preliminary assessment of species composition …...2016/05/21 · and two different types of...
TRANSCRIPT
Preliminary Assessment of Species Composition and Variation in Fig-Fig
Wasp Species in Yakushima Island, Japan and Their Corresponding
Phylogenetic Relationships
Lee C.1, Evan S.H. Quah2, Nur Juliani S.2, Kunal Deepak Arekar3, Kuroki
Y. 4, Nakamura I. 4, Kawakita A. 5, Yui F. 6, Fumihiko O.6, Gao Jie4, Oto Y.7
1Department of Botany, Graduate School of Science, Kyoto University - Japan
2School of Biological Sciences, Universiti Sains Malaysia, Penang, Malaysia
3Indian Institute of Science, Bangalore
4Primate Research Institute, Kyoto University, Japan
5Wildlife Research Institute, Kyoto University, Japan
6Japan Monkey Centre, Inuyama, Japan
7Department of Zoology, Division of Biological Science, Graduate School of Science, Kyoto
University, Japan
ABSTRACT
We investigated the relationship between figs and fig wasps. In the field, we collected 485
syconia, from which 169 insect samples were collected. The data showed that as the size of
syconium increased, the hardness decreased; on the other hand, as the stage increased, the
size also increased. In the following laboratory work, we produced phylogenic trees for both
fig species and fig wasp species, which showed that the coevolution relationship was not
distinct from the DNA analysis.
1.0 INTRODUCTION
The intimate relationship fig trees and their symbiotic pollinator wasps are one of the
best examples for coevolution the natural world. In total there are approximately 830 species
of figs (genus Ficus) known and most are distributed throughout tropical regions of the world.
All species possess one or more pollinator wasps of the family Agaonidae that enter their
syconia, which is the hollow, fleshy, flower bearing structures of the plant through a small
opening called an ostiole at its base to pollinate the female flowers inside. Although
pollinator wasps are often host specific, there are exceptions. Occasionally one pollinator
wasp species can have more than one host fig (Cook & Rasplus, 2003). Depending on the fig
species, pollen is transferred to the female flowers, either passively or purposively. In the
latter case, the female wasp have specialised pollen baskets known as corbiculae on the
underside of her thorax that she uses to carry pollen to be transferred to the stigma. Thus, the
fig depends on the pollinator wasps to transfer the pollen from one syconium to another in
order to pollinate the female flowers inside which would then develop into seeds. The tiny
insects in turn depend on the figs because their larvae can only develop inside the syconia.
The inner wall of each syconium is lined with tiny, apetalous, pollen-bearing male flowers
and two different types of female flowers. One type is the long-styled, seed-bearing female
flowers while the other is the short-styled female flowers. Fig wasps only develop from eggs
laid inside the ovaries of the short-style female flowers. The different structure of the female
flowers is the basis of two different reproductive mechanisms adopted by the figs.
In the first type of reproduction which is referred to as monoecious figs, male flowers
and both the long and short-styled female flowers occur in the same bisexual syconium.
About half of the world’s fig species belong to this group. The second group are known as
dioecious figs and in these species, the seed-producing, long-styled female flowers only occur
in unisexual syconia on female trees, while pollen-bearing male flowers and wasp-bearing,
short-styled female flowers occur in the same syconia on male trees. Female wasps cannot
successfully lay their eggs in the ovaries of long-styled flowers because the wasp's ovipositor
cannot reach the ovary; therefore, the ovary develops into a seed rather than a wasp if it is
pollinated. This remarkable dimorphism in the female flowers, termed heterostyly is how the
fig tree produces seeds on female trees while still maintaining its vital, "in-house" population
of symbiotic wasps on male trees.
Studies on monoecious species have revealed that most of their ovules are within the
wasp's reach based on measurements of their styles and the pollinator’s ovipositors (Herre et
al., 2008). These findings indicate that other mechanisms are involved in the determination of
seed-bearing and wasp-bearing ovaries of monoecious figs. Matters are very different in
dioecious species of figs, where there are vicarious selection pressures on the morphology of
the plants and wasps (style and ovipositor length) as well as the behaviour of the wasp
(purposive loading and unloading of pollen) as they enter and leave male syconia containing
short-style female flowers on male trees. This selection is crucial for the perpetuation of fig
trees as the plant requires the wasps to enter female syconia on female trees which
superficially resemble male syconia in order for the tree to bear seed. However this comes at
a price for the insect as the female syconia becomes a genetic graveyard for wasps as they
cannot oviposit in the long-style female flowers. The female wasps die in these syconia.
