part 2 of rna-seq for de analysis: investigating raw data

56
This presentation is available under the Creative Commons Attribution-ShareAlike 3.0 Unported License. Please refer to http://www.bits.vib.be/ if you use this presentation or parts hereof. RNA-seq for DE analysis training Raw data investigation Joachim Jacob 22 and 24 april 2014

Upload: joachim-jacob

Post on 27-Jun-2015

397 views

Category:

Science


1 download

DESCRIPTION

Second part of the training session 'RNA-seq for Differential expression' analysis. We explain the characteristics of RNA-seq data that allow us to detect differential expression. Interested in following this session? Please contact http://www.jakonix.be/contact.html

TRANSCRIPT

Page 1: Part 2 of RNA-seq for DE analysis: Investigating raw data

This presentation is available under the Creative Commons Attribution-ShareAlike 3.0 Unported License. Please refer to http://www.bits.vib.be/ if you use this presentation or parts hereof.

RNA-seq for DE analysis training

Raw data investigation

Joachim Jacob22 and 24 april 2014

Page 2: Part 2 of RNA-seq for DE analysis: Investigating raw data

2 of 56

Previous section: experimental setup

We have decided on:● how many samples per condition● how deep

This determines how reliable the statistics will be, using experience, and tools like Scotty. A wrong experimental design cannot be fixed. Best approach: pilot data (3 samples per condition, 10M)

But we have other sequencing options to choose!

Page 3: Part 2 of RNA-seq for DE analysis: Investigating raw data

3 of 56

PE versus SE Illumina● Single end (SE): from each cDNA fragment only

one end is read.

● Paired end (PE): the cDNA fragment is read from both ends: 2 reads per fragment, a given distance apart.

Purify and fragment,..

PE

SE

Part that is read

Page 4: Part 2 of RNA-seq for DE analysis: Investigating raw data

4 of 56

PE versus SE Illumina

Single end (SE):

● Gene level differential expression

Paired end (PE):

● Novel splice junction detection

● De novo assembly of transcriptome

● Helps with correctly positioning reads on the reference genome sequence.

Note: PE not the same as mate pairs.

Page 5: Part 2 of RNA-seq for DE analysis: Investigating raw data

5 of 56

Strandedness

● Naive protocols obtain reads from cDNA fragments. BUT the link with the sense or antisense strand is broken.

● Stranded protocols generate reads from one strand, corresponding to the sense or antisense strand (depending on the protocol).

Page 6: Part 2 of RNA-seq for DE analysis: Investigating raw data

6 of 56

Strandedness

Not strandedStranded

Page 7: Part 2 of RNA-seq for DE analysis: Investigating raw data

7 of 56

Example of a stranded protocol

● dUTP protocol to generate stranded reads.

Page 8: Part 2 of RNA-seq for DE analysis: Investigating raw data

8 of 56

Importance of strandedness

● Strandedness can bias the read counts compared to non-stranded protocols.

● Depends on the genome whether you should apply it, e.g. in case genes overlap, the improved benefit of assigning reads to correct genes can outweigh technical variation.

Page 9: Part 2 of RNA-seq for DE analysis: Investigating raw data

9 of 56

Required length of the reads

● Does not matter so much (when we want to quantify aligning to a reference sequence): 50 bp will do.

● The most important point is to be able to accurately position the read on the reference genome sequence, to assign it to the correct gene.

● Length can become important, if you want to assemble the transcriptome.

Page 10: Part 2 of RNA-seq for DE analysis: Investigating raw data

10 of 56

For DE on the gene level

The 'cheapest' protocol for high-throughput sequencing suffices to achieve DE detection:● SE● 50bp● Option: strandedness.

Use the money you have left over for increasing the number of biological replicates.

