pilin expression in neisseria gonorrhoeae is under both positive

The EMBO Journal vol.7 no.13 pp.4367-4378, 1988

Pilin expression in Neisseria gonorrhoeae is under both

positive and negative transcriptional control

Muhamed K.Taha, Magdalene So',H.Steven Seifert' 3, Elizabeth Billyard2 andChristian MarchalUnite des Antigenes Bacteriens, Institut Pasteur, 75724 Paris Cedex15, France and 'Department of Molecular Biology, MB4, ScrippsClinic and Research Foundation, 10666 N. Torrey Pines Rd, La Jolla,CA 92037, USA

2Present address: Agouron Pharmaceuticals, 505 Coast BoulevardSouth, La Jolla, CA 92037, USA3Present address: Department of Microbiology and Immunology, NorthWestern University, Chicago, IL 60611, USA

Communicated by M.Hofnung

We have identified two closely linked genes, pilA andpilB, which act in trans on the piUn promoter. pilA-pilBmap downstream of expression loci pilEl and opaEl inthe gonococcal chromosome. Subcloning data indicatethat pilB acts negatively on the pilin promoter, andinsertional inactivation of pilB results in hyperpiliatedgonococci. A pilA clone activates the pilin promoterin Escherichia coli, and a pilA-/pilA+ heterodiploidgonococcus exhibits a P- phenotype. Our inability toobtain simple pilA- mutants strongly suggests that pilAis an essential gene in the gonococcus. In an in vitrocoupled transcription/translation system, inserts spanningthe pilA and pilB region direct the synthesis of twoproteins of 40 and 58 kd. DNA sequence analysis showsthat the pilA and pilB loci encode proteins of 38.6 kd(with a putative DNA binding domain) and 57.9 kdrespectively. The pilA and pi1B genes are in oppositeorientation relative to each other, and the 5' ends of thetwo genes overlap. We discuss how these two loci mayinteract to control pilin expression in the gonococcus.

Key words: activation/gonococcal pili/repression oftranscription

IntroductionPili of Neisseria gonorrhoeae are important for virulencein that they mediate adhesion of the gonococcus to the humanhost (Swanson, 1973; Pearce and Buchanan, 1980). Theyare composed of a major protein (pilin), which undergoesantigenic variation in vitro and in vivo (Lambden et al., 1979;Hagblom et al., 1985). In vitro, pilus expression alsoundergoes phase variation at high frequencies. The biologicalrelevance of the P- state is not known, although it can be

imagined that less adherent (P-) cells may be more able to

spread from host to host, to different anatomical sites within

the host, or to have a selective advantage when in an

intracellular location.An expression locus (pilE) on the gonococcal chromosome

controls pilin expression (Meyer et al., 1984). In vitro,strains of gonococci with multiple expression loci can arise

CIRI Prpss Limited, Oxford, England

by DNA transformation (Seifert et al., 1988). There are twosuch loci in strain MS 1 (pilE1 and pilE2) mapping - 20 kbapart (Meyer et al., 1984), while other strains and derivativesof MS11 (Segal et al., 1985; Swanson et al., 1986) containonly one. Many other regions of the gonococcal chromosomecontain partial pilin sequences; only in expression sites arefound the 5' pilin coding sequences and pilin promotersequences (Haas and Meyer, 1986; Segal et al., 1986). Twomechanisms, both involving sequence changes at the pilElocus, have been shown to affect gonococcal piliation status.Deletions of the pilin structural gene in pilE can give riseto P- cells (Segal et al., 1985). Some P- variants have anintact expression site, and produce pilin mRNA. Their P-status results from nonsense or missense mutations of thepilin gene in pilE (Bergstrom et al., 1986; Haas et al., 1987).P- variants of an additional class have intact expressionsites and their pilE loci encode apparently normal pilins(Hagblom et al., 1985).Although the pilin gene in pilE has a -10 sequence, it

lacks a consensus -35 sequence (Meyer et al., 1984). Theabsence of a -35 region has been shown to be characteristicof positively controlled bacterial promoters (Raibaud andSchwartz, 1984). This and the above data have led to theproposal that P- variants may also arise by trans regulation(Hagblom et al., 1985; Segal et al., 1985). In thismanuscript, we describe experiments designed to study transregulation of pilin expression in N.gonorrhoeae.

ResultsConstruction of the reporter plasmidsIn order to screen a gonococcal gene bank in Escherichiacoli for inserts which could act in trans on the pilinpromoter, we constructed 'reporter' plasmids in which thegene encoding chloramphenicol resistance is fused to thegonococcal pilin promoter. We have reported previously onthe cloning of the pilE2 locus from strain MS 11 (Meyer etal., 1984; Segal et al., 1985). One such clone, pNG1749,was a multicopied plasmid recombinant derived from MS 11variant 9B, a P- variant whose pilE2 locus did not undergoany obvious sequence rearrangement (Segal et al., 1985).pNG 1749 was used to create a fusion between the pilinpromoter and the structural gene for chloramphenicolacetyltransferase (CAT cartridge) (Close and Rodriguez,1982). In this construction, the CAT cartridge, alsocontaining the ribosome binding site but no promoter, was

inserted downstream of the pilin -10 sequence, andupstream of the pilin ribosome binding site and structuralgene (Figure 1). This, in effect, creates an operon in whichthe CAT gene is placed under pilin promoter control. Thatthis construction resulted in an operon was confirmed bythe following evidence: (i) all recombinants tested (12/12)had the expected restriction map and had CAT inserted inthe desired orientation; (ii) by Northern blot analysis, pilin-

4367

pil Eli:: Mstil RBS,,.w

PILIN

pil E2-l0 Mstil RBS%

i,<C~~~~~~~~---- r- ;Y0CJi~.

-10 MstIl RBSp

*:~~ ~ ~ ~ 1_ o_

.PILIN ---

C-, .7 CAT} '

RBSc ap

pNG 749-COAT

DNG 1 721 -CAIT

pNG I 749-CATmn-

- kRBSc H 1 .:)

CAT PILIN

.1Kb

Fig. 1. Schematic representation of pilE2-CAT transcriptional fusion. The insert in pNG1749 is a 5-kb EcoRI fragment from MSlP1- variant 9B(Segal et al., 1985) containing pilE2, cloned into the EcoRI site of pBA (Meyer et al., 1982). The insert in pNG1721 is a 10-kb BclI fragmentfrom MS1 1A, P+, containing pil E2, cloned into pBR322 (Meyer et al., 1984). The MstII site in pNG1749 and pNG1721 is located 55 bpdownstream of the start of the pilin transcript and 16 bp upstream of the ribosomal binding site (Meyer et al., 1984). The 0.7-kb CAT cartridgefrom pCM7 (Close and Rodriguez, 1982) was blunt end ligated into the MSTII site of each of the inserts. Black boxes represent the pilin structuralgene; white boxes represent regions of homology flanking pilEl and pilE2; and striped boxes represent the CAT cartridge. The pilin promoterregion is denoted by the (-10) symbol. RBSp and RBSc are, respectively, the pilin gene and CAT gene ribosome binding sites. pNG1749-CATmwas generated by cloning an EcoRI partial digest of pNG1749-CAT into the EcoRI site of the monocopy plasmid pRPZ1 11 (Seifert, 1984). OnlyDNA fragments represented by boxes are drawn to scale.

gene-specific mRNA was increased by the size of the CATcartridge transcript (-- 0.6 to - 1.4 kb, data not shown). ThepilE2 -CAT-operon, pNG1749-CAT, was subsequentlyrecloned into a pBR322-compatible, kanamycin-resistantmini-RI plasmid pRPZ1 (Seifert, 1984). The resultantrecombinant was named pNG1749-CATm ('m' formonocopy), and like its vector is single copied.The pilE2 promoter in pNG1749-CAT and pNG1749-

CATm is derived from variant 9B of the original MS lAstrain (Segal et al., 1985). Variant 9B has a P- phenotype,and its pilE2 locus is apparently intact as it does not haveany obvious sequence rearrangements. To ascertain that thepilin promoter in 9B is fully functional, we next created a

pilin promoter-CAT fusion using the pilE2 pilin promoterfrom a P+ strain. pNG1721 is a pilE2 clone derived fromthe original MS11 P+ strain (Meyer et al., 1984). Anoperon fusion was also made in pNG1721 in which the CATcartridge was placed downstream of the pilin -10 sequenceand upstream of the pilin structural gene (pNG1721-CAT)(Figure 1). As the vectors for pNG1721-CAT and pNG1749-CAT were derived from pBR322, their copy number shouldbe equivalent, and the amount of CAT produced by cellscontaining these recombinant plasmids would be an accuratereflection of pilin-promoter activity. CAT assays indicatethat E. coli GC6(pNG1721-CAT) and GC6(pNG1749-CAT)produced the same amount ofCAT (80 +/- 10 units). Thisresult indicates that the P- phenotype in 9B is not due tosequence changes in the pilin promoter region ofpilE2. Incontrast, E. coli containing the monocopied pNG1749-CATm produced 10 units of CAT. These data indicate thatpNG1749-CATm can be used as the reporter plasmid forscreening our gene bank for genes that act in trans in thepilin promoter.

