworth, T., Connerton, P., Cronin, A., Davis, P., Davies, R.M., Dowd,

L., White, N., Farrar, J., Feltwell, T., Hamlin, N., Haque, A., Hien, T.T., Holroyd, S.,

Jagels, K., Krogh, A., Larsen, T.S., Leather, S., Moule, S., O'Gaora, P., Parry, C., Quail,

M., Rutherford, K., Simmonds, M., Skelton, J., Stevens, K., Whitehead, S., Barrell, B.G.,

2001. Complete genome sequence of a multiple drug resistant Salmonella enterica

serovar Typhi CT18. Nat. 413, 848-852.

Parry, C.M., Hien, T.T., Dougan, G., White, N.J., Farrar, J.J., 2002. Typhoid fever. N. Engl. J.

Med. 347, 1770-1782.

Parry, C.M., Ho, V.A., Phuong le, T., Bay, P.V., Lanh, M.N., Tung le, T., Tham, N.T., Wain, J.,

Hien, T.T., Farrar, J.J., 2007. Randomized controlled comparison of ofloxacin,

azithromycin, and an ofloxacin-azithromycin combination for treatment of multidrug-

References Chapter5

135

resistant and nalidixic acid-resistant typhoid fever. Antimicrob. Agents. Chemother. 51,

819-825.

Perdomo, R., Montero, V., 2006. Purification of E. coli 055:B5 lipopolysaccharides by size

exclusion chromatography. Biotecnología. Aplicada. 23, 124-129.

Perry, C.M., 2013. Meningococcal groups C and Y and Haemophilus b tetanus toxoid conjugate

vaccine (HibMenCY-TT; MenHibrix): A. Rev. Drugs. 7, 7.

Phan, M.D., Kidgell, C., Nair, S., Holt, K.E., Turner, A.K., Hinds, J., Butcher, P., Cooke, F.J.,

Thomson, N.R., Titball, R., Bhutta, Z.A., Hasan, R., Dougan, G., Wain, J., 2009.

Variation in Salmonella enterica serovar Typhi IncHI1 plasmids during the global spread

of resistant typhoid fever. Antimicrob. Agents. Chemother. 53, 716-727.

Phan, M.D., Wain, J., 2008. IncHI plasmids, a dynamic link between resistance and

pathogenicity. J. Infect. Dev. Ctries. 2, 272-278.

Pickard, D., Kingsley, R.A., Hale, C., Turner, K., Sivaraman, K., Wetter, M., Langridge, G.,

Dougan, G., 2013. A genomewide mutagenesis screen identifies multiple genes

contributing to Vi capsular expression in Salmonella enterica serovar Typhi. J. Bacteriol.

195, 1320-1326.

Pickard, D., Wain, J., Baker, S., Line, A., Chohan, S., Fookes, M., Barron, A., Gaora, P.O.,

Chabalgoity, J.A., Thanky, N., Scholes, C., Thomson, N., Quail, M., Parkhill, J., Dougan,

G., 2003. Composition, acquisition, and distribution of the Vi exopolysaccharide-

encoding Salmonella enterica pathogenicity island SPI-7. J. Bacteriol. 185, 5055-5065.

Pihlgren, M., Friedli, M., Tougne, C., Rochat, A.F., Lambert, P.H., Siegrist, C.A., 2006.

Reduced ability of neonatal and early-life bone marrow stromal cells to support

plasmablast survival. J. Immunol. 176, 165-172.

Prakash, P., Sen, M.R., Mishra, O.P., Gulati, A.K., Shukla, B.N., Nath, G., 2007. Dot enzyme

immunoassay (Typhidot) in diagnosis of typhoid fever in children. 53, 216-217.

References Chapter5

136

Pulickal, A.S., Callaghan, M.J., Kelly, D.F., Maskey, M., Mahat, S., Hamaluba, M., Dongol, S.,

Adhikari, N., Thorson, S., Basynat, B., Murdoch, D.R., Farrar, J.J., Pollard, A.J., 2013.

Prevalence and Genetic Analysis of Phenotypically Vi- Negative Salmonella Typhi

Isolates in Children from Kathmandu, Nepal. J. Trop. Pediatr. 17, 17.

Qian, F., Wu, Y., Muratova, O., Zhou, H., Dobrescu, G., Duggan, P., Lynn, L., Song, G., Zhang,

Y., Reiter, K., MacDonald, N., Narum, D.L., Long, C.A., Miller, L.H., Saul, A., Mullen,

G.E., 2007. Conjugating recombinant proteins to Pseudomonas aeruginosa ExoProtein

A: a strategy for enhancing immunogenicity of malaria vaccine candidates. Vaccine 25,

3923-3933.

Raetz, C.R., Whitfield, C., 2002. Lipopolysaccharide endotoxins. Annu. Rev. Biochem. 71, 635-

700.

Raffatellu, M., Wilson, R.P., Winter, S.E., Baumler, A.J., 2008. Clinical pathogenesis of typhoid

fever. J. Infect. Dev. Ctries. 2, 260-266.

Rahman, M.M., Guard-Petter, J., Carlson, R.W., 1997. A virulent isolate of Salmonella

enteritidis produces a Salmonella typhi-like lipopolysaccharide. J. Bacteriol. 179, 2126-

2131.

Reddy, E.A., Shaw, A.V., Crump, J.A., 2010. Community-acquired bloodstream infections in

Africa: a systematic review and meta-analysis. Lancet. Infect. Dis. 10, 417-432.

Rezania, S., Amirmozaffari, N., Tabarraei, B., Jeddi-Tehrani, M., Zarei, O., Alizadeh, R.,

Masjedian, F., Zarnani, A.H., 2011. Extraction, Purification and Characterization of

Lipopolysaccharide from Escherichia coli and Salmonella typhi. Avicenna. J. Med.

Biotechnol. 3, 3-9.

Richards, S.M., Strandberg, K.L., Gunn, J.S., 2010. Salmonella-regulated lipopolysaccharide

modifications. Subcell. Biochem. 53, 101-122.

Rijkers, G.T., Sanders, E.A., Breukels, M.A., Zegers, B.J., 1998. Infant B cell responses to

polysaccharide determinants. Vaccine. 16, 1396-1400.

References Chapter5

137

Rogerson, S.J., Spooner, V.J., Smith, T.A., Richens, J., 1991. Hydrocortisone in

chloramphenicol-treated severe typhoid fever in Papua New Guinea. Trans. R. Soc. Trop.

Med. Hyg. 85, 113-116.

Rondini, S., Micoli, F., Lanzilao, L., Hale, C., Saul, A.J., Martin, L.B., 2011. Evaluation of the

immunogenicity and biological activity of the Citrobacter freundii Vi-CRM197

conjugate as a vaccine for Salmonella enterica serovar Typhi. Clin. Vaccine. Immunol.

18, 460-468.

Rubin, F.A., McWhirter, P.D., Punjabi, N.H., Lane, E., Sudarmono, P., Pulungsih, S.P.,

Lesmana, M., Kumala, S., Kopecko, D.J., Hoffman, S.L., 1989. Use of a DNA probe to

detect Salmonella typhi in the blood of patients with typhoid fever. J. Clin. Microbiol. 27,

1112-1114.

Sabbagh, S.C., Forest, C.G., Lepage, C., Leclerc, J.M., Daigle, F., 2010. So similar, yet so

different: uncovering distinctive features in the genomes of Salmonella enterica serovars

Typhimurium and Typhi. FEMS. Microbiol. Lett. 305, 1-13.

