p53-dependent x-ray-induced modulation of cytokine mrna levelsin vivo

J. Pathol. 186: 24–30 (1998)

p53-DEPENDENT X-RAY-INDUCED MODULATION OFCYTOKINE mRNA LEVELS IN VIVO

. . **, . . *

MRC Radiation and Genome Stability Unit, Chilton, Didcot, Oxon OX11 0RD, U.K.

SUMMARY

In vitro studies have shown that ionizing radiation can cause increases in some cytokine mRNA levels and activation of the nuclearNF-êB and/or AP1 transcription factors which have been implicated in the transcriptional regulation of many cytokine genes. Thus,radiation-induced upregulation of cytokine mRNAs appeared to be in part a direct consequence of transcription factor activation. To testthis in vitro model in vivo, the effects of whole-body X-irradiation (0–10 Gy) on cytokine and other gene mRNA levels have beenexamined in mice. Increases and decreases in cytokine mRNA levels were detected in tissues which underwent an early wave of apoptosis(bone marrow and/or spleen), but not in more radioresistant tissues (kidney, liver, brain, and heart). Some mouse strain-specificdifferences were observed, but none of the changes in mRNA level was detected in p53"/" mice. As activation of the NF-êB and AP1transcription factors was not detected in early-(spleen) or late-(liver) responding tissues in 10 Gy X-irradiated p53+/+ mice in vivo, itis concluded that the modulation of cytokine gene expression in vivo is p53-dependent and indirectly associated with apoptosis. ? 1998John Wiley & Sons, Ltd.

KEY WORDS—gene expression; apoptosis; X-ray; cytokine; p53

INTRODUCTION

Increasing evidence suggests that the cellular responseto ionizing radiation involves the recognition of theradiation-induced damage and the initiation of signaltransduction cascade(s) which lead to cell cycle arrest,damage repair, and a decision to survive or die byapoptosis.1–3 A key response to genotoxic damage is theactivation of the p53 tumour suppressor gene product,as p53 has been implicated in cell cycle arrest, transcrip-tional control, and apoptosis.1–4 Ionizing radiationinduces p53 protein levels at the post-transcriptionallevel,4 but the cellular signal which induces the transientaccumulation of nuclear p53 protein remains to beelucidated.

Although the intracellular pathways which are acti-vated by ionizing radiation and which signal growtharrest, differentiation, or programmed cell death havebeen extensively investigated, much less is known aboutintercellular signalling in response to ionizing radiation-induced damage. In vitro studies have shown thatsteady-state mRNA levels encoding secretable cytokineproteins such as interleukin 1 (IL-1á and IL-1â),á-interferon, basic fibroblast growth factor (bFGF),platelet-derived growth factor á (PDGF-á), and tumournecrosis factor á (TNF-á) are induced by ionizingradiation.5–9 As extracellular messengers, these cyto-kines mediate the immune/inflammatory response tostress; regulate cell proliferation, differentiation, anddeath; and signal at the whole tissue/organism level.10–13

In vitro studies have led to the proposal that the

*Correspondence to: Mark A. Plumb, MRC Radiation andGenome Stability Unit, Chilton, Didcot, Oxon OX11 0RD, U.K.E-mail: [email protected]

**Current address: University of Bristol, Department of Medicine,Bristol Royal Infirmary, Marlborough Street, Bristol BS2 8HW, U.K.

Contract grant sponsors: Medical Research Council; LeukaemiaResearch Fund.

CCC 0022–3417/98/010024–07 $17.50? 1998 John Wiley & Sons, Ltd.

stimulation of protein tyrosine kinases in response tothe formation of radiation-induced reactive oxygenintermediates (ROIs) is followed by the activation ofsignal transduction pathway(s) which ultimately result inthe activation of transcription factors involved incytokine gene transcription, such as NF-êB, AP1, andSRF.8,14–25

Recent studies have shown that the in vivo response toionizing radiation as defined by the induction of p53protein and/or apoptosis is tissue-dependent in themouse. For example, immunohistochemical studies haveshown that ionizing radiation heterogeneously inducesp53 protein and apoptosis in cell populations in bonemarrow, spleen, and thymus; induces p53 protein in asubpopulation of cells without detectable apoptosis inthe kidney, heart, and lung; and induces neither p53protein nor apoptosis in the liver and brain,26 althoughwestern blot analyses indicate that p53 protein isinduced to a greater or lesser extent in all tissues.27

As the in vivo cell-specific p53-dependent response toionizing radiation is considerably more complicatedthan predicted from in vitro studies, we have examinedcytokine mRNA levels in various mouse tissues afterin vivo exposure to X-irradiation. We conclude thatobserved changes in mRNA levels in vivo are p53-dependent and an indirect consequence of apoptosis.

