Preliminary Assessment of Species Composition and Variation in Fig-Fig

Wasp Species in Yakushima Island, Japan and Their Corresponding

Phylogenetic Relationships

Lee C.1, Evan S.H. Quah2, Nur Juliani S.2, Kunal Deepak Arekar3, Kuroki

Y. 4, Nakamura I. 4, Kawakita A. 5, Yui F. 6, Fumihiko O.6, Gao Jie4, Oto Y.7

1Department of Botany, Graduate School of Science, Kyoto University - Japan

2School of Biological Sciences, Universiti Sains Malaysia, Penang, Malaysia

3Indian Institute of Science, Bangalore

4Primate Research Institute, Kyoto University, Japan

5Wildlife Research Institute, Kyoto University, Japan

6Japan Monkey Centre, Inuyama, Japan

7Department of Zoology, Division of Biological Science, Graduate School of Science, Kyoto

University, Japan

ABSTRACT

We investigated the relationship between figs and fig wasps. In the field, we collected 485

syconia, from which 169 insect samples were collected. The data showed that as the size of

syconium increased, the hardness decreased; on the other hand, as the stage increased, the

size also increased. In the following laboratory work, we produced phylogenic trees for both

fig species and fig wasp species, which showed that the coevolution relationship was not

distinct from the DNA analysis.

1.0 INTRODUCTION

The intimate relationship fig trees and their symbiotic pollinator wasps are one of the

best examples for coevolution the natural world. In total there are approximately 830 species

of figs (genus Ficus) known and most are distributed throughout tropical regions of the world.

All species possess one or more pollinator wasps of the family Agaonidae that enter their

syconia, which is the hollow, fleshy, flower bearing structures of the plant through a small

opening called an ostiole at its base to pollinate the female flowers inside. Although

pollinator wasps are often host specific, there are exceptions. Occasionally one pollinator

wasp species can have more than one host fig (Cook & Rasplus, 2003). Depending on the fig

species, pollen is transferred to the female flowers, either passively or purposively. In the

latter case, the female wasp have specialised pollen baskets known as corbiculae on the

underside of her thorax that she uses to carry pollen to be transferred to the stigma. Thus, the

fig depends on the pollinator wasps to transfer the pollen from one syconium to another in

order to pollinate the female flowers inside which would then develop into seeds. The tiny

insects in turn depend on the figs because their larvae can only develop inside the syconia.

The inner wall of each syconium is lined with tiny, apetalous, pollen-bearing male flowers

and two different types of female flowers. One type is the long-styled, seed-bearing female

flowers while the other is the short-styled female flowers. Fig wasps only develop from eggs

laid inside the ovaries of the short-style female flowers. The different structure of the female

flowers is the basis of two different reproductive mechanisms adopted by the figs.

In the first type of reproduction which is referred to as monoecious figs, male flowers

and both the long and short-styled female flowers occur in the same bisexual syconium.

About half of the world’s fig species belong to this group. The second group are known as

dioecious figs and in these species, the seed-producing, long-styled female flowers only occur

in unisexual syconia on female trees, while pollen-bearing male flowers and wasp-bearing,

short-styled female flowers occur in the same syconia on male trees. Female wasps cannot

successfully lay their eggs in the ovaries of long-styled flowers because the wasp's ovipositor

cannot reach the ovary; therefore, the ovary develops into a seed rather than a wasp if it is

pollinated. This remarkable dimorphism in the female flowers, termed heterostyly is how the

fig tree produces seeds on female trees while still maintaining its vital, "in-house" population

of symbiotic wasps on male trees.

Studies on monoecious species have revealed that most of their ovules are within the

wasp's reach based on measurements of their styles and the pollinator’s ovipositors (Herre et

al., 2008). These findings indicate that other mechanisms are involved in the determination of

seed-bearing and wasp-bearing ovaries of monoecious figs. Matters are very different in

dioecious species of figs, where there are vicarious selection pressures on the morphology of

the plants and wasps (style and ovipositor length) as well as the behaviour of the wasp

(purposive loading and unloading of pollen) as they enter and leave male syconia containing

short-style female flowers on male trees. This selection is crucial for the perpetuation of fig

trees as the plant requires the wasps to enter female syconia on female trees which

superficially resemble male syconia in order for the tree to bear seed. However this comes at

a price for the insect as the female syconia becomes a genetic graveyard for wasps as they

cannot oviposit in the long-style female flowers. The female wasps die in these syconia.

