at SciVerse ScienceDirect

Plant Physiology and Biochemistry 57 (2012) 254e260

Contents lists available

Plant Physiology and Biochemistry

journal homepage: www.elsevier .com/locate/plaphy

Research article

Phytostabilization of nickel by the zinc and cadmium hyperaccumulator Solanumnigrum L. Are metallothioneins involved?

Pedro Ferraz a,b, Fernanda Fidalgo a,b, Agostinho Almeida c, Jorge Teixeira a,b,*

aBioFIGeCenter for Biodiversity, Functional & Integrative Genomics, PortugalbDepartamento de Biologia, Faculdade de Ciências, Universidade do Porto, Ed. FC4, Rua do Campo Alegre, s/n, 4169-007 Porto, PortugalcREQUIMTE, Departamento de Ciências Químicas, Faculdade de Farmácia, Universidade do Porto, Rua Aníbal Cunha, 164, 4090-030 Porto, Portugal

a r t i c l e i n f o

Article history:Received 1 March 2012Accepted 29 May 2012Available online 6 June 2012

Keywords:Black nightshadeGene expressionHeavy metal homeostasisMetallothioneinsNickelPhytoremediation

Abbreviations: FW, fresh weight; HM, heavy metMT, metallothioneins; ROS, Reactive Oxygen Species; Rcoupled to the polymerase chain reaction.* Corresponding author. Departamento de Biologia

versidade do Porto, Ed. FC4, Rua do Campo Alegre, sTel.: þ351 220402701; fax: þ351 220402709.

E-mail addresses: ferraz87@gmail.com (P. Ferraz),aalmeida@ff.up.pt (A. Almeida), agteixei@fc.up.pt(J. Teixeira).

0981-9428/$ e see front matter � 2012 Elsevier Mashttp://dx.doi.org/10.1016/j.plaphy.2012.05.025

a b s t r a c t

Some heavy metals (HM) are highly reactive and consequently can be toxic to living cells when present athigh levels. Consequently, strategies for reducing HM toxicity in the environmental must be undertaken.This work focused on evaluating the Nickel (Ni) accumulation potential of the hyperaccumulator Solanumnigrum L., and the participation of metallothioneins (MT) in the plant Ni homeostasis. Metallothioneins(MT) are gene-encoded metal chelators that participate in the transport, sequestration and storage ofmetals. After different periods of exposure to different Ni concentrations, plant biometric andbiochemical parameters were accessed to determine the effects caused by this pollutant. Semi-quantitative RT-PCR reactions were performed to investigate the specific accumulation of MT-relatedtranscripts throughout the plant and in response to Ni exposure. The data obtained revealed that Niinduced toxicity symptoms and accumulated mostly in roots, where it caused membrane damage in theshock-treated plants, with a parallel increase of free proline content, suggesting that proline participatesin protecting root cells from oxidative stress. The MT-specific mRNA accumulation analysis showed thatMT2a- and MT2d-encoding genes are constitutively active, that Ni stimulated their transcript accumu-lation, and also that Ni induced the de novo accumulation of MT2c- and MT3-related transcripts in shoots,exerting no influence on MT1 mRNA accumulation. These results strongly suggest the involvement ofMT2a, MT2c, MT2d and MT3 in S. nigrum Ni homeostasis and detoxification, this way contributing to theclarification of the roles the various types of MTs play in metal homeostasis and detoxification in plants.

� 2012 Elsevier Masson SAS. All rights reserved.

1. Introduction

The environmental pollution caused by heavy metals (HM) is,nowadays, a major ecological problem with disastrous futureconsequences to our planet. The origin of these pollutants in theenvironment comes primarily from the release of untreatedindustrial waste effluents. The ecological unconsciousnesscombined with the lack of legislation in many countries has led tothe accumulation of these metals in soils and watercourses,affecting all living organisms, from bacteria to animals, including

als; MDA, malondialdehyde;T-PCR, Transcriptase reaction

, Faculdade de Ciências, Uni-/n, 4169-007 Porto, Portugal.

ffidalgo@fc.up.pt (F. Fidalgo),, jorgeg.teixeira@gmail.com

son SAS. All rights reserved.

humans [1]. An example of such pollutants is nickel (Ni), anelement that is essential to some living beings, including plants, butthat could be an environmental contaminant when present in highconcentrations [2].

Ni is the twenty-second most abundant element in the earth’scrust, where it occurs in igneous rocks as a free metal or togetherwith iron [3]. Ni is released into the environment mainly fromanthropogenic activities, such as metal mining, smelting, fossil fuelburning, vehicle emissions, industrial and municipal wastes andfertilizer applications [2]. Ni is essential for higher plants in lowconcentrations, and its uptake and transport is involved in someplant physiological processes. The uptake of Ni in plants is carriedout mainly by root systems via passive diffusion (cation transportsystem) and active transport, using the magnesium (Mg) iontransport system, due to the similar charge/size ratio of these twometal ions, or by high-affinity nickel transport proteins [2].Although Ni is an essential mineral nutrient for plant growth,excess Ni has been reported to cause toxicity symptoms includingretardation of germination, growth inhibition, leaf necrosis and

P. Ferraz et al. / Plant Physiology and Biochemistry 57 (2012) 254e260 255

chlorosis, and disruption of photosynthesis [2,4,5]. Some studiessuggest that Ni toxicity in plants is associated with the interferenceof this metal with the uptake and transport of other essential metalions, such as iron, copper and zinc, and with the induction ofoxidative stress, which leads to DNA damage and alterations in cellmembranes [2].

