Pathway-specific Profiling Identifies the NF-�B-dependent TumorNecrosis Factor �-regulated Genes in Epidermal Keratinocytes*

Received for publication, October 15, 2004, and in revised form, January 31, 2005Published, JBC Papers in Press, February 18, 2005, DOI 10.1074/jbc.M411758200

Tomohiro Banno‡§, Alix Gazel‡, and Miroslav Blumenberg‡¶�**

From the Departments of ‡Dermatology and ¶Biochemistry and the �Cancer Institute, New York University School ofMedicine, New York, New York and the §Dermatology Department, Institute of Clinical Medicine, Tsukuba University,1-1-1, Tennodai, Ibaraki 305-8575, Japan

Identification of tumor necrosis factor � (TNF�) as thekey agent in inflammatory disorders led to new thera-pies specifically targeting TNF� and avoiding many sideeffects of earlier anti-inflammatory drugs. However, be-cause of the wide spectrum of systems affected by TNF�,drugs targeting TNF� have a potential risk of delayingwound healing, secondary infections, and cancer. In-deed, increased risks of tuberculosis and carcinogenesishave been reported as side effects after anti-TNF� ther-apy. TNF� regulates many processes (e.g. immune re-sponse, cell cycle, and apoptosis) through several signaltransduction pathways that convey the TNF� signals tothe nucleus. Hypothesizing that specific TNF�-depend-ent pathways control specific processes and that inhibi-tion of a specific pathway may yield even more preciselytargeted therapies, we used oligonucleotide microar-rays and parthenolide, an NF-�B-specific inhibitor, toidentify the NF-�B-dependent set of the TNF�-regulatedgenes in human epidermal keratinocytes. Expression of�40% of all TNF�-regulated genes depends on NF-�B;17% are regulated early (1–4 h post-treatment), and 23%are regulated late (24–48 h). Cytokines and apoptosis-related and cornification proteins belong to the “early”NF-�B-dependent group, and antigen presentation pro-teins belong to the “late” group, whereas most cell cycle,RNA-processing, and metabolic enzymes are not NF-�B-dependent. Therefore, inflammation, immunomodula-tion, apoptosis, and differentiation are on the NF-�Bpathway, and cell cycle, metabolism, and RNA process-ing are not. Most early genes contain consensus NF-�Bbinding sites in their promoter DNA and are, presum-ably, directly regulated by NF-�B, except, curiously, thecornification markers. Using siRNA silencing, we iden-tified cFLIP/CFLAR as an essential NF-�B-dependentantiapoptotic gene. The results confirm our hypothesis,suggesting that inhibiting a specific TNF�-dependentsignaling pathway may inhibit a specific TNF�-regu-lated process, leaving others unaffected. This could leadto more specific anti-inflammatory agents that are bothmore effective and safer.

TNF�1 is the key initiator of inflammation; however, itsderegulation causes many disorders, including toxic shock syn-drome, rheumatoid arthritis, inflammatory bowel disease, pso-riasis, etc. (1). Therefore, drugs targeting TNF� have beendeveloped for inflammatory diseases, with expectations thatthese drugs would be more specific and avoid many side effectsof the previous drugs, glucocorticoids and nonsteroidal anti-inflammatory drugs (2). However, the wide spectrum of pro-cesses affected by TNF� precludes our understanding and pre-dicting fully the effects and side effects of the TNF�-targetedtherapies. Overinhibiting the TNF� signals has a potential riskof delaying wound healing, secondary infections, and cancer;indeed, increased risks of tuberculosis and carcinogenesis havebeen reported as side effects after anti-TNF� therapy (3, 4). Webelieve that the dissection and comprehensive characterizationof the pathways and genes regulated by TNF� will identifyeven more specific and finely tuned targets, which affect only aparticular, defined subset of the TNF�-regulated genes. Inhib-iting such could lead to anti-inflammatory treatments that areboth more effective and safer. Therefore, we decided to dissectthe epidermal responses to TNF� using pathway-specific pro-filing. Here, we identify the NF-�B-dependent TNF�-regulatedgenes in epidermal keratinocytes.

The binding of TNF� to its receptor triggers a series ofintracellular events, resulting in the activation of transcriptionfactors, including NF-�B, CEBR� and AP-1 (5, 6). Differentcellular processes seem to be differentially regulated by specificsignal transduction pathways. For example, NF-�B activationimpedes TNF�-induced apoptosis, whereas AP1 activation doesnot (7), in epidermis; activated NF-�B inhibits, whereas c-JunN-terminal kinase promotes, TNF�-induced hyperproliferation(8–11), etc. TNF� causes activation of IKKs, kinases that phos-phorylate I�B and induce its degradation, which results inactivation of NF-�B. Importantly, knock-out of IKK� has asevere cutaneous phenotype with incomplete epidermal differ-entiation, which suggests a fundamental role for NF-�B in skin(12, 13). A knock-out of IKK� is defective in signaling fromTNF� to NF-�B, whereas deletion mutations of the IKK�/NEMO account for most cases of incontinentia pigmenti, adominantly inherited X-linked genodermatosis (14, 15). NF-�Bis present in all epidermal layers but is nuclear only in thesuprabasal ones, which further implicates NF-�B in epidermaldifferentiation (8). Constitutive activation of NF-�B in I�B-knock-out mice results in a widespread and lethal dermatitis inthe first few days of life (16), and overexpression of NF-�Binhibits keratinocyte proliferation (8). Conversely, overexpres-

* This work was supported by National Institutes of Health GrantAR41850, by a grant from the DebRA-UK foundation with additionalsupport from DebRA of America, and Ministry of Education, Culture,Sports, Science and Technology of Japan Grant-in-aid 13770429 (toT. B.). The costs of publication of this article were defrayed in part bythe payment of page charges. This article must therefore be herebymarked “advertisement” in accordance with 18 U.S.C. Section 1734solely to indicate this fact.