Isolation of clones with a negative effect in trans onpiIE2-CAT expressionGene products which act in trans on promoters could beeither inducers or repressors. To examine the possibility thatpilin expression is regulated by a repressor, we made a genebank initially from variant 9B (P-). Chromosomal DNAfrom 9B was partially digested with MboI and ligated intothe dephosphorylated BamHI site of pBR322. The ligationmixture was transformed into E.coli GC6(pNG1749-CATm), and transformants were selected on plates containingKan30 and Ap5 . Of 1500 transformants screened forsensitivity to Cm'o, five were Kanr, Apr and Cm'. Twoof these exhibited a sensitivity to Cm" which is more

pronounced than for the three others, and contained the same4-kb insert (pNG11 and pNG56). The restriction maps ofthese two clones were identical. Furthermore, restrictionanalysis strongly suggested that the insert is derived froma region downstream of pilE1 and opaEl, an expressionsite for a variant Protein II (P.11) gene (Meyer et al., 1984)(Figure 2). Southern hybridizations with the pNG56 probeshowed that it hybridized under high stringency conditionsto clones containing this region (pNG171 1) (Segal et al.,1985; data not shown).The gene products encoded by pNG1 1 and pNG56 appear

to have a negative effect in trans on the pilin promoter. Thiseffect is not due to the opaE1 locus: pNG57, a subclone ofpNG56, in which the 5' portion of the opaEl gene is deleted,still conferred Cm sensitivity to the E. coli host (Figure 2).Thus, it appears that a region 3 kb downstream of pilE1encodes products which affect the pilin promoter in trans.

As pNGI and pNG56 were derived from a P- variant,we next examined whether the same region from a P+variant could also affect the pilin promoter. pNG1711 is a

4368

M.K.Taha et al.

pNG 1749

pNG 1721

Trans-regulation of gonococcal pilin expression

pil El opa El1:.=:-) .. I>

5-0 6 cj c-)

pil A b pil B

-2 ZZ- X>-<Dv -c .;; C

pil E2

AT>-as...AT assay !>W

1t--pNG 11- pNG 56

pNG 57

1...

pplcZ

p Iac Z -- -F"I- r

I 1 Kb

Fig. 2. Subcloning of the pilA-pilB region and the effects of these subclones in trans on the pilE2-CAT expression in E.coli. (A) Schematic

representation of the pilA and pilB region relative to the pilEl and opaEl loci in MS1 lA. ORFs of pilin in pilEl (Meyer et al., 1984) and of P.IIin opaEl (Stem et al., 1986) have been reported. ORFs in the pilA and pilB region were determined by DNA sequence analysis, and included herefor reference. Direction of the boxes indicate relative orientation of the reading frames. Black triangles indicate the positions of the mTn3Cm-3insertions. (B) Subcloning of the pilA and pilB region: pNGl and pNG56 are siblings containing the same 4-kb insert derived from MS1 1A variant

9B (P-), cloned into pBR322. pNG17 and pNG58 are subclones of pNG1711 [a pilEl clone derived from MSl lA (P+) (Meyer et al., 1984)] inpUC9 and pUC18 respectively. Other inserts are derived from pNGl or pNG56, cloned into pUC9 (pNG57), pUC18 (pNG59, pNG60, pNG62 andpNG63) or pUCl9 (pNG61). placZ- indicates orientation of the lacZ promoter. (C) CAT assays were done in Ecoli harboring pNG1749-CATmplus each of the above plasmids. Controls are the same strain harboring pNG1749-CATm and either pBR322 or pUC18. Cultures and extracts were

made according to the procedure of Close and Rodriguez (1982), and CAT assays were done as described by Shaw (1975). The rates of increase inabsorption were measured at room temperature, and numbers indicate units of CAT sp. act./mg protein in the extract (1 unit of CAT = 1 nmol ofchloramphenicol acetylated/min). Standard deviations were determined from results of three to six separate experiments.

clone of this region from the original MSIlA P+ strain(Segal et al., 1985). pNG 17, a pUC9 subclone of pNG171 1in which pilE and the 5' portion of opa El were deleted,also had a negative effect on the pilin promoter (Figure 2).To map the region of pNG 11 and pNG56 which encodes

the 'repressor' activity, subclones were made of each insert,and tested for their effect in trans on pilE2-CAT expressionin E. coli. Surprisingly, the subclones fell into two classes:those that retained their negative effect on CAT expression,and those that stimulated it (Figure 2). Fragments rightwardsof the XAoI site cloned into pUC18 still exerted a negativeeffect on the pilin promoter, although to a lesser degree thanpNGl and pNG56. Three subclones leftwards of XhoIactivated CAT expression 2.5- to 5-fold. pNG62 containsan additional 210 bp rightwards of the XhoI site, whilepNG63 contains an additional 584 bp rightwards of XhoI.The construction of pNG60 was found subsequently to haveplaced the leftwards open reading frame (ORF) of this region

to the B-galactosidase promoter ofpUC 18 (see Figure 4A).When the pNG60 insert was recloned in pUC19 in theopposite orientation (pNG6 1), the ability of the clone tostimulate CAT expression was lost. These differences inCAT expression are not due to copy number effects, as

apparent ratios between the monocopy reporter plasmid andeach of the subclones are constant. These results suggest thatthis region downstream ofpilEl controls expression of pilinin trans, and that clones pNGl 1 and pNG56 encode twogenes which act antagonistically on the pilin promoter. Theregion leftwards of XhoI which stimulates the pilin promoterwas named pilA, and the region rightwards of XhoI withrepressor activity was named pilB.

Cell-free protein synthesis assays on pilA and pilBclonesIn order to identify gene products encoded by the gonococcalinserts which act in trans on the pilin promoter, we have

4369

A

B

pNG 17

pNG 58

pNG 59

pNG 60

pNG 62

pNG 63

pNG 61

5± 1

1 ± 1

1 ±1I

6 ±1

5 ±1

50 ±5

54±5

25 ± 5

11 ±2

102control

i

'A

I I

M.K.Taha et al.

Fig. 3. Acrylamide gel electrophoresis and autoradiography of[35S]methionine-labeled PilA and PilB proteins synthesized in vitro.Reactions were programmed with 2.5 /g of CsCl-purified recombinantplasmids in a 50 4d final volume. Each lane contained 10 141 of in vitrosynthesis mixture. Amersham mol. wt markers for each gel were:bovine serum albumin (69 kd), ovalbumin (46 kd), carbonic anhydrase(30 kd), soybean trypsin inhibitor (21.5 kd) and lysozyme (14 kd).(A) Autoradiograph of protein separated in a 15% acrylamide gel. Thereaction mixes were programmed with: pNG57 (lane 1); pNG59 (2);pNG60 (3); pNG17 (4); pNG60 (5); pNG58 (6); pUC18 (7); pNG56(8). (B) Autoradiograph of proteins separated in a 12% polyacrylamidegel. The reaction mixes were programmed with: pNG57 (lane 1);pNG62 (2); pUC18 (3).

used the subclones from the previous experiments to programthe Zubay-type cell-free protein synthesis system (Figure 3).The pNG17 insert, encoding both pilA and pilB, directs thesynthesis of two proteins with apparent mol. wts of 40 and58 kd (Figure 3A, lane 4). The 58-kd protein is encodedby DNA rightwards of the XhoI site as a subclone containingthis region directs the synthesis of this protein (pNG58,Figure 3A, lane 6), while subclones missing part of thisregion do not (pNG57, lane 1; pNG59, lane 2). pNG57 maybe expected to direct the synthesis of -30-kd truncatedderivative of the 58-kd protein. However, such a productwould not be apparent in our gel system, as it wouldcomigrate with vector-encoded products.The gene encoding the 40-kd protein spans the XhoI site,

but the majority of the coding sequence is located leftwardsof this site. The 40-kd protein was detected in assays ofpNG57 and pNG62, subclones containing sequences left-wards of XhoI plus 1013 and 210 bp respectively rightwardsof XhoI (Figure 3A, lane 1; B, lanes 1 and 2). A shorterhybrid protein was observed in assays of pNG60 (Figure3A, lanes 3 and 5), a SalI-XhoI subclone in pUC18 whichhas pilA activity (Figure 2). Subsequent sequence analysisindicates that this construction has created a gene fusion bet-ween the gene encoding the 40-kd protein (see Figure 4A)and the 5' end of the lacZ gene in pUC 18. The 40-kd pro-tein is not detected in assays of pNG61, a subclone in whichthe insert in pNG60 is recloned in the opposite orientationto lacZ in pUC19 (data not shown). This hybrid protein ispresumably responsible for activation of the pilin promoter,

AAAACATAAAGGACACCAGCTCGCCCAAAATTTAATCAGCGTCGGTTTGTCTTTTTTCAAATAAACACTGGCGGGGCGGTTGTCCGCGGTTTTTAACGTGGATLAAGTGTGCGGCACGGTC* . . . . . -300 . -35 . .-10 . TGCGGTCCCGGCATCGACGATTTTGGGCGAACAAGCGCCCAGCGCAAGCAGGCAGCCGAACTTGGCGCAAAGGGAAAAGAAAGTACGGTGTTTCATTTTGATGTTTCCTGTGTGGACGGTT* . . . -200