Saha, M.R., Ramamurthy, T., Dutta, P., Mitra, U., 2001. Emergence of Salmonella Typhi Vi

antigen-negative strains in an epidemic of multidrug-resistant typhoid fever cases in

Calcutta, India. Natl. Med. J. India. 13, 164.

Salerno-Goncalves, R., Pasetti, M.F., Sztein, M.B., 2002. Characterization of CD8 (+) effector T

cell responses in volunteers immunized with Salmonella enterica serovar Typhi strain

Ty21a typhoid vaccine. J. Immunol. 169, 2196-2203.

Sambrook, J., Russell, D.W.,, 2001. Molecular Cloning, A Laboratory Manual, 3rd ed. Cold

Spring Harbor Laboratory Press, New York,.

Samuel, G., Reeves, P., 2003. Biosynthesis of O-antigens: genes and pathways involved in

nucleotide sugar precursor synthesis and O-antigen assembly. Carbohydr. Res. 338,

2503-2519.

References Chapter5

138

Sanborn, W.R., Vieu, J.F., Komalarini, S., Sinta, Trenggonowati, R., Kadirman, I.L., Sumarmo,

Aziz, A., Sadjimin, T., Triwibowo, Atas, Ayam, S., 1979. Salmonellosis in Indonesia:

phage type distribution of Salmonella typhi. J. Hyg. 82, 143-153.

Saxena, M., Di Fabio, J.L., 1994. Salmonella typhi O-polysaccharide--tetanus toxoid conjugated

vaccine. Vaccine. 12, 879-884.

Scheelings, T.F., Lightfoot, D., Holz, P., 2011. Prevalence of Salmonella in Australian reptiles. J.

Wildl. Dis. 47, 1-11.

Shafer, D.E., Toll, B., Schuman, R.F., Nelson, B.L., Mond, J.J., Lees, A., 2000. Activation of

soluble polysaccharides with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate

(CDAP) for use in protein-polysaccharide conjugate vaccines and immunological

reagents. II. Selective crosslinking of proteins to CDAP-activated polysaccharides.

Vaccine. 18, 1273-1281.

Shukla, V.K., Singh, H., Pandey, M., Upadhyay, S.K., Nath, G., 2000. Carcinoma of the

gallbladder--is it a sequel of typhoid? Dig. Dis. Sci. 45, 900-903.

Siddiqui, F.J., Rabbani, F., Hasan, R., Nizami, S.Q., Bhutta, Z.A., 2006. Typhoid fever in

children: some epidemiological considerations from Karachi, Pakistan. Int. J. Infect. Dis.

10, 215-222.

Silipo, A., Castro, C. De, Lanzetta, R., Parrilli, M., & Molinaro, A. , 2010. Lipopolysaccharides,

in: Konig, H. (Ed.), Prokaryotic Cell Wall Compounds. Springer-Verlag. Berlin.

Heidelberg, pp. 133-153. .

Silverman, M., Simon, M., 1980. Phase variation: genetic analysis of switching mutants. Cell.

19, 845-854.

Simanjuntak, C., Totosudirjo, H., Haryanto, P., Suprijanto, E., Paleologo, F., Punjabi, N.,

Witham, N., Darmowigoto, R., Hoffman, S., 1991. Oral immunisation against typhoid

fever in Indonesia with Ty21a vaccine. The Lancet. 338, 1055-1059.

References Chapter5

139

Simon, R., Levine, M.M., 2012. Glycoconjugate vaccine strategies for protection against

invasive Salmonella infections. Hum. Vaccin. Immunother. 8, 494-498.

Singleton, R., Wenger, J., Klejka, J.A., Bulkow, L.R., Thompson, A., Sarkozy, D., Emini, E.A.,

Gruber, W.C., Scott, D.A., 2013. The 13-valent pneumococcal conjugate vaccine for

invasive pneumococcal disease in Alaska native children: Results of a Clinical Trial.

Pediatr. Infect. Dis. J. 20, 20.

Song, J.H., Cho, H., Park, M.Y., Na, D.S., Moon, H.B., Pai, C.H., 1993. Detection of Salmonella

typhi in the blood of patients with typhoid fever by polymerase chain reaction. J. Clin.

Microbiol. 31, 1439-1443.

Spilker, T., Coenye, T., Vandamme, P., LiPuma, J.J., 2004. PCR-based assay for differentiation

of Pseudomonas aeruginosa from other Pseudomonas species recovered from cystic

fibrosis patients. J. Clinic. Microbiol. 42, 2074-2079.

Sugio, S., Kashima, A., Mochizuki, S., Noda, M., Kobayashi, K., 1999. Crystal structure of

human serum albumin at 2.5 A resolution. Prot. Eng. 12, 439-446.

Swartz, J.R., 2001. Advances in Escherichia coli production of therapeutic proteins. Curr. Opin.

Biotechnol. 12, 195-201.

Szu, S.C., Bystricky, S., 2003. Physical, chemical, antigenic, and immunologic characterization

of polygalacturonan, its derivatives, and Vi antigen from Salmonella typhi. Methods.

Enzymol. 363, 552-567.

Szu, S.C., Taylor, D.N., Trofa, A.C., Clements, J.D., Shiloach, J., Sadoff, J.C., Bryla, D.A.,

Robbins, J.B., 1994. Laboratory and preliminary clinical characterization of Vi capsular

polysaccharide-protein conjugate vaccines. Infect. Immun. 62, 4440-4444.

Tanomand, A., Farajnia, S., Najar Peerayeh, S., Majidi, J., 2013. Cloning, expression and

characterization of recombinant exotoxin A-flagellin fusion protein as a new vaccine

candidate against Pseudomonas aeruginosa infections. Iran. Biomed. J 17, 1-7.

References Chapter5

140

Taylor, C.E., Cobb, B.A., Rittenhouse-Olson, K., Paulson, J.C., Schreiber, J.R., 2012.

Carbohydrate moieties as vaccine candidates: targeting the sweet spot in the immune

response. Vaccine. 30, 4409-4413.

Terpe, K., 2006. Overview of bacterial expression systems for heterologous protein production:

from molecular and biochemical fundamentals to commercial systems. Appl. Microbiol.

Biotechnol. 72, 211-222.

Thompson, J.D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and Higgins, D. G., 1997. The

Clustal_X windows interface; flexible strategies for multiple sequence alignment aided

by quality analysis tools. Nucleic Acids Res 25, 4876–4882.

Thomson, N., Baker, S., Pickard, D., Fookes, M., Anjum, M., Hamlin, N., Wain, J., House, D.,

Bhutta, Z., Chan, K., Falkow, S., Parkhill, J., Woodward, M., Ivens, A., Dougan, G.,

2004. The role of prophage-like elements in the diversity of Salmonella enterica serovars.

J. Mol. Biol. 339, 279-300.

Tsang, R.S., Wong, A., 1989. Release of Vi antigens from Salmonella typhi: implications for

virulence and diagnosis. FEMS. Microbiol. Immunol. 1, 437-441.

Vernikos, G.S., Parkhill, J., 2006. Interpolated variable order motifs for identification of

horizontally acquired DNA: revisiting the Salmonella pathogenicity islands.

Bioinformatics. 22, 2196-2203.