** To whom correspondence should be addressed: Dept. of Dermatol-ogy, NYU School of Medicine, 550 First Ave., New York, NY 10016. Tel.:212-263-5924; Fax: 212-263-8752; E-mail: blumem01@med.nyu.edu.

1 The abbreviations used are: TNF�, tumor necrosis factor �; TUNEL,terminal dUTP nick-end labeling; GAPDH, glyceraldehyde-3-phosphatedehydrogenase; siRNA, small interfering RNA; cFLIP, cellular FLICEinhibitory protein.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 280, No. 19, Issue of May 13, pp. 18973–18980, 2005© 2005 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

This paper is available on line at http://www.jbc.org 18973

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

sion of I�B causes hyperplasia and inflammation and leads tosquamous cell carcinomas (9, 10). Therefore, we decided to usepathway-specific transcriptional profiling and identify compre-hensively the NF-�B-dependent, TNF�-regulated genes in epi-dermal keratinocytes.

Many environmental stimuli, such as microbial infections,chemicals, and UV light, can activate the NF-�B pathways (17,18). We have recently characterized the complete spectrum ofTNF�-regulated genes in the epidermis, using large DNA mi-croarrays (19). To identify the NF-�B-dependent subset ofTNF�-regulated genes, we used parthenolide, which specifi-cally blocks the degradation of I�B�, resulting in immediateand persistent inhibition of activation of NF-�B, without affect-ing other pathways (20). We chose parthenolide, a pharmaco-logic agent, over genetic inhibitor (e.g. transfection with a dom-inant inhibitor of the pathway) to avoid the need for long termcultivation of keratinocytes in the absence of functional NF-�B,which could affect additional pathways (21). Using pathway-specific gene expression profiling, we identified the NF-�B-de-pendent genes in normal human keratinocytes and revealedthat NF-�B is responsible for innate immunity, inflammation,cytoskeletal organization, and cellular survival against apo-ptotic signals.

EXPERIMENTAL PROCEDURES

Human Keratinocyte Cultures and Cytokine Treatment—Human neo-natal foreskin epidermal keratinocytes were first grown in a definedgrowth medium, KGM, supplemented with 2.5 ng/ml epidermal growthfactor and 0.05 mg/ml bovine pituitary extract (keratinocyte-SFM; In-vitrogen), as described (22, 23). Third-passage keratinocytes were usedat 50–70% confluence, at which point we switched to KBM, the samemedium but unsupplemented. Keratinocytes were treated 24 h laterwith 50 ng/ml human recombinant TNF� (Sigma), 10 �M parthenolide(BIOMOL), or both. We first optimized the parthenolide concentrationand found that the 20 �M level is lethal to the cells.2 At each time point,we harvested the treated and a corresponding, matched, untreatedcontrol sample.

Immunofluorescence and TUNEL Staining—Keratinocytes weregrown on Lab-Tek chamber slides (Nunc) in KGM and then incubated inKBM 24 h before cytokine treatments. The cells were fixed with 70%methanol, rinsed with PBS, and incubated first with primary antibodies(rabbit polyclonal anti-NF-�B; Santa Cruz Biotechnology, Inc., SantaCruz, CA) in PBS containing 1% bovine serum albumin and then withfluorescein isothiocyanate-labeled anti-IgG (Sigma). To detect apoptoticcells, we used the DeadEnd Fluorometric TUNEL System (Promega).Nuclei were counterstained with propidium iodide (Vector Laborato-ries). The stained cells were observed under the fluorescence micros-copy (Zeiss, Axiophot), and images were captured with a digital photocamera (DKC-5000; Sony). For the quantitative determination ofTUNEL-positive cells, for each experimental condition we selected 10different medium power views at random and counted the total numberof cells and the TUNEL-positive cells in each view.

NF-�B Motif Binding Assay—We used 10 �g of cell extract in aTransAM NF-�B kit (Active Motif), which can measure the binding ofactivated NF-�B to its consensus sequence attached to a microwellplate, according to the manufacturer’s instructions.

Preparation of Labeled cRNA and GeneChip Hybridization—We iso-lated total RNA from the cells using RNeasy kits (Qiagen) according tothe manufacturer’s instructions. Approximately 5–8 �g of total RNAwas reverse transcribed, amplified, and labeled as described (22, 23).Fifteen micrograms of labeled cRNA was hybridized to HGU95Av2arrays (Affymetrix). Arrays were washed, stained with anti-biotinstreptavidin-phycoerythin labeled antibody, and scanned using the Agi-lent GeneArray Scanner system (Hewlett-Packard).

Array Data Analysis—We used the same data analysis approach fordata extraction as before (19, 22), including Microsuite 5.0 (Affymetrix).Differential expressions of transcripts were determined by calculatingthe -fold change. To compare data from multiple arrays, the signal ofeach probe array was scaled to the same target intensity value. Geneswere considered regulated if the expression levels differed more than2-fold relative to untreated control at any time point. To improve

reliability, we checked individually the absolute expression levels and pvalues among all four time points. To reduce false positive regulatedgenes, we eliminated the genes that show a “zigzag” pattern of changesduring the time course studied. To determine the NF-�B-dependentgenes, we compared the values from the TNF�-treated and parthenol-ide � TNF�-treated cultures. We removed all genes deemed absent inthe samples with a higher expression and eliminated duplications of thegenes. The hierarchical clustering was performed using TIGR Multi-Experiment Viewer algorithms available on the World Wide Web atwww.tigr.org/software/tm4 (24).