Page 11: Part 2 of RNA-seq for DE analysis: Investigating raw data

11 of 56

First mRNA is extracted

sdf

Page 12: Part 2 of RNA-seq for DE analysis: Investigating raw data

12 of 56

After sequencing, you get raw data

The data you get arrives as...

barcode

experiment

Compressed, usually with gzip

Page 13: Part 2 of RNA-seq for DE analysis: Investigating raw data

13 of 56

Raw Illumina data

@HWI-ST571:202:D1B86ACXX:2:1102:1146:2155 1:N:0:ACAGTG

CCAACATCGAGGTCGCAATCTTTTTNANCGATATGAACTCTCCAAAAAAA

+

@@@FFFDFHHDG?FFHIIJJJJJIJ#1#1:BFFIGJJJJJIJJGIJJJJA

@HWI-ST571:202:D1B86ACXX:2:1102:1073:2240 1:N:0:ACAGTG

CGGAGCTGAAGGAGAAACTGAAATCCCTGCAATGTGAATTGTACGTTCTT

+

CCCFFFFFGGHHHIJJJJJJJIJFHIJIIIJJJJGIIIIIEFGHIFCHJI

@HWI-ST571:202:D1B86ACXX:2:1102:1385:2192 1:N:0:ACAGTG

GTTGGCAGCCCTGGAGCCCTGCCTCGGTGGTTTAGCCAGTACTAGGGGAT

+

CCCFFFFFHHHHHJJJIJJJJJJGIJJCGHFHIGIHJJJBDHGHHJJJIE

@HWI-ST571:202:D1B86ACXX:2:1102:1352:2244 1:N:0:ACAGTG

ATTTCCTCTTATTTACGTTGCTTTAAAGCGAGACTTCAACGCCATTTGAC

+

@@CFFFFFHHFHDFGHIJIIJGIJGGEHGGJB>??FHHGFFFGHIGIECF

@HWI-ST571:202:D1B86ACXX:2:1102:1981:2152 1:N:0:ACAGTG

CATCGAAGCAAAGCATATAAAGTTANTNNTNNCTGAGTTGTACATATTGC

+

??;;D?DB6CDB+<EFE>:AFA443#2##1##11)0:0?9**0??DAGI4

@HWI-ST571:202:D1B86ACXX:2:1102:1877:2165 1:N:0:ACAGTG

GAAGTGCCCCGCTGGCAGCACACAAGGAGCAGCCCGCTGCCGGACCACTC

+

?@@DDDADFFAA:CEGHBFGAHGD?F@BE9BFF?D@F;'-8AG<B92=;;

One read (minimum 4 lines)

http://wiki.bits.vib.be/index.php/.fastq

sequence

certainty reading this base at this position ('quality')

(this one: 87196924 lines)

Page 14: Part 2 of RNA-seq for DE analysis: Investigating raw data

14 of 56

Exploring the raw data

1) check whether the Fastq file is consistent-

2) Make graphs of some metrics of the raw data

http://wiki.bits.vib.be/index.php/.fastq

http://wiki.bits.vib.be/index.php/RNAseq_toolbox#Quality_control_and_visualization_of_raw_reads

Page 15: Part 2 of RNA-seq for DE analysis: Investigating raw data

15 of 56

FastQC – graphical exploration

http://www.bioinformatics.babraham.ac.uk/projects/fastqc/

Page 16: Part 2 of RNA-seq for DE analysis: Investigating raw data

16 of 56

FastQC – perfect example

Reads have good quality!

Page 17: Part 2 of RNA-seq for DE analysis: Investigating raw data

17 of 56

FastQC – perfect example

Anna Karenina principle: “There is only one way to be good, but there are many ways to be wrong.”

We will start by showing a good sample. Afterwards we will discuss a less good sample.

http://en.wikipedia.org/wiki/Anna_Karenina_principle

Page 18: Part 2 of RNA-seq for DE analysis: Investigating raw data

18 of 56

FastQC – perfect example

Smooth histogram/ density line towards the right,

Page 19: Part 2 of RNA-seq for DE analysis: Investigating raw data

19 of 56

FastQC – perfect example

steady nucleotide distribution.

Bias typical for illumina

Page 20: Part 2 of RNA-seq for DE analysis: Investigating raw data

20 of 56

Not strongly fluctuating GC content

Bias typical for illumina

FastQC – perfect example

Page 21: Part 2 of RNA-seq for DE analysis: Investigating raw data

21 of 56

GC-content nicely bell shaped

FastQC – perfect example

Page 22: Part 2 of RNA-seq for DE analysis: Investigating raw data

22 of 56

No N's! (should ring something)

FastQC – perfect example

Page 23: Part 2 of RNA-seq for DE analysis: Investigating raw data

23 of 56

All reads have length 50bp,

FastQC – perfect example

Page 24: Part 2 of RNA-seq for DE analysis: Investigating raw data

24 of 56

Reads are nicely duplicated: some amount of duplication is to be expected in RNA-seq data.