TGCATGATTAGACGTTTGAGATGCCGAAACCTTACGGCCCGGATTTTCAGACAACCTTGCCGCGCAAAATACGCTACAATACGCCCTATTTCAAGTTTCTAAAATTAAAAaGGAAAATTCA* . -100 . . . . SD -1MetPheSerPhePheArgArgLysLysLysGlnGluThrProAlaLeuGluGluAlaGlnValGlnGluThrAlaAlaLysvalGluserGluValAlaGlnIleValGlyAJnI1.LysATGTTCAGCTTCTTCCGTCGCAAGAAAAAACAGGAAACGCCGGCTLCLCAGGAGGCCCAAGTTCAGGAAACCGCAGCAAAAGTAGAATCTGAAGTTGCTCAAATAGTTGGAAATATTAAA1 . . XhoI . . . 100GluAapValGluSerLruAlaGluSerValLysGlyArgAlaGluSerAlaValGluThrValSerGlyAlaValGluGlnValLysGluThrValAlaGluMetProSerGluAlaGlyGAAGATGTCGAATCTTTAGCAGAAAGCGTCAAAGGGCGGGCCGAATCTGCCGTTGAAACCGTCAGCGGTGCGGTTGAACAGGTAAAGGAAACCGTTGCCGAGATGCCGTCTGAAGCAGGG

* * * *. . . 200 .GluAlaAlaGluArgValGluSerAlaLysGluAlaValAlaGluThrValGlyGluAlaValGlyGlnValGlnGluAlaValAlaThrThrGluGluHisLysLeuGlyTrpAlaAlaGAAGCGGCGGAACGCGTTGAATCCGCAAAAGAAGCTGTTGCCGAAACCGTCGGCGAGGCTGTCGGGCAAGTTCAAGAAGCCGTTGCGACAACTGAAGAACACAAGCTCGGTTGGGCTGCG

* * . . . 300 . .ArgLeuLysGlnGlyLeuAlaLysSerArgAspLysMetAlaLysSerLeuAlaGlyValPheGlyGlyGlyGlnIleGlyGluAspLeuTyrGluGluLeuGluThrValLeuIleThrCGTTTGAAACAAGGCTTGGCCAAATCACGCGACAAAATGGCGAAATCGCTGGCCGGCGTGTTCGGCGGCGGACAAATCGGCGAGGATTTGTACGAAGAGCTGGAAACCGTGCTGATTACC

BalI 400 . . . .

GlyAspMetGlyMetGluAlaThrGluTyrLeuMetLysAspValArgGlyArgValSerLeuLysGlyLeuLysAspGlyAsnGluLeuArgGlyAlaLeuLysGluAlaLeuTyrAspGGCGATATGGGCATGGAGGCCACCGAATACCTGATGAAAGACGTGCGCGGCCGCGTCAGCCTCAAAGGGCTGAAAGACGGCAACGAATTGCGCGGCGCGTTGAAAGAAGCCTTGTACGAC

* 500 NotI . . . . 600LeuIleLysProLeuGluLysProLeuValLeuProGluThrLysGluProPheValIleMetLeuAlaGlyIleAsnGlyAlaGlyLysThrThrSerIleGlyLysLeuAlaLysTyrCTGATTAAGCCGTTGGAAAAACCGCTGGTCTTGCCCGAAACTAAAGAGCCTTTCGTGATTATGCTTGCCGGTATCAACGGCGCGGGCAAAACCACGTCTATCGGCAAACTCGCCAAATAT*** * . . . 700

PheGlnAlaGlnGlyLysSerValLeuLeuAlaAlaGlyAspThrPheArgAlaAlaAlaArgGluGlnLeuGlnAlaTrpGlyGlyArgAsnAsnValThrValIleSerGlnThrThrTTCCAAGCGCAGGGCAAATCCGTATTGCTGGCGGCGGGCGATACCTTCCGCGCCGCCGCCCGTGAGCAGCTTCAGGCTTGGGGCGGGCGCAACAATGTAACCGTCATTTCACAAACCACG

* * * * * . . 800 .GlyAspSerAlaAlaValCysPheAspAlaValGlnAlaAlaLysArgAlaAspArgHisArgAlaCysArgHisArgArgProProAlaHisAlaAlaSerPheAspGlyArgAsnGlnGGCGATTCCGCCGCCGTGTGCTTCGATGCCGTCCAAGCCGCCAAGCGCGCGGATGACATCGTGCTTGCCGACACCGCCGGCCGCCTGCCCACGCAGCTTCATTTGATGGAAGAAATCAA

* . . . . MboI 900 . .LysSerGluAlaArgAlaAlaLysSerHisSerArgArgAlaAlaArgAsnTyrArgArgThrArgCysGlnTyrArgAlaLysArgArgGlnProSerGlnSerLeu***AAAAGTGAAGCGCGTGCTGCAAAAAGCCATTCCCGGCGCGCCGCACGAAATTATCGTCGTACTCGATGCCAATATCGGGCAAAACGCCGTCAACCAAGTCAAAGCCTTTGACGACGCATT

1000

GGGGCTGACGGGGCTTATCGTTACCAAACTCGACGGCACGGCAAAAGGCGGCATCCTCGCCGCGCTTGCTTCCGACCGCCCCGTCCCCGTCCGCTACATCGGCGTGGGCGAAGGCATAGA* 1100 . . . . . 1200CGACCTGCGCCCGTTTGACGCGCGCGCGTTTGTGGACCGACTGCTGGATTGAGCCGAAATGCCGTCCGAAAACGGCAGACCGAACCGTCkZf=G GTGGGA CTAGGACGCGG

* * * * * * . . 1300GGTTTGGGCAACCGTTTTATCCGATAAGTTTCCGTGCGGACAGGTCCGGk C.CTG*1 *GGCGGGTTTTAGGGTTACGGTGTATCGGCAATGACGGTTCGGGTATTTTAC... . . . . ~~~~ ~ ~ ~ ~ ~ ~~~1400...

TGCGCCCGCCCCGCGCCTGTAAACGGCGGGCGCATCAAAAASTGCCLGTCTGAGGTTCAGACGGC-A CGGTATCGGGGAATCAGAAGCGGTAGCGCACGCCCAATGAGGCTTCGTGGGTTT.. . . . ~~~~ ~ ~~~1500....-

4370


BACTTCAGATTCTACTTTTGCTGCGGTTTCCTGAACTTGGGCCTCCTC,GAQAGCCGGCGTTTCCTGTTTTTTCTTGCGACGGAAGAAGCTGAACATDGAATTTTCCTTTTAATTTTAGAAA* . -200 XhoI. .. -35 -10.CTTGAAATAGGGCGTATTGTAGCG7hTTTTGCGCGGCAAGGTTGTCTGAAAATCCGGGCCGTAAGGTTTCGGCATCTCAAACGTCTAATCATGCAAACCGTCCACACASCAA.ACATCAAA. -35 -100 -10 . . . . . . SD. -1MetLysHisArgThrPhePheSerLeuCysAlaLysPheGlyCysLeuLeuAlaLeuGlyAlaCysSerProLysIleValAspAlaGlyThrAlaThrValProHisThrLeuSerThrATGAAACACCGTACTTTCTTTTCCCTTTGCGCCAAGTTCGGCTGCCTGCTTGCGCTGGGCGCTTGTTCGCCCAAAATCGTCGATGCCGGGACCGCGACCGTGCCGCACACTTTATCCACG1 . . . . . . . . . 100

LeuLysThrAlaAspAsnArgProAlaSerValTyrLeuLysLysAspLysProThrLeuIleLysPheTrpAlaSerTrpCysProLeuCysLeuSerGluLeuGlyGlnAlaGluLysTTAAAAACCGCGGACAACCGCCCCGCCAGTGTTTATTTGAAAAAAGACAAACCGACGCTGATTAAATTTTGGGCGAGCTGGTGTCCTTTATGTTTGTCCGAATTGGGACAGGCCGAGAAA

* . . . . . . 200 .

TrpAlaGlnAspAlaLysPheSerSerAlaAsnLeuIleThrValAlaSerProGlyPheLeuHisGluLysLysAspGlyGluPheGlnLysTrpTyrAlaGlyLeuAsnTyrProLysTGGGCGCAAGATGCAAAATTCAGCTCCGCCAACCTGATTACCGTCGCCTCCCCCGGCTTTTTGCACGAGAAAAAAGACGGCGAGTTTCAAAAATGGTATGCCGGTTTGAACTACCCCAAG

* * * * . 300 . . .LeuProValValThrAspAsnGlyGlyThrIleAlaGlnAsnLeuAsnIleSerValTyrProSerTrpAlaLeuIleGlyLysAspGlyAspValGlnArgIleValLysGlySerIleCTGCCCGTCGTTACCGACAACGGCGGCAZG&Tf..CCCAAAACCTGAATATCAGCGTTTATCCTTCTTGGGCGTTAATCGGTAAAGACGGCGACGTGCAGCGCATCGTCAAAGGCAGCATC

* . PvuI 400 . . . . .AsnGluAlaGlnAlaLeuAlaLeuIleArgAsnProAsnAlaAspLeuGlySerLeuLysHisSerPheTyrLysProAspThrGlnLysLysAspSerAlaIleMetAsnThrArgThrAACGAAGCGCAGGCATTGGCGTTAATCCGCAACCCGAATGCCGATTTGGGCAGTTTGAAACATTCGTTCTACAAACCCGACACTCAGAAAAAGGATTCAGCAATCATGAACACGCGCACC

* 500 * . . . . . . . . 600

IleTyrLeuAlaAlaAlaAlaSerGlyAlaTrpLysProIleSerAsnAlaSerThrAlaTrpLeuThrArgTyrArgTyrAlaAsnGlyAsnThrGluAsnProSerTyrGluAspVa1ATCTACCTCGCGGCGGCTGCTTCTGGGGCTTGGAAGCCTATTTCCAACGCATCGACGGCGTGGTTGACGCGGTATCGCTACGCCAACGGCAACACGGAAAACCCGAGCTACGAAGACGTG*..... . . . 700