We developed an extensive gene annotation table describing themolecular function and biological category of the genes present on thechip, primarily based on data from J. M. Ruillard and the Gene Ontol-ogy Consortium Data (available on the World Wide Web at cgap.nci.nih.gov/Genes/GOBrowser and dot.ped.med.umich.edu:2000/ourimage/pub/shared/JMR_pub_affyannot.html). The genes were annotatedaccording to this table.

Identification of NF-�B Binding Sites in the Promoters of RegulatedGenes—The upstream sequence for each gene was obtained from theHumanGenomeBrowser Gateway (available on the World Wide Web atgenome.cse.ucsc.edu/cgi-bin/hgGateway?org�human). We searched fora �B binding motif in the 2 kb upstream from the coding region, usingMOTIF (available on the World Wide Web at motif.genome.ad.jp/) andTFSEARCH software (available on the World Wide Web at www.cbrc.jp/htbin/nph-tfsearch) with the cut-off threshold of 85%. We clas-sified the identified sites into “perfect match” sequences identical to the�B consensus GGGRNNYYCC and into one nucleotide “mismatch”sequences.

Real Time PCR—To confirm the microarray results, quantitativereal time PCR was performed using LightCycler-RNA Amplification KitSYBR Green I (Roche Applied Science). The PCR primers for each genewere designed using software (Roche Applied Science), with a targetmelting temperature at 60 °C. 300 ng of total RNA was applied forRT-PCR. The primers used for PCR analysis were as follows: EFNA1(GAGGTGCGGGTTCTAC, GCTAGGTGATAGCTTATGCC), CEP4 (C-CAGGCTTCGTGAATTG, GCGTTTAACTCAGCACTCT), SOX4 (GTC-TTATGGCATGATGATAGC, ACACGGCATATTGCAC), NINJ1 (AACG-TGAACCATTACGC, GTTGTTAAGGTCGTACTTGAC), SOD2 (GTTG-GCCAAGGGAGATGTTA, CTGATTTGGACAAGCAGCAA), TNF�AIP(CCACAAACTTCGTGGA, CAATGAGGTGACGGGA), KRT15 (CTTGA-CATAAAGACACGGC, GGGGAATAGAGCGCAT), and GAPDH (GTC-GGAGTCAACGGAT, CCACGACGTACTCAGC). The relative changesof gene expression were estimated and normalized to GAPDH by usingthe 2-��C

T method (25).siRNA—The 21-mer small interfering RNA duplexes (siRNA) with 3�

overhang dimers of uridine were synthesized using a Silencer siRNAConstruction Kit, according to the manufacturer’s instructions(Ambion). The oligonucleotide sequences were as follows: NF-�B1 (AA-GATGATCCATATTTGGGAACCTGTCTC, AATTCCCAAATATGGAT-CATCCCTGTCTC) and cFLIP (AAGAAGCACTTGATACAGATGCCT-GTCTC, AACATCTGTATCAAGTGCTTCCCTGTCTC). The transfec-tion of siRNAs, 10 nM, was conducted using a liposome delivery system,1.5 �l/ml siPORT Lipid (Ambion) in subconfluent keratinocytes. Wetreated keratinocytes with TNF� 48 h after siRNA and recorded thephenotypes 48 h after the TNF� treatment.

RESULTS

Parthenolide Inhibits NF-�B Activation by TNF� in Keratino-cytes—Activation of NF-�B by TNF� leads to its nuclear trans-location and subsequent binding to the NF-�B sequence motifs inDNA; parthenolide blocks both processes in the TNF�-treatedkeratinocytes (Fig. 1, a and b). We expect, therefore, that theNF-�B-dependent genes will not be regulated by TNF� in theparthenolide-pretreated cells. Prevention of apoptosis is, argu-ably, the best known NF-�B-specific TNF�-regulated process (7).To demonstrate this phenomenon in epidermal keratinocytes, weused the TUNEL assay. The TNF� treatment caused degenera-tive changes indicative of apoptosis in only a few cells; however,the inhibition of NF-�B with parthenolide caused massive celldeath after the TNF� treatment (Fig. 1c). Parthenolide by itselfdoes not affect the cell viability. Quantitative analysis of apo-ptotic cells confirmed these results (Fig. 1d). Thus, the activationof the NF-�B pathway prevents apoptosis in the TNF�-treatedkeratinocytes, presumably because of the antiapoptotic genesinduced by the NF-�B-dependent pathway.2 T. Banno, A. Gazel, and M. Blumenberg, unpublished results.

NF-�B Pathway Profiling in Epidermis18974

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Identification of the NF-�B-dependent TNF�-regulatedGenes—In our previous work, we described 293 genes regulatedby TNF� (19); of these, 118 (40%) are NF-�B-dependent. Of the118, 51 (17%) belong to the early genes (i.e. regulated 1–4 hafter the TNF� treatment), whereas 67 (23%) are late, regu-lated 24 and 48 h post-treatment (Table I). To confirm the arrayresults independently, we performed quantitative real timeRT-PCR analysis of seven representative genes, six induced byTNF� and one suppressed; GAPDH, which is not regulated byTNF�, served as the control. To our satisfaction, all genestested showed equivalent regulation in the two methods,microarrays and RT-PCR (Fig. 2).