FastQC – perfect example

Page 25: Part 2 of RNA-seq for DE analysis: Investigating raw data

25 of 56

Reads are nicely duplicated: some amount of duplication is to be expected in RNA-seq data.

FastQC – perfect example

Page 26: Part 2 of RNA-seq for DE analysis: Investigating raw data

26 of 56

Kmers are short sequence stretches. Sometimes they are overrepresented. But in RNA-seq this is not so important (duplication).

FastQC – perfect example

Page 27: Part 2 of RNA-seq for DE analysis: Investigating raw data

27 of 56

FastQC – less good RNA-seq sample

A relatively large Portion of the reads have mistakes at the 3' end of the read.

Page 28: Part 2 of RNA-seq for DE analysis: Investigating raw data

28 of 56

FastQC – less good RNA-seq sample

There is an over- representation of reads

with a low mean quality score

Page 29: Part 2 of RNA-seq for DE analysis: Investigating raw data

29 of 56

FastQC – less good RNA-seq sample

Not a steady levelof different nucleotide

fractions

Page 30: Part 2 of RNA-seq for DE analysis: Investigating raw data

30 of 56

FastQC – less good RNA-seq sample

Fluctuates

Page 31: Part 2 of RNA-seq for DE analysis: Investigating raw data

31 of 56

FastQC – less good RNA-seq sample

Heavily skewed versusAT rich reads

Page 32: Part 2 of RNA-seq for DE analysis: Investigating raw data

32 of 56

FastQC – less good RNA-seq sample

Apparently a mixture of two sets of reads

with different lengths

Page 33: Part 2 of RNA-seq for DE analysis: Investigating raw data

33 of 56

FastQC – less good RNA-seq sample

Duplication seems abit on the low side

(reported figures are from 60 -75%)

Page 34: Part 2 of RNA-seq for DE analysis: Investigating raw data

34 of 56

FastQC – less good RNA-seq sample

Very highly skewed read number.Often the sequence of Truseq adaptor, or multiplex identifierscan be found here. BLAST can revealmore information!

Page 35: Part 2 of RNA-seq for DE analysis: Investigating raw data

35 of 56

FastQC – less good RNA-seq sample

Specific patterns of Specific kmers.

Note: A and T rich

Page 36: Part 2 of RNA-seq for DE analysis: Investigating raw data

36 of 56

Quality control of raw data

Proceed? Or rerun?

This QC can guide you to which preprocessing steps you need to apply for sure. The extra time and money needed to correct the biases (and still obtain less then optimal results...) can sometimes justify a rerun of the experiment.

This QC shows which preprocessing steps have already been made by the sequencing provider.

Page 37: Part 2 of RNA-seq for DE analysis: Investigating raw data

37 of 56

Preprocessing: what does it takes

Removing unwanted sequences or parts hereof ('contamination') so it helps as much as possible with reaching our goal: defining differentially expressed genes.

1) removing contamination of technical sources● Low quality read parts● Technical sequences: adaptors● PhiX internal control sequences

2) removing contamination with biological sources● polyA-tails● rRNA sequences● mtDNA sequences

After this, run FastQC again!

Page 38: Part 2 of RNA-seq for DE analysis: Investigating raw data

38 of 56

Focus on technical contamination

We need to assign reads with a high confidence to the correct genomic location.

We remove low quality read parts: they have a higher chance to contain errors. Errors can lead to wrong alignment, hence noise in our read counts.

Page 39: Part 2 of RNA-seq for DE analysis: Investigating raw data

39 of 56

Remove low quality read: tools (1)

Our goal is to define DE expression, for this we need to assign reads with a high confidence to the correct genomic location.

Removal of low quality read parts: they have a higher chance to contain errors, and cause noise in our read counts.

Page 40: Part 2 of RNA-seq for DE analysis: Investigating raw data

40 of 56

Remove low quality read: tools (2)

Page 41: Part 2 of RNA-seq for DE analysis: Investigating raw data

41 of 56

Technical contamination

We need to assign reads with a high confidence to the correct genomic location.