Although it is often assumed that each species of fig has a specific pollinating wasp
species, there are exceptions to the rule. Some fig species have two or more species of
symbiotic wasp pollinators (Molbo et al., 2003). For example, in the African fig species
Ficus natalensis, three or more species of pollinator agaonid wasps have been found in their
syconia (Compton et al., 2009). The different species of fig wasp species coexisting within a
syconium may be closely related sister taxa, or may be quite different from each other. This
indicates both long-term coexistence on shared hosts and relatively recent colonization of the
fig species. In addition, the syconium may contain one or more non-pollinating wasps from
different wasp families. These wasps do not pollinate the female flowers inside but instead
may even be detrimental, especially when they compete with and/or parasitize the beneficial
pollinator wasps or parasitize of the plants ovules.
This competition with non-pollinator wasp species within the syconia of monoecious
figs is believed to have driven the evolution of the dioecious breeding system. Monoecious
figs are considered to be the ancestral breeding system, dating back at least to late Cretaceous
and dioecious figs may have evolved from monoecious ancestral fig species due to selection
pressure by non-pollinating fig wasps (Kerdelhue & Rasplus, 1996). Although these non-
pollinator wasps belong to the same order Chalcidoidea as pollinators, many of them belong
to different families. The non-pollinator, parasitic wasps never occur in the long-style flowers
of syconia on female trees, and non-pollinator wasps are uncommon in the syconia of male
trees of dioecious figs. Thus, seed production in the syconia on female trees and pollinator
wasp production in syconia on male trees are not diminished, as compared to the syconia of
monoecious figs that contain harmful non-pollinator wasps (Kerdelhue and Rasplus 1996).
As a result, having separate male and female syconia may be an adaptive advantage with
regards to pollination and seed production. However, it is evident that the fig/fig wasp
scenario is far more complicated than originally described.
2.0 MATERIALS AND METHODS
2.1 Study area
Yakushima Island, which belongs to Kagoshima Prefecture, Japan, is distant from
Kyushu main island from 135km in a south direction. Its shape is round and 132km around.
The highest peak in the island is Mt. Miyanoura and it is 1,936m high. Because the
mountains are high, climate is very variable (from subtropical to subalpine climate) along the
altitude (Kagoshima Pref.). In addition, amount of the annual precipitation ranges 2,400-
7,400mm (Takahara & Matsumoto, 2002). As for flora and fauna, the island is located near
two distribution borders, Watase and Miyake line, so it is thought to be in transitional zone.
Watase line is a border of fauna between the Old World and Oriental region (Kuroda, 1931;
Kayashima, 1955), and Miyake line divides the distribution of insect, spider, and so on (e. g.
Kayasima 1955). These backgrounds make flora and fauna of Yakushima island rich and
specific (Yokoyama et al., 2006). It was registered as a World Natural Heritage Site in 1993
and the island is ideal for biological study.
2.2 Fieldwork and sample collection
Fieldwork was conducted from 21st- 27th May 2016 for three consecutive days. All
syconia were collected from five Ficus spp.; Ficus pumila, Ficus superba, Ficus microcarpa,
Ficus erecta, and Ficus sarmentosa from ten sampling sites which located at Isso, Yoshida
and Nagata (Figure 1). We recorded all the details including the date, time, GPS coordinates
and species name for each sample (Table 1).
We measured the diameter of each syconia using digital caliper, determine their
percentage of light green color (0%-100%) and the stage of hardness (soft, intermediate and
hard). Then, the syconia were cut, observed under the microscope and the stage of maturity
and sex of syconia (male or female plant) were also determined. All the larvae, pupa and fig
wasp inside the syconia were collected into small tubes and preserved in 100% ethanol.
Besides that, the leave samples were also collected using tea bags and plastic with silica gel.
All the specimens were brought back to laboratory in Inuyama for the next plant-insect DNA
sequencing.