Vernikos, G.S., Thomson, N.R., Parkhill, J., 2007. Genetic flux over time in the Salmonella

lineage. Genome. Biol. 8.

Viret, J.F., Favre, D., Wegmuller, B., Herzog, C., Que, J.U., Cryz, S.J., Jr., Lang, A.B., 1999.

Mucosal and systemic immune responses in humans after primary and booster

immunizations with orally administered invasive and noninvasive live attenuated

bacteria. Infect. Immun. 67, 3680-3685.

References Chapter5

141

Vos, Q., Lees, A., Wu, Z.Q., Snapper, C.M., Mond, J.J., 2000. B-cell activation by T-cell-

independent type 2 antigens as an integral part of the humoral immune response to

pathogenic microorganisms. Immunol. Rev. 176, 154-170.

Wai, S.N., Lindmark, B., Soderblom, T., Takade, A., Westermark, M., Oscarsson, J., Jass, J.,

Richter-Dahlfors, A., Mizunoe, Y., Uhlin, B.E., 2003. Vesicle-mediated export and

assembly of pore-forming oligomers of the enterobacterial ClyA cytotoxin. Cell. 115, 25-

35.

Wain, J., Diep, T.S., Bay, P.V., Walsh, A.L., Vinh, H., Duong, N.M., Ho, V.A., Hien, T.T.,

Farrar, J., White, N.J., Parry, C.M., Day, N.P., 2008. Specimens and culture media for the

laboratory diagnosis of typhoid fever. J. Infect. Dev. Ctries. 2, 469-474.

Wain, J., Hosoglu, S., 2008. The laboratory diagnosis of enteric fever. J. Infect. Dev. Ctries. 2,

421-425.

Wain, J., House, D., Zafar, A., Baker, S., Nair, S., Kidgell, C., Bhutta, Z., Dougan, G., Hasan, R.,

2005. Vi antigen expression in Salmonella enterica serovar Typhi clinical isolates from

Pakistan. J. Clin. Microbiol. 43, 1158-1165.

Wain, J., Pham, V.B., Ha, V., Nguyen, N.M., To, S.D., Walsh, A.L., Parry, C.M., Hasserjian,

R.P., HoHo, V.A., Tran, T.H., Farrar, J., White, N.J., Day, N.P., 2001. Quantitation of

bacteria in bone marrow from patients with typhoid fever: relationship between counts

and clinical features. J. Clin. Microbiol. 39, 1571-1576.

Wang, X., Li, X., Zhang, Z., Shen, X., Zhong, F., 2010. Codon optimization enhances secretory

expression of Pseudomonas aeruginosa exotoxin A in E. coli. Protein Expr. Purif. 72,

101-106.

Weldon, J.E., Pastan, I., 2011. A guide to taming a toxin--recombinant immunotoxins

constructed from Pseudomonas exotoxin A for the treatment of cancer. FEBS. J. 278,

4683-4700.

References Chapter5

142

Wetter, M., Goulding, D., Pickard, D., Kowarik, M., Waechter, C.J., Dougan, G., Wacker, M.,

2012. Molecular characterization of the viaB locus encoding the biosynthetic machinery

for Vi capsule formation in Salmonella Typhi. PLoS One 7, 21.

Whitfield, C., Kaniuk, N., Frirdich, E., 2003. Molecular insights into the assembly and diversity

of the outer core oligosaccharide in lipopolysaccharides from Escherichia coli and

Salmonella. J. Endotoxin. Res. 9, 244-249.

Wolf, P., Elsasser-Beile, U., 2009. Pseudomonas exotoxin A: from virulence factor to anti-cancer

agent. Int. J. Med. Microbiol. 299, 161-176.

Wu, S., Li, Y., Xu, Y., Li, Q., Chu, Y., Huang, R., Qin, Z., 2010. A Salmonella enterica serovar

Typhi plasmid induces rapid and massive apoptosis in infected macrophages. Cell. Mol.

Immunol. 7, 271-278.

Yoon, H., Ansong, C., Adkins, J.N., Heffron, F., 2011. Discovery of Salmonella virulence

factors translocated via outer membrane vesicles to murine macrophages. Infect. Immun.

79, 2182-2192.

Zhang, X.L., Jeza, V.T., Pan, Q., 2008. Salmonella typhi: from a human pathogen to a vaccine

vector. Cell. Mol. Immunol. 5, 91-97.

Zhao, L., Ezak, T., Li, Z.Y., Kawamura, Y., Hirose, K., Watanabe, H., 2001. Vi-Suppressed wild

strain Salmonella typhi cultured in high osmolarity is hyperinvasive toward epithelial

cells and destructive of Peyer's patches. Microbiol. Immunol. 45, 149-158.

Zhou, L., Pollard, A.J., 2012. A novel method of selective removal of human DNA improves

PCR sensitivity for detection of Salmonella Typhi in blood samples. BMC. Infect. Dis.

12, 1471-2334.

Zimmerman, M.D., Murdoch, D.R., Rozmajzl, P.J., Basnyat, B., Woods, C.W., Richards, A.L.,

Belbase, R.H., Hammer, D.A., Anderson, T.P., Reller, L.B., 2008. Murine typhus and

febrile illness, Nepal. Emerg. Infect. Dis. 14, 1656-1659.

References Chapter5

143

Zunszain, P.A., Ghuman, J., Komatsu, T., Tsuchida, E., Curry, S., 2003. Crystal structural

analysis of human serum albumin complexed with hemin and fatty acid. BMC. Struct.

Biol. 3, 7.

Appendices

144

APPENDICES

Appendix 1: PREPARATION OF TRYPTIC SOY BROTH (TSB)

Composition

Peptone from casein 16.0 g/L

Peptone from meat 3.0 g/L

D (+) glucose 2.5 g/L

NaCl 5.0 g/L

Di potassium hydrogen phosphate 2.5 g/L

TSB is a prep formulated media (MERCK Cat. No. 1.00800). Thirty grams of TSB

media was suspended in 1 liter of demineralized water along with heating in a microwave

oven. The media was autoclaved at 121°C for 15 minutes. pH : 7.3 + 0.2 at 25 °C.

Appendix 2: PREPARATION OF MACCONKEY AGAR MEDIUM

Composition

Peptone (from casein) 17.0 g/L

Peptone (from meat) 3.0 g/L

NaCl 5.0 g/L

Lactose 10.0 g/L

Bile salt mixture 1.5 g/L

Neutral red 0.03 g/L

Crystal violet 0.001 g/L

Agar-agar 13.5 g/L

Preformulated MacConkey (MERCK Cat. No. 1.05465) media was dissolved @ 50g

media in 1 liter of demineralized water by heating in microwave oven. Media was poured

in to plates and allowed to solidify. The plates were clear and red-brown. pH: 7.1+ 0.2 at

25°C.

Appendices

145

Appendix 3: PREPARATION OF TRIPLE SUGAR IRON (TSI) AGAR

Composition

Peptone from casein 15.0 g/L

Peptone from soy meal 5.0 g/L

Meat extract 3.0 g/L

Yeast extract 3.0 g/L

Sodium Chloride 5.0 g/L

Lactose 10.0 g/L

Sucrose 10.0 g/L

D (+) glucose 1.0 g/L

Ammonium iron citrate 0.5 g/L

Sodium thiosulfate 0.5 g/L

Phenol red 0.024 g/L

Agar-agar 12.0 g/L

Suspended 65g of TSI agar medium (MERCK Cat. No. 1.03915) in 1 liter of

demineralized water by heating in a microwave oven. The media was autoclaved at

121°C for 15 minutes and allowed to solidify at 30° angle to give agar slants. The

prepared medium was clear and red-orange. pH: 7.4 ± 0.2 at 25°C.