MATERIALS AND METHODS

Mice

Male mice 8–17 weeks old (MRC Harwell colonies)were whole-body X-irradiated at a dose rate of 0·5 Gy/min. A breeding nucleus of p53"/" mice with a 75 percent C57BL/6 and 25 per cent 129/Sv genetic back-ground28 was backcrossed with 129/Sv mice to generatep53"/+ mice in a predominantly 129/Sv geneticbackground.

Received 4 December 1997Revised 23 January 1998Accepted 26 March 1998

25P53-DEPENDENT RNA RADIATION RESPONSE

The animal studies were carried out under guidanceissued by the MRC in ‘Responsibility in the Use ofAnimals in Medical Research’ (July 1993) and HomeOffice project licence No. PPL 30/00689.

DNA ‘laddering’ assayPBS-washed bone marrow cell (2#106) lysates were

analysed essentially as previously described.29 Sampleswere resolved by 2 per cent (w/v) agarose gel electro-phoresis and then gels were incubated at 37)C for 4 hin 20 ìg/ml RNase A, before staining with ethidiumbromide.

Northern blot analysisTotal cellular RNA from bone marrow cell suspen-

sions was isolated using the RNAzol-B technique(Biogenesis Ltd). Mouse brain, heart, lung, liver, kidney,and spleen were snap-frozen in liquid nitrogen; groundto a powder; and lysed directly in RNAzol-B. RNA(30 ìg) was resolved by denaturing 1·2 per centagarose/18 per cent (vol/vol) formaldehyde gel electro-phoresis and transferred to GeneScreen (Du Pont), priorto UV-crosslinking.

With the exception of the MIP-1á cDNA ribo-probes,30 cDNA inserts were labelled (Random PrimersDNA Labeling System, Life Technologies) using[á-32P]dATP (Amersham, 3000 Ci/mmol). Filters werepre-hybridized and hybridized in a solution containing 7per cent (w/v) sodium dodecyl sulphate (SDS), 1 per cent(w/v) bovine serum albumin (BSA), 0·25 NaCl, and0·25 Na2HPO4 buffer (pH 7·2) at 65)C for 16 h;washed sequentially at 65)C in 4#SSC, 0·5#SSC, and0·2#SSC each containing 0·1 per cent SDS; andresolved by autoradiography.

Northern blots were quantitated using an AlphaInnotech Corporation (CA, U.S.A.) Digital Imagingand Analysis System. Where possible, induction levelsare expressed relative to basal levels in the mock-irradiated tissue after being corrected for loadingrelative to GAPDH and/or actin mRNA controls.

cDNA probesMouse cDNA clones encoding CD19,31 DNA ligase

I,32 IGIF,33 IL-1á and IL-1â,34 lysozyme M cDNA,35

MIP-1á, MIP-1â and rat GAPDH,30,36 muscle creatinekinase,37 TGF-â1,38 and TNF-á39 were as described.Human â-actin was from Clontech.

Crude nuclear extractsAll solutions were ice-cold and contained protease

and phosphatase inhibitors essentially as described.30

Fresh spleens and livers were gently homogenized in asolution containing 0·25 sucrose, 10 m Tris–Cl(pH 7·5), and 2·5 m MgCl2 (TMS) containing 0·2 percent (v/v) Triton X-100, and nuclei were recovered bycentrifugation and washed once with TMS. Nuclei weresuspended in 100 ìl (spleen) or 300 ìl (liver) of storagebuffer [SB: 50 m NaCl, 20 m Hepes (pH 7·9), 5 mMgCl2, 0·1 m EDTA, 1 m dithiothreitol, and 20 percent (v/v) glycerol], and 4 NaCl was added to 0·4 .