Although it is often assumed that each species of fig has a specific pollinating wasp

species, there are exceptions to the rule. Some fig species have two or more species of

symbiotic wasp pollinators (Molbo et al., 2003). For example, in the African fig species

Ficus natalensis, three or more species of pollinator agaonid wasps have been found in their

syconia (Compton et al., 2009). The different species of fig wasp species coexisting within a

syconium may be closely related sister taxa, or may be quite different from each other. This

indicates both long-term coexistence on shared hosts and relatively recent colonization of the

fig species. In addition, the syconium may contain one or more non-pollinating wasps from

different wasp families. These wasps do not pollinate the female flowers inside but instead

may even be detrimental, especially when they compete with and/or parasitize the beneficial

pollinator wasps or parasitize of the plants ovules.

This competition with non-pollinator wasp species within the syconia of monoecious

figs is believed to have driven the evolution of the dioecious breeding system. Monoecious

figs are considered to be the ancestral breeding system, dating back at least to late Cretaceous

and dioecious figs may have evolved from monoecious ancestral fig species due to selection

pressure by non-pollinating fig wasps (Kerdelhue & Rasplus, 1996). Although these non-

pollinator wasps belong to the same order Chalcidoidea as pollinators, many of them belong

to different families. The non-pollinator, parasitic wasps never occur in the long-style flowers

of syconia on female trees, and non-pollinator wasps are uncommon in the syconia of male

trees of dioecious figs. Thus, seed production in the syconia on female trees and pollinator

wasp production in syconia on male trees are not diminished, as compared to the syconia of

monoecious figs that contain harmful non-pollinator wasps (Kerdelhue and Rasplus 1996).

As a result, having separate male and female syconia may be an adaptive advantage with

regards to pollination and seed production. However, it is evident that the fig/fig wasp

scenario is far more complicated than originally described.

2.0 MATERIALS AND METHODS

2.1 Study area

Yakushima Island, which belongs to Kagoshima Prefecture, Japan, is distant from

Kyushu main island from 135km in a south direction. Its shape is round and 132km around.

The highest peak in the island is Mt. Miyanoura and it is 1,936m high. Because the

mountains are high, climate is very variable (from subtropical to subalpine climate) along the

altitude (Kagoshima Pref.). In addition, amount of the annual precipitation ranges 2,400-

7,400mm (Takahara & Matsumoto, 2002). As for flora and fauna, the island is located near

two distribution borders, Watase and Miyake line, so it is thought to be in transitional zone.

Watase line is a border of fauna between the Old World and Oriental region (Kuroda, 1931;

Kayashima, 1955), and Miyake line divides the distribution of insect, spider, and so on (e. g.

Kayasima 1955). These backgrounds make flora and fauna of Yakushima island rich and

specific (Yokoyama et al., 2006). It was registered as a World Natural Heritage Site in 1993

and the island is ideal for biological study.

2.2 Fieldwork and sample collection

Fieldwork was conducted from 21st- 27th May 2016 for three consecutive days. All

syconia were collected from five Ficus spp.; Ficus pumila, Ficus superba, Ficus microcarpa,

Ficus erecta, and Ficus sarmentosa from ten sampling sites which located at Isso, Yoshida

and Nagata (Figure 1). We recorded all the details including the date, time, GPS coordinates

and species name for each sample (Table 1).

We measured the diameter of each syconia using digital caliper, determine their

percentage of light green color (0%-100%) and the stage of hardness (soft, intermediate and

hard). Then, the syconia were cut, observed under the microscope and the stage of maturity

and sex of syconia (male or female plant) were also determined. All the larvae, pupa and fig

wasp inside the syconia were collected into small tubes and preserved in 100% ethanol.

Besides that, the leave samples were also collected using tea bags and plastic with silica gel.

All the specimens were brought back to laboratory in Inuyama for the next plant-insect DNA

sequencing.

