PARABASALIA  (Excavata,  Metamonada)  

Vera  Tai1,  Erick  R.  James2,  Patrick  J.  Keeling2  1BC-­‐CFE  in  HIV/AIDS,  St.  Paul’s  Hospital,  Vancouver,  BC,  Canada  

 Amitochondriate  proOsts  (but  have  hydrogenosome)  that  are  best  known  as  parasites  of  vertebrate  hosts  (eg.  Trichomonas  vaginalis,  Tritrichomonas  foetus)     Greatest  diversity  is  found  as  symbionts  in  the  hindguts  of  wood-­‐eaOng  cockroaches  and  termites     Phylum  is  named  aUer  the  parabasal  apparatus  which  consists  of  a  parabasal  body  (modified  Golgi)  with  parabasal  fibres  that  are  aWached  to  basal  bodies       Most  have  an  axostyle  which  is  a  hollow  tube  of  a  rolled  row  of  microtubules   Ancestor  is  thought  to  be  a  trichomonad-­‐like  cell,  simple  in  structure,  bearing  4  flagella,  one  of  which  is  recurrent  and  underlain  by  the  costa  forming  an  undulaOng  membrane   Assumed  to  have  evolved  from  simple  to  complex  and  was  divided  into  two  classes,  the  simpler  Trichomonadida  and  the  mulOflagellated  HypermasOgida   This  view  was  overly  simplisOc  and  current  classificaOon  includes  6  classes  of  Parabasalia  implying  several  transiOons  of  mulOplicaOon  and  reducOon  in  flagellar,  cytoskeletal,  and  nuclear  elements   Many  are  misclassified,  especially  smaller  ones,  due  to  misunderstanding  of  morphological  evoluOon   Many  other  parabasalids  remain  unclassified  because  new  taxonomic  groups  need  to  be  defined  

are needed. In the present study, Spirotrichonymphea andHypotrichomonadea are represented by only two taxa and afurther taxon sampling may improve the resolution; however,

Hypotrichomonadea comprises only two genera [26] both ofwhich are included in the analyses and Spirotrichonymphea cells,usually small in size, are very hard to distinguish by lightmicroscopy if multiple species occur simultaneously in the gut oftermites (and they very often do).

Table 3. Shimodaira-Hasegawa (SH) and approximatelyunbiased (AU) tests for parabasalian root positions.

Root position P value

SH AU

a 0.012* 0.001*

b 0.088 0.044*

c 0.005* ,0.001*

d 0.019* 0.001*

e 0.367 0.161

f 0.378 0.013*

g 0.491 0.148

h 0.009* 0.002*

i 0.018* 0.001*

j 0.065 ,0.001*

k Best Best

Root positions are depicted in Figure 3. Asterisks indicate that the root positionwas significantly different from the best ML topology at P,0.05.doi:10.1371/journal.pone.0029938.t003

Figure 4. Maximum likelihood tree based on concatenation of GAPDH, actin, EF-1a, and SSU rRNA gene sequences and rooted byTrimastix. Unambiguously aligned amino acid sites of GAPDH (257), actin (268), and EF-1a (274), and nucleotide sites of SSU rRNA (1338) genesequences were concatenated and analyzed in 28 parabasalian species with Trimastix as an outgroup. The tree was estimated in RAxML using theCAT model (CATMIX). The parameters and branch length were optimized for each gene partition individually. The supporting values (bootstrap inRAxML/Bayesian posterior probability) are indicated at the nodes. Values below 50% or 0.5 are indicated by hyphens. Vertical bars to the right of thetree represent the parabasalian classes. The scale bar corresponds to 0.10 substitutions per site.doi:10.1371/journal.pone.0029938.g004

Table 4. Exclusion of parabasalian taxa and the effect ontheir root.