? 1998 John Wiley & Sons, Ltd.

The crude nuclear extract was isolated by centrifugationat 100 000 g for 1 h and stored at "70)C.

Electrophoretic mobility shift assays

Double-stranded oligonucleotides containing p53(GGACATGCCCGGGCATGTCC),40 NF-êB (CAACGGCAGGGGAATTCCCCTCTCCTT),30 and AP1(CTCGATGCCATGACTCATCTTTAC)36 consensusrecognition sequences were as described.

Binding reactions, in a final volume of 30 ìl of SB,contained 4 ìl of crude nuclear extract, 9 ìg ofpoly(dI.dC) (dI.dC), 0·5 ng of double-strandedoligonucleotide probe 5* kinase end-labelled with[c-32P]ATP (Amersham, 3000 Ci/mmol), the presence orabsence of 100 ng of cold competitor oligonucleotide,and, in the case of p53 EMSAs, 1 ìl of Pab421 anti-p53monoclonal antibody (p53 [Ab-1], Oncogene Science).Binding reactions were incubated on ice for 90 min andthen resolved by non-denaturing 5 per cent (w/v)polyacrylamide/0·2#TBE gel electrophoresis andautoradiography.30,36,40

RESULTS

To investigate the in vivo response to X-irradiation ofcandidate genes at the mRNA level, total cellular RNAwas isolated from several CBA/H mouse tissues either0–16 h after 10 Gy X-irradiation to examine the kineticsof modulation, or 8 h after X-irradiation (0·1–10 Gy) ina dose–response study, and analysed by northern blothybridizations. Maximum apoptosis at 8 h associatedwith a decline in spleen weight following 5 Gy ionizingradiation has been described.26 We detected a wave ofDNA laddering in the CBA/H bone marrow 2–6 h(maximum 3–4 h) after 10 Gy X-irradiation (Fig. 1). Theobserved post-10 Gy X-irradiation decline in the yield oftotal RNA from spleen (275 per cent after 8 h) andbone marrow (40 per cent after 8 h) is consistent withthe temporal apoptotic differences between these twotissues.

The only cytokine mRNA which was modulated inheart (Fig. 2B), kidney, brain, or liver (data not shown)in response to radiation, when compared with GAPDHand â-actin controls, was IL-1â, which exhibited anincrease 16 h (but not 8 h) after 10 Gy X-irradiation,suggesting that this late response is an indirectconsequence of X-irradiation.

Interestingly, no change in M-CK mRNA levels weredetected in heart (Fig. 2B), despite the fact that p53protein is induced in heart in vivo and that the M-CKgene contains p53-responsive elements,41 but this isconsistent with the reported transcriptional inactivity ofp53 in the irradiated mouse myocardium.27

In vivo increases in mRNA levels after 10 GyX-irradiation

Whole-body 10 Gy X-irradiation resulted in increasesof IL-1â, TNF-á, and interferon-ã-inducing factor(IGIF) mRNA levels in bone marrow and spleen, in

J. Pathol. 186: 24–30 (1998)

26 N. C. H. KERR ET AL.

addition to IL-1á and macrophage inflammatory protein1á and 1â (MIP-1á and MIP-1â) mRNAs detected inirradiated but not control spleen (Fig. 2A and data notshown). Increases in non-cytokine lysozyme M (Fig. 2A)and ferritin heavy (H) chain and ‘ferritin S’ (spleen butnot bone marrow, data not shown) mRNAs were alsoobserved.

Small but significant differences were apparent in thekinetics (Fig. 2A) and/or dose–response (Figs 2C and2D) in the induction of mRNAs within a tissue orbetween tissues. For example, a higher dose of X-rayswas required to obtain an equivalent increase in IGIFmRNA in spleen (Fig. 2D) compared with bone marrow(Fig. 2C), suggesting that the response of the expressingcells is tissue-specific and/or that there are tissue-specificdifferences in the expressing cells themselves. Similarly,in time-course studies, equivalent changes in IL-1â (andto a lesser extent TNF-á) mRNA levels occurred slightlylater in spleen than in bone marrow (Fig. 2A).