Fig. 1: Site locations in Yakushima Island (Yellow: sampling sites in Yoshida, blue:

sampling sites in Isso, green: sampling sites in Nagata)

Table 1: Site locations and species collected during the sampling.

No. Site Location Species

1. Yoshida 30º26’05.56”N, 130º27’51.94”E Ficus pumila (Oitabi)

30º26’05.56”N, 130º29’51.94”E

2. Isso 30º27’11.54”N, 130º28’21.54”E Ficus superba (Ako)

30º27’05.95”N, 130º29’01.65”E

30º26’23.59”N, 130º28’19.04”E

30º27’11.46”N, 130º28’21.52”E

30º27’06.47”N, 130º29’15.05”E Ficus microcarpa (Gajumaru)

30º27’05.95”N, 130º29’01.65”E Ficus erecta (Inubiwa)

30º26’37.54”N, 130º28’17.22”E Ficus sarmentosa

3. Nagata 30º25’29.15”N, 130º26’49.66”E Ficus erecta (Inubiwa)

2.3 Plant-insect DNA sequencing

A total of 48 insect samples and eight leave samples were obtained for further DNA

sequencing. The procedures for plant-insect DNA sequencing includes; (i) DNA extraction

and purification, (ii) Polymerase chain reaction (PCR) process, (iii) DNA sequencing and (iv)

phylogenetic analyses.

(i) DNA extraction and purification (DNA extraction and purification for both

plant and insect samples are different):-

DNA extraction and purification for leaves of figs

1. NucleoSpin Plant II (Takara)

2. Take photos for morphological records

3. Weigh 20 mg of a part of leaves and transfer to a new 2 ml tube

4. Add 4 zirconia/silica beads (0.1 mm in diameter)

5. Add 400 µL Buffer PL1

6. Use a beads crusher for 12 minutes (4,200 rpm)

7. Extract and purify DNA according to protocol and quality check of purified

DNA using Nanodrop

DNA extraction and purification for fig wasp

1. Use QIAamp DNA Micro Kit (QIAGEN)

2. Dry up ethanol

3. Observe using microscope and take photos for morphological records

4. Transfer to a new 2 ml tube

5. Add 4 zirconia/silica beads (0.1 mm in diameter)

6. Add 180 µl Buffer ATL

7. Use beads crusher for 4 minutes (4,200 rpm) and centrifuge at 12,000 rpm to

remove bubbles

8. Extract and purify DNA according to protocol and quality check of purified

DNA using Nanodrop

(ii) PCR process (PCR process for both plant and insect samples are different):-

PCR for leaves of figs

1. Amplify the atpB-rbcL region (a barcode sequence) in the chloroplast

2. Forward primer (C9F): AGAACCAGAAGTAGTAGGAT

3. Reverse primer (C9R): ACACCAGCTTTGAATCCAAC

4. For the Master Mix, the following were mixed in: dH2O, 10X LA PCR buffer

II, dNTP mixture, forward primer (C9F), reverse primer (C9R) and TaKaRa

LA Taq HS.

5. 24 µL Master Mix was dispensed to each PCR tube and 1 µL DNA template

was added.

6. The following were the settings:

PCR for fig wasp

1. Amplify the 28S region (a barcode sequence) in the insect nuclear genome

2. Forward primer (28SF-01): GACTACCCCCTGAATTTAAGCAT

3. Reverse primer (28SR-01): GACTCCTTGGTCCGTGTTTCAAG

4. For the Master Mix, the following were mixed in: dH2O, 10X LA PCR buffer

II, dNTP mixture, forward primer (28SF-01), reverse primer (28SR-01) and

TaKaRa LA Taq HS.

5. 23 µL Master Mix was dispensed to each PCR tube and 2 µL DNA template

was added.