No. of parabasalian taxaexcluded 23 outgroup taxa 13 outgroup taxa

3 10 NT

6 10 NT

12 10 10

16 4 8

18 5 6

Values represent the number of occurrences of root position k (shown inFigure 3) in 10 replicates of the random taxa exclusion analyses in each definednumber of excluded taxa. NT, not tested. The 23 outgroup taxa correspond tothe concatenate dataset of EF-1a, actin, and SSU rRNA gene sequences using 23outgroup taxa as shown in Figure 3, whereas the 13 outgroup taxa correspondto those remained after excluding 10 long-branch outgroup taxa (asinvestigated in Table S1). Note that in the cases of 16 and 18 taxa exclusions, allother replicates demonstrated the root position at the branch leading toTrichonymphea (position g).doi:10.1371/journal.pone.0029938.t004

Phylogeny and Evolution of Parabasalia

PLoS ONE | www.plosone.org 8 January 2012 | Volume 7 | Issue 1 | e29938

C. Trichomonadea O. Trichomonadida F. Trichomonadidae O. Honigbergiellida, F. Honigbergiellidae F. Hexamastigidae F. Tricercomitidae

C. Hypotrichomonadea O. Hypotrichomonadida F. Hypotrichomonadidae

C. Tritrichomonadea O. Tritrichomonadida F. Tritrichomonadidae F. Dientamoebidae F. Monocercomonadidae

C. Cristamonadea O. Cristamonadida F. Lophomonadidae

C. Trichonymphea O. Trichonymphida F. Hoplonymphidae F. Staurojoenidae F. Trichonymphidae F. Teranymphidae F. Spirotrichosomidae

C. Spirotrichonymphea O. Spirotrichonymphida F. Holomastigotoididae

!"#$%&'(

!

" # $

CURRENT  CLASSIFICATION  based  on  Cepicka  et  al.  2010  

Cristamonadida  

Trichonymphida  

Spirotrichonymphida  

Trichomonadida  

Tritrichomonas murisImage caption: Scanning electron micrograph of cells from a rodent.

Page 1/1

image  by  G.  Brugerolle  

image  by  G.  Brugerolle  

Tritrichomonadida  

Hypotrichomonadida  image  by  J.  Cole  

2Department  of  Botany,  University  of  BriOsh  Columbia,  Vancouver,  BC,  Canada  

ARTICLE IN PRESS

I. Cepicka et al.418

PHYLOGENY  OF  MAJOR  LINEAGES  Noda  et  al.  2012  

EVOLUTION  of  MORPHOLOGICAL  TRAITS  Cepicka  et  al.  2012  

EXAMPLE  IMAGES  of  MAJOR  LINEAGES  

MANY  DESCRIBED  ORGANISMS  ARE  UNCLASSIFIED  or  MISCLASSIFIED,  MANY  MORE  ARE  BEING  DISCOVERED,  WITH  PARTICULARINTEREST  ON  FREE-­‐LIVING  ONES  THAT  MAY  SHED  LIGHT  ON  THE  ROOT  OF  THE  EXCAVATA  

Cthylla microfasciculumque n. sp. James and Keeling,2012urn:lsid:zoobank.org:act:C5109A93-A1EC-4362-AEBF-

D2E538C55D66Type host: Reticulitermes virginicus (Isoptera, Rhinotermitidae:

barcode JX975354)Type locality: Ft. Lauderdale, Secrete Woods County Park,

Florida, USA: lat. 26.08567, long. 280.18017.Host collection: University of Florida termite collection,

accession number FL2261. Collector R. H. Scheffrahn. CollectedFeb 21, 2005.Description: Parabasalian flagellate with morphological

characteristics of the genus Cthylla. Cells are 10 to 15 mm inlength and 6 to 10 mm in width. Found in the hindgut ofReticulitermes virginicus. Distinct SSU rRNA sequence (GenBankaccession number JX975350)Hapantotype: Microscope slide deposited at the Beaty

Biodiversity Museum, University of British Columbia, Vancouver,Canada under accession number MI-PR201.Gene sequence: SSU rRNA accession number JX975350.Etymology: Species name refers to the small (micro) bunch

(fasciculumque) of flagella.

