pair-wise and multiple sequence alignment using dynamic programming (local & global alignment) g...
TRANSCRIPT
![Page 1: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/1.jpg)
Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local &
Global Alignment)
G P S Raghava
![Page 2: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/2.jpg)
Protein Sequence Alignment and Database Searching
•Alignment of Two Sequences (Pair-wise Alignment)
– The Scoring Schemes or Weight Matrices
– Techniques of Alignments
– DOTPLOT
•Multiple Sequence Alignment (Alignment of > 2 Sequences)
–Extending Dynamic Programming to more sequences
–Progressive Alignment (Tree or Hierarchical Methods)
–Iterative Techniques
• Stochastic Algorithms (SA, GA, HMM)
• Non Stochastic Algorithms •Database Scanning
– FASTA, BLAST, PSIBLAST, ISS
• Alignment of Whole Genomes
– MUMmer (Maximal Unique Match)
![Page 3: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/3.jpg)
Pair-Wise Sequence Alignment
Scoring Schemes or Weight Matrices Identity Scoring Genetic Code Scoring Chemical Similarity Scoring Observed Substitution or PAM Matrices PEP91: An Update Dayhoff Matrix BLOSUM: Matrix Derived from Ungapped Alignment Matrices Derived from Structure
Techniques of Alignment Simple Alignment, Alignment with Gaps Application of DOTPLOT (Repeats, Inverse Repeats, Alignment) Dynamic Programming (DP) for Global Alignment Local Alignment (Smith-Waterman algorithm)
Important Terms Gap Penalty (Opening, Extended) PID, Similarity/Dissimilarity Score Significance Score (e.g. Z & E )
![Page 4: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/4.jpg)
Aligning biological sequences
• Nucleic acid (4 letter alphabet + gap)
TT-GCACTTTACAC
• Proteins (20 letter alphabet + gap)
RKVA--GMAKPNMRKIAVAAASKPAV
![Page 5: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/5.jpg)
• Any two sequences can always be aligned
• There are many possible alignments
• Sequence alignment needs to be scored to find the „optimal“ alignment
• In many cases there will be several solutions with the same score
ACGTACGTACGTACGTACGTACGTACGT | | | | | | |GATCGATCGATCGATCGATCGATCGATC ACGTACGTACGTACGTACGTACGTACGT
| | | | | | | GATCGATCGATCGATCGATCGATCGATC
ACGTACGTACGTACGTACGTACGTACGT | | | | | | GATCGATCGATCGATCGATCGATCGATC
ACGTACGTACGTACGTACGTACGTACGT | | | | | | | GATCGATCGATCGATCGATCGATCGATC
ACCGGTACGTTACGATACGTAACGTTACTGTACTGT | | | | | | | GATCGATCGATCGATCGATCGATCGATC
Question:what is „similar“enough to be relevant ?
Problem
![Page 6: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/6.jpg)
What is sequence alignmentGiven two sentences of letters (strings), and a scoring scheme for evaluating matching letters, find the optimal pairing of letters from one sequence to letters of the other sequence
Align:THIS IS A RATHER LONGER SENTENCE THAN THE NEXTTHIS IS A SHORT SENTENCE
THIS IS A RATHER LONGER - SENTENCE THAN THE NEXT|||| || | --*|-- -|---| - |||||||| ---- --- ----
THIS IS A --SH-- -O---R T SENTENCE ---- --- ----orTHIS IS A RATHER LONGER SENTENCE THAN THE NEXT|||| || | ------ ------ |||||||| ---- --- ----THIS IS A SHORT- ------ SENTENCE ---- --- ----
![Page 7: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/7.jpg)
Dynamic Programming
• Dynamic Programming allow Optimal Alignment between two sequences
• Allow Insertion and Deletion or Alignment with gaps
• Needlman and Wunsh Algorithm (1970) for global alignment
• Smith & Waterman Algorithm (1981) for local alignment
• Important Steps– Create DOTPLOT between two sequences
– Compute SUM matrix
– Trace Optimal Path
![Page 8: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/8.jpg)
![Page 9: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/9.jpg)
Steps for Dynamic Programming
![Page 10: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/10.jpg)
Steps for Dynamic Programming
![Page 11: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/11.jpg)
Steps for Dynamic Programming
![Page 12: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/12.jpg)
Steps for Dynamic Programming
![Page 13: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/13.jpg)
Important Terms in Pairwise Sequence Alignment
Global Alignment
–Suite for similar sequences
–Nearly equal legnth
– Overall similarity is detected
Local Alignment
–Isolate regions in sequences
–Suitable for database searching
–Easy to detect repeats
•Gap Penalty (Opening + Extended)
ALTGTRTG...CALGR …
AL.GTRTGTGPCALGR …
![Page 14: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/14.jpg)