Appendices

146

Appendix 4: REMEL KIT IDENTIFICATION RESULTS AND INTERPRETATION THROUGH ERIC SOFTWARE

Reagent Isolates

Salmonella. Typhi Microcode: 6021011

URE -

ADH +

ODC +

LDC -

TET -

LIP -

KSF -

SBL +

GUR -

ONPG +

BGLU -

BXYL -

NAG -

MAL +

PRO -

GGT +

PYR -

ADON -

IND -

Appendices

147

Appendix 5: REAGENTS FOR DNA EXTRACTION

a. T buffer (10mM Tris HCl, pH 8.3)

Composition

1 M Tris-Cl 1 mL

Distilled water up to 100 mL

Preparation

Took 70 mL of distilled water in a bottle; poured 1 mL of Tris buffer (1M) in it. Adjusted

pH to 8.3 and made a final volume of 100 mL by adding distilled water. Autoclaved and

stored at 4°C for DNA extraction. Made aliquots of 1 mL in eppendorf tubes and stored

at -20°C for PCR use.

b. Sodium dodecyl sulfate (SDS) 10% (w/v)

Preparation

Dissolved 100 g of SDS in 800 mL distilled water. The pH was adjusted to 7.0 by adding

several drops of concentrated HCl and water was added to make a final volume of 1 liter.

c. SS phenol (Salt-saturated phenol)

Composition

2 M Tris-Cl 200 mL

Phenol 453.6 g (1 lb)

Cresol (Sigma) 25 mL

2-Mercaptoethanol (Sigma) 1 mL

8-Hydroxyquinline 0.50 g

Distilled water 130 mL

Preparation

To a 1lb bottle of phenol, added 100 mL 2 M Tris-Cl, pH 8.3 and 130 mL water. Warmed

to 37°C to melt phenol. Removed the upper aqueous phase with a pipette and discarded.

Added 100 mL of 2M Tris-Cl (pH 8.3), 25 mL m-cresol, 1 mL 2-mercaptoethanol and

0.5g 8-hydroxyquinoline. Organic (Phenol) and aqueous phase separated spontaneously.

Appendices

148

d. 3 M sodium acetate

Composition

Sodium acetate.3H2O 40.8g

Distilled water 80.0 mL

Preparation

Dissolved 40.8g sodium acetate.3H2O in 80 mL water. Adjusted the solution to the

desired pH (4.8) with glacial acetic acid. Added water to a final volume of 100 mL,

autoclaved and stored at room temperature.

e. RNase A 10 mg/ mL (DNase free)

Preparation

Dissolved RNase A (pancreatic RNase) at 10 mg/ mL in 10mM Tris HCl (pH 8.3).

Incubated in boiling water bath at 100°C for 10 to 15 min. Cooled slowly to room

temperature, made aliquots and stored at –20°C.

Appendices

149

Appendix 6: REAGENTS FOR AGAROSE GEL ELECTROPHORESIS

a. TBE Buffer 10X/L

Dissolved 128g trisma base, 55g boric acid 40 mL of 0.5 M EDTA .2H2O in 500 mL of

water and adjusted the pH to 8.0 with acetic acid. Shaking with magnetic stirrer was done

overnight; added water to make a final volume of 1liter. Autoclaved and stored at room

temperature.

b. Bromophenol blue (Tracking dye) 10% (w/v)

Dissolved 1g bromophenol blue in water to final volume of 10 mL and stored at room

temperature in a foil wrapped bottle to prevent exposure to light.

c. Ethidium bromide (10 mg/ mL)

Dissolved 0.3g of ethidium bromide in distilled water to make the volume 30 mL; stored

the solution at room temperature in a foil-wrapped bottle to prevent exposure.

TAE RUNNING BUFFER (50 X)

Components Formula weight Amount used

Tric- HCl

Glacial acetic acid

*EDTA (0.5M pH 8.0)

142 g mol-1

142 g

57 g

50 mL

Volume was adjusted to 1 liter with MilliQ water

*Disodium EDTA dehydrate (18.61) was dissolved in MilliQ water (80 mL) and the pH

was adjusted to 8.0 by addition of sodium hydroxide pellets. The volume was made up to

100 mL and solution was autoclaved at 15 psi, 120 C for 20 min.

Appendices

150

Appendix 7: PREPARATION OF POLYACRYLAMIND GEL ELECTROPHORESIS

7.1 Composition of 12% separating gel

S.No. Solutions Separating gel 10%

1. H2O 1.67 mL 2. 30% Acrylamide mix 2 mL 3. Separating gel buffer

1.5 M Tris (pH 8.8) 1.25 mL

4. 20% SDS 25 µL 5. TEMED 2.5µL 6. 10% APS 50 µL

7.2 Composition of staking gel 5%

S.No. Solutions Staking gel 5%

1. H2O 1.702 mL 2. 30% Acrylamide mix 0.5 mL 3. Staking gel buffer

1 M Tris (pH 6.8) 0.75 mL

4. 20% SDS 15 µL 5. TEMED 3 µL 6. 10% APS 30 µL

7.3 Running buffer for PAGE 10X

S.No. Components Formula weight Amount used

1. Glycine 75.07 g /L 144 g 2. Tric HCl 121.14 g /L 30 g 3. SDS 288.38 g /L 10 g

Volume was adjusted to 1 liter with Sterile distilled water and diluted 10 times and

named working solution

Appendices

151

7.4 Preparation of loading dye


1. Glycerol 92.09 g /L 5 g 2. SDS 288.38 g /L 1 g 3. EDTA 292.4 g/L 0.037 g 4. Bromophenol blue dye 669.69 g /L 0.2 g

7.5 Composition of Sample loading dye 4X (10 mL)


1. Glycerol 92.09 g /L 5 g 2. SDS 288.38 g /L 1 g 3. EDTA 292.4 g/L 0.037 g 4. Tris-Cl (0.5 M pH 6.8) 121.14 g /L 3.153 g 5. Bromophenol blue dye 669.69 g /L 0.2 g

Dissolve glycerol, SDS and EDTA in tris adjust pH to 6.8 and make the volume 10 mL.

add BPB to guve deep blue color. Store at – 20 °C in aliquots.

7.6 SDS-PAGE Staining solution

S.No. Components Amount used

1. Acetic acid (10%) 50 mL 2. Isopropanol (25%) 125 mL 3. Commassaie B. Blue R-250

(0.025 %) 0.125 mL

4. Sterile distilled water 325 mL 5. Total volume 500 mL

7.7 SDS-PAGE De-staining solution

S.No. Components Amount used

1. Acetic acid (10%) 50 mL 2. Sterile distilled water 450 mL 3. Total volume 500 mL

Appendices

152

Appendix 8: SOLUTIONS OF SILVER STAINING

I. Fixing solution:

40% ethanol and 5% glacial acetic acid in Milli-Q water.

II. Oxidizing solution:

0.7% periodic acid in fixing solution.

III. Staining solution:

mL of ammonium hydroxide (concentrated) in 28 mL of 0.1N NaOH and added 5 mL of

20% silver nitrate to the solution with stirring. The volume of the staining solution was

makeup with Milli-Q water upto 150 mL.