Fig. 1: Site locations in Yakushima Island (Yellow: sampling sites in Yoshida, blue:
sampling sites in Isso, green: sampling sites in Nagata)
Table 1: Site locations and species collected during the sampling.
No. Site Location Species
1. Yoshida 30º26’05.56”N, 130º27’51.94”E Ficus pumila (Oitabi)
30º26’05.56”N, 130º29’51.94”E
2. Isso 30º27’11.54”N, 130º28’21.54”E Ficus superba (Ako)
30º27’05.95”N, 130º29’01.65”E
30º26’23.59”N, 130º28’19.04”E
30º27’11.46”N, 130º28’21.52”E
30º27’06.47”N, 130º29’15.05”E Ficus microcarpa (Gajumaru)
30º27’05.95”N, 130º29’01.65”E Ficus erecta (Inubiwa)
30º26’37.54”N, 130º28’17.22”E Ficus sarmentosa
3. Nagata 30º25’29.15”N, 130º26’49.66”E Ficus erecta (Inubiwa)
2.3 Plant-insect DNA sequencing
A total of 48 insect samples and eight leave samples were obtained for further DNA
sequencing. The procedures for plant-insect DNA sequencing includes; (i) DNA extraction
and purification, (ii) Polymerase chain reaction (PCR) process, (iii) DNA sequencing and (iv)
phylogenetic analyses.
(i) DNA extraction and purification (DNA extraction and purification for both
plant and insect samples are different):-
DNA extraction and purification for leaves of figs
1. NucleoSpin Plant II (Takara)
2. Take photos for morphological records
3. Weigh 20 mg of a part of leaves and transfer to a new 2 ml tube
4. Add 4 zirconia/silica beads (0.1 mm in diameter)
5. Add 400 µL Buffer PL1
6. Use a beads crusher for 12 minutes (4,200 rpm)
7. Extract and purify DNA according to protocol and quality check of purified
DNA using Nanodrop
DNA extraction and purification for fig wasp
1. Use QIAamp DNA Micro Kit (QIAGEN)
2. Dry up ethanol
3. Observe using microscope and take photos for morphological records
4. Transfer to a new 2 ml tube
5. Add 4 zirconia/silica beads (0.1 mm in diameter)
6. Add 180 µl Buffer ATL
7. Use beads crusher for 4 minutes (4,200 rpm) and centrifuge at 12,000 rpm to
remove bubbles
8. Extract and purify DNA according to protocol and quality check of purified
DNA using Nanodrop
(ii) PCR process (PCR process for both plant and insect samples are different):-
PCR for leaves of figs
1. Amplify the atpB-rbcL region (a barcode sequence) in the chloroplast
2. Forward primer (C9F): AGAACCAGAAGTAGTAGGAT
3. Reverse primer (C9R): ACACCAGCTTTGAATCCAAC
4. For the Master Mix, the following were mixed in: dH2O, 10X LA PCR buffer
II, dNTP mixture, forward primer (C9F), reverse primer (C9R) and TaKaRa
LA Taq HS.
5. 24 µL Master Mix was dispensed to each PCR tube and 1 µL DNA template
was added.
6. The following were the settings:
PCR for fig wasp
1. Amplify the 28S region (a barcode sequence) in the insect nuclear genome
2. Forward primer (28SF-01): GACTACCCCCTGAATTTAAGCAT
3. Reverse primer (28SR-01): GACTCCTTGGTCCGTGTTTCAAG
4. For the Master Mix, the following were mixed in: dH2O, 10X LA PCR buffer
II, dNTP mixture, forward primer (28SF-01), reverse primer (28SR-01) and
TaKaRa LA Taq HS.
5. 23 µL Master Mix was dispensed to each PCR tube and 2 µL DNA template
was added.