SerTyrArgHisThrGlyHisAlaGluThrValLysvalThrTyrAspAlaAspLysLeuSerLeuAspAspIleLeuGlnTyrTyrPheArgValValAspProThrSerLeuAsnLysTCCTACCGCCATACGGGCCATGCCGAGACCGTCAAAGTGACCTACGATGCCGACAAACTCAGCCTGGACGACATCCTGCAATATTATTTCCGCGTCGTTGATCGACCAGCCTCAACAAA

* . . . . . . 800 . MboIGlnGlyAsnAspThrGlyThrGlnTyrArgSerGlyValTyrTyrThrAspProAlaGluLysAlaValIleAlaAlaAlaLeuLysArgGluGlnGlnLysTyrGlnLeuProLeuValCAGGGTAACGACACCGGCACGCAATACCGCAGCGGCGTGTACTACACCGACCCCGCCGAAAAAGCCGTCATCGCCGCCGCCCTCAAACGCGAGCAGCAAAAATACCAACTGCCCCTCGTT

* * * * . 900ValGluAsnGluProLeuLysAsnPheTyrAspAlaGluGluTyrHisGlnAspTyrLeuIleLysAsnProAsnGlyTyrCysHisIleAspIleArgLysAlaAspGluProLeuProGTTGAAAACGAGCCGCTGAAAAACTTCTACGACGCCGAGGAATACCATCAGGACTACCTGATTAAAAACCCCAACGGCTACTGCCACATCGACATCCGCAAAGCCGACGAACCGCTGCCG

1000

GlyLysThrLysAlaAlaProGlnGlyGlnArgLeuArgArgGlyGlnArgIleLysAsnArgValThrProAsnSerAsnAlaProAspArgArgAlaIleProSerAspGlnAsnSerGGCAAAACCAAAGCCGCACCGCAAGGCCAAAGGCTTCGACGCGGCCAACGTATAAAAAACCGAGTGACGCCGAACTCAAACGCACCTGACCGAAGAGCAATACCAAGTGACCAAAACAGC

* 1100 . . . . . . . . . 1200AlaThrGluTyrAlaPheSerHisGluTyrAspHisLeuPheLysProGlyIleTyrValAspValValSerGlyGluProLeuPheSerSerAlaAspLysTyrAspSerGlyCysGlyGCGACCGAATACGCCTTCAGCCACGAATACGACCATTTGTTCAAACCCGGCATTTATGTGGACGTTGTCAGCGGCGAACCCCTGTTCAGCTCCGCCGACAAATATGATTCCGGCTGCGGC

* . . . . . . . . 1300TrpProSerPheThrArgProIleAspAlaLysSerValThrGluHisAspAspPheSerPheAsnMetArgArgThrGluValArgSerArgAlaAlaAspSerHisLeuGlyHisVa1TGGCCGAGCTTCACGCGCCCGATTGATGCAAAATCCGTTACCGAACACGATGATTTCAGCTTCAATATGCGCCGCACCGAAGTCAGAAGCCGCGCCGCCGATTCGCACTTGGGACACGTC

* . . . . . . 1400 .

PheProAspGlyProArgAspLysGlyGlyLeuArgTyrCysIleAsnGlyAlaSerLeuLysPheIleProLeuGluGlnMetAspAlaAlaGlyTyrGlyAlaLeuLysGlyGluValTTCCCCGACGGCCCCCGCGACAAAGGCGGACTGCGCTACTGCATCAACGGCGCGAGCTTGAAATTCATCCCGCTGGAACAAATGGACGCGGCAGGCTACGGCGCGTTGAAGGGCGAAGTG

* . . . . 1500 . . .

Lys***AAATAAGCCGCACCGCCGCCTAACCCGGCNAAATGCCGTCTGAAACCTGCAACGTTTCAGACGGCATTT;TTATCCGGCGGGGATTTGTTCAGACAGCATCGCCGCCGTTTTCAACCAGC

* . . 1600 . . . . .

CCGGCCAACCGTTCCAACGCGAAGGCGACCGCCTGCGCGCGGACGGATTCGCGGTTGCCGTCAAAACGGCGCATTGCTTCGCAACTTCCGCCCGGAAAGGCAAACCCGAACCAAACCGTG* 1700 . . . . . . .

CCGACGGGTTTGCTTTCGCCGCCGCCGCCCGGG* . SnmaI

Fig. 4. DNA sequence of pilA and pilB. The deduced amino acid sequences for pilA and pilB appear over the coding sequence starting at position+ 1. (-35) and (-10) indicate hypothetical RNA polymerase binding sites, which are indicated in bold letters. The arrow at position -248 in (A)indicates the start of pilA mRNA synthesis. 'SD' denotes the Shine-Dalgarno ribosome binding sequence. The amino acid residues in bold letters in(A) constitute the possible DNA binding site of the PilA protein. Underlined bases correspond to key restriction sites. Divergent arrows indicatepossible pairing sequences. TCA underlined at position 1520 in (A) represents the reverse strand sequence for the opaEl stop codon (Stem et al.,1986). (A) DNA and deduced amino acid sequence of pilA and pilA-opa El intergenic region. (B) DNA and deduced amino acid sequence of pilB.

as pNG61 cannot activate the pilin promoter (Figure 2). Two observation indicates that, at least in the two MS1 1 variants,minor polypeptides expressed from pilA and pilB, smaller the modulation of pilin expression by pilA -pilB does notthan the 40- and 58-kd products, most likely represent pro- occur via sequence changes in these two loci.ducts of incomplete synthesis commonly observed in the in The pNG17 insert contains two ORFs in oppositevitro system. orientation. One frame of 1068 bp begins with an ATG 45

bases rightwards of the XhoI site, and continues leftwardsSequence analysis of pNG57 and pNG 17 across the XhoI site towards the SalI site (Figures 2A andpNG57 and pNG17 were subcloned into M13 mplO or 4A). The predicted mol. wt of the protein is 38 641 daltons,mpll, and a series of overlapping deletions generated corresponding to the 40-kd protein observed in Zubay assaysin these inserts by the technique of Dale (1985). Both of subclones of this region. This ORF corresponds to thestrands of the resultant inserts were sequenced by the Sanger region defined by subcloning and subsequent transposonchain termination technique (Sanger, 1977). The insert in mutagenesis studies to be the pilA gene. Thus, the 38.6-kdpNG57 is derived from a P- variant of MS1 1, while the protein is the pilA gene product (PilA). Protection studiespNG17 insert is from a P+ derivative. The sequences of were done to identify the transcriptional start site for pilA.both inserts are identical in the pilA-pilB region. This We used the 587 bases 5' XhoI-3' PvuI pilA-pilB

4371

M.K.Taha et al.

fragment as a single-stranded radiolabelled probe (seeMaterials and methods and Figure 2). This experiment placedthe start ofpilA transcription at the guanosine at the position-248, and five bases upstream is a putative promoter. ThuspilA coding sequence is preceded by putative promoter andribosome binding sequences:

TTGTCC-(N)-17-TAAAGT-(N)-242-AGGAA-(N)6-ATG

A stretch of 20 amino acids in PilA (positions 29-48) hasstrong sequence homology with the consensus DNA bindingdomain described by Pabo and Sauer (1984) (Figure 4A):within this 20-amino-acid region, 5/6 residues match theconsensus sequence: Ala, Gly and Val at positions 5, 9 and15 respectively, and hydrophobic residues at positions 4 and8. Furthermore, secondary structure prediction analysis(Garnier et al., 1978) of this region suggests that this domainis organized in the alpha helix-turn-alpha helix motif.These observations strongly suggest that the 38.6-kd pilAgene product interacts with DNA.The second reading frame is in the opposite orientation

with respect to the pilA reading frame (Figure 4B). It beginswith an ATG 191 base rightwards ofXoI and contains 1563bases. The ORF is preceded by one putative ribosomebinding site and two possible promoters:

a: TTGCGA-(N) 17-TGAATT-(N) 126-AGGAA-(N)8-ATGb: TTGAAA-(N)17-TATTTT-(N)77-AGGAA-(N)8-ATG

This reading frame encodes a protein of 57 880 daltons,corresponding to the 58-kd protein synthesized in vitro bysubclones of this region of DNA. We have shown that thisregion, named pilB, acts negatively on the pilin promoter.Thus, this second reading frame encodes the pilB gene.Downstream (23 bp) of the TAA stop codon for the pilBgene are sequences indicative of a transcriptional stop signal(Platt, 1986): exact inverted repeats of 17 bp flanking 7 bpof non-homology, followed by a series of thymines.The pilA and pilB genes are divergently transcribed and

the 5' promoter regions overlap. Moreover, the pilA tran-script would be expected to overlap the transcript of pilB,whether it starts from promoter 'a' or 'b' (Figure 4). Thededuced amino acid sequences of PilA and PilB were com-pared to other protein sequences in the NBRF bank (release15.0) using the FASTP program (Lipman and Pearson,1985), but no significant homology was found.