IV. Developing solution:

10 mg of citric acid and 0.1 mL of 37% formaldehyde in dissolved in Milli-Q water to

make the total volume 200 mL.

V. Stop solution:

Glacial acetic acid (5% in Milli-Q water) was used as stop solution.

Appendices

153

Appendix 9: DNA SEQUENCING PROTOCOL

Sequencing Kit:

Big Dye Terminator v3.1 Cycle Sequencing Kits (Applied Biosystems).

Sequencer:

ABI 3730xl DNA Analyzer (96 capillary type)

PCR machine:

DNA Engine Tetrad 2 Peltier Thermal Cycler (BIO-RAD)

Sequencing Protocol

Sequencing reactions were performed in the DNA Engine Tetrad 2 Peltier Thermal

Cycler (BIORAD) using the ABI Big Dye Terminator v3.1 Cycle Sequencing Kit

(Applied Biosystems), as directed by manufacturer. Single-pass sequencing was

performed on each template using specific primer. The fluorescent-labeled fragments

were purified from the unincorporated terminators with the BigDye XTerminator

Purification Kit (Applied Biosystems). The samples were injected to electrophoresis in an

ABI 3730xl DNA Analyzer (Applied Biosystems).

Appendices

154

Appendix 10: LB GROWTH / EXPRESSION MEDIA

The composition of the media used for growth and expression studies of E.coli, namely

Luria Bertani (LB) media (Miller 1972) is described in table below:

Components

Tryptone 10 g/L

Yeast extract 5 g/L

NaCl 10 g/L

All the reagents were dissolved in the demineralized distilled water and made up the

volume to the required value and autoclave the media at 121 °C for 15 min. pH: 7.4 ± 0.2

at 25°C.

Note: for preparation of LB agar media 20 g/ L agar was added to the broth before

autoclaving.

Appendices

155

Appendix 11: SOLUTIONS PREPARATION FOR PLASMID ISOLATION

Solutions Chemicals Final Conc. F. wt Stock sol. /wt

Solution 1

Tris-Cl (pH 8.0) 25 mM 121.14 g 1M

EDTA (pH 8.0) 10 mM 292.4 g 1M

Glucose 50 mM 180 g 0.9 g

Solution 2 NaOH 0.2 N 40 g 10 N

SDS 1% 288.38 g 20%

Solution 3 Potassium acetate 3M 98.19g 29.442g

Glacial acetic acid Conc.

Solution I cell Resuspension

Tris-Cl 25 mM Tris-Cl (pH 8.0)

EDTA 10mM EDTA (pH 8.0)

Autoclave the solutions (of Tris and EDTA and then add Glucose 50 mM

Add autoclaved distilled Water for volume make up to100 mL

Solution 2 Cell lysis solution

10 N NaOH 0.2 N NaOH (M.W 40)

20% SDS 5 mL 1% SDS

Add autoclaved distilled Water up to 100 mL

Solution 3 Neutralization solution

Potassium acetate 3M

Adjust pH 8 with addition of glacial acetic acid approximately 7 mL

Add autoclaved distilled Water up to 100 mL

Appendices

156

Appendix 12: ELISA

Coating antigens:

Coat all at 0.5 µg well in carbonated coating buffer + MgCl2

Stock: 1000µg /mL (0.5 µg /well)

Controls:

Blank well (which will only have 1% BSA –PBS and pNPP substrate) did not get coated

Positive well (1% BSA- PBS and pNPP substrate)

Primary antibodies:

Mouse prebleed sere from Balb/c mice starting at 1:10 and 3 two- fold dilutions (1:10,

1:20, 1:40 and 1:80) down the plate

Secondary antibodies:

Goat anti- mouse IgG (H+L)- alkaline phophatase 1:500

Substrate

phophatase substrate for ELISA (p-Nitrophenylphosphate)

LIST OF PUBLICATIONS

THESIS RELATED

1. Salman M., Ali A. and Haque A. A novel multiplex PCR for detection of Pseudomonas aeruginosa: a major cause of wound infections. Pak J. Med Sci. 2013; 29 (4): 957-961.

2. Salman M., Michel F., Cairn C., Ali A., Jabbar A., Rahman M., Haque A. and Cox A. Conjugation of rEPA with Salmonella Typhi Vi negative OSP using different strategies and determine the IgG titer in mice.(ready for submission in Vaccine)

3. Salman M., Ali A., Haque A. and Rahman M. Over expression and characterization of detoxoid ETA of Pseudomonas aeruginosa as conjugate vaccines candidate. (in preparation for submission in Microbial Cell Factories)

4. Salman M., Ali A., Sarwar Y., Rahman M. and Haque A.Accession No. GenBank JN717229, GenBank JN717230, GenBank JN717231 and GenBank JN717232.

OTHER GRPOUP PUBLICATIONS

1. Tariq A., Haque A., Ali A., Bashir S., Habeeb. M., A., Salman M. and Sarwar Y. Molecular profiling of antimicrobial resistance and integron association of MDR clinical isolates of Shigella species from Faisalabad, Pakistan. Can. J. Microbiol.. 2012; 58:1047–1054

2. Afzal A., Habeeb M. A., Sarwar Y., Ali A. Salman M. and Haque A. Molecular evaluation of drug resistance in clinical isolates of Salmonella. J. Infect Dev Ctries 2013; 7(12):929-940.

3. Habeeb M. A., Sarwar Y., Ali A. Salman M. and Haque A. Rapid emergence of ESBL producers in E. coli causing urinary and wound infections in Pakistan. Pak J. Med Sci. 2013;29 (2):540-544.

4. Jabbar A., Salman M., Twelkmeyer B., Ali A., Imran M., Tawab A., Haque A., Schweda E. and Iqbal M. ESI-MSn based structural characterization of lipid A from Salmonella Typhi strain isolated from Faisalabad region of Pakistan. (Manuscript ready for submission)

Pak J Med Sci 2013 Vol. 29 No. 4 www.pjms.com.pk 957

Open Access

INTRODUCTION

Wound infections are complications caused by bacteria which result in belated healing and can sometimes be even life-threatening.1 These infections also considerably contribute to increased health care

costs.2 Pseudomonas aeruginosa (P. aeruginosa) has been recognized as a frequent inhabitant of chronic non-healing wounds3 and is one of the foremost opportunistic bacteria isolated from wounds which cause high morbidity and mortality despite antimicrobial therapy.4 P. aeruginosa infections are generally detected by standard microbiological techniques such as phenotypic and biochemical profiles,5 however these commercial tests tend to be lengthy and unreliable.5,6 Molecular techniques, such as polymerase chain reaction (PCR) are rapid and reliable for the identification of microbial pathogens,6 many PCR based diagnostic methods have been developed for P. aeruginosa.7-9

However, most of the protocols target only a single gene fragment which is inadequate for comprehensive and reliable diagnosis.9,10 The reason is that P. aeruginosa strains from patients

1. Muhammad Salman BS, 2. Dr. Aamir Ali, PhD,3. Dr. Abdul Haque, PhD,1-3: Health Biotechnology Division, National Institute for Biotechnology and Genetic Engineering, FaisalabadaffiliatedwithPakistanInstituteofEngineeringand Applied Sciences (PIEAS), Islamabad,Pakistan.