By comparison with GAPDH and â-actin loadingcontrols, mRNA increases of more than five-fold rela-tive to levels in mock-irradiated bone marrow or spleenwere observed for IL-1â (ten- to 20-fold) and IGIF (five-to ten-fold). IL-1á, MIP-1á, MIP-1â, and ferritin SmRNAs were detected only in irradiated but not controlspleen. All other mRNA level increases were less thanfive-fold compared with basal levels in the tissue andcould represent the enrichment of a radioresistant sub-population of cells in the tissue, as more sensitivenon-expressing subpopulation(s) of cells are lost throughapoptosis.

In vivo decreases in mRNA levels after 10 GyX-irradiation

Radiation-induced decreases in levels of mRNAsencoding DNA ligase I, the B-cell marker CD19, and a


novel uncharacterized 0·6 kb bone marrow-specific tran-script detected with a TGF-â1 cDNA probe (Figs 2A,2C, and 2D) were again observed only in bone marrowand spleen. Time-course studies showed that the mRNAlevel decreases were coordinate within a tissue (Figs 2A,2C, and 2D, and data not shown) and declined to lessthan 20 per cent of basal levels 8 h after 10 GyX-irradiation. Basal levels of DNA ligase I mRNA werealso detected in brain, kidney, heart, and liver, but didnot alter in time-course studies (data not shown), indi-cating that the observed decreases in spleen and bonemarrow are an indirect effect. Similarly, the decrease inCD19 mRNA presumably reflects the loss by apoptosisof radiosensitive CD19+ B-cells.

Compared with bone marrow, a higher dose of X-rayswas required to obtain an equivalent mRNA leveldecrease in the spleen (cf. LIG-I, Fig. 2C and CD19,Fig. 2D), again suggesting that the radiosensitivity ofthe cells expressing the CD19 and DNA ligase I mRNAsin the two tissues is different.

mRNA levels in irradiated p53"/" miceAs significant early (<8 h) radiation-induced changes

in mRNA levels in vivo were detected only in tissueswhich underwent a wave of apoptosis (bone marrow andspleen), we examined the effects of radiation on mRNAlevels in p53"/" mice which are resistant to radiation-induced p53-dependent apoptosis. The genetic back-ground of the p53"/" mice is predominantly 129/Svbut contains a small (<5 per cent) C57BL/6 component,so bone marrow and spleen from individual wild-typep53+/+ (129/Sv and C57BL/6), (p53"/"#129/Sv)F1p53+/" heterozygotes and p53"/" homozygoteswere compared 8 h after mock or 10 Gy X-irradiation.

The radiation-induced increases (IL-1â, TNFá, MIP-1á, and IGIF) or decreases (DNA ligase I, CD19, and0·6 kb TGF-â1-related transcript) in mRNA levelsobserved in CBA/H bone marrow and/or spleen (Fig. 2)were also generally observed in p53+/+ 129/Sv andC57BL/6 mice, and in p53+/" heterozygotes (Fig. 3and data not shown). In contrast, spleen and bonemarrow mRNA levels did not change significantly 8 hafter 10 Gy X-irradiation of p53"/" mice (Fig. 3 anddata not shown), indicating that the modulation ofmRNA levels observed in bone marrow and spleenin vivo is p53-dependent.

In addition to the differences detected between p53"/" and p53+/+ or p53+/" mice, strain-specificresponses were also observed. For example, the 2·4 kbTGF-â1 mRNA is unaffected by radiation in the CBA/Hor C57BL/6 bone marrow and spleen after 8 h (Fig. 2Aand data not shown), but decreases in p53+/+ (129/Sv)and to a lesser extent p53+/" but not p53"/" mice(Fig. 3D). The induction of IGIF and IL-1â mRNAlevels in 129/Sv mouse bone marrow was minimal(<two-fold) compared with that in C57BL/6 andCBA/H mice (ten- to 20-fold, Fig. 2A and 3E and datanot shown), whereas in spleen mRNA induction levelswere comparable in CBA/H, C57BL/6, and 129/Sv mice(Figs 2 and 3F, and data not shown). Thus, the strain-specific differences are apparent in bone marrow but notspleen.