Transposon inactivation of pilA and pilBThe effects pilA and pilB have on the pilin promoter wereobserved in E. coli. In order to assess the role each locusplays in regulating pilin expression, we made pilA- andpilB- mutants of N.gonorrhoeae strain MS 1. A methodof direct transposon mutagenesis does not exist for N.gonorrhoeae. We therefore used shuttle mutagenesis (Seifertet al., 1986a,b) to obtain pilA- and pilB- mutants. Clonedinserts are transposon mutated in E. coli and the mutatedinserts introduced into N. gonorrhoeae by DNA transform-ation. This system takes advantage of the fact that piliatedcells of N.gonorrhoeae are transformed by homologousDNA at high frequency, and that linearized transformingDNA will recombine with and replace its homologue. Thedefective minitransposon mTn3 was adapted for use in

N. gonorrhoeae by replacing the j3-lactamase gene with anE. coli Cmr gene (Seifert et al., 1986a). A minitransposonwith an up mutation in the Cm promoter was generated bychemical mutagenesis. This minitransposon, mTn3Cm-3(1.6 kb), when transferred into N.gonorrhoeae strain MS1 1,allowed the bacterium to grow on 10 Rg/m1 Cm (H.S.Seifert,M.Vito, R.S.Ajioka and M.So, in preparation).pNG17, which contains pilA, pilB and the 3' half of

opa E1, was recloned as a SalI-SmnaI fragment into pHSS6,and minitransposon insertions were isolated. After restrictionmapping, four plasmids with transposon insertions wereselected for further studies; pilA::mTn3Cm-3a; pilA::-mTn3Cm-3b; pilB::mTn3Cm-3; and opaEl::mTn3Cm-3. Inthese plasmids, the minitransposon was found to have in-serted - 550 or 100, 250 and 600 bp downstream of thepilA, pilB and opaEl start codons respectively (Figure 2A).Each of these plasmids was linearized by digestion withSmaaI, and total digested plasmid DNA was used to transformpiliated cells of MS llA (pilE1+, pilE2+), and its piliatedderivative 4. 1C (pilE1 +, ApilE2) (Hagblom et al., 1985;Segal et al., 1985).

Generation of pilB- mutantsThe opaEl::mTn3Cm-3 transformants appeared on theplates within 24 h, at a frequency of 2 x 10-5/c.f.u. Whentransformed by the pilB: :mTn3Cm-3 DNA, Cm-resistantcolonies of MSl lA and 4. 1C appeared also within 24 h, atfrequencies of 7 x 10-5 to 1 x 10-4/c.f.u. pilB- andopaE1- mutants grew equally well on Cm'I, and coloniesof both types of mutants had a P+ phenotype. Interestingly,the dark rings circumscribing colonies of pilB- mutantswere much more pronounced than those surrounding coloniesof wild-type cells or colonies of opaEl - cells. The edgesof these colonies also appeared much sharper. The pilB-piliation phenotype appeared to be stable without Cmselection.

Five pilB- MSllA transformants, four pilB- 4.1Ctransformants and three opaEl- MSl1 and 4.1C trans-formants were selected for Southern blot analysis (FigureSB). Chromosomal DNA from these transformants wasdigested with Cla I, and the filters hybridized with a pilBprobe (a 0.4-kb PvuI-MboI pilB internal fragment, seeFigure 2A). A 5.8-kb ClaI fragment in both MSllA and4.1C contains pilA, pilB and part of opaE1 (Figure 5A-C,lanes a and b). This fragment in the pilB- and opaEl-transformants has increased in size by - 1.6 kb (Figure SB,lanes 1-12), as would be expected from a simple insertionof the mTn3Cm-3 element into the homologouschromosomal DNA. The CAT gene probe hybridized to thesame 7.4-kb ClaI fragment in all the transformants, but notto the wild-type MSllA or 4.1C DNA (Figure 5B').

Generation of pilA - mutantsMajor differences were observed when pilA- mutants weregenerated.pilA::mTn3Cm-3a contains the minitransposon atposition 550 bp ofpilA. The pilA: :mTn3Cm-3a transform-ants of MSl lA and 4.1C (pilA-a) appeared only after 48 h(cf. 24 h for pilB- and opaEl -). pilA::mTn3Cm-3bcontains the minitransposon at position 100 bp ofpilA. ThepilA::mTn3m-3b transformants of MS1 lA and 4.1C(pilA-h) appeared after 24 h. In both cases (for pilA-a andpilA-b transformants) the transformation frequency was

4372


4 9.4_ _

A e _. 46.6e

44.4

a b 1 2 4 5 6 7 8 9 10 11 124 9.4

o a.

e@ - e_ _

a b 2 3 4 5 6 7 8 9 10 2/`

49.4

fo we "46.6

* 4.4

49.4

C e_-46.6

44.4

a b 1

Fig. 5. Southern blot analysis of pilA- and pilB- mutants. Cla I-digested chromosomal DNA from each mutant was hybridized with nick-translatedintragenic segments of pilA (A and C), or pilB (B), or with nick-translated pCM7 containing the CAT gene (A' and B'). The pilA and pilB probeshybridize with the same 5.8-kb Clal fragment of strains MS1lA and its P+ variant 4. IC (a and b respectively in each photograph). mTn3Cm-3(1.6 kb) (Seifert et al., 1986b) does not contain a ClaI site. (A and A') pilA::mTn3Cm-3a-transformed MS1 derivatives (lanes 1-3) or 4.1Cderivatives (lanes 4-13). Two derivatives were grown on nonselective medium before DNA extraction (lanes 6 and 7), and cultures presumablycontained a mixture of pilA-lpilA+ heterodiploids and pilA+ revertants. DNA in lane 2 of (A') was lost during restriction digestion. (B and B')pilB::mTn3Cm-3-transformed MSl lA derivatives (lanes 2-6) or 4.1C derivatives (lanes 9-12) and opaEl ::mTn3Cm-3-transformed MS1 lAderivative (lane 1) or 4.1C derivatives (lanes 7 and 8). (C) pilA::mTn3Cm-3a-transformed 4.1C derivative shown in A5, lane 1, and two of its P+revertants grown on nonselective medium (lanes 2 and 3).

low (- 7 x 10-7). The pilA-a transformants (distalinsertion in pilA) grew more slowly than the pilB-,opaEl- and pilA-b transformants whether they were

passed on selective or nonselective media. The pilA-btransformants (proximal insertion in pilA) grew as wellas pilB- and opaEl- transformants. pilA-a coloniesexhibited a morphology similar to that of P- colonies, i.e.no dark rings surround the edges of the colonies. However,

pilA-a colonies were much more convex than those of P-colonies. pilA-b colonies exhibited a usual P+ phenotype.Chromosomal DNA from three MS1lA pilA-a trans-

formants, and from ten 4. IC pilA-a transformants (FigureSA), as from two MS 1A pilA-b and sixteen 4. 1C pilA-btransformants (data not shown) were digested with Cla I, andanalyzed by Southern blotting using apilA probe (a 0.85-kbMboI -XhoI pilA internal fragment cloned into pUC 18)

4373

A'

B

-

4 6.6

44.4

49.4

46.6

44.4

B'

M.K.Taha et al.

(Figure 2A). Surprisingly, in all 13 pilA-a and all 18pilA-b transformants, the pilA probe hybridized to twoClaI fragments, one of 7.4 kb and one of 5.8 kb (Figure5A, lanes 1-13). Only the 7.4-kb fragment hybridized withthe CAT probe, indicating that the 5.8-kb fragment containsthe wild-type pilA gene (Figure 5A'). Both the 5.8- and7.4-kb fragments hybridized with the pilB probe (data notshown). Further mapping of all 31 transformants indicatedthat the pilA-pilB duplication containing the minitransposonhad occurred in four other chromosomal locations outsideof pilE1 (data not shown).

Because of the unexpected Southern blotting data, werepeated the transformation experiment. DNAs from fourof the above pilA-alpilA+ transformants were used toretransform MS1 IA and 4. IC. As the incoming gonococcalDNA did not have to overcome the restriction barrier, thetransformation frequency was higher (10-5/c.f.u.), andCmr colonies appeared after 24 h of incubation. The trans-formants also exhibited a P- like phenotype (convex colonieswithout dark edges), but growth of transformants uponrepassage was again slow. Southern blot analysis of trans-formants from these four experiments using the pilA probegave the same pattern as seen in Figure SA.These data strongly suggest that the pilA gene, in addition

to regulating pilin gene expression, has an essential functionin the gonococcus, as a transposon insertion into pilAappears to be lethal. The presence of two pilA hybridizingClaI fragments indicates that the transformants areheterodiploids which contain one copy of pilA+-pilB+and one of pilA--pilB+. It is curious that the ClaIfragment containing pilA --pilB+ is 7.4 kb, as this is thesize of the wild-type locus containing a minitransposoninsertion, and as the transforming DNA contains only oneCla I site (see Figure 2). There are several possibleexplanations for this blotting result. One is that the incomingDNA containing the minitransposon has simply recombinedwith other loci with which it shares partial homology,fortuitously generating a new 7.4-kb ClaI fragment in eachcase. Such coincidence would be extremely unlikely. A morelikely explanation is that the incoming DNA has recombinedinitially with the wild-type pilA -pilB locus, generating anon-viable cell which undergoes autolysis. DNA from thisregion of the chromosome, containing the pilA--pilB+region and the flanking ClaI sites, would then transforma neighboring wild-type cell, and recombine with otherpartially homologous loci within the cell. Such a transformantwould still contain one wild-type pilA-pilB region (in a5.8-kb ClaI fragment) and one mutated pilA- -pilB+region plus flanking sequences (in a 7.4-kb ClaI fragment).Supporting this hypothesis are the observations that thegonococcus undergoes autolysis readily (Heebeler andYoung, 1975), that it is transformed by its own DNA at highfrequency (Sparling, 1966), and that DNA from lysed cellsare active in DNA transformation (Sarubbi and Sparling,1974). Indeed, we have observed recently that DNA trans-formation is the primary means by which the pilin expressionsites acquire variant pilin gene sequences (H.S.Seifert et al.,1988).