Plants have developed several antioxidant mechanisms, bothenzymatic and non-enzymatic, to prevent the damage caused bythe overproduction of ROS. Concerning non-enzymatic mecha-nisms, the accumulation of soluble proline is recognized as havingan important protective function against heavy metal stress, beingreported to act as a radical scavenger or involved in metal chelation[6]. In addition, the lipid-soluble antioxidants carotenoids playa multitude of functions in plant metabolism including oxidativestress tolerance [7]. Thus, the quantification of membrane damage,carotenoids and free proline levels in plants exposed to high HMconcentrations serve as indicators of the adverse effects caused bysuch exposure, thus allowing knowing how much plants havesuffered from this type of environmental stress.

The recognition of the problem of HM pollution by internationalauthorities led to the implementation of stricter laws to controldischarges of these metals into the environment, and to thedevelopment of technologies to solve this serious ecologicalproblem. Phytoremediation is an emerging technology that usesplants and their rhizosphere-associated microbes for environ-mental cleanup [8e11]. Various phytoremediation strategies arepossible, with different phytotechnologies profiting from differentplant properties. Concerning metal decontamination of soils, themain treatment streamlines are phytostabilization, the use ofplants to stabilize pollutants in soil, either by preventing leachingor erosion, or by converting pollutants into less bioavailable andtoxic [1,11], and phytoextraction, the use of plants to clean uppollutants via extraction and accumulation of the toxic elements inharvestable tissues [11e13]. A concept that has accompanied thedevelopment of phytoextraction strategies is the so-called hyper-accumulators, which are plant species who are able to accumulatein their harvestable tissues one ormore inorganic elements, such asHM, to levels 100-fold higher than other species [14].

Solanum nigrum L., commonly known as black nightshade, isaplant species thathasbeenreported tohyperaccumulateHMsuchascadmium and zinc, and has the particularity of being a fast growing,easily adaptable plant and having a greater biomass than mosthyperaccumulators [15], making it a potential candidate for phytor-emediation and for the accumulation of other metals, such as Ni.

Hyperaccumulation has been recognized as an extreme physio-logical response to heavy metal tolerance. Thus, to tolerate highconcentrations of metals in their tissues, plants use several metal-binding biomolecules, including low-molecular-weight ligands andsmall metal-binding proteins, such as histidine, organic acids, phy-tosiderophores, phytochelatins and metallothioneins (MT), in orderto sequester, transport and store the accumulated metals [16e18].

MTs are low molecular weight, cysteine-rich, metal-bindingproteins, that are products of mRNA translation. The classificationof these proteins is one of the most controversial issues involvingits study [19]. Due to the high protein similarity between the

Fig. 1. Sequence alignments of the predicted protein sequence for the known S. nigrum MSequences were aligned by the ClustalW program [38]. Black boxes represent the cysteine

different MTs, the proposed classifications are based on thearrangement of their cysteine residues [20]. Although there areseveral conflicting classifications, the most accepted and followedby researchers is the classification of the various plant MTs into fourtypes: MT1 (subtypes a, b, c), whose gene expression is higher inroots than shoots, MT2 (subtypes a, b, c, d), in which geneexpression occurs mostly in shoots, MT3 (subtypes a, b, c), that hasa specific accumulation of their transcripts in fleshy fruits as theyripen, and MT4, whose gene expression is restricted to developingseeds [16,21]. Regarding S. nigrum MT system, the availableS. nigrum MT-encoding cDNA sequences at the NCBI database(www.ncbi.nlm.nih.gov, 2010) belong only to MT types 2 and 3(Fig. 1), which hinders the study of these proteins in this plantspecies.

Although these proteins have beenwidely studied, their specificcontribution toward plant metal homeostasis is poorly known.Nevertheless, there is some evidence of their involvement incopper tolerance, and in the transport of cadmium and zinc [16],which suggests that these proteins could be the peptide complexesfirst reported in 1988, which are involved in Ni transport in thexylem [22]. Furthermore, recent studies have suggested that thehistidine residues of MT molecules may also be related to thesequestration and transport of metal ions in plants [23].

Thus, it is possible that MTs have an important role in planthomeostasis and detoxification of other HM, including Ni, and maybe involved in transporting and chelating such pollutants in planttissues, as previously described for the aquatic fern Azolla fili-culoides [24]. In this way, determining the real functions of theseproteins in higher plants remains a fascinating challenge.