Materials and Methods

Host identification and barcodingParaneotermes simplex was collected Sept. 15, 2002 in Secret

Woods County Park, Ft. Lauderdale, Florida, (lat. 26.08567, long.280.18017) and deposited in the University of Florida termite

collection, accession number FL1563. Reticulitermes virginicus wascollected on Feb 21, 2005 at the same location and deposited inthe University of Florida termite collection, accession numberFL2261. Cryptotermes cylindroceps, Calcaritermes nearcticus, and Hetero-termes tenuis were collected as reported previously [21,22]. Nospecific permits were required for the described field studies, thelocations are not privately owned or protected, and no endangeredor protected species were collected.DNA barcodes at the mitochondrial 16S (LSU) rRNA marker

for P. simplex and R. virginicus were amplified using LR-N-13398CGCCTGTTTATCAAAAACAT and LR-J-13007TTACGCTGTTATCCCTAA under conditions previously de-scribed [21,22]. Since no comparable P. simplex barcode wasavailable, we also barcoded P. simplex from eight other indepen-dent isolations (University of Florida Termite collection accessionsFL2476, FL1793, PR348, BA2814, BZ87, GUA615, HN24, andHN700) from Florida, Puerto Rico, Bahamas, Belize, Guatemala,and Honduras (the latter three being new regional and countryrecords for this species). These new barcodes were submitted toGenBank under accessions KC140183-90. These were alignedwith all available Paraneotermes and Reticulitermes mt LSU termitebarcodes from Genbank using MAFFT [24], and refined by eyeusing SeaView [25]. Poorly aligned regions were automaticallyremoved with trimAl using a gap threshold of 0.9 [26]. AIC weightas calculated with the perl script MrAIC.pl [27] was used todetermine the evolutionary model that best fit the data, whichcorresponded to GTR+C+I in all cases. For the termite phylogeny,Maximum Likelihood (ML) estimation was carried out using

Figure 5. Phylogenetic relationships between Cthulhu, Cthylla, environmental sequences, and closely related parabasalians. Bayesiantree with posterior probabilities (upper) and maximum likelihood bootstraps (lower) indicated for each node, and major identified groups named tothe right. Cthulhu and Cthylla are both related to unidentified environmental sequences from Heterotermes tenuis and Reticulitermes chinensis,respectively. They are all closely related to a large clade of unidentified environmental sequences from Cryptotermes, Glyptotermes, and Calcaritermes,which has previously been hypothesized to represent Tricercomitus. If true, then Cthulhu and Cthylla would be best considered members of theTricercomitidae, thought this will depend on molecular characterization for this group.doi:10.1371/journal.pone.0058509.g005

Cthulhu and Cthylla

PLOS ONE | www.plosone.org 6 March 2013 | Volume 8 | Issue 3 | e58509

Ctuhlhu  and  Cthylla  are  possibly  members  of  a  yet  to  be  described  order  of  Trichomonadida  (James  et  al.  2013)  

Cthulhu  

Kofoidia  

Kofoidia  is  a  Cristamonad,  but  taxa  known  as  the  lophomonads  (*)are  polyphyleOc  and  the  type  genus  of  the  family  Lophomonadidae  groups  outside  of  the  Cristamonadea.    A  redefined  taxonomy  is  needed  for  the  cristamonads  (Tai  et  al.  2015)  

!"#$"#%&'(')*+,*

-"#.$*(')*+,*

!"!#

$!!%$"!!

&'%$"!!

()%$"!!

**)(%!"&+

$!!%$"!!

,#%!"(#

,,%!"&(

)-%!"&,

&!%$"!!

)'%!",+ &)%$"!!

$!!%$"!!

(+%$"!! (#%!"&(

$!!%$"!!

**('%!"&&

**(-%!"&(

**&+%$"!!

)-%!"&+

&&%$"!!

&)%$"!!

(#%!"&#

,'%!"&)

&#%$"!!

$!!%$"!!