Deriving pilA + revertantsThe slow growth rate of the pilA-alpilA+ mutants wasnot due to the presence of Cm in the medium, as themutants grow as slowly on Cm'o as on nonselective

A

23SPI

16S '

C

4 23S

.a.

1 2 3 a

B

*416S

1 2 3 bD

*R' 4pilin mRNA

Fig. 6. Level of pilin transcription of pilA- and pilB- mutants. Totalgonococcal RNA was separated on formaldehyde agarose gels andtransferred to N-hybond filter. The filters were hybridized with nick-translated pNGl 100 probe (B and D) which contains the pilin gene ofMS1 1A (Meyer et al., 1984). After autoradiography, the filters werewashed extensively to remove all probe and rehybridized withnick-translated pBT18-88 (A and C) containing the Bacillusthuringiensis 23S and 16S ribosomal genes (Klier et al., 1979). Theratio of pilin to 16S ribosomal signal for each variant was determinedby densitometer scanning. 16S rRNA transfer was observed to bemore efficient than 23S in separate experiments. Hybridizations withtotal RNA from two mutants and three pilus phase variants are shown:4.1C pil A-alpilA+ (lane a), 4.1C pilB- (lane b), 4.1C (lane 2),4.1B (lane 1) and 2B (lane 3). 2B is a P- variant which has the pilingene deleted from both expression sites and 4.1B is a P- variant inwhich pilEl is intact and which has reduced pilin gene transcription(Segal et al., 1985; Hagblom et al., 1985; M.K.Taha, M.So andC.Marchal in preparation).

media. However, when pilA -alpilA+ transformants were

passaged on plates without Cm, they gave rise at very highfrequency (10-50%) to P+ colonies of normal size. TheseP+ colonies are Cms, while the parental P colonies are

Cmr. Southern blotting analysis of DNA from theserevertants using the pilA probe shows that the 7.4-kb ClaIfragment has disappeared (Figure SC). Further blots of XhoIIEcoRI-digested DNA indicated that these revertants are

pilA+-pilB+ homodiploids (data not shown), suggestingthat they probably resulted from homogenotization.

Pilin transcription in pilA - and pilB- mutantsThe level of pilin transcription in mutants 4.1C pilA-a/pilA+ and 4. IC pilB- were determined by Northern blotanalysis and compared to that of the P+ wild-type strain4. IC (Figure 6, compare Ba to B2 and Db to D2). Afternormalization to rRNA concentration detected on the same

filters (Figure 6A and C), the level of pilin transcription wasobserved to be reduced -3- to 4-fold in pi1A-aapilA+mutant and increased -3- to 5-fold in pilB- mutant

(results from three independent experiments).

Electron microscopy of pilA - and pilB- mutantsWe examined pilA-a/pilA+ and pilB- mutants, and pilA+revertants, by electron microscopy, and compared theirpiliation status to that of P+ and P- variants. In all,

4374


4t

Fig. 7. Piliation status of wild-type gonococci and mutants observed by electron microscopy. Grids were examined at x21 000 magnification.Platinum-paladium shadowed cells are from strain MS1I A P+ (a), from 4. 1B, its P- phase variant (b) and from 4. 1C, the P+ revertant of 4. 1B(c). Representative samples of mutants are shown for MS1 1A pilB - (d) and for 4.1C pilA-alpilA+ heterodiploid (e). The 4.1C pilA+ revertant isshown in (f). Three to five mutants of each class (d, e and f) were examined. Each mutant within a class had the same piliation phenotype.Furthermore, each mutation resulted in the same piliation phenotype whether the recipient strain was MS1 1A or 4. IC. No pili were observed oncells of 2B, a P- variant of MS1 A in which pilin sequences have been deleted from both pilE 1 and pilE2 (Segal et al., 1985; data not shown).

4375

M.K.Taha et al.

three to five mutants of each class were studied, andrepresentatives from each class are shown in Figure 7. ThepilA-alpilA+ mutants were observed to have very few pili(Figure 7e). The number of pili seen on the pilA- mutantis comparable to that observed on 4. 1B, a P- variant ofMS1 1 in which pilE1 is intact (Segal et al., 1985), and whichmakes reduced amount of pilin mRNA (Hagblom et al.,1985; M.K.Taha, M.So and C.Marchal, in preparation). Weexamined - 50-100 cells, and did not observe any whosepiliation status is comparable to that of MSllA (P+). Onthe other hand, the presumptive pilA+ revertants producethe same amount of pili as MS1 lA and 4. IC when examinedby electron microscopy (Figure 7f). These data indicate thatpilA has a positive effect on pilin expression, as a mutationin pilA results in cells producing few to no pili. This effectis at the transcriptional level since pilA clones were observedto stimulate pilin promoter activity in E. coli and less pilinmRNA is made in pilA-alpilA+ gonococci.Compared with wild-type P+ cells (Figure 7a and c), the

pilB- mutant is hyperpiliated (Figure 7d). The pili appearin clumps, and many are detached from the cells. In all,five pilB- mutants of MSllA and 4. IC were examinedand they all exhibited this hyperpiliation phenotype. Theseobservations agree with our earlier observations thatwild-type pilB has an inhibitory effect on pilin expressionby repressing pilin gene transcription.

DiscussionWe have identified two loci mapping downstream ofpilEl,pilA and pilB, which act in trans to regulate pilin expression.pilB in conjunction with pilA, decreases pilin promoteractivity in E. coli and pilB- mutants of the gonococcus haveincreased pilin gene transcription and are hyperpiliated. Theinhibitory activity of the pilB gene on pilin expression issimilar to the effect of the E. coli and Pseudomonasaeruginosa hyp genes on piliation (Orndorff and Falkow,1984; Johnson and Lory, 1987). pilA alone stimulates pilinpromoter activity in E. coli and pilA-alpilA+ heterodiploidgonococci produce only a small amount of pili. Our failureto obtain a single pilA- mutant strongly suggests that pilAhas an essential regulatory function in the gonococcus. Thereduced pilin gene transcription and piliation of pilA-a/pilA+ heterodiploids, along with the stimulatory activity ofpilA on the pilin promoter, indicate that pilA also plays arole in pilin transcriptional regulation. Sequence analysisshows that the pilA and pilB genes are in opposite orientationrelative to each other, and that 5' of the two genes overlap.The ORFs for the pilA and pilB genes code for 38.6- and57.9-kd proteins respectively. These sizes correspond wellwith those of proteins detected in Zubay assays of subclonesof these genes.

It is interesting that piliation is affected in pilA-alpilA+but not in pilA-blpilA+ heterodiploids. One explanationfor this observation is that the minitransposon insertion intothe distal part of pilA (pilA-a) leads to the production ofa truncated protein which is able to bind the pilin promoter,but which is unable to activate transcription. Indeed, oursequence data indicate that a putative DNA binding domainexists near the N-terminal end of PilA. The truncated PilAprotein would compete with native protein for the pilinpromoter binding site, thereby decreasing pilin transcription.A variation on this theme is that activation of pilin

transcription involves the activity of a PilA complex. In apilA-alpilA+ heterodiploid, aberrant complexes may beformed consisting of wild-type and truncated PilA proteins.Supporting this hypothesis is the observation that wild-typeand mutant recA1 proteins are capable of forming mixedtetramers whose ATPase activity is dramatically reduced(Ogawa et al., 1978). In addition, such negative dominancewas also observed with some missence lamB mutations(Marchal and Hofnung, 1983). These two alternatives wouldalso explain the slow growth rate of pilA-alpilA+heterodiploids. If pilA is an essential regulatory gene, anegative dominance of pilA-a on pilA+ in these mutantswould result in decreased cell viability. By isolating an earlyinsertion in pilA (pilA-b), we again obtained mutantswhich were heterodiploid for pilA. This confirms theessential role of pilA. But they were P+ and had normalviability, which we would expect when the insertion is earlyenough in pilA to completely inactivate pilA. In this case,pilA- allele has no negative dominance on the wild-typepilA+.We observed that pilB, in conjunction with pilA, has a

stronger negative effect than pilB alone on pilin promoteractivity. pilB expression may need a sequence located in thepilA gene or may be under pilA positive control. Finally,PilB activity may need PilA protein as co-effector. Preciselyhow pilA and pilB interact to regulate pilin expression isunclear. This control may involve a heteropolymer composedof the pilB and pilA gene products. Alternatively, the pilAand pilB proteins may compete for binding sites on the pilinpromoter. The pilB ORF extends beyond the minimalfragment shown to have negative activity on the pilinpromoter in E. coli. That the 5' half of pilB is enough toexert this effect may be due to the activity of a truncatedPilB or the 5' half of the pilB transcript. Our sequence datareveal the existence of substantial antisense homologybetween the 5' ends of the pilin and pilB message. Oursequence data also show that there are two possiblepromoters for pilB and that these overlap the pilA transcrip-tion. Indeed, transcriptional initiation from the pilB promoterwould result in a pilB transcript that overlaps the pilAtranscript. The significance of these findings awaits detailedtranscription studies.Our data strongly suggest that pilA is an essential regulator

in the gonococcus. We therefore favor a model of regulationin which the pilA gene product plays the role of a centralactivator. Indeed recent data suggest that piliation andother envelope components may be coordinately regulated(Klimpel and Clark, 1988).