6. The following were the settings:
Temperature (ºC) Time
94 5 min
94 1 min
50 90 sec
72 2 min
72 7 min
4 ∞
Temperature (ºC) Time
94 1 min
95 20 sec
58 10 sec
68 2 min
72 10 min
4 ∞
35 cycles
35 cycles
Purification of PCR products using ISOSPIN PCR Product (for both leaves of
figs and fig wasp)
1. Add 125 µL ISB buffer
2. Inversion mixing, spin down
3. Transfer to spin column
4. Centrifuge at 12,000 g for 1 min (room temp)
5. Discard filtrate
6. Add 750µL ISW buffer
7. Centrifuge at 12,000 g for 1 min (room temp)
8. Discard filtrate
9. Centrifuge at 12,000 g for 1 min (room temp), to dry up the column membrane
10. Transfer the column to a new 1.5 ml tube
11. Add 50 µL ISE buffer
12. Incubation for 3 min (room temp)
13. Centrifuge at 12,000 g for 1 min (room temp)
14. Purified PCR products.
(iii) DNA sequencing reaction using BigDye Terminator v3.1 Cycle Sequencing
Kit (Dye terminator / Sanger method)
1. For the Master Mix, the following were mixed in: BigDye ready reaction mix,
5X Sequencing buffer, primer (forward and reverse primer) and dH2O.
2. 8 µL Master Mix was dispensed to each tube and 2 µL DNA template was
added.
3. The following were the settings:
Temperature (ºC) Time
96 1 min
96 10 sec
50 5 sec
60 4 min
15 ∞
30 cycles
Purification of sequencing reaction products by magnetic beads (Agencourt
CleanSEQ)
1. Add 10 µL CleanSEQ and 42 µL ethanol
2. Pipette mix until the solution is homogenous
3. Place the sample onto a magnetic plate until the solution is clear
4. Aspirate the cleared solution (supernatant) from the plate and discard
5. Dispense 100 µL 85% ethanol
6. Completely remove the ethanol and discard
7. Repeat the ethanol wash process
8. Remove samples from the magnetic plate
9. Let the samples dry for 10 mins (room temp)
10. Add 40 µL sterile dH2O
11. Pipette mix until the solution is homogenous
12. Place the sample onto a magnetic plate until the solution is clear
13. Transfer 35 µL solution to a new 8-tube and spin down
14. Transfer 20 µL solution to a 96-well plate and ready to sequence
(iv) Phylogenetic analyses
The analysis was done using Geospiza FinchTV, MEGA7, and NCBI BLAST.
3.0 RESULTS
3.1 The Relationship between Different Species of Ficus with Size, Level of Hardness,
Stage of Maturity and Percentage of Green Colour of Syconia
In total we sampled 10 sites in Yakushima and collected 485 syconia belonging to the
five Ficus species mentioned before. From these syconia, we found insects in 169 syconia.
Figure 2 shows the boxplot of the variation in size of syconia in these five Ficus species. It
was prepared in R software (Ver. 3.2.3). The figure shows that syconia of Ficus pumila are
the biggest in size, whereas the syconia of F. microcarpa are the smallest. Similarly, boxplots
were constructed to check if there is any relationship between size and hardness and between
size and stage of maturity (Fig. 3 and Fig. 4, respectively). In Figure 3 we can see that as the
size increases, the syconium becomes softer. F. microcarpa (p=9.481e-6), F. superba
(p<2.2e-16) and F. erecta (p=6.88e-7) shows this trend. Figure 4 shows the relationship
between the size and stage of maturity. From this graph, we can say that as the syconia
becomes mature, it is bigger in size.
Fig. 2: Size variation in syconia of different species of figs
Fig. 3: This plot shows the relationship between hardness and size (mm) of syconia for
different species of figs.
Dia
met
er (m
m)
Hardness of syconia
Dia
met
er (m
m)
Fig. 4: Relationship between different stages of syconia and its size (mm)
We also measured the colour of the syconia. As described before, it was standardised
using a majority consensus rule. In our sampling, most of the syconia we collected had higher
percentage green colour (Fig. 5); it means that most of the syconia we had sampled were
young and immature. Our analysis shows that there is no relation between colour and size of
the syconia (Fig. 6). F. sarmentosa was not included in this analysis as all the syconia had
single colour.
F.pumila F.microcarpa F.sarmentosa F.superba F.erecta
Dia
met
er (m
m)
Stage of maturity
Fig. 5: Relative percentage of colour green on the syconia. It was standardised by majority
consensus rule in the laboratory.