This work focused on evaluating the Ni accumulation potentialof the Cd, Zn hyperaccumulator S. nigrum L., and the participation ofMTs in the plant Ni homeostasis. Several biometric and biochemicalparameters were determined in order to evaluate the effects of theexposure to this metal in S. nigrum plants. The quantification of Niaccumulation was also performed to verify if this plant can beconsidered a hyperaccumulator of this HM and/or if it can be usedfor phytoremediation purposes. RT-PCR semi-quantitative reac-tions were performed to investigate the specific accumulation ofMT’s transcripts in roots and shoots, in order to discriminate theparticipation of these proteins in S. nigrum Ni homeostasis, so thattheir specific contribution toward HM homeostasis may be furtherclarified.

2. Results

2.1. Metal exposure effects on biometric parameters

At the end of the exposure period, Ni-treated plants showedvisible signs of metal toxicity, such as growth reduction. Thedetermined biometric parameters of Ni-exposed plants can beobserved in Fig. 2. Shoot fresh weight significantly decreased by52% with the 7.5 mM Ni treatment and 45% with the 100 mM Nishock treatment. Root fresh weight significantly decreased by 65%with both Ni treatments (Fig. 2A). Shoot dry weight significantlydecreased by 61% and 54% in 7.5 mM and 100 mM Ni-treatments,

T-encoding cDNAs available at the NCBI database (2010): MT2 group and MT3 group.domains used for MT classification according to Cobbett and Goldsbrough [16].

Fig. 2. Biometric parameters of control and Ni-treated S. nigrum plants. A) freshweight, B) dry weight, C) shoot and root length. Columns represent mean þ S.D. oftriplicates (n � 3). S e shoots (grey bars); R e roots (white bars); C e control; 7.5 e

7.5 mM Ni; 100 e 100 mM Ni. Asterisks represent significant differences at P < 0.05.

Fig. 3. Ni levels accumulated in shoots and roots of S. nigrum plants exposed to 7.5 mMor 100 mM Ni. Columns represent mean þ S.D. of triplicates (n � 3). Grey bars corre-spond to shoots (S) and white bars correspond to roots (R).

Fig. 4. A) Lipid peroxidation levels, determined by estimating the MDA content, inS. nigrum control plants and exposed to Ni. B) Proline content of S. nigrum controlplants and exposed to Ni. Columns represent mean þ S.D. of triplicates (n � 3). S e

shoots (grey bars); R e roots (white bars); C e control; 7.5 e 7.5 mM Ni; 100 e 100 mMNi. Asterisks represent significant differences at P < 0.05.

P. Ferraz et al. / Plant Physiology and Biochemistry 57 (2012) 254e260256

respectively. No significant difference was detected in root dryweight values (Fig. 2B).

Shoot length significantly decreased by about 33% with the7.5 mMNi treatment and 30% with the shock treatment. Root lengthdecreased in both treatments, but only significantly at 7.5 mM Nitreatment, by 30% (Fig. 2C).

2.2. Metal accumulation

For each Ni exposure treatment (both prolonged and shock) itwas possible to verify a higher accumulation of Ni in roots than inshoots. No significant variations in Ni accumulation levels wereobserved between both treatments with this metal (Fig. 3). Noaccumulation of Ni was observed regarding control plants (data notshown).

2.3. Biochemical determinations

Lipid peroxidation levels, determined by estimating themalondialdehyde (MDA) content, can be observed in Fig. 4A. Shoot

lipid peroxidation levels were higher compared to roots in alltreatments, and no significant differences in MDA content in shootswere detected among all situations. Root lipid peroxidationsignificantly increased only with the 100 mM Ni treatment, byapproximately 1.3 fold.

As shown in Fig. 4B, shoot free proline content from Ni-treatedplants significantly increased only with the 7.5 mMNi treatment, by1.4 fold. In roots, the proline content significantly increased onlywith the 100 mM Ni treatment, by 1.3 fold.

No significant differences were observed regarding carotenoidsand chlorophyll contents between all growth conditions used (datanot shown).

P. Ferraz et al. / Plant Physiology and Biochemistry 57 (2012) 254e260 257

2.4. MT mRNA accumulation analysis

Due to the high similarity between the available S. nigrum MT-encoding cDNA sequences (types 2 and 3), in particular betweensubtypes MT2a and MT2b, subtypes MT2c and MT2d, and betweenall MT3 sequences, it was only possible to design specific sets ofprimers for MT2b-, MT2c- and MT3c-encoding sequences. Since itwas not possible to obtain specific primers for the other known MTsequences, another set of primers were designed to discriminatethe group MT2a þ b from the MT2c þ d and from the MT3 one.Thus, comparing the results obtainedwith all these pairs of primersit is possible to evaluate the accumulation of all types of S. nigrumMT2- and MT3-encoding mRNAs. Regarding MT1, as there are noavailable MT-encoding cDNA sequences, the strategy used was toelaborate degenerated primers deduced from other MT1 sequencesavailable at the NCBI database. The limiting number of MT1-encoding sequences available plus belonging to species that arephylogenetically distant, added to the misclassification of some ofthe existing ones while others were incomplete, have led to choosethe MT1-encoding cDNA sequences from Arabidopsis thaliana forprimer design.