6. The following were the settings:

Temperature (ºC) Time

94 5 min

94 1 min

50 90 sec

72 2 min

72 7 min

4 ∞

Temperature (ºC) Time

94 1 min

95 20 sec

58 10 sec

68 2 min

72 10 min

4 ∞

35 cycles

35 cycles

Purification of PCR products using ISOSPIN PCR Product (for both leaves of

figs and fig wasp)

1. Add 125 µL ISB buffer

2. Inversion mixing, spin down

3. Transfer to spin column

4. Centrifuge at 12,000 g for 1 min (room temp)

5. Discard filtrate

6. Add 750µL ISW buffer

7. Centrifuge at 12,000 g for 1 min (room temp)

8. Discard filtrate

9. Centrifuge at 12,000 g for 1 min (room temp), to dry up the column membrane

10. Transfer the column to a new 1.5 ml tube

11. Add 50 µL ISE buffer

12. Incubation for 3 min (room temp)

13. Centrifuge at 12,000 g for 1 min (room temp)

14. Purified PCR products.

(iii) DNA sequencing reaction using BigDye Terminator v3.1 Cycle Sequencing

Kit (Dye terminator / Sanger method)

1. For the Master Mix, the following were mixed in: BigDye ready reaction mix,

5X Sequencing buffer, primer (forward and reverse primer) and dH2O.

2. 8 µL Master Mix was dispensed to each tube and 2 µL DNA template was

added.

3. The following were the settings:

Temperature (ºC) Time

96 1 min

96 10 sec

50 5 sec

60 4 min

15 ∞

30 cycles

Purification of sequencing reaction products by magnetic beads (Agencourt

CleanSEQ)

1. Add 10 µL CleanSEQ and 42 µL ethanol

2. Pipette mix until the solution is homogenous

3. Place the sample onto a magnetic plate until the solution is clear

4. Aspirate the cleared solution (supernatant) from the plate and discard

5. Dispense 100 µL 85% ethanol

6. Completely remove the ethanol and discard

7. Repeat the ethanol wash process

8. Remove samples from the magnetic plate

9. Let the samples dry for 10 mins (room temp)

10. Add 40 µL sterile dH2O

11. Pipette mix until the solution is homogenous

12. Place the sample onto a magnetic plate until the solution is clear

13. Transfer 35 µL solution to a new 8-tube and spin down

14. Transfer 20 µL solution to a 96-well plate and ready to sequence

(iv) Phylogenetic analyses

The analysis was done using Geospiza FinchTV, MEGA7, and NCBI BLAST.

3.0 RESULTS

3.1 The Relationship between Different Species of Ficus with Size, Level of Hardness,

Stage of Maturity and Percentage of Green Colour of Syconia

In total we sampled 10 sites in Yakushima and collected 485 syconia belonging to the

five Ficus species mentioned before. From these syconia, we found insects in 169 syconia.

Figure 2 shows the boxplot of the variation in size of syconia in these five Ficus species. It

was prepared in R software (Ver. 3.2.3). The figure shows that syconia of Ficus pumila are

the biggest in size, whereas the syconia of F. microcarpa are the smallest. Similarly, boxplots

were constructed to check if there is any relationship between size and hardness and between

size and stage of maturity (Fig. 3 and Fig. 4, respectively). In Figure 3 we can see that as the

size increases, the syconium becomes softer. F. microcarpa (p=9.481e-6), F. superba

(p<2.2e-16) and F. erecta (p=6.88e-7) shows this trend. Figure 4 shows the relationship

between the size and stage of maturity. From this graph, we can say that as the syconia

becomes mature, it is bigger in size.

Fig. 2: Size variation in syconia of different species of figs

Fig. 3: This plot shows the relationship between hardness and size (mm) of syconia for

different species of figs.

Dia

met

er (m

m)

Hardness of syconia

Dia

met

er (m

m)

Fig. 4: Relationship between different stages of syconia and its size (mm)

We also measured the colour of the syconia. As described before, it was standardised

using a majority consensus rule. In our sampling, most of the syconia we collected had higher

percentage green colour (Fig. 5); it means that most of the syconia we had sampled were

young and immature. Our analysis shows that there is no relation between colour and size of

the syconia (Fig. 6). F. sarmentosa was not included in this analysis as all the syconia had

single colour.

F.pumila F.microcarpa F.sarmentosa F.superba F.erecta

Dia

met

er (m

m)

Stage of maturity

Fig. 5: Relative percentage of colour green on the syconia. It was standardised by majority

consensus rule in the laboratory.