0
20
40
60
80
100
120
140
160
pumila microcarpa sarmentosa superba erecta
81-100
61-80
41-60
21-40
0-20
F.pumila F.microcarpa F.sarmentosa F.erecta F.erecta
Fig species
Num
ber o
f syc
onia
Fig. 6: Correlation between colour of the syconia and its size (mm)
3.2 Phylogenetic Relationship of Different Species of Ficus and fig wasps
The samples collected during Yakushima field course were stored in absolute alcohol
(insects) and silica gel (plants) for molecular work. We performed DNA extraction, PCR
amplification and sequencing for this samples. The result of PCR for figs is shown here (Fig.
7). All the samples worked properly with distinct dark bands as seen in the figure.
In the phylogenetic tree for fig species (Fig. 8), we can see F. microcarpa, F. superba
and F. erecta forming distinct clades along with other conspecific sequences downloaded
from Genbank. But the sequences of F. pumila and F. sarmentosa are not resolved properly.
This might be a species complex; a more rigorous molecular and taxonomic work is required
to resolve this complex. Here we cannot explain the branching of one sample of F. erecta
with F. pumila and F. sarmentosa clade.
Fig. 7: Gel electrophoresis results showing the bands from the Ficus samples. The first and the last column are DNA ladder.
Fig. 8: Neighbour-Joining (NJ) tree for Ficus species constructed using atpB-rbcL
chloroplast gene.
Phylogenetic reconstruction of fig wasps shows that F. pumila and F. erecta have a
specific fig wasp species as pollinator; Wiebesia pumilae and Blastophaga nipponica,
respectively. These species of figs are dioecious. Whereas, the monoecious fig species like F.
microcarpa and F. superba have multiple wasps species associated with them (Fig. 9).
F1 F sarmentosa
F2 F sarmentosa
F4 F sarmentosa
F6 Ficus spp
F8 F pumila
AB445603.1 F pumila
AB445605.1 F sarmentosa thunbergii
AB445606.1 F sarmentosa nipponica
AB445609.1 F erecta
AB445602.1 F variegata
F5 F erecta
AB445607.1 F erecta
F7 F microcarpa
AB445595.1 F microcarpa
F3 F superba
AB445593.1 F superba japonica
AB445594.1 F caulocarpa87
78
30
50
45
42
0.0005
Fig. 9: NJ tree for the fig wasp (pollinator and non-pollinator) species constructed using
28S rRNA nuclear gene
The pollinator fig wasps from F. erecta form a monophyletic clade, but the
relationship between the fig wasps from the other species of Ficus is not well resolved,
especially at the lower levels. We can also see that non-pollinators from F. erecta i.e.
Sycoscapter sp., forms a sister clade with the fig wasps from F. microcarpa. This shows that
the pollinator and non-pollinator wasps from the same fig species need not be evolutionarily
sister to each other. The fig wasp from F. microcarpa (Wiebesia sp.) could potentially be a
new species distinct from Wiebesia pumilae associated with F.pumila. As we have seen in
Fig. 8 that F.pumila and F.sarmentosa can be a complex of multiple species, therefore, the
resolution for fig wasps from these two species of figs is not clear (Fig. 9).
Our results do not show any signals of co-evolution among the figs and fig wasps at
Yakushima Island. This could be an artifact of less number of samples or another possibility
is short length of the DNA marker or both. However, it could also mean that the fig and fig
wasps in Yakushima Island are not co-evolving. But, to determine this we need more number
of samples and more number of markers. We were able to collect only a few samples during
the time we had. If more time is invested, it is possible to collect more number of samples to
address this issue.
4.0 DISCUSSION
4.1 Interpretation of the Sampling Data
Theoretically, there can be correlation between mature syconium size and failure rate
of producing pollinators/seeds. It is better for high failure rate species to produce many small
synocia for risk hedge. (Syconium size can be influenced by other factors, such as difference
of seed dispersers.)
Only male syconia are available for fig wasp parasitoids in dioecious species
population, and all syconia are available in monoecious figs, which imply monoecious
species can be more attractive for parasitoids. Although we observed more parasitoids and
smaller mature syconia in monoecious Ficus superba, it is in discord with the fact there were
not so much parasitoids found in monoecious Ficus microcarpa, but Wang (2014) shows that
F. microcarpa has at least 8 non-pollinator wasp species in Japan. Despite it is not congruent
in our data, it possibly explains why F. superba and F. microcarpa produce many small
syconia.