The analysis by agarose gel electrophoresis of the semi-quantitative RT-PCRs performed to evaluate the accumulation ofthe different types of S. nigrum MT-encoding mRNAs can beobserved in Fig. 5A. The accumulation of MT1-related transcriptsoccurred in both shoots and roots from plants of the control situ-ation and these transcript levels remained constant in shoots from

Fig. 5. A) Analysis by a 1% (w/v) agarose gel electrophoresis of typical RT-PCR reactions pergroup- and MT3 group-related transcripts in shoots (S) and roots (R) of S. nigrum control plaPCR procedures corresponding to 200 ng of RNA loaded and separated by 0.8% (w/v) agaroselocation and size of the corresponding expected amplified products.

both Ni treatments, and decreased in roots from both Ni treat-ments, predominantly in the 7.5 mMNi treatment. NoMT2b-relatedtranscripts were detected in both shoots and roots from all situa-tions analyzed, but could be detected in seedlings (data not shown).This analysis also showed an occurrence of a de novo accumulationof MT2c-related transcripts only in shoots from both Ni treatments,as none were detected in the control situation. No MT3c-relatedtranscripts were detected in both shoots and roots from allanalyzed situations. The accumulation of MT2aþ b- and MT2cþ d-related transcripts occurred in both shoots and roots from plants ofthe control situation and these transcript levels increasedwith bothNi treatments. The MT3-related transcripts accumulated only inshoots of Ni-treated plants, predominantly in the 100 mM Nitreatment.

3. Discussion

Exposure of S. nigrum to high levels of Ni induced variousdeleterious effects on plant development with the appearance oftoxicity symptoms. Both Ni concentrations used in this study led toa significant decrease in root and shoot fresh weight, and in shootlength and dry weight, with a significant parallel increase in watercontent (Fig. 2). Root length only decreased in the 7.5 mM Nitreatment, as the roots of plants from the shock treatment werealready large enough at the onset of Ni exposure (the fourth week),thus not being expected a greater growth of these organsthroughout the last week and therefore no significant differences

formed for the detection of MT1-, MT2b-, MT2c-, MT3c-, MT2a þ b group-, MT2c þ dnts and exposed to Ni. B) Loading controls of the amount of total RNA used for the RT-gel electrophoresis. C e control; 7.5 e 7.5 mM Ni; 100 e 100 mM Ni. Arrows indicate the

P. Ferraz et al. / Plant Physiology and Biochemistry 57 (2012) 254e260258

were detected. These results show that high concentrations of Nicause growth inhibition of S. nigrum’s roots and shoots. Similarresults have already been described for the non-hyperaccumulatorsrice (Oryza sativa L.) [5] and wheat (Triticum aestivum L.) [4]. Thisinhibitory effect may be related to the competition of Ni in theuptake of other essential metal ions, such as magnesium, iron,copper and zinc [2,25], provoking their deficiency and leading toplant growth impairment.

Ni accumulation was always higher in roots than in shoots(Fig. 3), evidencing a slow translocation rate of Ni between theseorgans [26]. Because of this evident accumulation of Ni in S. nigrumroots, this plant species cannot be considered a Ni hyper-accumulator because the quantified levels are lower than 1 mg g�1

dry weight [27]. Nevertheless, it can be used in for Ni phytostabi-lization, preventing its leaching and further contamination ofnatural watercourses.

Of the two Ni treatments, only the one-week 100 mM Ni expo-sure caused an increase in roots’ lipid peroxidation levels (Fig. 4),indicating that these tissues have suffered oxidative membranedamage. An increase in free proline levels in this exact situationwasalso detected, which may contribute to protect root cells from thedamage caused by the Ni-induced oxidative stress [28]. Consideringthe shoots of the 100 mM treatment, there were no significantdifferences in these two parameters, which combined with theabsence of changes in chlorophyll and carotenoids contentssuggests that oxidative stress did not occur in photosynthetictissues of 100 mMNi-treated plants. However, there was an increasein free proline content in shoots of plants treated with 7.5 mM Ni,which can be related to the induction of its synthesis or an inhi-bition of its degradation in response to the metal, even though noapparent oxidative stress was set, similarly to what has beendescribed for rice [28]. However, the participation of other anti-oxidant mechanisms, such as enzymes and other chelating agents,must not be ruled out.

The MT mRNA accumulation analysis (Fig. 5) presented anoverview on the influence of Ni in the regulation of MT1-, MT2- andMT3-related transcript accumulation in shoots and roots from themetal-exposed plants. MT1-related transcripts were constitutivelyaccumulated in plants from the control situation, and these tran-script levels remained constant in shoots from both Ni treatments,while a decrease of transcript levels occurs in the roots from Ni-treated plants. This is a curious result, since the gene expressionof this type of MT was previously described as being higher in rootsthan shoots [16]. This situation suggests that the other groups ofMTs may offset the decrease of MT1-related transcripts levels inroots, the organ where the most of the Ni was accumulated.