0

20

40

60

80

100

120

140

160

pumila microcarpa sarmentosa superba erecta

81-100

61-80

41-60

21-40

0-20

F.pumila F.microcarpa F.sarmentosa F.erecta F.erecta

Fig species

Num

ber o

f syc

onia

Fig. 6: Correlation between colour of the syconia and its size (mm)

3.2 Phylogenetic Relationship of Different Species of Ficus and fig wasps

The samples collected during Yakushima field course were stored in absolute alcohol

(insects) and silica gel (plants) for molecular work. We performed DNA extraction, PCR

amplification and sequencing for this samples. The result of PCR for figs is shown here (Fig.

7). All the samples worked properly with distinct dark bands as seen in the figure.

In the phylogenetic tree for fig species (Fig. 8), we can see F. microcarpa, F. superba

and F. erecta forming distinct clades along with other conspecific sequences downloaded

from Genbank. But the sequences of F. pumila and F. sarmentosa are not resolved properly.

This might be a species complex; a more rigorous molecular and taxonomic work is required

to resolve this complex. Here we cannot explain the branching of one sample of F. erecta

with F. pumila and F. sarmentosa clade.

Fig. 7: Gel electrophoresis results showing the bands from the Ficus samples. The first and the last column are DNA ladder.

Fig. 8: Neighbour-Joining (NJ) tree for Ficus species constructed using atpB-rbcL

chloroplast gene.

Phylogenetic reconstruction of fig wasps shows that F. pumila and F. erecta have a

specific fig wasp species as pollinator; Wiebesia pumilae and Blastophaga nipponica,

respectively. These species of figs are dioecious. Whereas, the monoecious fig species like F.

microcarpa and F. superba have multiple wasps species associated with them (Fig. 9).

F1 F sarmentosa

F2 F sarmentosa

F4 F sarmentosa

F6 Ficus spp

F8 F pumila

AB445603.1 F pumila

AB445605.1 F sarmentosa thunbergii

AB445606.1 F sarmentosa nipponica

AB445609.1 F erecta

AB445602.1 F variegata

F5 F erecta

AB445607.1 F erecta

F7 F microcarpa

AB445595.1 F microcarpa

F3 F superba

AB445593.1 F superba japonica

AB445594.1 F caulocarpa87

78

30

50

45

42

0.0005

Fig. 9: NJ tree for the fig wasp (pollinator and non-pollinator) species constructed using

28S rRNA nuclear gene

The pollinator fig wasps from F. erecta form a monophyletic clade, but the

relationship between the fig wasps from the other species of Ficus is not well resolved,

especially at the lower levels. We can also see that non-pollinators from F. erecta i.e.

Sycoscapter sp., forms a sister clade with the fig wasps from F. microcarpa. This shows that

the pollinator and non-pollinator wasps from the same fig species need not be evolutionarily

sister to each other. The fig wasp from F. microcarpa (Wiebesia sp.) could potentially be a

new species distinct from Wiebesia pumilae associated with F.pumila. As we have seen in

Fig. 8 that F.pumila and F.sarmentosa can be a complex of multiple species, therefore, the

resolution for fig wasps from these two species of figs is not clear (Fig. 9).

Our results do not show any signals of co-evolution among the figs and fig wasps at

Yakushima Island. This could be an artifact of less number of samples or another possibility

is short length of the DNA marker or both. However, it could also mean that the fig and fig

wasps in Yakushima Island are not co-evolving. But, to determine this we need more number

of samples and more number of markers. We were able to collect only a few samples during

the time we had. If more time is invested, it is possible to collect more number of samples to

address this issue.

4.0 DISCUSSION

4.1 Interpretation of the Sampling Data

Theoretically, there can be correlation between mature syconium size and failure rate

of producing pollinators/seeds. It is better for high failure rate species to produce many small

synocia for risk hedge. (Syconium size can be influenced by other factors, such as difference

of seed dispersers.)

Only male syconia are available for fig wasp parasitoids in dioecious species

population, and all syconia are available in monoecious figs, which imply monoecious

species can be more attractive for parasitoids. Although we observed more parasitoids and

smaller mature syconia in monoecious Ficus superba, it is in discord with the fact there were

not so much parasitoids found in monoecious Ficus microcarpa, but Wang (2014) shows that

F. microcarpa has at least 8 non-pollinator wasp species in Japan. Despite it is not congruent

in our data, it possibly explains why F. superba and F. microcarpa produce many small

syconia.