Statistical analysis of the functional categories shows a veryspecific, nonrandom segregation into early, late and NF-�B-independent categories (Table II). The most prominent amongthe early genes are the secreted proteins (i.e. chemokines,cytokines, and growth factors (Tables IA and II). Thus, signal-ing to the surrounding cells is one of the most important func-tions of the NF-�B-dependent responses to TNF�. NF-�B isknown to play an essential role in innate immunity and theinflammatory host response in skin (26). All nine of the TNF�-regulated chemokines are NF-�B-dependent, as are 10 of 11 ofthe genes associated with antigen presentation. These genestend to have multiple NF-�B motifs, and the chemokine familygenes tend to have the NF-�B binding motifs at short distancesfrom the TATA box (Table II), which indicates direct transcrip-tional regulation by NF-�B. Moreover, the TNF�-induced gene

expression of the chemokine gene family is very rapid buttransient, also suggesting high dependence on direct transcrip-tional regulation.

Although the NF-�B pathway has been implicated in thedifferentiation of epidermal cells, IKK knock-outs having con-spicuous epidermal phenotype (8), little is known about theNF-�B-associated regulation of the epidermal differentiationgenes. Curiously, although the induction of cornified envelopemarkers is an early NF-�B-dependent event (Table IA), we findthat these genes lack the perfect NF-�B consensus motifs(Table II), which suggests a different regulatory mechanism oftranscriptional regulation by NF-�B.

Two secreted metalloproteases, MMP9 and MMP10 (gelatin-ase B and stomelysin-2), were also in the early NF-�B-depend-ent group, as were the transcription factors TNFAIP3, SOX4,and IRF1; these may be responsible, in part, for the indirectNF-�B-dependent late transcriptional effects.

The late NF-�B-dependent genes comprise very differentfunctional categories from the early ones (Table IA). Prominentamong these are the antigen presentation-related proteins,components of the complement, CD58, and HLA markers. Thisimplicates the NF-�B pathway in the immunomodulatory ef-fects of TNF�. Extracellular matrix proteins collagen-XVI andchondroitin sulfate proteoglycan 4, which play roles in theattachment of keratinocytes to the basement membrane and inthe cadherin-mediated adhesion (27, 28), belong to the lategenes, as does MMP13 (collagenase 3). Therefore, remodeling

FIG. 1. Parthenolide blocks TNF�-induced NF-�B activation and nucle-arization in keratinocytes and causeswidespread cell death. a, cultures ofkeratinocytes were treated with TNF�and examined using immunofluorescencewith an NF-�B-binding antibody after1 h. NF-�B is cytoplasmic in untreatedkeratinocytes but moves to the nucleus inthe TNF�-treated cells. b, binding to theNF-�B consensus DNA sequence. The er-ror bars indicate S.E. (n � 3). c, TUNELstaining 24 h after treatment. Untreatedand parthenolide-treated cells show nosign of apoptosis. A few apoptotic cellscould be detected in the TNF�-treatedcultures, but in the parthenolide-pre-treated, TNF�-treated cells, we see mas-sive apoptosis. Propidium iodide (PI)stain was used to visualize the nuclei. d,quantitative analysis of cell numbers andapoptosis. There is a mild increase in thenumber of apoptotic cells in the TNF�-treated keratinocyte cultures; parthenol-ide, by itself, has no effect. However, theparthenolide � TNF� treatment causes amassive increase of apoptotic cells. Cellswere counted 48 h after treatment, andthe error bars indicate S.E. (n � 10 fieldseach condition). UT, untreated control; T,TNF�-treated; PT, parthenolide � TNF�-treated; P, parthenolide-treated.

NF-�B Pathway Profiling in Epidermis 18975

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

TABLE IList of NF-�B-dependent TNF�-regulated genes

The four leftmost columns show the comparison of control, untreated, and TNF�-treated cultures at 1, 4, 24, and 48 h post-treatment; the nextfour columns show the comparison between the TNF�-treated cultures with and without pretreatment with parthenolide. The red numbersshow-fold induction by TNF�, whereas the green ones show-fold suppression of the TNF�-induced levels by parthenolide. Unigene accessionnumbers are provided for easy reference. A, genes regulated in the early time points, 1 and 4 h after the addition of TNF�. B, genes regulated inthe late time points, 24 and 48 h after treatment. The double line separates the TNF�-induced genes from the suppressed ones. The presence ofthe perfect NF-�B motif in the 2-kb upstream sequence is marked with PM, a single base mismatch with SBM, and its absence with “none.” Thecolumn showing the number of NF-�B motifs in 2 kb upstream from each gene is marked with a number symbol, and the position of a motif in theupstream sequence is given in the last column.

NF-�B Pathway Profiling in Epidermis18976

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

of the extracellular matrix and interaction with the neighbor-ing cells seems to be an important component of the late NF-�B-dependent responses to TNF�. Confirming this, we findproteolysis inhibitors, adhesion and junctional proteins in thisgroup as well.

Interestingly, the late NF-�B-dependent group also containsMADH1 and MADHIP, which form a transcription factor com-plex and provide a nexus between the TNF�/NF-�B and thetransforming growth factor �/SMAD signaling pathways.

Several TNF�-suppressed genes were identified in the NF-�B-dependent group. However, using microarray approaches,we cannot determine with certainty the timing of their regula-tion, early versus late, because this depends on the mRNAdegradation rates and other factors.

Importantly, the TNF�-regulated cell cycle proteins are sta-tistically overrepresented in the non-NF-�B-dependent cate-gory. TNF� inhibits keratinocyte proliferation and arrests thecells in G1 phase (19). The arrest seems to be wholly dependenton TNF�-regulated pathways other than NF-�B (Table II). Cell

surface receptors and metabolic enzyme also belong to theTNF�-regulated genes that are independent from the NF-�B.