MT2a- and MT2d-related transcripts were constitutively accu-mulated in plants from the control situation and the exposure to Nistimulated this accumulation in roots and shoots. Also, Ni inducedthe accumulation of MT2c-related mRNAs only in shoots. Theseresults suggest that MT translocation may occur from aerial tissuesto roots. Because most of the Ni was accumulated in roots, and dueto the decrease of MT1-related transcripts levels in roots from theNi-treated plants; these translocated MT2 may play a protectiverole against the harmful effects of Ni by chelating it and renderingless harmful in these organs. Furthermore, these results suggest theinvolvement of specific MT2 type subfamily members in thedefense process against the exposure to high Ni levels in both rootsand shoots.

MT2b-related transcripts could not be detected in any situationanalyzed, implying that the MT2b members do not participate inmetal homeostasis in full-grown plants.

Regarding MT3-related mRNA accumulation, an increasedtranscript accumulation in shoots was observed only with theexposure to Ni, especially in the shock-treated plants. Since no

MT3c-related transcripts were detected in both shoots and rootsfrom all analyzed situations, these results suggests that only MT3aand/or MT3b were involved in the tolerance to high levels of Ni inS. nigrum. Moreover to the Ni-induction, the accumulation of MT3-related mRNAs in shoots was a surprising result, as these MTs weredescribed as being specific to the process of fruit ripening[16,29e31].

According to the results obtained in this work, it is possible toassume that Ni induced an increased accumulation of MT2a-,MT2d-related transcripts in both roots and shoots, and the de novoaccumulation of the MT2c-, MT3-related transcripts only in shoots,suggesting that these MTs are related to the Ni homeostasis inS. nigrum, thus contributing to the clarification of the roles thevarious types of MTs play in metal homeostasis in plants. Hence,this study showed that S. nigrum can tolerate high concentrations ofNi in the soil solution, uptake it and store it in their roots, and thatthese plants used proline and specific MTs (and possibly otherprotective agents) to protect themselves from the oxidative damagecaused by Ni exposure.

The present results also suggest that the actual classification ofplant MTs may not be the most appropriate, since the accumulationof MT1-related mRNAs decrease in the roots of Ni-treated plantsand the accumulation of MT2-related transcripts were induced inroots from Ni-treated plants. As previously mentioned, the accu-mulation of MT3-related mRNAs in shoots was an unexpectedresult, as these MTs were described as being specific to the processof fruit ripening. Taken together, these results demonstrate that thisclassification is not linear and that the gene expression and thetranscript distribution in the plant bodymay vary depending on theplant species. Furthermore, the fact that the histidine residues ofMT molecules may also play a role in metal transport in plants,reinforces the idea that the classification based on the arrangementof MT cysteine residues may not be sufficiently adequate.

4. Methods

4.1. Growth conditions and biometric analysis

Fifteen days after germination, S. nigrum L. plants were grownhydroponically in plastic pots, using a mixture of vermiculite andperlite (2:1) as substrate under greenhouse conditions for fourweeks in a nutrient solution (Hoagland solution) [32] suppliedunder 3 different situations: one set without Ni; another oneexposed to 7.5 mM Ni (as NiSO4$6H2O), simulating a soil contami-nated with this metal; and the third consisted on a short shocktreatment with 100 mM Ni throughout the last week, simulatinga discharge of high concentrations of this pollutant to an uncon-taminated soil. These metal concentrations were set in preliminaryseed germination tests in the nutrient media supplemented withincreasing concentrations of Ni (data not shown).

At the end of the treatment period, at least 3 plants from eachcondition were used for the determination of several biometricparameters: root and shoot fresh weight, dry weight and length.Roots and shoots from these plants were frozen and grinded withliquid N2, and the resulting powder was stored at�80 �C until used.

4.2. Metal accumulation analysis

Root and shoot samples were washed with tap water, followedby further washing with HCl 0.1 M and demineralized water. Then,the plant material was oven-dried (60 �C), grinded to a fine powderand stored at room temperature until used. For Ni determination,a microwave-assisted acid digestion in closed vessels was per-formed, originating acid extracts that were analyzed by inductivelycoupled plasmaemass spectrometry (ICPeMS). Briefly, sample

P. Ferraz et al. / Plant Physiology and Biochemistry 57 (2012) 254e260 259

masses up to 500 mg were placed in microwave oven vessels and3 mL of concentrated (65% w/v) HNO3 (Suprapur�, Merck) and1.5 mL of 30% (w/v) H2O2 (Fluka) were added. Then, the vesselswere sealed and heated in the microwave unit (a Milestone MLS1200 mega, equipped with an HPR-1000/10 S rotor) according tothe following time (min.)/power (W) program: 1/250e 2/0e 5/250e 5/400 e 5/600. After cooling, the vessels content were trans-ferred into 25 mL volumetric flasks and diluted to volume withultrapure water (Milli-Q, Millipore). ICPeMS analysis was per-formed using a VG Elemental, PlasmaQuad 3 (quadrupole-based)instrument, equipped with concentric glass nebulizer (MeinhardType A), water-cooled glass spray chamber with impact-bead,standard quartz torch and nickel skimmer and sampling cones.For sample introduction, a Minipuls 3 (Gilson) peristaltic pumpwasused. 60Ni was monitored as analytical isotopes and 45Sc and 89Yas internal standards. Results were expressed as mg of metal g�1 ofsample (dry weight).