Fig. 1—Time course of apoptosis-related DNA fragmentation inCBA/H mouse bone marrow following 10 Gy X-irradiation. Bonemarrow cell lysates from control (0) or irradiated CBA/H mice 0–24 hafter 10 Gy X-irradiation were resolved by 2 per cent (w/v) agarose gelelectrophoresis. M=ÖX174/HaeIII fragments (bp)

J. Pathol. 186: 24–30 (1998)


Transcription factor activation

The activation of NF-êB and AP1 transcription fac-tors by ionizing radiation has been inferred from in vitrostudies, and both have been implicated in the transcrip-tional regulation of cytokine genes such as MIP-1á,TNF-á, and IL-1â, whose mRNA levels are upregulatedin response to ionizing radiation in vivo (Figs 2 and 3).p53, NF-êB- and AP1-related DNA-binding activities incrude nuclear extracts prepared from in vivo control andX-irradiated CBA/H mouse spleen and liver were there-fore assessed using electrophoretic mobility shift assays(EMSAs). The EMSAs were performed using conditionsand the same or similar consensus DNA-binding recog-nition sequences, which we have previously used toshow quantitative and/or qualitative changes in NF-êB


and AP1 DNA-binding activities in endotoxin/serum-stimulated macrophage cell lines in vitro.30,36 Tissuenuclear extracts were prepared 3 h after X-irradiation tooptimize the probability of detecting quantitative orqualitative changes in DNA-binding activity and tominimize the potential complications caused by the waveof apoptosis which is initiated at about this time in thespleen.26

As shown in Fig. 4A, a dose-dependent (0·5–2 Gy)induction of nuclear p53 DNA-binding activity isdetected in spleen nuclear extracts, consistent with in situimmunological studies which show a dose-dependentand heterogeneous induction of p53 at these compara-tively low doses.26,27 In contrast, and at higher(5–10 Gy) X-ray doses, no significant quantitative orqualitative changes in NF-êB- (Fig. 4B) or AP1-related

Fig. 2—(A) Northern blot analyses of CBA/H bone marrow and spleen total cellular RNA (30 ìg) 0–8 h after 10 Gy X-irradiationhybridized to the probes as shown. GAPDH or â-actin was used as the loading control. The major 2·4 kb and bone marrow-specific 0·6 and0·3 kb transforming growth factor â1 (TGFâ1)-related mRNAs are shown with arrows. (B) Northern blot analyses of heart RNA (30 ìg)0–16 h after 10 Gy X-irradiation and hybridized to the probes as shown. (C, D) Northern blot analyses of bone marrow (B) or spleen (C)RNAs 8 h after 0–10 Gy X-irradiation and probed as shown

J. Pathol. 186: 24–30 (1998)


(Fig. 4C) DNA-binding activity were detectable in eitheran early-responding (spleen) or a late-responding (liver)tissue, providing supportive evidence that the mech-anism(s) responsible for the observed increases ofcytokine mRNAs levels in response to ionizing radiationin vivo is not transcriptional.

DISCUSSION

X-irradiation of mice results in tissue- and/or strain-specific changes in IL-1â, IL-1á, TNF-á, IGIF, TGF-â1,MIP-1á, and MIP-1â cytokine mRNA levels. Thesechanges were detected within 3–8 h after X-irradiation inearly responding tissues (bone marrow and/or spleen)which contain cell subpopulations which undergo apop-tosis 2–8 h after irradiation, but were undetectable inmore radioresistant late-responding tissues (heart, brain,kidney, or liver). As none of these changes was detectedin 10 Gy X-irradiated p53"/" mice, they are p53-dependent and presumably an indirect consequence ofapoptosis rather than a direct response to the initialirradiation.

Evidence is presented that many of the mRNA levelchanges observed are attributable to the loss of radio-sensitive population(s) of cells in the complex spleen andbone marrow tissues. For example, many of the mRNAlevel increases observed were less than five-fold com-pared with basal levels. Similarly, basal levels of DNAligase I mRNA decreased in bone marrow and spleen,but did not change in response to radiation in the moreradioresistant mouse tissues that do not undergo apop-tosis (brain, kidney, heart, and liver). Furthermore, thedose required to cause a significant decrease (DNAligase I and CD19) or increase (IGIF and IL-1â) in


specific mRNA levels was noticeably higher in spleenthan in bone marrow, and in the case of the B-cell-specific CD19 marker, this is consistent with the three-to four-fold greater radiosensitivity of bone marrowB-cell precursors compared with mature B-cells in thespleen.42