Whereas most early genes are directly regulated by NF-�B,the late genes, in turn, may depend on the transcription factorsregulated by the early genes. If so, we expect the promoters ofthe early genes to have more NF-�B binding sites than those ofthe late genes. Therefore, we used promoter analysis softwareto determine the presence of the NF-�B binding sequences inthe 200-bp segments of the 2-kb sequences upstream from thecoding region of each NF-�B-dependent gene (Table III). Wecalculated the average number of NF-�B sites per 200-bp in-terval and the S.D. of these numbers. The results indicate thatonly the promoter-proximal 200 bp of the early regulated geneshave a statistically significant, greater than 2-S.D., increase inthe number of the NF-�B motifs.

Correlation of the NF-�B sites in the promoters with thefunctional analysis of the regulated genes indicates that thedistribution of the NF-�B sites is not random (Table II). Che-mokines and cytokines as a group have the highest accumula-tion of the NF-�B motifs, especially in the first 200 bp of theirupstream sequences. Integrins and apoptosis-related proteinsalso have an overabundance of NF-�B sites. In contrast, kera-tins, cell cycle, and proteolysis genes generally lack NF-�Bmotifs. Curiously, although the induction of cornified envelopemarkers is NF-�B-dependent, we found that these genes lackthe perfect NF-�B consensus motifs but contain single basemismatches; this suggests a different regulatory mechanism oftheir transcriptional regulation by NF-�B (Table II).

Identification of cFLIP as an Essential NF-�B-dependentAntiapoptotic Gene—Prevention of apoptosis is, arguably, thebest known NF-�B-specific TNF�-regulated process (7). Inother systems, NF-�B was shown to regulate several genesencoding proteins with antiapoptotic properties, such as cFLIP,A20, cIAP, TRAF1, and Bcl-XL (29–31). Perhaps unexpectedly,only one such antiapoptotic gene was found in the early NF-�B-dependent category, cFLIP (31). A caveat in such conclu-sions is the fact that some genes have multiple, interactingfunctions. For example, TNFAIP3 and SOX4 are transcriptionfactors with imputed antiapoptotic roles (32, 33).

Because massive apoptosis can be seen in TNF�-treated cellswith disrupted NF-�B activity, we were particularly interestedin the NF-�B-dependent antiapoptotic genes. We focused oncFLIP, because the protein product of this gene is an inactivecaspase that dimerizes with and thereby inactivates caspase-8as well as binds to TNF� receptor-associated proteins TRAF-1,TRAF-2, and FADD, thereby blocking the apoptotic signalsfrom the receptor (34). We argued that if cFLIP is an essentialcomponent of the NF-�B pathway that rescues the keratino-

TABLE I—continued

FIG. 2. RT-PCR analysis confirms the results of microarrays.Six representatives of TNF�-induced genes, one TNF�-suppressedgene, and GAPDH as an unregulated control were selected, and theirrelative mRNA levels were examined using real time RT-PCR. The twodifferent methods, the microarrays and the RT-PCR, show excellentqualitative agreement.

NF-�B Pathway Profiling in Epidermis 18977

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

cytes from the proapoptotic effects of TNF�, then we should beable to elicit apoptosis by blocking cFLIP, even without block-ing NF-�B. We used siRNAs to target cFLIP and, as a positivecontrol, NF-�B. We used a liposome-based delivering system totransfect the siRNAs into cultured keratinocytes and thentreated the transfected cells with TNF�. The reduction of thetarget mRNAs was monitored using Northern blots (Fig. 3a).As expected, the NF-�B-targeted siRNA, similar to parthenol-ide, induced widespread cell death and morphological changesin the TNF�-treated keratinocytes (Fig. 3b), which confirmsthe effective reduction of NF-�B in the parthenolide-treatedcells. The TUNEL assay confirmed the cell death by apoptosis.Importantly, the cFLIP-targeted siRNA also induced apoptosis inthe TNF�-treated keratinocytes (Fig. 3b). This means that cFLIPis indeed an essential component of the antiapoptotic pathwayinduced by TNF�. Quantitative examination of the siRNA-treated cultures indicated significant increases in TUNEL-positive cells and reduction in total cell numbers (data notshown). Note that these effects are completely TNF�-dependent;in the absence of the cytokine, the siRNAs have no visible effects.

Importantly, although blocking cFLIP causes apoptosis ofTNF�-treated cells, the blocking has no major effect on themorphology of the remaining, viable cells (Fig. 3c). This con-firms the specific antiapoptotic property of cFLIP. In contrast,the parthenolide-treated and NF-�B-siRNA-treated cells dem-onstrate extensive morphological changes in surviving cells(Fig. 3c). The NF-�B-targeted keratinocytes show elongatedprocesses after the TNF� stimulation, suggesting cytoskeletalreorganization. Therefore, although both the antiapoptotic andthe cytoskeletal effects of TNF� are mediated by NF-�B, onlythe antiapoptotic ones depend on cFLIP (Fig. 4).

FIG. 3. siRNAs targeting NF-�B or cFLIP induce apoptosis inthe TNF�-treated keratinocytes. a, Northern blots demonstratethat the siRNAs targeting NF-�B or cFLIP cause reduced levels ofcorresponding mRNAs in keratinocyte cultures. b, both the NF-�B- andthe cFLIP-targeted siRNA cause widespread apoptosis in the TNF�-treated keratinocytes. P.I., propidium iodide. c, phase-contrast imagesof keratinocyte cultures 48 h after the treatment. GAPDH-targetedsiRNA has no effect on the cell morphology. NF-�B-targeted siRNA andparthenolide greatly affect the morphology of the treated cells. Themorphology of the surviving cFLIP-targeted siRNA cells does notchange drastically. Note that TNF� is absolutely necessary for all of thechanges observed.