4.3. Lipid peroxidation

Lipid peroxidation levels in roots and shoots were determinedby estimating the malondialdehyde (MDA) content as described byRef. [33]. About 400 mg of stored frozen powder were used for eachreaction. The concentration of MDA was calculated using theextinction coefficient of 155 mM�1 cm�1 and results wereexpressed as nmol MDA g�1 fresh weight.

4.4. Proline content

Proline was quantified as described by Bates et al. [34]. Prolinewas extracted from plant samples by homogenization of150e200 mg of frozen powder in 3% (w/v) sulphosalicylic acid withquartz sand. Results were expressed as mg proline g�1 fresh weight.

4.5. Chlorophylls and carotenoids content

Photosynthetic pigments from 120 to 150 g of shoots frozensamples were extracted in 80% (v/v) acetone with quartz sand. Thehomogenate was centrifuged at 2150� g for 10 min. After centri-fugation, the absorbance of the supernatant was measured at 470,647 and 663 nm, and chlorophylls and carotenoids contents wereestimated from the formulas of Lichtenthaler [35]. Results wereexpressed as mg g�1 fresh weight.

4.6. Primers design

Available S. nigrum MT-encoding cDNA sequences (www.ncbi.nlm.nih.gov, 2010): MT2a (GenBank ID: EU760481.1); MT2b (Gen-Bank ID: EU760482.1); MT2c (GenBank ID: EU760483.1); MT2d(GenBank ID: EU760484.1); MT3a (GenBank ID: FJ546423.1); MT3b(GenBank ID: FJ546424.1); MT3c (GenBank ID: FJ546425.1), werealigned (Blastn), and the resulting alignments were submitted tothe PrimerIdent software (http://primerident.up.pt, 2010) [36] forMT-specific primers’ design. Due to the high similarity between theavailable S. nigrum MT sequences, it was only possible to designspecific sets of primers (forward and reverse) for MT2b-, MT2c- andMT3c-encoding sequences. Another set of primers were designedto discriminate the group MT2a þ b from the MT2c þ d and fromthe MT3 one, as previously described in section 2.4. Regarding MT1,as there are no available S. nigrumMT-encoding cDNA sequences atthe NCBI database, the strategy used was to elaborate degeneratedprimers deduced from MT1-encoding cDNA sequences from A.thaliana: MT1a (GenBank ID: NM_100633.2); MT1b (GenBank ID:NM_001037008.2); MT1c (GenBank ID: NM_100634.1).

The forward primer and reverse primer sequences, meltingtemperature (TM) and the expected amplified size from each groupof MTs analyzed are:

MT1: 50 eGCAGTT GCGAGA AGA ACTACe 30, 50 e CCAGTGAGCAGAGTGACGAGGACT CGAGCT CAAGCe 30, TM¼ 52 �C,z380 bp;MT2b: 50 eGGGATC CGATTATGT CTT Ge 30, 50 eATTACC AGA AGCAGAGAT GCe 30, TM¼ 46 �C, 433 bp; MT2c: 50 eGAT GTG GGATGTACC CTG AC e 30, 50 e GTT ACA AGC CCA TGT CAA CTT C e 30,TM¼ 49 �C, 362 bp;MT3c: 50 eGTCGGACAAGTGTAGTAGTTGe 30,50 eAGA CCA AAG AGA CAG ACT AGA G e 30, TM ¼ 44 �C, 340 bp;MT2ab: 50 e GCT GTG GAG GAT GCA AGA T e 30, 50 e CTT AGA GCAAGT GCA AGG GTT AC e 30, TM ¼ 50 �C, 191 bp; MT2cd: 50 e GATGTG GGA TGT ACC CTG AC e 30, 50 e GCA GTT TGA TCC ACA TTTGC e 30, TM ¼ 49 �C, 146 bp; MT3: 50 e TGC TGA TGT CAG CCAATG e 30, 50 e CCA GTG AGC AGA GTG ACG AGG ACT CGA GCT CAAGC e 30, TM ¼ 48 �C, 440 bp.

As MT4 are exclusive from seeds, this group was not consideredin this study.

4.7. RNA extraction and MT RT-PCRs

Total RNA extraction was performed using the Trizol reagent(Invitrogen, USA), according to the manufacturer instructions. RNAconcentration and quality were spectrophotometrically assessedand electrophoretically confirmed, respectively, and RNA prepara-tions were stored at �80 �C until used.