Correspondence:

Dr. Abdul Haque, E-mail: [email protected]

* Received fort Publication: March 21, 2013

* Revision Received: May 17, 2013

* Revision Accepted: May 21 , 2013

Original Article

A novel multiplex PCR for detection of Pseudomonas aeruginosa: A major cause of wound infections

Muhammad Salman1, Aamir Ali2, Abdul Haque3

ABSTRACTBackground and Objective: Woundinfectionsareoftendifficulttotreatduetovariousbacterialpathogens.Pseudomonas aeruginosaisoneofthecommoninvadersofopenwounds.Precisediagnosisofthisetiologicalagent inwound infections isofcritical importanceparticularly intreatmentofproblematiccases.Theexistingdiagnosticmethodshavecertainlimitationsparticularlyrelatedtospecificity.OurobjectivewastotoestablishacomprehensiveandreliablemultiplexPCRtoconfirmdiagnosisofP. aeruginosa.Methods: AmultiplexPCRtestwasdevelopedforrapidandcomprehensiveidentificationofP. aeruginosa. Four highly specific genes were targeted simultaneously for detection of genus, species and exotoxinproduction (16S rDNA, gyrB, oprL and ETA) in P. aeruginosa; additionally one internal control gene invA of Salmonellawasused.ThespecificityofthemultiplexPCRwasconfirmedusinginternalandnegativecontrols.AmplifiedfragmentswereconfirmedbyrestrictionanalysisandDNAsequencing.Results: Thedevelopedmethodwasappliedon40morphologicallysuspectedP. aeruginosa isolates (from 200pussamples)and18isolateswereconfirmedasP. aeruginosa.Incomparison,only12couldbeidentifiedbiochemically. Conclusions: Combination of the four reported genes in multiplex PCR provided more confident andcomprehensive detection of P. aeruginosa which is applicable for screening of wound infections andassisting treatment strategy.

KEY WORDS: MultiplexPCR,woundinfections,P. aeruginosa.

doi: http://dx.doi.org/10.12669/pjms.294.3652How to cite this:Salman M, Ali A, Haque A. A novel multiplex PCR for detection of Pseudomonas aeruginosa: A major cause of wound infections. Pak J Med Sci 2013;29(4):957-961. doi: http://dx.doi.org/10.12669/pjms.294.3652

ThisisanOpenAccessarticledistributedunderthetermsoftheCreativeCommonsAttributionLicense(http://creativecommons.org/licenses/by/3.0),whichpermitsunrestricteduse,distribution,andreproductioninanymedium,providedtheoriginalworkisproperlycited.

Muhammad Salman et al.

958 Pak J Med Sci 2013 Vol. 29 No. 4 www.pjms.com.pk

demonstrate high genotypic diversity11 and several studies have confirmed the absence of one or more of the virulence genes in some P. aeruginosa strains.12

To overcome these problems, several multiplex PCR protocols have been reported,13 but due to genetic exchanges among P. aeruginosa and closely related bacteria, most multiplex PCRs have low specificity.14 Therefore, there is need to establish a comprehensive and reliable multiplex PCR to confirm diagnosis of P. aeruginosa. This study deals with optimization of a multiplex PCR targeting four different gene fragments specific for P. aeruginosa (16S rDNA, gyrB, oprL and ETA) simultaneously for comprehensive and confirmatory identification. Application of this method on clinical samples demonstrated improved efficiency and reproducibility.

METHODS

Bacterial isolation: P. aeruginosa strain # MS6 (previously confirmed as P. aeruginosa) was taken from National Institute for Biotechnology and Genetic Engineering (NIBGE) stock cultures. Two hundred wound (pus) samples were collected from non-hospitalized outdoor patients from Allied Hospital, Faisalabad, Pakistan in the year 2011. Samples were collected on sterile cotton wool swabs which were transported to laboratory immediately. In case of a delay, the samples were kept at 4°C in tryptic soy broth (TSB) till transportation. Salmonella enterica serovar Typhi (as internal control) and isolates of Staphylococcus aureus, Escherichia coli, Klebsiella aerogenes, Proteus vulgaris and Proteus mirabilis were also taken from NIBGE stock cultures and used as negative controls. The swabs were streaked on MacConkey agar plates and kept overnight at 37°C to observe colony morphology. Five different colonies from each of the MacConkey agar plates, suspected as P. aeruginosa, were processed further for biochemical

identification using RapidONE Remel kit (Thermo Fisher Scientific, Kansas, USA) according to manufacturer’s instructions.DNA extraction: Morphologically identified P. aeruginosa from wound samples, P. aeruginosa MS6, internal control (S. Typhi) and negative controls strains were cultured in TSB. Genomic DNA of the overnight cultures was extracted by the conventional phenol-chloroform method.15 Integrity of the DNA samples was checked by electrophoresis on 1% agarose gel and purity was determined by ratio of A260/A280 using a spectrophotometer (Spectro22 Labomed 22. Inc, USA).PCR amplification: First set of primers (Pa16S-F and Pa16S-R) was specific for 16s rDNA gene of the genus Pseudomonas.14 Second (gyrB-F and gyrB-R) and third (oprL-F and oprL-R) primer sets targeted species gene sequences of gyrB and oprL genes respectively.9,7 Fourth set (ETA-F and ETA-R) was used for amplification of exotoxin production related gene fragment (ETA).16 For internal control, the invA gene of S. Typhi was targeted using invA-F and invA-R primers.17 All sets of oligonucleotide primers were synthesized by Gene link (New York, USA). Sequences and lengths of targeted gene fragments are given in Table-I. Preliminarily, the PCR amplification conditions were optimized with P. aeruginosa MS6 for each of the four genes separately and then for the multiplex PCR. Each 50μl of the multiplex PCR mixture, in addition to the template DNA, contained 10 x buffer 5 μl, 1.5 mM MgCl2, 0.4mM of each dNTP, 5U of Taq DNA polymerase (Fermentas, USA), 0.25 μM of the primers targeting oprL gene and 0.5μM of each of the primers targeting invA, gyrB, ETA and Pa16S gene fragments. The thermal cycler (PTC 06 ICCC, Pakistan) conditions for the multiplex PCR were: 94°C for 5 minutes followed by 35 cycles of 94°C for 1 min, 58°C for 1 min, 72°C for 1.5 minutes; and a final extension step at 72°C