TABLE IIFunctional classification of the NF-�B-dependent genes

The total number of genes in each category is given; only categories with five or more members are represented, smaller ones being statisticallyunreliable. We determined the percentage of genes in each category that are early, late, or neither, as well as those containing a perfect match PMNF-�B site, a single base mismatch SBM, or none. Having calculated the averages and S.D. values of these percentages (bottom row), we identifythe functional categories that are more than one S.D. different from the average. Those overrepresented are boxed; those underrepresented areunderlined. The last column lists the average number of NF-�B motifs per gene in each functional category.

TABLE IIIDistribution of NF-�B motifs in the promoters of regulated genes

Distribution of the motifs upstream from the genes is plotted for200-bp intervals. Note the statistically significant cluster of NF-�B sitesin the promoter-proximal 200 bp of the early genes, marked with theasterisk, and the even distribution of the NF-�B motifs in the lategenes.

Upstream distance bpNumber of genes with NF�B sites

Early Late

0/�200 15* 4�200/�400 7 5�400/�600 3 7�600/�800 3 5�800/�1000 4 2�1000/�1200 3 2�1200/�1400 5 5�1400/�1600 2 3�1600/�1800 0 4�1800/�2000 0 4

NF-�B Pathway Profiling in Epidermis18978

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

DISCUSSION

We used pathway-specific gene expression profiling to dis-sect the transcriptional responses to TNF� in normal epider-mal keratinocytes by identifying the NF-�B-dependent genes.Time course analysis and functional clustering revealed theresponsibility of NF-�B for the inflammatory and immuno-modulating signals, apoptosis, cytoskeletal changes, and motil-ity, but not for the cell cycle, and for general metabolism. Here,we focus on five functional categories, which have a character-istic pattern of transcriptional regulation by NF-�B.

First, NF-�B is known to play an essential role in innateimmunity and the inflammatory host response in skin (26). Weidentified many NF-�B-dependent genes in this functional cat-egory. Astonishingly, all nine of the TNF�-regulated chemo-kines are NF-�B-dependent, as are 10 of the 11 genes associ-ated with antigen presentation. These genes commonly havemultiple NF-�B motifs and tend to have the NF-�B bindingmotifs at short distances from the TATA box, which indicatestheir direct transcriptional regulation by NF-�B. Moreover, theTNF�-induced gene expression of chemokine family is veryrapid but transient, also suggesting a high dependence ondirect transcriptional regulation. NF-�B also regulates thegene expression of several inflammatory cytokines, matrix met-alloproteinases, and complement proteins, suggesting a crucialrole for NF-�B in the immune response and inflammation.These findings agree with previous reports.

The comprehensive and specific dependence of the genesinvolved with innate immunity and inflammation on theNF-�B signaling suggests that the inhibition of the NF-�Bpathway may be as effective an anti-inflammatory treatmentas is the inhibition of the entire set of responses to TNF�.

Second, NF-�B has an important role in the inhibition ofapoptosis; P65/RelA knock-out mice show an embryonic lethalphenotype due to extensive apoptosis of hepatocytes, and inhi-bition of NF-�B activation enhances the apoptotic effects of avariety of death inducers, including TNF�. The NF-�B activa-tors can confer resistance against the progression of apoptosis.Inhibition of the NF-�B action in the TNF�-stimulated kerat-inocytes showed significant apoptosis (see Fig. 1); however,little is known about the NF-�B-dependent antiapoptotic mech-anisms in keratinocytes. We identified cFLIP, which interacts

with FADD and procaspase-8, interfering with the activation ofprocaspase-8 (37), as the essential NF-�B-dependent TNF�-induced antiapoptotic gene and confirmed its significant role inkeratinocytes by using an siRNA silencing approach. We notethat additional genes in Table I may have antiapoptotic prop-erties as well. Overexpression of antiapoptotic genes is thoughtto interfere with death of cancer cells, resulting in the resist-ance against radiation therapy or chemotherapy (38). If cFLIPplays such a role in skin cancer, then drugs targeting thisprotein could make effective supplements for cancer therapy.

Third, inhibition of NF-�B resulted in disturbance of cy-toskeletal organization and detachment of cell-to-cell contacts.We identified several actin regulators, integrins, and adhesionmolecules as NF-�B-dependent, TNF�-regulated genes. For ex-ample, CEP4 is a member of the CDC42-binding protein familyand regulates the organization of the actin cytoskeletonthrough Rho-GTPases, leading to cell shape changes (39); eph-rin A1 is a secreted ligand with a significant role in actinreorganization through its receptor and Rho proteins (40);CD47 initiates G-protein signaling and modulates cell adhesionand migration through its association with integrins (41); andHEF1, a focal adhesion-associated docking protein, has aunique function in response to cellular detachment (42). Takentogether, these results suggest that NF-�B has a significantrole in coordination of cellular processes associated with cellshape, adhesion, motility, and detachment.