Analysis of MT transcript accumulation was performed byoptimized semi-quantitative RT-PCRs [37]. RT reactions for eachtreatment/organwere performed using the Reverase (M-MuLV RT)reagents (Bioron, Germany), according to the instructions supplied.The RT procedure used 5 mg of total RNA as starting template, and1 mg of the primer complementary to the poly-A tail 50 e TTT TTTTTT TTT TCG AAC TCG AGC TCA GGA GCA GTG AGA CGA GTGACC e 30. RT final reactions were kept at �80 �C until needed.

PCR was performed in a 25 mL reaction composed of 1 mL of theRT reaction, 1x PCR complete buffer (with MgCl2), 0.2 mM dNTPs,0.1 mMof forward primer, 0.1 mMof reverse primer and 1.25 U of TaqDNA Polymerase (Fermentas, Lithuania). The PCR reactions wereset on a Mastercycler Gradient thermocycler (Eppendorf, USA) withthe following optimized program: an initial denaturation step at94 �C for 1 min, followed by 35 cycles of 94 �C e 3000, TM (specificfor each primer pairing) e 3000, 72 �C e 3000. The final extension, forcompleting uncompleted DNA strands, was performed at 72 �C for3 min. At least 3 RT-PCR reactions were performed for eachanalyzed mRNA. Reaction mixtures were analyzed by 1% (w/v)agarose gel electrophoresis. All gels were captured using the“Kodak EDAS 290 imaging system” and the “Kodak 1D softwarev.3.5.4” (Kodak, USA).

4.8. Statistical analysis

Biometric parameters, biochemical determinations, and metalaccumulation assays were performed at least in triplicate (n � 3).Variance analysis was performed by Fisher test and themeans werestatistically analyzed using a two-sided t-test. Statistical signifi-cance is assumed at P � 0.05.

Acknowledgments

The authors gratefully acknowledge the University of Porto forfinancial support (Project MetalloChromium, IJUP 2010/11) withthe contribution of Santander Totta.

P. Ferraz et al. / Plant Physiology and Biochemistry 57 (2012) 254e260260

References

[1] S. Eapen, S.F. D’Souza, Prospects of genetic engineering of plants for phytor-emediation of toxic metals, Biotechnol. Adv. 25 (2005) 97e114.

[2] C. Chen, D. Huang, J. Liu, Functions and toxicity of nickel in plants: recentadvances and future prospects, Clean 37 (2009) 304e313.

[3] F.W. Sunderman, A. Oskarsson, Nickel, in: E. Merian (Ed.), Metals and TheirCompounds in the Environment: Occurrence, Analysis and Biological Rele-vance, VCH, Weinteim, Cambridge, 1991, pp. 1101e1126.

[4] E. Gajewska, M. Sklodowska, M. Slaba, J. Mazur, Effect of nickel on anti-oxidative enzyme activities, proline and chlorophyll contents in wheat shoots,Biol. Plant 50 (2006) 653e659.

[5] Y.C. Lin, C.H. Kao, Nickel toxicity of rice seedlings: cell wall peroxidase, lignin,and NiSO4-inhibited root growth, crop, Environ. Bioinform. 2 (2005) 131e136.

[6] S.A.L. Andrade, P.L. Gratão, M.A. Schiavinato, A.P.D. Silveira, A.A. Azevedo,P. Manzzafera, Zn uptake, physiological response and stress attenuation inmycorrhizal jack bean growing in soil with increasing Zn concentrations,Chemosphere 75 (2009) 1363e1370.

[7] S.S. Gill, N. Tuteja, Reactive oxygen species and antioxidant machinery inabiotic stress tolerance in crop plants, Plant Physiol. Biochem. 48 (2010)909e930.

[8] M.M. Lasat, Phytoextraction of toxic metals: a review of biological mecha-nisms, J. Environ. Qual. 31 (2002) 109e120.

[9] D.E. Salt, M.J. Blaylock, N.P.B.A. Kumar, V. Dushenkov, B.D. Ensley, I. Chet,I. Raskin, Phytoremediation: a novel strategy for the removal of toxic metalsfrom the environment using plants, Nat. Biotechnol. 13 (1995) 468e474.

[10] D.E. Salt, R.D. Smith, I. Raskin, Phytoremediation, Annu. Rev. Plant Physiol.Plant Mol. Biol. 49 (1998) 643e668.

[11] E. Pilon-Smits, Phytorremediation, Annu. Rev. Plant Biol. 56 (2005) 15e39.[12] M.J. Blaylock, J.W. Huang, Phytoextraction of metals, in: I. Raskin, B. Ensley

(Eds.), Phytoremediation of Toxic Metals. Using Plants to Clean up the Envi-ronment, Wiley, New York, 2000, pp. 53e70.

[13] G.S. Bañuelos, D.W. Meek, Accumulation of selenium in plants grown onselenium-treated soil, J. Environ. Qual. 19 (1990) 772e777.

[14] R.D. Reeves, Hyperaccumulation of nickel by serpentine plants, in: J. Proctor,A. Baker, R. Reeves (Eds.), The Vegetation of Ultramafic (Serpentine) Soils,Intercept Ltd., Andover, 1992, pp. 253e277.