1 AGGATTGGAATGCTCAGAAGCAGCTAAAGCGTGTATGCAGGATTGGAATTAAAGAGGAGGTAGACCG... 67 |||||||||||||| | | | ||| || | | | || 1 AGGATTGGAATGCTAGGCTTGATTGCCTACCTGTAGCCACATCAGAAGCACTAAAGCGTCAGCGAGACCG 70
Global alignment
Two sequences sharing several local regions of local similarity
Algorithm: GAP(Needleman & Wunsch)Produces an end-to-end alignment
![Page 15: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/15.jpg)
1 AGGATTGGAATGCTCAGAAGCAGCTAAAGCGTGTATGCAGGATTGGAATTAAAGAGGAGGTAGACCG.... 67 |||||||||||||| | | | ||| || | | | || 1 AGGATTGGAATGCTAGGCTTGATTGCCTACCTGTAGCCACATCAGAAGCACTAAAGCGTCAGCGAGACCG 70
Algorithm: Bestfit(Smith & Waterman)Identifies the region with the best local similarity
Algorithm: Similarity(X. Huang)Identifies all regions with local similarity
1 AGGATTGGAATGCT |||||||||||||| 1 AGGATTGGAATGCT
39 AGGATTGGAAT ||||||||||| 1 AGGATTGGAAT
62 AGACCG ||||||66 AGACCG
14 TCAGAAGCAGCTAAAGCGT ||||||||| |||||||||42 TCAGAAGCA.CTAAAGCGT
14 TCAGAAGCAGCTAAAGCGT ||||||||| |||||||||42 TCAGAAGCA.CTAAAGCGT
Local alignment
![Page 16: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/16.jpg)
Global alignmentthe gap
1 AGGATTGGAATGCTCAGAAGCAGCTAAAGCGTGTATGCAGGATTGGAATTAAAGAGGAGGTAGACCG 67 |||||||||||||| | || | | | | | || | | | 1 AGGATTGGAATGCTACAGAAGCAGCTAAAGCGTGTATGCAGGATTGGAATTAAAGAGGAGGTAGACCG 68
1 AGGATTGGAATGCT.CAGAAGCAGCTAAAGCGTGTATGCAGGATTGGAATTAAAGAGGAGGTAGACCG 67 |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||1 AGGATTGGAATGCTACAGAAGCAGCTAAAGCGTGTATGCAGGATTGGAATTAAAGAGGAGGTAGACCG 68
The alignment is much better when one gap is introduced
![Page 17: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/17.jpg)
Parameters for sequence alignment
Gap penalties
Opening: The cost to introduce a gap
Extension: The cost to extend a gap
Scoring systems
Every symbol pairing is assigned with a numerical value that is
based on a „symbol comparison“ or „replacement“ table/matrix
![Page 18: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/18.jpg)
The optimal alignment of two similar sequences usually
• maximizes the number of matches and
• minimizes the number of gaps.
Permitting the insertion of arbitrarily many gaps might lead to
high scoring alignments of non-homologous sequences.
Penalizing gaps forces alignments to have relatively few gaps.
Why gap penalties ?
Gap penalties increase the quality of an alignment –
non-homologous sequences are not aligned
![Page 19: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/19.jpg)
Linear gap penalty score:
Affine gap penalty score:
(g) = gap penalty score of a gap of length g
d = gap opening penalty e = gap extension penalty g = gap length
(g) = - gd
(g) = -d - (g -1) e
Gap penalties
![Page 20: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/20.jpg)
match = 1 mismatch = 0
Scoring insertions and deletions
T A T G T G C G T A T A | | | | | | | | A T G T - - - T A T A C
T A T G T G C G T A T A | | | | A T G T T A T A C
Total Score: 4
Total Score: 8 + (-3.2) = 4.8
(g) = -3 - (3 -1) 0.1 = -3.2
Gap parameters:
d = 3 (gap opening)
e = 0.1 (gap extension)
g = 3 (gap length)
![Page 21: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/21.jpg)
Calculating alignments:Global vs. Local alignment
• For optimal GLOBAL alignment, we want best score in the final row or final column
GLOBAL - best alignment of entirety of both sequences (possibly at expense of great local similarity)
• For optimal LOCAL alignment, we want best score anywhere in matrix
LOCAL - best alignment of segments, without regard to rest of two sequences (at the expense of the overall score)
![Page 22: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/22.jpg)
Important Points in Pairwise Sequence Alignment
Significance of Similarity– Dependent on PID (Percent Identical Positions in Alignment)
–Similarity/Disimilarity score
– Significance of score depend on length of alignment
–Significance Score (Z) whether score significant
–Expected Value (E), Chances that non-related sequence may have that score
![Page 23: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/23.jpg)
Why we do multiple alignments?• Multiple nucleotide or amino sequence alignment techniques are
usually performed to fit one of the following scopes :– In order to characterize protein families, identify shared regions
of homology in a multiple sequence alignment; (this happens generally when a sequence search revealed homologies to several sequences)
– Determination of the consensus sequence of several aligned sequences.