Some small syconia had mature color and hardness, and it is possibly related to

infection. Basically, only for seed dispersal, syconia have to change its color from green to

red/dark violet in order to be eaten by seed dispersers. No benefit in making male syconia red.

Losing syconia already spoiled by non-pollinator insects or fungus may kill enemies in the

syconia, but mature spoiled syconia may come from the lack of ability to notice its failure. If

trees can notice, they may stop syconia growth and spur syconia maturity so as to make

spoiled syconia eaten by animals. It can be better than make spoiled syconia just fall down,

because large fruit-eaters can take infected ones far away.

We could not find female syconia of Ficus erecta and Ficus sarmentosa, both are

dioecious species. In Japan, female trees of Ficus erecta tend not to bear syconia in Jan-May

but male tree constantly bears, despite not constantly releasing fig wasps (Takeuchi, 2011). It

may be explained by seed disperser habits, but according to Suleman et al. (2011), such a

mechanism can spur more fig wasps to enter female syconia. There are many reasons we

cannot say it is common strategy for dioecious figs, one of those is the fact we recorded both

male and female syconia of Ficus pumila, which is also dioecious.

4.2 Phylogenetic Reconstructions of Fig and Fig-wasp Species

Our analysis of the DNA sequences from figs species of Yakushima Island revealed a

somewhat unclear phylogeny of these plants. Though F. microcarpa and F. superba form

distinct clades (but with low bootstrap support), the relationship within the F. pumila and

F.sarmentosa was not resolved (Fig. 8). This result could possibly be because of low

variation in the sequences of F. pumila and F.sarmentosa; this possibly suggests that this

particular clade might be a species complex with misidentification issues. The branching of a

single sequence of F. erecta with the F. pumila clade cannot be explained at this point in time

because of less number of samples and less sequence data.

The phylogenetic tree of fig wasps shows four major clades with wasps from F.

erecta forming a distinct monophyletic clade with a good bootstrap support (98%). Though,

Wiebesia pumilae forms a monophyletic clade, the wasps in this clade come from two

different species of figs, F. pumila and F. sarmentosa. This result gives support to our

assumption that the F. pumila and F. erecta could possibly be a species complex. The

monoecious fig species, F. superba and F. microcarpa, have multiple species of wasps

associated with them; with none of the species forming a well-defined clade.

The undefined species Wiebesia sp. from F. microcarpa, could potentially be a new

species distinct from W. pumilae. We can also see that non-pollinators from F. erecta i.e.

Sycoscapter sp., forms a sister clade with the fig wasps from F. microcarpa. This shows that

the pollinator and non-pollinator wasps from the same fig species need not be evolutionarily

sister to each other.

Our results do not show any signals of co-evolution among the figs and fig wasps at

Yakushima Island. This could be an artefact of less number of samples or another possibility

is short length of the DNA marker or both. However, it could also mean that the fig and fig

wasps in Yakushima Island are not co-evolving. But, to determine this we need more number

of samples and more number of markers. We were able to collect only a few samples during

the time we had. If more time is invested, it is possible to collect more number of samples to

address this issue.

In this study, we used single genetic markers for reconstruction of both, the figs and

fig wasp phylogenies. The uncertainties associated with the phylogenetic trees can be

attributed to less information in the sequence data. Use of multiple markers, to increase

character length, with advance algorithms to build phylogenies might shade some more light

on the relationship of figs and fig wasp species on Yakushima Island.

4.3 Technical Problems

In this course there might have been certain errors during lab work, although we did

our best to be as meticulous as possible. Some of the amplified and sequenced samples

appeared to have been contaminated. Sequenced data was ambiguous and matched several

different species in at least one set of samples. Another issue faced was the unspecific

amplification of gene regions probably due to the unsuitability of the primers for that sample

that were imprecise and it was shown in the results of electrophoresis that had multiple bands.