Removal of adaptor sequences (and other technical sequences, such as multiplex) as they cannot be mapped to the reference genome.

Page 42: Part 2 of RNA-seq for DE analysis: Investigating raw data

42 of 56

Technical contamination

Our goal is to define DE expression, for this we need to assign reads with a high confidence to the correct genomic location.

Removal of adaptor sequences (and other technical sequences, such as multiplex) as they cannot be mapped to the reference genome.

List of technical sequences

Advised by FastqMcf to use defaults

http://code.google.com/p/ea-utils/wiki/FastqMcf

Page 43: Part 2 of RNA-seq for DE analysis: Investigating raw data

43 of 56

Fastq-mcf output

http://code.google.com/p/ea-utils/wiki/FastqMcf

Page 44: Part 2 of RNA-seq for DE analysis: Investigating raw data

44 of 56

Duplicates are not contamination

● Never remove duplicate reads! Highly expressed genes can have genuine duplicate reads, which are not due to the PCR amplification step in the protocol.

● PhiX sequences: the DNA of Phi X bacteriophage is spiked in to monitor and optimize sequencing on Illumina machines. Your sequencing provider should filter out those sequences before delivery. If they are still present, you can filter them out by aligning your reads to the PhiX genome.

http://en.wikipedia.org/wiki/Phi_X_174

Page 45: Part 2 of RNA-seq for DE analysis: Investigating raw data

45 of 56

Biological contamination: what's in it

Mitochondria containrRNA, mRNA and mtDNA

cell

rRNA and non-coding (95% of RNA)

mRNA (5% of RNA)

nucleus

Page 46: Part 2 of RNA-seq for DE analysis: Investigating raw data

46 of 56

Biological contamination (1)

mRNAs are captured with oligo-dT coated beads.

Occasionally, non-protein coding sequences are also captured (especially since mtRNA and rRNA can be relatively rich in AT).

We can remove them via homology searching (BLAST) with known non-protein coding sequences.

Mitochondrial

mRNA (5% of RNA)

rRNA and nc

Page 47: Part 2 of RNA-seq for DE analysis: Investigating raw data

47 of 56

Biological contamination (2)

mRNAs are post-transcrip- tionally modified: e.g. the addition of a poly-A tail. If our goal is to map the reads to a reference genome sequence, the polyA tails should be removed. This can be viewed as some source of 'biological contamination' in our sequences.

AAAAAAAAAAAAA

Page 48: Part 2 of RNA-seq for DE analysis: Investigating raw data

48 of 56

● Get the non-protein coding sequences via Biomart, and also mitochondrial genome sequence.

Biological contamination: howto

Page 49: Part 2 of RNA-seq for DE analysis: Investigating raw data

49 of 56

Biological contamination

Page 50: Part 2 of RNA-seq for DE analysis: Investigating raw data

50 of 56

Biological contamination

Page 51: Part 2 of RNA-seq for DE analysis: Investigating raw data

51 of 56

Filter the biological contamination

Your reads

The biological readsImported via Biomart

We are interested in the reads that don't map!

Page 52: Part 2 of RNA-seq for DE analysis: Investigating raw data

52 of 56

Doing this in Galaxy

PRO TIP: take a sample of your reads with the tools: fastq-to-tabular, select random lines, tabular-to-fastq

1. create a new history and load the sample data in3. Run fastqMcf to remove technical sequences4. Run bowtie to match against biological sequence databases you just fetched, and keep reads that don't match.5. Summarize: fastqc

→ create a workflow of this, and run it on all your samples in parallel

Page 53: Part 2 of RNA-seq for DE analysis: Investigating raw data

53 of 56

Summary preprocessing

Your reads

…...Format consistent? Errors in quality?

Your groomed reads

…....…... Trends in raw data? QC report

Your groomed reads without technical contamination

….... ... Get biological contaminants- ….- ….

Your groomed reads without technical and biological contamination

…... How does your data look now? QC

... Get technical contaminants- ….

Page 54: Part 2 of RNA-seq for DE analysis: Investigating raw data

54 of 56

KeywordsPaired end

Stranded reads

gzip

fastq

Biological contamination

Technical contamination

Adapter sequence

Write in your own words what the terms mean

Page 56: Part 2 of RNA-seq for DE analysis: Investigating raw data

56 of 56

Break