Fourth, although the NF-�B pathway has been implicated inthe differentiation of epidermal cells (IKK knock-outs havingconspicuous epidermal phenotype (8)), little is known about theNF-�B-associated regulation of the epidermal differentiationgenes. Interestingly, although a cluster of cornification mark-ers falls in the category of early regulated NF-�B-dependentgenes (Table I), we find that these genes do not have the perfectNF-�B motifs in their promoter regions (Table II). This agreesvery well with the completely independently derived findingsthat NF-�B indirectly regulates keratin gene expression (i.e.without binding to the keratin gene promoter DNAs) (43). Inthe case of keratin K6, NF-�B and C/EBP� form a complex thatbinds to the C/EBP� consensus sequence motif in the promoterthrough the C/EBP� DNA binding domain (43). This suggestsindirect transcriptional regulation of epidermal markers byNF-�B-containing complexes of transcription factors. Perhapssignificantly, the cornification marker genes do contain singlebase mismatch motifs, which may play a role in forming orstabilizing the NF-�B-containing complexes.

Finally, in contrast to the four categories described above, itappears that the TNF�-regulated cell cycle proteins do not re-quire the activation of the NF-�B pathway. TNF� inhibits ke-ratinocyte proliferation and arrests the cells in the G1 phase ofthe cycle (19). This process, unregulated by NF-�B, seems to bewholly dependent on the other TNF�-regulated pathways (Fig.4). This is in good agreement with studies that identified thec-Jun N-terminal kinase pathway, rather than the NF-�B path-way, as the one critical for the proliferation effects of TNF� (44).

We note that the regulation of transcription of a given genemay depend on multiple pathways (e.g. both the NF-�B and thec-Jun N-terminal kinase pathway). Genes in this categorywould be identified by our approach as NF-�B-dependent, andwe do not imply that additional pathways play no role in theirregulation. However, our results indicate that more specificapproaches to treating inflammatory disorders are possible andpoint to the pathway-specific transcriptional profiling as theright method to identify the best therapeutic targets.

Acknowledgments—We thank members of our laboratory andDr. Y. Kawachi (Tsukuba University) for advice, reagents, andencouragement.

FIG. 4. Summary of the findings. The TNF�-regulated processesdepend on specific signal transduction pathways. Motility, cytoskeletalchanges, inflammation, immune response and apoptosis are on theNF-�B pathway, and epidermal differentiation requires co-regulators,whereas the cell cycle proteins and the metabolic enzymes are not onthe NF-�B pathway. Inhibitors targeting TNF� (e.g. Infliximab) aremore specific than corticosteroids, whereas the pathway-specific inhib-itors may be even more specific, as indicated by dashed boxes.

NF-�B Pathway Profiling in Epidermis 18979

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

REFERENCES

1. McDermott, M. F. (2001) Cell. Mol. Biol. (Noisy-le-grand) 47, 619–6352. Wolf, R., Matz, H., Orion, E., and Ruocco, V. (2002) Clin. Dermatol. 20,

522–5303. Antoni, C., and Braun, J. (2002) Clin. Exp. Rheumatol. 20, S152–1574. Nahar, I. K., Shojania, K., Marra, C. A., Alamgir, A. H., and Anis, A. H. (2003)

Ann. Pharmacother. 37, 1256–12655. Baud, V., and Karin, M. (2001) Trends Cell Biol. 11, 372–3776. Chen, G., and Goeddel, D. V. (2002) Science 296, 1634–16357. Natoli, G., Costanzo, A., Guido, F., Moretti, F., Bernardo, A., Burgio, V. L.,

Agresti, C., and Levrero, M. (1998) J. Biol. Chem. 273, 31262–312728. Seitz, C. S., Lin, Q., Deng, H., and Khavari, P. A. (1998) Proc. Natl. Acad. Sci.

U. S. A. 95, 2307–23129. van Hogerlinden, M., Rozell, B. L., Ahrlund-Richter, L., and Toftgard, R.

(1999) Cancer Res. 59, 3299–330310. Lind, M. H., Rozell, B., Wallin, R. P., van Hogerlinden, M., Ljunggren, H. G.,

Toftgard, R., and Sur, I. (2004) Proc. Natl. Acad. Sci. U. S. A. 101,4972–4977

11. Zhang, J. Y., Green, C. L., Tao, S., and Khavari, P. A. (2004) Genes Dev. 18,17–22

12. Takeda, K., Takeuchi, O., Tsujimura, T., Itami, S., Adachi, O., Kawai, T.,Sanjo, H., Yoshikawa, K., Terada, N., and Akira, S. (1999) Science 284,313–316

13. Hu, Y., Baud, V., Delhase, M., Zhang, P., Deerinck, T., Ellisman, M., Johnson,R., and Karin, M. (1999) Science 284, 316–320

14. Li, Z. W., Chu, W., Hu, Y., Delhase, M., Deerinck, T., Ellisman, M., Johnson,R., and Karin, M. (1999) J. Exp. Med. 189, 1839–1845

15. Smahi, A., Courtois, G., Vabres, P., Yamaoka, S., Heuertz, S., Munnich, A.,Israel, A., Heiss, N. S., Klauck, S. M., Kioschis, P., Wiemann, S., Poustka,A., Esposito, T., Bardaro, T., Gianfrancesco, F., Ciccodicola, A., D’Urso, M.,Woffendin, H., Jakins, T., Donnai, D., Stewart, H., Kenwrick, S. J.,Aradhya, S., Yamagata, T., Levy, M., Lewis, R. A., and Nelson, D. L. (2000)Nature 405, 466–472

16. Klement, J. F., Rice, N. R., Car, B. D., Abbondanzo, S. J., Powers, G. D., Bhatt,P. H., Chen, C. H., Rosen, C. A., and Stewart, C. L. (1996) Mol. Cell. Biol.16, 2341–2349