Transcriptional regulation has been shown to control pilusexpression in other systems. Examples of these are the pappilus of E. coli urinary tract isolates (Baga et al., 1985), thepiltfs of Vibrio cholerae (Miller et al., 1987) and the E. coliType 1 pilus (Eisenstein, 1981). Sequence homology in the5' promoter regions of the pilin genes of N. gonorrhoeae andP. aeruginosa (Johnson et al., 1986) strongly suggests thatthe two systems have common regulatory components. Acentral activator has been shown to control expression ofseveral other virulence factors in V. cholerae (Miller et al.,1987), Bordetella pertussis (Weiss and Falkow, 1984), andAgrobacterium tumefaciens (Winans et al., 1986). Moreover,environmental factors play a major role in the expressionof the above genes.As pilA and pilB have an effect on pilin expression, they

4376


are candidates as factors which control a class of 'trans-regulated' pilus phase variants. If pilA and pilB participatein the pilus phase switch, the expression of pilA and pilBwould have to be finely balanced, and a shift in the levelof expression of one gene relative to the other woulddetermine the piliation status of the cell. This balance couldbe brought about in several ways. One possibility is that thisdifferential balance is determined by high frequencyrevertable mutations/rearrangements in either the pilA orpilB gene. In one case studied no sequence changes weredetected in pilA and pilB genes from MS 11 and from oneof its P- variants. An alternate possibility is that expressionof the pilA and pilB genes is under control of another locus.Finally, the pilA and pilB genes may regulate each otherby an as yet undefined way. A detailed characterization ofthese two genes will shed light on this matter.

Finally, pilA -pilB control of pilin expression may be aphenomenon separate from the pilus phase switch. Thecoexistence of two modes of piliation control has beendescribed for the E. coli Type I fimbriae, where an 'on andoff' control system 'shares' regulation of pilus expressionwith a transcriptional control system. The drastic metastableregulation is due to the inversion of a DNA fragmentcontaining the pilin gene promoter (Abraham et al., 1985;Klemm, 1986). In addition, transcriptional regulation iseffected by the hyp gene product when the pilin gene is inthe 'on' mode (Ormdorff et al., 1985). Two modes of controlof expression of virulence factors have also been describedin B.pertussis (Weiss and Falkow, 1984). In this system,modulation of expression of the virulence genes is sensitiveto environmental changes. To our knowledge, detailedstudies have not been carried out to examine the influenceof the environment on gonococcal pilus expression, althoughgonococcal piliation and virulence can change with cultureconditions (Keevil et al., 1986). Of the different pathwayswhich control pilus expression in the gonococcus, thepilA-pilB pathway would be most likely to respond toenvironmental factors. The identification of the pilA and pilBloci should help to define the parameters by which thisvirulence factor is expressed.

Materials and methods

Strains and mediaAll strains used were N.gonorrhoeae strain MS1I A (pilEl +, pilE2+) andits derivatives, and have been described by Segal et al. (1985) and Hagblomet al. (1985). Cultures were passed every 18-22 h on G medium plateswith G supplement (Diagnostics Pasteur, France) or on GCB plates (Difco)with supplements (Kellogg et al., 1963) as previously described (Segal etal., 1985). For recipients of recombinant plasmids, E.coli RDP145 (Buzbyet al., 1983) was used for isolation of pNG1749-CAT and pNG172 1-CAT;E.coli GC6 [a P1 transductant of GC1 (Meyer et al., 1982) which bringsin the locus delta (srl-recA)306::TnlO (H.S.Seifert, unpublished data)]for isolation of pNG1749-CATm, pNGl1 and pNG56; Ecoli JM109(Yanisch-Perron et al., 1985) for subcloning of pNG17, pNG57; and E.coliTGI(Gibson, 1984) for pNG58 to 63 and for M13 recombinant clonesthat were sequenced. Plasmids isolated from JM109 or TG1 were thentransferred to Ecoli DH5 (Hanahan, 1983). Transformation of N.gonorrhoeae was as described by Sparling (1966) except that gonococciwere plated directly onto antibiotic-containing plates after allowing forexpression of antibiotic resistance in liquid GCB medium (H.S.Seifert,unpublished data).

Nucleic acid extraction, purification and hybridizationDNA isolation and restriction digestion were as described by Segal et al.(1985), except that the DNA was transferred from agarose gels ontoN-hybond (Amersham) in 1 M ammonium acetate, and then filter dried

and fixed with UV (254 nm) for 4 min.Total RNA was isolated from N.gonorrhoeae cells which were grown

for 18-20 h on G medium and supplement (Diagnostics Pasteur, France),and harvested into lysis buffer (10 mM Na-acetate, 50 mM NaCl, 0.5%SDS). RNAs were extracted once with hot acidic phenol and diluted in 3vol. of ice-cold 4 M guanidinium isothiocyanate, 10 mM Na-acetate, 50 mMNaCl and 1 M 3-mercaptoethanol. 2.5 ml of this solution was layered on

a 1.5 mlCsCl cushion (6 M CsCl in 10 mM Tris-HCI, pH 7.5, and 1 mMEDTA, filtered through a 0.45-ltm membrane) and centrifuged at 38 000r.p.m. for 20 h at 20°C in an SW 50.1 rotor. The RNA pellet was

resuspended in water, extracted with hot acidic phenol, acidic phenol/chloroform, then chloroform/isoamyl alcohol, and precipitated in ethanol.Pellets were vacuum dried and resuspended in 20 mM phosphate buffer(pH 7).RNA (10 jg) resuspended in formamide/formaldehyde was separated in

a 1.8% agarose gel in 20 mM phosphate buffer (pH 7), 6% formaldehyde,and then blotted overnight into N-hybond (Amersham) filters in 20 x SSPE.The filter was dried and exposed to UV (254 nm) for 4 min. The filterwas washed with 4 x SSPE, prehybridized in 0.5 M phosphate buffer (pH7), 7% SDS, 1 mM EDTA and 1% BSA, and hybridized with 32P-labelednick-translated probe in the same buffer with 100 Ag/ml salmon sperm DNAat 65°C. Filters were washed in 40 mM phosphate buffer (pH 7), 1% SDS,1 mM EDTA, three times, each for 15 min at 65°C. Kodak XAR-5 filmwas exposed at -70°C with an intensifying screen.

Recombinant DNA techniquesAll recombinant DNA protocols were from Maniatis et al. (1982).pNG1749-CAT and pNG1721-CAT were generated by flush ending theHindHm fragment containing the CAT gene of pCM7 (Close and Rodriguez,1982) and inserting this fragment into the single and blunt-ended MstII siteof pNG1749 and pNG 1721. pNG1749-CATm was made by partial digestionof pNG1749-CAT with EcoRl, and ligation with EcoRI linearized pRPZ1 11(Seifert, 1984). Transformants were selected on agar containing Kan30 andCm'5.pNG17 is a 4-kb pNG1711 Sall-SnaI fragment cloned into pUC9

linearized with the same enzymes. pNG57 is a 3-kb Sall fragment frompNG56 cloned into the SalI site of pUC9. pNG58 is a 2-kb XhooI-EcoRIfragment from pNG17 cloned into the SalI-EcoRI site of pUC 18. pNG59and pNG60 are, respectively, a 1.3- and 1.9-kb XNoI -SalI fragment frompNG57 cloned into the SalI site of pUC18. pNG61 is a 1.9-kb HindmI-XWoIfragment from pNG57 cloned into the Hindlll-Sall site of pUC19. Togenerate pNG63, the 2.5-kb PvuI-HindIII fragment from pNG57 was gelpurified and ligated to the SmaI-HindIll site of pUC 18. PvuI ends were

blunted and a second ligation was carried out to circularize the recombinantDNA. To generate pNG62, the 2.5-kb EcoRI-HindIH fragment frompNG63 was cloned into Eco RI- and Hin dIll-cut M13 mpl 1 vector, anda 370-bp deletion was generated from Eco RI towards the Xho I site usingthe technique of Dale et al. (1985).

Cell-free protein synthesis assaysThe system described by Zubay et al. (1970) was used with minormodifications (Marchal et al., 1980). DNAs used to program this in vitrosystem were purified on CsCI density gradients.

DNA sequencingThe 1.9-kb SalI-XhoI and the 1.3-kb XhooI-SalI fragments from pNG56were subcloned into M13 DNA mplO or mpl 1 in both orientations, as wellas the 1.9-kb SalI-XhoI and the 2-kb X7hoI-SmnaI fragments from pNG17.Sequential deletions in the inserts to be sequenced were made by the techniqueof Dale et al. (1985). Oligonucleotides RD29 and RD22 were purchasedfrom IBI. Briefly, unidirectional digestions of the single-stranded insertswere done for varying times (2-20 min), using T4 DNA polymerase, afterannealing of a specific oligomer to create a double-stranded EcoRI site (formp 11 recombinants) or HindIll site (for mplO recombinants), andlinearization by cutting at this site. Recircularization and transformation ofE.coli strain TG1 were made, and after sizing the deletions, the DNA was

sequenced without the subcloning step. Sequencing reactions were carriedout using the dideoxy chain termination procedure of Sanger et al. (1977).

S1 mappingThe start of pilA mRNA synthesis was determined by SI mapping as

described by Maniatis et al. (1982). DNA probe was the single-strandedfragment 5' Xhol-3' PvuI, complementary to pilA transcript. It was

synthesized and homogeneously labeled using radioactive dTTP, as the

complement of the 3' XhoI -5' PvuI fragment cloned in M13 mplO, and

gel purified. The length of the protected fragment was analyzed on 7%

polyacrylamide and 8 M urea gel.