[15] A.P.G.C. Marques, R.S. Oliveira, A.O.S.S. Rangel, P.M.L. Castro, Zinc accumula-tion in Solanum nigrum is enhanced by different arbuscular mycorrhizalfungi, Chemosphere 65 (2006) 1256e1263.

[16] C. Cobbett, P.B. Goldsbrough, Phytochelatins and metallothioneins: roles inheavy metal detoxification and homeostasis, Annu. Rev. Plant Biol. 53 (2002)159e182.

[17] D.L. Callahan, A.J.M. Baker, S.D. Kolev, A.G. Wedd, Metal ion ligands inhyperaccumulating plants, J. Biol. Inorg. Chem. 11 (2006) 2e12.

[18] L. Kerkeb, U. Krämer, The role of free histidine in xylem loading of nickel inAlyssum lesbiacum and Brassica juncea, Plant Physiol. 131 (2003) 716e724.

[19] E. Freisinger, Plant MTs e long neglected members of the metallothioneinsuperfamily, Dalton Trans. 47 (2008) 6663e6675.

[20] G.M. Cherian, H.M. Chan, Biological functions of metallothioneins: a review,in: K. Suzuki, N. Imura, M. Kimura (Eds.), Metallothionein III: Biological Rolesand Medical Implications, Birkhauser Verlag, Basel, 1993, pp. 87e109.

[21] N.J. Robinson, A.M. Tommey, C. Kuske, P.J. Jackson, Plant metallothioneins,Biochem. J. 295 (1993) 1e10.

[22] D.A. Cataldo, K.M. McFadden, T.R. Garland, R.E. Wildung, Organic constituentsand complexation of nickel(II), iron(III), cadmium(II), and plutonium(IV) insoybean xylem exudates, Plant Physiol. 86 (1988) 734e739.

[23] A. Torreggiani, A. Tinti, Raman spectroscopy a promising technique forinvestigations of metallothioneins, Metallomics 2 (2010) 246e260.

[24] T. Schor-Fumbarov, P.B. Goldsbrough, Z. Adam, E. Tel-Or, Characterization andexpression of a metallothionein gene in the aquatic fern Azolla filiculoidesunder heavy metal stress, Planta 223 (2005) 69e76.

[25] B.Y. Khalid, J. Tinsley, Some effects of nickel toxicity on rye grass, Plant Soil 55(1980) 139e144.

[26] S.K. Panda, S. Choudhury, Chromium stress in plants, Braz. J. Plant Physiol. 17(2005) 95e102.

[27] U. Krämer, Metal hyperaccumulation in plants, Annu. Rev. Plant Biol. 61(2010) 517e534.

[28] Y.C. Lin, C.H. Kao, Proline accumulation induced by excess nickel in detachedrice leaves, Biol. Plant 51 (2007) 351e354.

[29] S.K. Clendennen, G.D. May, Differential gene expression in ripening bananafruit, Plant Physiol. 115 (1997) 463e469.

[30] S.E. Ledger, R.C. Gardner, Cloning and characterization of five cDNAs for genesdifferentially expressed during fruit development of kiwifruit (Actinidia deli-ciosa var. deliciosa), Plant Mol. Biol. 25 (1994) 877e886.

[31] S.J. Reid, G.S. Ross, Up-regulation of two cDNA clones encodingmetallothionein-likeproteins inapple fruitduringcool storage,Physiol. Plant100(1997)183e189.

[32] D.R. Hoagland, D.I. Arnon, The Water-culture Method for Growing PlantsWithout Soil. Circular 347, Univ. of Calif. Agric. Exp. Station, Berkley, 1950.

[33] R.L. Heath, L. Packer, Photoperoxidation in isolated chloroplasts, Arch. Bio-chem. Biophys. 125 (1968) 189e198.

[34] L.S. Bates, R.P. Waldren, I.D. Teare, Rapid determination of free proline forwater-stress studies, Plant Soil 39 (1973) 205e207.

[35] H.K. Lichtenthaler, Chlorophylls and carotenoids: pigments of photosyntheticbiomembranes, Methods Enzymol. 148 (1987) 350e382.

[36] A.M. Pessoa, S. Pereira, J. Teixeira, PrimerIdent: a web based tool for conservedprimer design, Bioinformation 5 (2010) 52e54.

[37] J. Teixeira, F. Fidalgo, Salt stress affects glutamine synthetase activity andmRNA accumulation on potato plants in an organ-dependent manner, PlantPhysiol. Biochem. 47 (2009) 807e813.

[38] M.A. Larkin, G. Blackshields, N.P. Brown, R. Chenna, P.A. McGettigan,H. McWilliam, F. Valentin, I.M. Wallace, A. Wilm, R. Lopez, J.D. Thompson,T.J. Gibson, D.G. Higgins, Clustal W and Clustal X version 2.0, Bioinformatics 23(2007) 2947e2948.