17. Pahl, H. L. (1999) Oncogene 18, 6853–686618. Adachi, M., Gazel, A., Pintucci, G., Shuck, A., Shifteh, S., Ginsburg, D., Rao,

L. S., Kaneko, T., Freedberg, I. M., Tamaki, K., Blumenberg, M., Li, D.,Turi, T. G., Schuck, A., and Khitrov, G. (2003) DNA Cell Biol. 22, 665–677

19. Banno, T., Gazel, A., and Blumenberg, M. (2004) J. Biol. Chem. 279,32633–32642

20. Hehner, S. P., Hofmann, T. G., Droge, W., and Schmitz, M. L. (1999) J. Im-munol. 163, 5617–5623

21. Won, Y. K., Ong, C. N., Shi, X., and Shen, H. M. (2004) Carcinogenesis 25,

1449–145822. Li, D., Turi, T. G., Schuck, A., Freedberg, I. M., Khitrov, G., and Blumenberg,

M. (2001) FASEB J. 15, 2533–253523. Banno, T., Adachi, M., Mukkamala, L., and Blumenberg, M. (2003) Antivir.

Ther. 8, 541–55424. Saeed, A. I., Sharov, V., White, J., Li, J., Liang, W., Bhagabati, N., Braisted, J.,

Klapa, M., Currier, T., Thiagarajan, M., Sturn, A., Snuffin, M., Rezantsev,A., Popov, D., Ryltsov, A., Kostukovich, E., Borisovsky, I., Liu, Z., Vinsavich,A., Trush, V., and Quackenbush, J. (2003) BioTechniques 34, 374–378

25. Livak, K. J., and Schmittgen, T. D. (2001) Methods 25, 402–40826. Pasparakis, M., Courtois, G., Hafner, M., Schmidt-Supprian, M., Nenci, A.,

Toksoy, A., Krampert, M., Goebeler, M., Gillitzer, R., Israel, A., Krieg, T.,Rajewsky, K., and Haase, I. (2002) Nature 417, 861–866

27. Kassner, A., Hansen, U., Miosge, N., Reinhardt, D. P., Aigner, T., Bruckner-Tuderman, L., Bruckner, P., and Grassel, S. (2003) Matrix Biol. 22, 131–143

28. Legg, J., Jensen, U. B., Broad, S., Leigh, I., and Watt, F. M. (2003) Develop-ment 130, 6049–6063

29. Wang, C. Y., Mayo, M. W., Korneluk, R. G., Goeddel, D. V., and Baldwin, A. S.,Jr. (1998) Science 281, 1680–1683

30. Karin, M., and Lin, A. (2002) Nat. Immunol. 3, 221–22731. Kataoka, T., Schroter, M., Hahne, M., Schneider, P., Irmler, M., Thome, M.,

Froelich, C. J., and Tschopp, J. (1998) J. Immunol. 161, 3936–394232. He, K. L., and Ting, A. T. (2002) Mol. Cell. Biol. 22, 6034–604533. Ahn, S. G., Kim, H. S., Jeong, S. W., Kim, B. E., Rhim, H., Shim, J. Y., Kim,

J. W., Lee, J. H., and Kim, I. K. (2002) Exp. Mol. Med. 34, 243–24934. Chang, D. W., Xing, Z., Pan, Y., Algeciras-Schimnich, A., Barnhart, B. C.,

Yaish-Ohad, S., Peter, M. E., and Yang, X. (2002) EMBO J. 21, 3704–371435. Beg, A. A., Sha, W. C., Bronson, R. T., Ghosh, S., and Baltimore, D. (1995)

Nature 376, 167–17036. Beg, A. A., and Baltimore, D. (1996) Science 274, 782–78437. Irmler, M., Thome, M., Hahne, M., Schneider, P., Hofmann, K., Steiner, V.,

Bodmer, J. L., Schroter, M., Burns, K., Mattmann, C., Rimoldi, D., French,L. E., and Tschopp, J. (1997) Nature 388, 190–195

38. Wang, X. J., Liefer, K. M., Tsai, S., O’Malley, B. W., and Roop, D. R. (1999)Proc. Natl. Acad. Sci. U. S. A. 96, 8483–8488

39. Hirsch, D. S., Pirone, D. M., and Burbelo, P. D. (2001) J. Biol. Chem. 276,875–883

40. Carter, N., Nakamoto, T., Hirai, H., and Hunter, T. (2002) Nat. Cell Biol. 4,565–573

41. Brown, E. J., and Frazier, W. A. (2001) Trends Cell Biol. 11, 130–13542. O’Neill, G. M., and Golemis, E. A. (2001) Mol. Cell. Biol. 21, 5094–510843. Komine, M., Rao, L. S., Kaneko, T., Tomic-Canic, M., Tamaki, K., Freedberg,

I. M., and Blumenberg, M. (2000) J. Biol. Chem. 275, 32077–3208844. Roulston, A., Reinhard, C., Amiri, P., and Williams, L. T. (1998) J. Biol. Chem.

273, 10232–10239

NF-�B Pathway Profiling in Epidermis18980

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Tomohiro Banno, Alix Gazel and Miroslav Blumenberg-regulated Genes in Epidermal Keratinocytes

αB-dependent Tumor Necrosis Factor κPathway-specific Profiling Identifies the NF-

doi: 10.1074/jbc.M411758200 originally published online February 18, 20052005, 280:18973-18980.J. Biol. Chem. 

  10.1074/jbc.M411758200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/280/19/18973.full.html#ref-list-1

This article cites 44 references, 24 of which can be accessed free at

by guest on April 11, 2018

http://ww

w.jbc.org/

Dow

nloaded from