– Help prediction of the secondary and tertiary structures of new sequences;
– Preliminary step in molecular evolution analysis using Phylogenetic methods for constructing phylogenetic trees
![Page 24: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/24.jpg)
An example of Multiple Alignment
VTISCTGSSSNIGAG-NHVKWYQQLPGQLPGVTISCTGTSSNIGS--ITVNWYQQLPGQLPGLRLSCSSSGFIFSS--YAMYWVRQAPGQAPGLSLTCTVSGTSFDD--YYSTWVRQPPGQPPGPEVTCVVVDVSHEDPQVKFNWYVDG--ATLVCLISDFYPGA--VTVAWKADS--AALGCLVKDYFPEP--VTVSWNSG---VSLTCLVKGFYPSD--IAVEWWSNG--
![Page 25: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/25.jpg)
Alignment of Multiple Sequences
Extending Dynamic Programming to more sequences–Dynamic programming can be extended for more than two
–In practice it requires CPU and Memory (Murata et al 1985)
– MSA, Limited only up to 8-10 sequences (1989)
–DCA (Divide and Conquer; Stoye et al., 1997), 20-25 sequences
–OMA (Optimal Multiple Alignment; Reinert et al., 2000)
–COSA (Althaus et al., 2002)
Progressive or Tree or Hierarchical Methods (CLUSTAL-W)–Practical approach for multiple alignment
–Compare all sequences pair wise
–Perform cluster analysis
–Generate a hierarchy for alignment
–first aligning the most similar pair of sequences
–Align alignment with next similar alignment or sequence
![Page 26: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/26.jpg)
Alignment of Multiple Sequences
Iterative Alignment Techniques
•Deterministic (Non Stochastic) methods–They are similar to Progressive alignment
–Rectify the mistake in alignment by iteration
–Iterations are performed till no further improvement
–AMPS (Barton & Sternberg; 1987)
–PRRP (Gotoh, 1996), Most successful
–Praline, IterAlign
• Stochastic Methods– SA (Simulated Annealing; 1994), alignment is randomly modified only acceptable alignment kept for further process. Process goes until converged
– Genetic Algorithm alternate to SA (SAGA, Notredame & Higgins, 1996)
–COFFEE extension of SAGA
–Gibbs Sampler
–Bayesian Based Algorithm (HMM; HMMER; SAM)
–They are only suitable for refinement not for producing ab initio alignment. Good for profile generation. Very slow.
![Page 27: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/27.jpg)
Alignment of Multiple Sequences
Progress in Commonly used Techniques (Progressive)Clustal-W (1.8) (Thompson et al., 1994)
Automatic substitution matrix
Automatic gap penalty adjustment
Delaying of distantly related sequences
Portability and interface excellent
T-COFFEE (Notredame et al., 2000)
Improvement in Clustal-W by iteration
Pair-Wise alignment (Global + Local)
Most accurate method but slow
MAFFT (Katoh et al., 2002)
Utilize the FFT for pair-wise alignment
Fastest method
Accuracy nearly equal to T-COFFEE
![Page 28: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/28.jpg)
![Page 29: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/29.jpg)
Multiple Alignment Method• The steps are summarized as follows:• Compare all sequences pairwise. • Perform cluster analysis on the pairwise data • Generate a hierarchy for alignment
– Binary tree or a simple ordering• First align the most similar pair of sequences • Then the next most similar pair and so on. • Once an alignment of two sequences has been made,
then this is fixed. • Thus for a set of sequences A, B, C, D having aligned • A with C and B with D • Alignment of A, B, C, D is obtained by comparing the
alignments of A and C with that of B and D – using averaged scores at each aligned position.