Although many of the p53-dependent changes inspecific mRNA levels observed in vivo could be attributedto cell population changes, other changes where morethan ten-fold increases in mRNA levels were observed(IL-1â, IGIF, MIP-1á, and MIP-1â) are less likely to besolely attributable to cell population changes. Forexample, maximum levels of IL-1â mRNA are detectedearlier in bone marrow than in spleen, and there is a directtemporal relationship between maximum IL-1â mRNAlevels and induction of apoptosis in the two tissues. Theselate changes, where considerable cell death has occurredin the tissues, may reflect cytokine production by inflam-matory cells. It is therefore unlikely that the changes are adirect response to X-irradiation, but rather are a second-ary response to apoptosis.

Tyrosine phosphorylation and subsequent activationof signal transduction pathways leading to transcriptionfactor activation have been implicated in the response toionizing radiation in vitro.3,15,17,20,22,24,42,43–46 In par-ticular, the AP1 and NF-êB transcription factors havebeen implicated in the transcriptional upregulation ofcytokine genes and are induced by ionizing radiationin vitro.6,14,15,17,18,20–22,30,36,47–51 However, the activationof spleen and liver AP1- and NF-êB-related nuclearDNA-binding activities was not observed within 3 hafter in vivo 5–10 Gy irradiation, although a dose-dependent (0·5–2 Gy) increase in nuclear p53 DNA-binding was detectable in the same nuclear extracts,consistent with other in vivo studies which demonstrated

Fig. 3—Northern blot analyses of total cellular RNA (30 ìg) isolated from bone marrow (BM, rows A–E) or spleen (SPL, rows F and G) isolatedfrom individual control (") or 10 Gy X-irradiated (+) C57BL/6, 129/Sv or p53"/+ and p53"/" mice 8 h after irradiation and probed as shown.The irradiated p53"/" mouse which has high levels of GAPDH mRNA in the spleen (row G) also had elevated CD19 mRNA levels and anenlarged spleen (data not shown) attributed to an infection

J. Pathol. 186: 24–30 (1998)


dose-dependent and heterogeneous induction of p53protein.26,27 As there is no evidence that these cytokinegenes have transcriptional p53-response element(s),these data are supporting evidence that in vivo modu-lation of cytokine (and other) early-response genemRNA levels is indirectly associated with p53 proteininduction and is not a direct consequence of radiation-induced transcriptional upregulation. As in vitro studieshave shown that cytokine mRNA levels are also regu-lated at the level of mRNA stability,52–56 our data raise


the interesting formal possibility that the more thanten-fold increases in cytokine mRNA levels observedin vivo are in part a consequence of p53-dependentcytokine mRNA stabilization.

Mouse strain-specific quantitative differences in 10 GyX-irradiation-induced increases (IGIF and IL-1â) ordecreases (the 2·4 kb TGF-â1 transcript) of mRNAlevels were detected. Interestingly, these strain-specificdifferences were observed in bone marrow but notspleen. Mouse strain-specific responses to ionizingradiation have been reported and include survival,57

differences in thymocyte radiosensitivity,58 and inci-dence of radiation-induced delayed chromosomalinstability,59 indicating that there is a large geneticcomponent which quantitatively and/or qualitativelydetermines a cell’s response to ionizing radiation in vivo.

Taken together, our data are consistent with changesin cytokine mRNA levels being an indirect consequenceof X-irradiation. This is in sharp contrast to in vitrostudies, where an increasing number of radiation-responsive intracellular kinases and signal transductionpathways leading to transcription factor activation havebeen identified. In many ways, our results are verysimilar to the in vivo studies on the p53 responsein mouse tissues to ionizing radiation, which wereunexpected in the light of preceding in vitro studies.

ACKNOWLEDGEMENTS

We thank T. Tedder, A. Montecucco, H. Okamura,and M. Kurimoto (Hayashibara Biochemical Labora-tories, Okayama), K. Brookman, E. Kuff, A. Shaw, M.Cross, and J. Buskin for the cDNA clones used in thestudy, and L. A. Donehower and A. Bradley for provid-ing the p53 knockout mice to generate a breedingnucleus. This work was supported by the MedicalResearch Council and the Leukaemia Research Fund.