Table-I: Primers used in multiplex PCR.Primers Sequences (5/ - 3/) Genes Amplicon size (bp)

gyrB-F CCTGACCATCCGTCGCCACAAC gyrB 2229

gyrB-R CGCAGCAGGATGCCGACGCC ETA-F GACAACGCCCTCAGCATCACCA ETA 39716

ETA-R CGCTGGCCCATTCGCTCCAGCG oprL-F ATG GAAATGCTGAAATTCGGC oprL 5047

oprL-R CTTCTTCAGCTCGACGCGACG Pa16S-F GGGGGATCTTCGGACCTCA 16SrDNA 61814

Pa16S-R TCCTTAGAGTGCCCACCCG invA-F GTGAAATTATCGCCACGTTCGGGCAA invA 28417

InvA-R TCATCGCACCGTCAAAGGAACC


for 7 minutes. Similar multiplex PCR conditions were applied to the DNA templates of negative control isolates. On completion of PCR cycles, the amplified products were electrophoresed on 2% agarose gel, stained with ethidium bromide (5 μg /100 ml) and visualized under UV illumination and documentation system (Viopro platinum, Uvitech, Cambridge, UK). The optimized multiplex PCR conditions were applied on morphologically identified clinical wound samples.Restriction analysis: The amplified products of the targeted genes, gyrB, ETA, oprL and 16S rDNA, were subjected to restriction analysis with site specific restriction endonucleases. BsuRI was used to restrict amplified products of gyrB and 16S rDNA while CfrI and NcoI restriction endonucleases were used for ETA and oprL respectively. Each of the restriction mixtures contained 5µl (10 U) of enzyme, 3 µl of enzyme buffer, 8 µl of PCR-amplified product and 18µl of deionized water followed by overnight incubation at 37°C. Restricted fragments were electrophoresed on 2.5% agarose gel and visualized under UV illumination and documentation system (Viopro platinum, Uvitech, Cambridge, UK).DNA sequencing: Sequencing of the amplified gene fragments of P. aeruginosa MS6 (gyrB, ETA, oprL and 16S rDNA) was done by a commercial

vendor, Macrogen Inc. (Seoul, Korea) and the sequencing chromatographs were analyzed with Seqman software (DNASTAR, Inc. Wisconsin, USA) followed by submission to GenBank with accession numbers [GenBank: JN717229, GenBank: JN717230, GenBank: JN717231, GenBank: JN717232] respectively.

RESULTS

Identification of P. aeruginosa: From 200 clinical pus samples, 40 isolates were suspected as P. aerugi-nosa on the basis of formation of large, translucent, pale, mucoid colonies on MacConkey agar plates. On nutrient agar, typical greenish blue color (due to production of pyocanin and fluorescin pigments) was observed spreading throughout the medium. Biochemically, 12 isolates were identified as P. aer-uginosa by RapidONE Remel kit (Thermo Fisher Scientific, Kansas, USA). However, the number of positive isolates increased from 12 to 18 by mul-tiplex PCR developed for this study. In all cases, amplification products of internal control (284 bp), specific P. aeruginosa gene fragments gyrB (222 bp), ETA (397 bp), oprL (504 bp) and 16S rDNA (618 bp) were obtained (Fig.1). There was no amplification in case of negative control bacteria.Restriction analysis and DNA sequencing: Restriction of all the four amplified gene fragments

P. aeruginosa Multiplex PCR

Fig.1: Multiplex PCR of P. aeruginosa isolates.Lane M: 100 bp DNA ladder (Fermentas Cat# SM323). Lane 1-3: Multiplex PCR of P. aeruginosa showing amplicons of 16S rDNA (618 bp), oprL (504), ETA (397bp), ivnA internal control (284bp) and gyrB gene fragments (222 bp). Lane 4 and 5: Multiplex PCR of negative control (Proteus mirabilis) showing amplified product of internal control ivnA gene fragment (284bp) only. Lane 6: Negative control (without template DNA).

Fig.2: Restriction analysis of P. aeruginosa MS6 strain.Lane M: 100 bp DNA ladder (Fermentas Cat# SM323). Lane 1: gyrB gene (222 bp), Lane 2: Restricted products of gyrB gene, 167 & 55 bp. Lane 3: ETA gene (397bp). Lane 4: Restricted products of ETA gene, 258 & 139 bp. Lane 5: oprL gene (504 bp), Lane 6: Restricted products of oprL gene, 467 & 47 bp. Lane 7: 16S rDNA gene (618 bp). Lane 8: Restricted products of 16S rDNA gene, 459 & 159 bp. Lane 9: Negative control.

960 Pak J Med Sci 2013 Vol. 29 No. 4 www.pjms.com.pk

resulted in their cleavage into smaller fragments confirming band sizes as retrieved from website www.nebcutter.com. The 16S rDNA gene product (618 bp) produced 459 and 159 bp fragments, the oprL gene product (504 bp) was cleaved into 467 and 47 bp fragments, the ETA gene product (397 bp) yielded 258 and 139 bp fragments and the gyrB gene product (222 bp) was cleaved into fragments of 167 and 55 bp (Fig.2). The sequences of the amplified gene fragments (gyrB, ETA, oprL and 16S rDNA) of P. aeruginosa strain # MS6 were compared with already reported gene sequences of P. aeruginosa on NCBI database using BLAST search and top two similarity results were noted. The gyrB gene fragment sequence was found 99% identical with PAO1 [GenBank: AE004091.2] and 98% identical with NCGM2 [GenBank: AP012280.1]. The ETA gene was found 99% identical with PAO1 [GenBank: AE004091.2] and 98% identical with NCGM2 [GenBank: AP012280.1]. The oprL gene fragment sequence was found 99% identical with each of PAO1 [GenBank: AE004091.2] and M18 [GenBank: CP002496.1]. The 16S rDNA gene fragment sequence was found 97% identical with each of ZDC-2 [GenBank: JQ249910.1] and CW512 [GenBank: FM207514.1].

DISCUSSION

Wound infections often become complicated and problematic due to invasion of multiple organisms and most of them are multi drug resistant. One of the major causes of complications in the wound infections is P. aeruginosa and its early and precise diagnosis is of substantial importance.8 The delay in accurate diagnosis may prolong the hospitaliza-tion and effective treatment.5 In routine, the micro-biological culture is the mainstay for detection of P. aeruginosa. Although some other detection methods promise better sensitivity but these methods still need evaluation and validation,14,16 because Pseu-domonas species are sometime indistinguishable from other closely related microbes.18 The biochemi-cal tests lack specificity as in one study, 52 non-typ-ical P. aeruginosa isolates were not identified by API 20 E kit.19 We had similar observations with Rapid ONE Remel kit during this study. Many researchers have made attempts to develop molecular methods especially PCR for the detection of P. aeruginosa,20 but due to various limitations such as genetic diversity and the fact that genome sequences of closest species are not available, a comprehensive and definitive methodology is still lacking.

A multiplex PCR on respiratory samples targeting 3 genes (algD, chit A and 16S rDNA) detected P. aeruginosa in 78.7% samples whereas culture was positive in 56% cases only.21 A real time PCR on multiple targets for identification of P. aeruginosa reported the lesser specificity of ETA and algD genes as compared to oprl.5 Similar results about lesser specificity of ETA and algD genes have also been reported by other researchers.21 A study using quantitative PCR (qPCR) to target the oprL gene showed 85% specificity and concluded that qPCR may have a predictive value for impending P. aeruginosa infection for only a limited number of patients.22 The specificity of another developed multiplex PCR was reported as only 45.5%.23 P. aeruginosa from various sources were studied and it was found that the combination of oprl, oprL, 16S rDNA, ETA and fliC genes leads to false positive result because of genetic conservation and it showed difficulties in building up a reliable screening with these targets, however the gyrB and 16S-23S rDNA ITS genes were highly specific.7

We selected four highly specific gene fragments of P. aeruginosa (16S rDNA, gyrB, oprL and ETA) and optimized a multiplex PCR for its comprehensive and reliable identification with 100% specificity as no amplification was found in case of negative controls. The specificity of each of the four targeted genes has been reported earlier in different studies separately. The 16S rDNA gene showed 96.5% specificity using real time PCR.24 The gyrB gene coding a type II topoisomerase has also been noted to be a better candidate for the identification of bacterial species.25 The specificity of the oprL gene based PCRs for P. aeruginosa has also been reported as 80%.7

After multiplex PCR, amplicons were confirmed by restriction analysis which provided the relevant fragments of exact sizes and the nucleotide sequencing of the four targeted gene fragments showed more than 97% identity with P. aeruginosa strain PAO1. Main benefit of this developed multiplex PCR is the detection of gyrB, ETA, oprL and 16S rDNA genes simultaneously that, in presence of internal control, eliminates the chances of false positive results which are due to phenotypic and monogenic resemblance of P. aeruginosa with closely related species.