![Page 30: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/30.jpg)
ClustalW- for multiple alignment • ClustaW is a multiple alignment program for DNA or proteins.• Developed by Julie D. Thompson, Toby Gibson at EMBL/EBI• ClustalW: Improving the sensitivity of multiple sequence
alignment – sequence weighting– positions-specific gap penalties – weight matrix choice– Nucleic Acids Research, 22:4673-4680
• Manipulate existing alignments • do profile analysis • create phylogentic trees.• Alignment can be done by 2 methods:
- slow/accurate
- fast/approximate
![Page 31: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/31.jpg)
Running ClustalW [~]% clustalw
************************************************************** ******** CLUSTAL W (1.7) Multiple Sequence Alignments ******** **************************************************************
1. Sequence Input From Disc 2. Multiple Alignments 3. Profile / Structure Alignments 4. Phylogenetic trees
S. Execute a system command H. HELP X. EXIT (leave program)
Your choice:
![Page 32: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/32.jpg)
Using ClustalW
****** MULTIPLE ALIGNMENT MENU ****** 1. Do complete multiple alignment now (Slow/Accurate) 2. Produce guide tree file only 3. Do alignment using old guide tree file
4. Toggle Slow/Fast pairwise alignments = SLOW
5. Pairwise alignment parameters 6. Multiple alignment parameters
7. Reset gaps between alignments? = OFF 8. Toggle screen display = ON 9. Output format options
S. Execute a system command H. HELP or press [RETURN] to go back to main menu
Your choice:
![Page 33: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/33.jpg)
Output of ClustalWCLUSTAL W (1.7) multiple sequence alignment
HSTNFR GGGAAGAG---TTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAG------GCAGSYNTNFTRP GGGAAGAG---TTCCCCAGGGACCTCTCTCTAATCAGCCCTCTGGCCCAG------GCAGCFTNFA -------------------------------------------TGTCCAG------ACAGCATTNFAA GGGAAGAG---CTCCCACATGGCCTGCAACTAATCAACCCTCTGCCCCAG------ACACRABTNFM AGGAGGAAGAGTCCCCAAACAACCTCCATCTAGTCAACCCTGTGGCCCAGATGGTCACCCRNTNFAA AGGAGGAGAAGTTCCCAAATGGGCTCCCTCTCATCAGTTCCATGGCCCAGACCCTCACACOATNFA1 GGGAAGAGCAGTCCCCAGCTGGCCCCTCCTTCAACAGGCCTCTGGTTCAG------ACACOATNFAR GGGAAGAGCAGTCCCCAGCTGGCCCCTCCTTCAACAGGCCTCTGGTTCAG------ACACBSPTNFA GGGAAGAGCAGTCCCCAGGTGGCCCCTCCATCAACAGCCCTCTGGTTCAA------ACACCEU14683 GGGAAGAGCAATCCCCAACTGGCCTCTCCATCAACAGCCCTCTGGTTCAG------ACCC ** *
![Page 34: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/34.jpg)
ClustalW optionsYour choice: 5 ********* PAIRWISE ALIGNMENT PARAMETERS ********* Slow/Accurate alignments:
1. Gap Open Penalty :15.00 2. Gap Extension Penalty :6.66 3. Protein weight matrix :BLOSUM30 4. DNA weight matrix :IUB
Fast/Approximate alignments:
5. Gap penalty :5 6. K-tuple (word) size :2 7. No. of top diagonals :4 8. Window size :4
9. Toggle Slow/Fast pairwise alignments = SLOW
H. HELPEnter number (or [RETURN] to exit):
![Page 35: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/35.jpg)
ClustalW optionsYour choice: 6
********* MULTIPLE ALIGNMENT PARAMETERS *********
1. Gap Opening Penalty :15.00 2. Gap Extension Penalty :6.66 3. Delay divergent sequences :40 %
4. DNA Transitions Weight :0.50
5. Protein weight matrix :BLOSUM series 6. DNA weight matrix :IUB 7. Use negative matrix :OFF
8. Protein Gap Parameters
H. HELP
Enter number (or [RETURN] to exit):
![Page 36: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/36.jpg)
ClustalX - Multiple Sequence Alignment Program
• ClustalX provides a new window-based user interface to the ClustalW program.
• It uses the Vibrant multi-platform user interface development library, developed by the National Center for Biotechnology Information (Bldg 38A, NIH 8600 Rockville Pike,Bethesda, MD 20894) as part of their NCBI SOFTWARE DEVELOPEMENT TOOLKIT.
![Page 37: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/37.jpg)
ClustalX
![Page 38: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/38.jpg)
ClustalX
![Page 39: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/39.jpg)
ClustalX
![Page 40: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/40.jpg)
ClustalX
![Page 41: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/41.jpg)
ClustalX
![Page 42: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/42.jpg)
ClustalX
![Page 43: Pair-wise and Multiple Sequence Alignment Using Dynamic Programming (Local & Global Alignment) G P S Raghava](https://reader036.vdocuments.site/reader036/viewer/2022062423/56649daa5503460f94a98678/html5/thumbnails/43.jpg)
Thanks