Some small syconia had mature color and hardness, and it is possibly related to
infection. Basically, only for seed dispersal, syconia have to change its color from green to
red/dark violet in order to be eaten by seed dispersers. No benefit in making male syconia red.
Losing syconia already spoiled by non-pollinator insects or fungus may kill enemies in the
syconia, but mature spoiled syconia may come from the lack of ability to notice its failure. If
trees can notice, they may stop syconia growth and spur syconia maturity so as to make
spoiled syconia eaten by animals. It can be better than make spoiled syconia just fall down,
because large fruit-eaters can take infected ones far away.
We could not find female syconia of Ficus erecta and Ficus sarmentosa, both are
dioecious species. In Japan, female trees of Ficus erecta tend not to bear syconia in Jan-May
but male tree constantly bears, despite not constantly releasing fig wasps (Takeuchi, 2011). It
may be explained by seed disperser habits, but according to Suleman et al. (2011), such a
mechanism can spur more fig wasps to enter female syconia. There are many reasons we
cannot say it is common strategy for dioecious figs, one of those is the fact we recorded both
male and female syconia of Ficus pumila, which is also dioecious.
4.2 Phylogenetic Reconstructions of Fig and Fig-wasp Species
Our analysis of the DNA sequences from figs species of Yakushima Island revealed a
somewhat unclear phylogeny of these plants. Though F. microcarpa and F. superba form
distinct clades (but with low bootstrap support), the relationship within the F. pumila and
F.sarmentosa was not resolved (Fig. 8). This result could possibly be because of low
variation in the sequences of F. pumila and F.sarmentosa; this possibly suggests that this
particular clade might be a species complex with misidentification issues. The branching of a
single sequence of F. erecta with the F. pumila clade cannot be explained at this point in time
because of less number of samples and less sequence data.
The phylogenetic tree of fig wasps shows four major clades with wasps from F.
erecta forming a distinct monophyletic clade with a good bootstrap support (98%). Though,
Wiebesia pumilae forms a monophyletic clade, the wasps in this clade come from two
different species of figs, F. pumila and F. sarmentosa. This result gives support to our
assumption that the F. pumila and F. erecta could possibly be a species complex. The
monoecious fig species, F. superba and F. microcarpa, have multiple species of wasps
associated with them; with none of the species forming a well-defined clade.
The undefined species Wiebesia sp. from F. microcarpa, could potentially be a new
species distinct from W. pumilae. We can also see that non-pollinators from F. erecta i.e.
Sycoscapter sp., forms a sister clade with the fig wasps from F. microcarpa. This shows that
the pollinator and non-pollinator wasps from the same fig species need not be evolutionarily
sister to each other.
Our results do not show any signals of co-evolution among the figs and fig wasps at
Yakushima Island. This could be an artefact of less number of samples or another possibility
is short length of the DNA marker or both. However, it could also mean that the fig and fig
wasps in Yakushima Island are not co-evolving. But, to determine this we need more number
of samples and more number of markers. We were able to collect only a few samples during
the time we had. If more time is invested, it is possible to collect more number of samples to
address this issue.
In this study, we used single genetic markers for reconstruction of both, the figs and
fig wasp phylogenies. The uncertainties associated with the phylogenetic trees can be
attributed to less information in the sequence data. Use of multiple markers, to increase
character length, with advance algorithms to build phylogenies might shade some more light
on the relationship of figs and fig wasp species on Yakushima Island.
4.3 Technical Problems
In this course there might have been certain errors during lab work, although we did
our best to be as meticulous as possible. Some of the amplified and sequenced samples
appeared to have been contaminated. Sequenced data was ambiguous and matched several
different species in at least one set of samples. Another issue faced was the unspecific
amplification of gene regions probably due to the unsuitability of the primers for that sample
that were imprecise and it was shown in the results of electrophoresis that had multiple bands.