CONCLUSIONS

We conclude that the unique combination of these four genes in multiplex PCR provides more confident and reliable detection of P. aeruginosa for

Muhammad Salman et al.

http://www.nebcutter.com

screening of wound infections that can be helpful to the clinicians for effective antimicrobial therapy.

ACKNOWLEDGEMENTS

The research facilities and funds for this work were provided by National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad and Higher Education Commission (HEC), Islamabad, Pakistan.

Conflict of interest: Authors have no conflict of interest.

REFERENCES1. Bryan CS, Dew CE, Reynolds KL. Bacteremia

associated with decubitus ulcers. Arch Intern Med. 1983;143(11):2093-2095.

2. Bennett G, Dealey C, Posnett J. The cost of pressure ulcers in the UK. Age Ageing. 2004;33(3):230-235.

3. James GA, Swogger E, Wolcott R, Pulcini E, Secor P, Sestrich J, et al. Biofilms in chronic wounds. Wound Repair Regen. 2008;16:37-44.

4. Lau GW, Hassett DJ, Britigan BE. Modulation of lung epithelial functions by Pseudomonas aeruginosa. Trends Microbiol. 2005;13:389-397.

5. Qin X, Emerson J, Stapp J, Stapp L, Abe P, Burns JL. Use of real-time PCR with multiple targets to identify Pseudomonas aeruginosa and other nonfermenting gram-negative bacilli from patients with cystic fibrosis. J Clin Microbiol. 2003;41:4312-4317.

6. Procop GW. Molecular diagnostics for the detection and characterization of microbial pathogens. Clin Infect Dis. 2007;1:99-111.

7. de Vos D, Lim A, Jr., Pirnay JP, Struelens M, Vandenvelde C, Duinslaeger L, et al. detection and identification of Pseudomonas aeruginosa in clinical samples such as skin biopsy specimens and expectorations by multiplex PCR based on two outer membrane lipoprotein genes, oprI and oprL. J Clin Microbiol. 1997;35:1295-1299.

8. Lavenir R, Jocktane D, Laurent F, Nazaret S, Cournoyer B. Improved reliability of Pseudomonas aeruginosa PCR detection by the use of the species-specific ecfX gene target. J Microbiol Methods. 2007;70:20-29.

9. Motoshima M, Yanagihara K, Fukushima K, Matsuda J, Sugahara K, Hirakata Y, et al. Rapid and accurate detection of Pseudomonas aeruginosa by real-time polymerase chain reaction with melting curve analysis targeting gyrB gene. Diagn Microbiol Infect Dis. 2007;58:53-58.

10. McCulloch E, Lucas C, Ramage G, Williams C. Improved early diagnosis of Pseudomonas aeruginosa by real-time PCR to prevent chronic colonisation in a paediatric cystic fibrosis population. J Cyst Fibros. 2011;10:21-24.

11. Vosahlikova S, Drevinek P, Cinek O, Pohunek P, Maixnerova M, Urbaskova P, et al. High genotypic diversity of Pseudomonas aeruginosa strains isolated from patients with cystic fibrosis in the Czech Republic. Res Microbiol. 2007;158:324-329.

12. Bradbury RS, Roddam LF, Merritt A, Reid DW, Champion AC. Virulence gene distribution in clinical, nosocomial and environmental isolates of Pseudomonas aeruginosa. J Med Microbiol. 2010;59:881-890.

13. Xu W, Zhai Z, Huang K, Zhang N, Yuan Y, Shang Y, et al. A novel universal primer-multiplex-PCR method with sequencing gel electrophoresis analysis. PLoS One. 2012;7:17.

14. Spilker T, Coenye T, Vandamme P, LiPuma JJ. PCR-Based Assay for Differentiation of Pseudomonas aeruginosa from Other Pseudomonas Species Recovered from Cystic Fibrosis Patients. J Clin Microbiol. 2004;42:2074-2079.

15. Haque A, Ahmed N, Peerzada A, Raza A, Bashir S, Abbas G. Utility of PCR in diagnosis of problematic cases of typhoid. Jpn J Infect Dis. 2001;54:237-239.

16. Khan AA, Cerniglia CE. Detection of Pseudomonas aeruginosa from clinical and environmental samples by amplification of the exotoxin A gene using PCR. Appl Environ Microbiol. 1994;60:3739-3745.

17. Rahn K, De Grandis SA, Clarke RC, McEwen SA, Galan JE, Ginocchio C, et al. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes. 1992;6:271-279.

18. Doring G, Pier GB. Vaccines and immunotherapy against Pseudomonas aeruginosa. Vaccine. 2008;26:1011-1024.

19. Warren AE, Boulianne-Larsen CM, Chandler CB, Chiotti K, Kroll E, Miller SR, et al. Genotypic and phenotypic variation in Pseudomonas aeruginosa reveals signatures of secondary infection and mutator activity in certain cystic fibrosis patients with chronic lung infections. Infect Immun. 2011;79(12):4802-4818.

20. Nikbin V, Aslani M, Sharafi Z, Hashemipour M, Shahcheraghi F, Ebrahimipour G. Molecular identification and detection of virulence genes among Pseudomonas aeruginosa isolated from different infectious origins. Iran J Microbiol. 2012;4:118-123.

21. da Silva Filho LV, Tateno AF, Velloso Lde F, Levi JE, Fernandes S, Bento CN, et al. Identification of Pseudomonas aeruginosa, Burkholderia cepacia complex, and Stenotrophomonas maltophilia in respiratory samples from cystic fibrosis patients using multiplex PCR. Pediatr Pulmonol. 2004;37:537-547.

22. da Silva Filho LV, Levi JE, Oda Bento CN, da Silva Ramos SR, Rozov T. PCR identification of Pseudomonas aeruginosa and direct detection in clinical samples from cystic fibrosis patients. J Med Microbiol. 1999;48:357-361.

23. Hoiby N, Frederiksen B, Pressler T. Eradication of early Pseudomonas aeruginosa infection. J Cyst Fibros. 2005;4(Suppl 2):49-54.

24. Deschaght P, Schelstraete P, Lopes dos Santos Santiago G, Van Simaey L, Haerynck F, Van Daele S, et al. Comparison of culture and qPCR for the detection of Pseudomonas aeruginosa in not chronically infected cystic fibrosis patients. BMC Microbiol. 2010;10:245.

25. Anuj SN, Whiley DM, Kidd TJ, Bell SC, Wainwright CE, Nissen MD, et al. Identification of Pseudomonas aeruginosa by a duplex real-time polymerase chain reaction assay targeting the ecfX and the gyrB genes. Diagn Microbiol Infect Dis. 2009;63:127-131.

Authors contribution:

MS: Main lab work and preparing draft of paper. AA: Practical guidance in molecular and microbiology work. AH: Concept and finalization of manuscript.


P. aeruginosa Multiplex PCR

preparation of polysaccharide-protein conjugates of vi...

Documents