Practical examPractical exam Preparatory period: 30 minutesPreparatory period: 30 minutes Exam period: 2 hoursExam period: 2 hours 4 tasks4 tasks

Task 1: Prepare a single solutionTask 1: Prepare a single solution Task 2: Setup a PCRTask 2: Setup a PCR Task 3: Design an experiment to Task 3: Design an experiment to

resolve an ambiguous restriction mapresolve an ambiguous restriction map Task 4: Pour and run a gelTask 4: Pour and run a gel

Task 1: Prepare solutionTask 1: Prepare solution Preparation of a solution with Preparation of a solution with

multiple ingredientsmultiple ingredients Evaluation based on absorbance Evaluation based on absorbance

readingreading ± 20% 5 points± 20% 5 points ± 20 - 30% 2.5 points± 20 - 30% 2.5 points ≥ ≥ 30% 0 points30% 0 points

Setup a PCRSetup a PCR Choose appropriate primersChoose appropriate primers

6 primers: 3 forward and 3 reverse6 primers: 3 forward and 3 reverse Ex.Ex. GGTTGGCCTT AACCGGAACCGGTTGGCCTT AACCGGAACC

Setup PCR reactionSetup PCR reaction

Choice of primers 1 pointChoice of primers 1 point PCR amplicon 4 pointsPCR amplicon 4 points

Ingredients Stock Conc. Final Conc. Volume Water Complete to 50µL

Taq PCR buffer 10X 1X Assigned « Forward » primer 2µM 0.2µM

« Reverse » primer 2µM 0.2µM MgCl2 50mM 1.5mM dNTP 2mM 200µM

Template Taq polymerase 5 units/µL 0.05 units/µL

Resolve ambiguous mapResolve ambiguous map

1.0 3.0

3.7 1.03.0 1.0

Experimental design; gel plan: 5 pointsExperimental design; gel plan: 5 points

Pour, load, run gelPour, load, run gel All gels must be loaded and All gels must be loaded and

migration initiated at the latest 15 migration initiated at the latest 15 minutes before the end of the exam minutes before the end of the exam periodperiod

All gels will be stopped 15 minutes All gels will be stopped 15 minutes after the exam periodafter the exam period

Load all samples indicated on gel Load all samples indicated on gel planplan

Final exam – 3 hoursFinal exam – 3 hours 10 bioinfo questions – 10 points10 bioinfo questions – 10 points 5 calculations – 5 points5 calculations – 5 points 1 bonus calculation – 1 point1 bonus calculation – 1 point 5 theoretical questions (MC) – 5 5 theoretical questions (MC) – 5

pointspoints 3 out of 4 problems – 5 points each3 out of 4 problems – 5 points each

5 parts/problem5 parts/problem

DNA fingerprintsDNA fingerprints Determing number of loci

Determine both extremes In this case 8 and 13

Dertermine max and min for each extreme

In the case of 8: max 8, min 4 In the case of 13: max 13, min 7

Determine range 7-8 loci

What is maximum number of homozygous loci if number of bands is 13?