./+#(()$*!"#$%&'('%$)*+,-./0,$*01234$(

.5-$#(#(*1$0'&,-(,)*20$3".'00")*67189:;<*=>)./+#((#+*4',%"$*$%%,.&,%)

5?&()-$&*5'-'%6(7+$*3$0,%&"%"$

5?&()---*5'-'%6(7+$*($.8"%%'%"$5?&()--$*5'-'%6(7+$*8'"9:/("$

./+#(()-*;$.-'&-".+'('%$)*6@"*26A4$./+#(()'*;$.-'&-".+'('%$)*6@"*2>A$

5A$)!)++*;,&$9,3,).'3"%$*('9".$*BC:;D*2EF1@+'

./+#(()!*<'$"%$*%$%$*GH534-./!'---#*=,3,).'3"%$*6@"*IJ&

K$,#!)*;,&$9,3,).'3"%$*7'06)7"-$

./!'--$+*5-67&'&,-(,)*9'(,)&"./)*67189:;<*GH'LM(##+!#*5$9/.,"$*3,-)$&"0")

./+#((#(*=,3,).'3"%$*6@"*IJ534)./+#((#&*=,3,).'3"%$*6@"*2>L4$

!"#"$%$&'(")$*+(&,&/%0'),/1.#!,234!"#"$%$&'(")$*+(&,&/%0'),/1.#5"#3*

0M-$#(')*5$0'%6(7+$*.+"$LM(##+!'*>&,7+$%'%6(7+$*%,0/(?"/(*BC:;D*$

0M-$#('(*>%69,-,00$*)@,:6$,0M#&'$++*>%69,-,00$*6$("%"

.N!)'-&+*5$0'%6(7+$*#-$))""*BC:;D*$

.?#('',,*;"A'&-".+$*7$-$9'A$.?$'-+),*1'-/#$*?'%"&$

.?#('',(*=,0&'&-".+'%6(7+$*%$%$O(,$'-*;,&$9,3,).'3"%$*,A&-$%,$*PA$#

./+#((#)*4',%'"9,)*"%&,-(,9"$*01?4-./+#((##*?:D;9;Q*@RCBEDCCQ*PQ?4-

.N,'!+!#*=",%&$(',?$*2-$#"0")

.N!##(!'*B-"&-".+'('%$)*%'%.'%2'-($*S$$+.5-&'!#)*C")&'('%$)*(,0,$#-"9")

2M-#+)',*>"(70"."('%$)*)"("0")

K$,#!&*B-"&-".+'('%$)*2',&/)*.TGG*'!&-+

LM$,+'!$*;'%'.,-.'('%$)*.'0/?-'-/(*AUIT$K$,#!,*;'%'.,-.'('%$)*6@"*.TGG*#!-$!

6

5 7 -

*  *  

*  *  

*  

*  *  

Calonymphidae?  

Devescovinidae?  

Kofoiididae?  

Deltotrichonymphidae?  

Coronymphidae??  

REFERENCES  Cepicka  et  al.  2010.    CriOcal  taxonomic  revision  of  parabasalids  with  descripOon  of  one  new  genus  and  three  new  species.    Pro8st.    161:  400-­‐433    

Tai  et  al.  2015.    The  phylogeneOc  posiOon  of  Kofoidia  loriculata  (Parabasalia)  and  its  implicaOons  for  the  evoluOon  of  the  Cristamonadea.    J  Euk  Micro.    62:  255-­‐259  

James  et  al.  2013.  Cthulhu  macrofasciculumque  n.  g.,  n.  sp.  and  Cthylla  microfasciculumque  n.  g.,  n.  sp.,  a  newly  idenOfied  lineage  of  parabasalian  termite  symbionts.    PLoSONE.  8:  e58509  

Noda  et  al.  2012.  Molecular  phylogeny  and  evoluOon  of  Parabasalia  with  improved  taxon  sampling  and  new  protein  markers  of  acOn  and  elongaOon  factor-­‐1α.    PLoSONE.    7:  e29938