4377

M.K.Taha et al.

Shuttle mutagenesis of gonococcal inserts in E.coliTechniques, strains and plasmids used were as described by Seifert et al.(1986a,b). The 4-kb EcoRl-HindIH fragment from pNG17 was subclonedinto the shuttle vector pHSS6, and the recombinant plasmid then transferredinto the Tn3 transposase +E.coli strain RDPl45(pTCA). The resultantstrain was then conjugated with RDPI45(pOX38::mTn3Cm-3) to allowtransposition to occur. The plasmids were then conjugated into NS2114Smto allow resolution of cointegrates. Transconjugants with mTn3Cm-3insertions into the plasmid were selected by plating on agar containingCm30, and insertion sites of the minitransposon were mapped by restrictionanalysis of plasmids.

Transformation of N.gonorrhoeaePlasmids used for transformation were cesium purified and linearized bydigestion with Snia I. Gonococci were grown on solid G medium (DiagnosticsPasteur) and harvested in GCB liquid medium (Difco) with supplements(Kellogg et al., 1963) and MgCI2 5 mM (GCB-Mg) to a final concentrationof 108 cells/ml. One milliliter of each bacterial suspension was incubatedin a 24-well tissue culture plate with or without 2 yg of restriction digestedplasmid DNA for 30 min at 37°C with 5% CO2. Transformed cells werediluted 1: 10 with pre-warmed GCB-Mg in tissue culture flasks, incubated4 h at 37°C with 5% CO2 for expression of the CAT gene, then platedon solid G medium containing 10 Atg/ml Cm.

Electron microscopyGonococcal colonies were gently dissociated in phosphate buffer. Poly-lysine-coated formvar grids were floated for 5 min on the bacterial supsension,fixed with 1% glutaraldehyde, rapidly washed in distilled water, andshadowed with platinum-paladium alloy.

AcknowledaementsWe would like to thank R.L.Rodriguez for the CAT cartridge, A.Klier forthe pBT18-88 plasmid, A.Ryter for electron microscope work, David Perrinfor setting up the Zubay system and William Saurin for computer analysisof the DNA sequences. We are very grateful to Maurice Hofnung and JulianDavies for their generous support. This work was supported by a grantfrom Centre National de la Recherche Scientifique (UA 040557) and byEMBO award ALTS 34984 and Fogarty Award to C.M.; by NationalInstitutes of Health grant RO1 A120845 and National Science Foundationgrant DMB 8512623 to M.S. E.B. was a fellow from the Pasteur- Weiz-mann Foundation.

ReferencesAbraham,J.M., Freitag,C.S., Clements,J.R. and Eisenstein,B.I. (1985)

Proc. Natl. Acad. Sci. USA, 82, 5724-5727.Baga,M., Goransson,M., Normark,S. and Uhlin,B.E. (1985) EMBO J.,

4, 3887-3893.Bergstrom,S., Robbins,K., Koomey,J.M. and Swanson,J. (1986) Proc. Natl.

Acad. Sci. USA, 83, 3890-3894.Buzby,J.S., Porter,R.D. and Stevens,S.E., Jr (1983) J. Bacteriol., 154,

1446-1450.Close,T.J. and Rodriguez,R.L. (1982) Gene, 20, 305-316.Dale,R.M.K., McClure,B.A. and Houchins,J.P. (1985) Plasmid, 13,31-40.

Eisenstein,B.I. (1981) Science, 214, 337-339.Garnier,J., Osguthorpe,D.J. and Robson,B. (1978) J. Mol. Biol., 120,97-120.

Gibson,T.J. (1984) Ph.D. Thesis, University of Cambridge.Haas,R. and Meyer,T.F. (1986) Cell, 44, 107-115.Haas,R., Schwarz,H. and Meyer,T.F. (1987) Proc. Natl. Acad. Sci. USA,

84, 9079-9083.Hagblom,P., Segal,E., Billyard,E. and So,M. (1985) Nature, 315,

156-158.Hanahan,D. (1983) J. Mol. Biol., 166, 557-580.Heebeler,B.H. and Young,F.E. (1975) J. Bacteriol., 122, 385-392.Johnson,K. and Lory,S. (1987) J. Bacteriol., 169, 5663-5667.Johnson,K., Parker,M.L. and Lory,S. (1986) J. Biol. Chem., 261,

15703-15708.Keevil,C.W., Major,N.C., Davies,D.B. and Robinson,A. (1986) J. Gen.

Microbiol., 132, 3289-3302.Kellogg,D.S., Peacock,W.L., Deacron,W.E., Brown,L. and Pirkle,C.I.

(1963) J. Bacteriol., 85, 1274-1279.Klemm,P. (1986) EMBO J., 5, 1389-1393.

Klier,A., Kunst,F. and Rapoport,G. (1979) Nucleic Acids Res., 7,997-1010.

Klimpel,W.K. and Clark,V.L. (1988) Infect. Immun., 56, 808-814.Lambden,P.R., Heckels,J.E., James,L.T. and Watt,P.J. (1979) J. Gen.

Microbiol., 144, 305-312.Lipman,D.Z. and Pearson,W.R. (1985) Science, 277, 1435-1440.Maniatis,T., Fritsch,E.F. and Sambrook,J. (1982) Molecular Cloning. A

Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold SpringHarbor, NY.

Marchal,C. and Hofnung,M. (1983) EMBO J., 2, 81-86.Marchal,C., Perrin,D., Hedgpeth,J. and Hofnung,M. (1980) Proc. Natl.

Acad. Sci. USA, 77, 1491-1495.Meyer,T.F., Mlawer,N. and So,M. (1982) Cell, 30, 45-52.Meyer,T.F., Billyard,E., Haas,R., Storzbach,S. and So,M. (1984) Proc.

Natl. Acad. Sci. USA, 81, 6110-6114.Miller,V.L., Taylor,R.K. and Mekalanos,J. (1987) Cell, 48, 271-279.Ogawa,T., Wabiko,H., Tsurimoto,T., Horii,T., Masukata,H. and

Ogawa,H. (1978) Cold Spring Harbor Symp. Quant. Biol., 43, 909-915.Orndorff,P.E. and Falkow,S. (1984) J. Bacteriol., 160, 61-66.Orndorff,P.E., Spears,P.A., Schauer,D. and Falkow,S. (1985) J. Bacteriol.,

164, 321-330.Pabo,C.O. and Sauer,R.T. (1984) Annu. Rev. Biochem., 53, 293-321.Pearce,W.A. and Buchanan,T.M. (1980) In Beachey,E. (ed.), Bacterial

Adherence. Chapman and Hall, New York, pp. 291-344.Platt,T. (1986) Annu. Rev. Biochem., 55, 339-372.Raibaud,O. and Schwartz,M. (1984) Annu. Rev. Genet., 18, 173-206.Sanger,F., Nicklen,S. and Coulson,A.R. (1977) Proc. Natl. Acad. Sci. USA,

74, 5463-5467.Sarubbi,F.A., Jr and Sparling,P.F. (1974) J. Infect. Dis., 130, 660-663.Segal,E., Billyard,E., So,M., Storzbach,S. and Meyer,T.F. (1985) Cell,

40, 293-300.Segal,E., Hagblom,P., Seifert,H.S. and So,M. (1986) Proc. Natl. Acad.

Sci. USA, 83, 2177-2181.Seifert,H.S. (1984) Ph.D. dissertation, Pennsylvania State University.Seifert,H.S., Chen,E.Y., So,M. and Heffron,F. (1986a) Proc. Natl. Acad.

Sci. USA, 83, 735-739.Seifert,H.S., So,M. and Heffron,F. (1986b) In Setlow,J.K. and

Hollaender,A. (eds), Genetic Engineering, Principles and Methods.Plenum Press, New York, Vol. 8, pp. 123-134.

Seifert,H.S., Ajioka,R.S., Marchal,C., Sparling,P.F. and So,M. (1988)Nature, in press.

Shaw,W.V. (1975) In Colowick,S.P. and Kaplan,N.O. (eds), Methods inEnzymology. Academic Press, New York, pp. 737-755.

Sparling,P.F. (1966) J. Bacteriol., 92, 1364-1371.Stern,A., Brown,M., Nickel,P. and Meyer,T.F. (1986) Cell, 47, 61-71.Swanson,J. (1973) J. Exp. Med., 127, 571-589.Swanson,J., Bergstrom,S., Robbins,K., Barrera,O., Corwin,D. and

Koomey,J.M. (1986) Cell, 47, 267-276.Weiss,A.A. and Falkow,S. (1984) Infect. Immun., 43, 263-269.Winans,S.C., Ebert,P.R., Stachel,S.E., Gordon,M.P. and Nester,E.W.

(1986) Proc. Natl. Acad. Sci. USA, 83, 8278-8282.Yanisch-Perron,C., Vieira,J. and Messing,J. (1985) Gene, 33, 103-119.Zubay,G., Chambers,D.A. and Cheong,L.C. (1970) 7he Lactose Operon.

Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp.375 -391.

Received on May 19, 1988; revised on September 21, 1988

Note added in proofTwo putative DNA uptake sequences required for gonococcal specifictransformation are present in pilA-pilB region [Goodman and Scocca(1988), Proc. Natl. Acad. Sci. USA, 85, 6982-6986]. Each consists ofan inverted duplication in the pilB terminator (Figure 4B) and the opaElterminator (Figure 4A).

4378

pilin expression in neisseria gonorrhoeae is under both positive

Documents