In general, it can be summarized that the bulk of the mistakes that occurred during the period

of this course was due to the lack of experience in molecular techniques by the bulk of the

participants and short of time we had to achieve our research goals. An example would be the

pipetting errors that could have happened during the transfer of solutions in many of the

extraction, PCR and purification protocols for a large number of samples, up to 96 samples

that was done by multiple people from the group. In this same process, DNA from different

samples might have been mixed which lead to the contamination. Another problem that was

faced was related to marking of samples while being handled and processed. The same set of

samples was handled by three different groups and was not labelled in the same way which

leads to confusion and mix up of the samples. The samples were transferred multiple times,

and some labels were incorrect in the end. There was also a mix up with the images of

samples that were recorded prior to extraction and sequencing. All these issues can be

improved upon in future works with more careful handling of the samples and better record

keeping.

5.0 CONCLUSION

In conclusion, we found that the relationship between different species of ficus with size,

hardness, and stage of syconia. Our analysis shows, however, there is no relation between

colour and size of the syconia. By using DNS analysis, some fig wasps species could be

identified and phylogenetic trees for figs and fig wasps were produced. Given that our

technical problems, further research may reveal how figs and fig wasps relate mutually.

ACKNOWLEDGEMENTS

We would like to thank Prof. Takakazu Yumoto, Prof. Munehiro Okamoto, Prof. Takashi

Hayakawa, and Prof. Goro Hanya for their great help, support and guidance during the field

trip and genome course. We would also like to thank Liesbeth Frias and Shintaro Ishizuka for

their assistance during genome course in Inuyama. Special thanks to Prof. Shiro Kohshima

for inviting us to participate in this brilliant training and thanks to all participants that made

this program thoroughly enjoyable.

REFERENCES

Compton, S.G., Grehan, K., and S. van Noort. (2009). A Fig Crop Pollinated by Three or

More Species of Agaonid Fig Wasps. African Entomology, 17 (2): 215-222.

Cook, J.M., and J.-Y. Rasplus. (2003). Mutualists With Attitude: Coevolving Fig Wasps and

Evolution. Trends in Ecology and Evolution, 18 (5): 241-248.

Herre, E.A., Jandér, K.C., and C.A. Machado. (2008). Evolutionary Ecology of Figs and

Their Associates: Recent Progree and Outstanding Puzzles. Annual Review of

Ecology, Evolution, and Systematics, 39: 439-458.

Kayashima, I. (1955). On the Watase’s line viewed from the distribution of Spiders. Acta

Arachnol, 14: 25-28.

Kerdelhue, C. and J.-Y. Rasplus. (1996). The Evolution of Dioecy Among Ficus (Moraceae):

An Alternative Hypothesis Involving Non-Pollinating Fig Wasp Pressure on the Fig-

Pollinator Mutualism. Oikos, 77: 163-166.

Kuroda, N. (1931). Consideration of Watase line, focusing on Vertebrate distribution.

Zoological Science, 43: 172-175.

Molbo, D., Machado, C. A., Sevenster, J.G., Keller, L., and E.A. Herre. (2003). Cryptic

Species of Fig Pollinating Wasps: Implications for the Evolution of the Fig-Wasp

Mutualism, Sex Allocation, and the Precision of Adaptation. Proceedings of the

National Academy of Sciences, 100: 5867-5872.

Suleman, N., Raja,S., Zhang, Y., Compton, S.G. (2011). Sexual differences in the

attractiveness of figs to pollinators: females stay attractive for longer. Ecological

Entomology, 36, 417-424.

Takahara, H., Matsumoto, A. (2002). Climatological study of precipitation distribution in

Yaku-shima Island, Southern Japan. J Geogr, 111: 726-746.

Takeuchi, H. (2011). Phenology of the fig Ficus erecta and life cycle of its mutualist, the fig

wasp Blastophaga nipponica. Master thesis, Mie University, Tsu, Japan.

Wang, R. (2014). The fig wasps associated with Ficus microcarpa, an invasive fig tree. PhD

thesis, University of Leeds, Leeds, U.K.

Yokoyama, Y., Yamaguchi, T., Akiyama, H., Furuki, T., Tanaka, A., Shimamura, M.,

Deguchi, H. (2006), Ecological study of Bryophytes in Yakushima island. Bryol Res 9:

124.