In general, it can be summarized that the bulk of the mistakes that occurred during the period
of this course was due to the lack of experience in molecular techniques by the bulk of the
participants and short of time we had to achieve our research goals. An example would be the
pipetting errors that could have happened during the transfer of solutions in many of the
extraction, PCR and purification protocols for a large number of samples, up to 96 samples
that was done by multiple people from the group. In this same process, DNA from different
samples might have been mixed which lead to the contamination. Another problem that was
faced was related to marking of samples while being handled and processed. The same set of
samples was handled by three different groups and was not labelled in the same way which
leads to confusion and mix up of the samples. The samples were transferred multiple times,
and some labels were incorrect in the end. There was also a mix up with the images of
samples that were recorded prior to extraction and sequencing. All these issues can be
improved upon in future works with more careful handling of the samples and better record
keeping.
5.0 CONCLUSION
In conclusion, we found that the relationship between different species of ficus with size,
hardness, and stage of syconia. Our analysis shows, however, there is no relation between
colour and size of the syconia. By using DNS analysis, some fig wasps species could be
identified and phylogenetic trees for figs and fig wasps were produced. Given that our
technical problems, further research may reveal how figs and fig wasps relate mutually.
ACKNOWLEDGEMENTS
We would like to thank Prof. Takakazu Yumoto, Prof. Munehiro Okamoto, Prof. Takashi
Hayakawa, and Prof. Goro Hanya for their great help, support and guidance during the field
trip and genome course. We would also like to thank Liesbeth Frias and Shintaro Ishizuka for
their assistance during genome course in Inuyama. Special thanks to Prof. Shiro Kohshima
for inviting us to participate in this brilliant training and thanks to all participants that made
this program thoroughly enjoyable.
REFERENCES
Compton, S.G., Grehan, K., and S. van Noort. (2009). A Fig Crop Pollinated by Three or
More Species of Agaonid Fig Wasps. African Entomology, 17 (2): 215-222.
Cook, J.M., and J.-Y. Rasplus. (2003). Mutualists With Attitude: Coevolving Fig Wasps and
Evolution. Trends in Ecology and Evolution, 18 (5): 241-248.
Herre, E.A., Jandér, K.C., and C.A. Machado. (2008). Evolutionary Ecology of Figs and
Their Associates: Recent Progree and Outstanding Puzzles. Annual Review of
Ecology, Evolution, and Systematics, 39: 439-458.
Kayashima, I. (1955). On the Watase’s line viewed from the distribution of Spiders. Acta
Arachnol, 14: 25-28.
Kerdelhue, C. and J.-Y. Rasplus. (1996). The Evolution of Dioecy Among Ficus (Moraceae):
An Alternative Hypothesis Involving Non-Pollinating Fig Wasp Pressure on the Fig-
Pollinator Mutualism. Oikos, 77: 163-166.
Kuroda, N. (1931). Consideration of Watase line, focusing on Vertebrate distribution.
Zoological Science, 43: 172-175.
Molbo, D., Machado, C. A., Sevenster, J.G., Keller, L., and E.A. Herre. (2003). Cryptic
Species of Fig Pollinating Wasps: Implications for the Evolution of the Fig-Wasp
Mutualism, Sex Allocation, and the Precision of Adaptation. Proceedings of the
National Academy of Sciences, 100: 5867-5872.
Suleman, N., Raja,S., Zhang, Y., Compton, S.G. (2011). Sexual differences in the
attractiveness of figs to pollinators: females stay attractive for longer. Ecological
Entomology, 36, 417-424.
Takahara, H., Matsumoto, A. (2002). Climatological study of precipitation distribution in
Yaku-shima Island, Southern Japan. J Geogr, 111: 726-746.
Takeuchi, H. (2011). Phenology of the fig Ficus erecta and life cycle of its mutualist, the fig
wasp Blastophaga nipponica. Master thesis, Mie University, Tsu, Japan.
Wang, R. (2014). The fig wasps associated with Ficus microcarpa, an invasive fig tree. PhD
thesis, University of Leeds, Leeds, U.K.
Yokoyama, Y., Yamaguchi, T., Akiyama, H., Furuki, T., Tanaka, A., Shimamura, M.,
Deguchi, H. (2006), Ecological study of Bryophytes in Yakushima island. Bryol Res 9:
124.