REFERENCES

1. Marx J. New link found between p53 and DNA repair. Science 1994; 266:1321–1322.

2. Levine AJ. p53, the cellular gatekeeper for growth and division. Cell 1997;88: 323–331.

3. Brown L, McCarthy N. A sense-abl response? Nature 1997; 387: 450–451.4. Kastan MB, Onyekwere O, Sidransky D, Vogelstein B, Craig RW. Partici-

pation of p53 protein in the cellular response to DNA damage. Cancer Res1991; 51: 6304–6311.

5. Woloschak GE, Chang-Liu C-M. Differential modulation of specific geneexpression following high- and low-LET radiations. Radiat Res 1990; 124:183–187.

6. Sherman ML, Datta R, Hallahan DE, Weichselbaum RR, Kufe DW.Regulation of tumor necrosis factor gene expression by ionizing radiation inhuman myeloid leukemia cells and peripheral blood monocytes. J ClinInvest 1991; 87: 1794–1797.

7. Weichselbaum RR, Hallahan DE, Sukhatme V, Dritschilo A, Sherman ML,Kufe DW. Biological consequences of gene regulation after ionizing radia-tion exposure. J Natl Cancer Inst 1991; 83: 480–484.

8. Lee YJ, Galoforo SS, Berns CM, et al. Effect of ionizing radiation on AP-1binding activity and basic fibroblast growth factor gene expression indrug-sensitive human breast carcinoma MCF-7 and multidrug-resistantMCF-7/ADR cells. J Biol Chem 1995; 270: 28 790–28 796.

9. Weill D, Gay F, Tovey MG, Chouaib S. Induction of tumor necrosis factoralpha expression in human T lymphocytes following ionizing gammairradiation. J Inteferon Cytokine Res 1996; 16: 395–402.

10. Lasky LA. Chemokines; combinatorial mediators of inflammation? CurrBiol 1993; 3: 366–368.

Fig. 4—Electrophoretic mobility shift assays (EMSAs) of spleenand/or liver crude nuclear extracts isolated 3 h after 0–10 GyX-irradiation. (A) Antibody-dependent p53 DNA-binding activity ofspleen nuclear extracts prepared 3 h after 0–2·0 Gy X-irradiation in thepresence (+) or absence (") of a 200-fold excess of cold competitoroligonucleotide. (B, C) EMSA using spleen or liver nuclear extractsprepared 3 h after 0–10 Gy X-irradiation and incubated with end-labelled double-stranded oligonucleotides containing (B) NF-êB or(C) AP1 consensus recognition sequences in the presence (+) orabsence (") of a 200-fold excess of cold competitor oligonucleotide.Specific p53, NF-êB, and AP1-related nucleoprotein complexes areshown

J. Pathol. 186: 24–30 (1998)


11. Kishimoto T, Taga T, Akira S. Cytokine signal transduction. Cell 1994; 76:253–262.

12. Collins MKL, Lopez-Rivas A. Cytokines and apoptosis: the mechanism ofregulation of cell death. In: Garland JM, Queensberry PJ, Hilton DJ, eds.Colony Stimulating Factors. New York: Marcel Dekker 1997; 107–132.

13. Adams DH, Lloyd AR. Chemokines: leucocyte recruitment and activationcytokines. Lancet 1997; 349: 490–495.

14. Datta R, Rubin E, Sukhatme V, et al. Ionizing radiation activates transcrip-tion of the EGR1 gene via CArG elements. Proc Natl Acad Sci USA 1992;89: 10 149–10 153.

15. Hallahan DE, Sukhatme VP, Sherman ML, Virudachalam S, Kufe D,Weichselbaum RR. Protein kinase C mediates X-ray inducibility of nuclearsignal transducers EGR1 and JUN. Proc Natl Acad Sci USA 1991; 88:2156–2160.

16. Meyer M, Schreck R, Baeuerle PA. H2O2 and antioxidants have oppositeeffects on activation of NF-êB and AP-1 in intact cells: AP-1 as secondaryantioxidant-responsive factor. EMBO J 1993; 12: 2005–2015.

17. Park Chae H, Jarvis LJ, Uckun FM. Role of tyrosine phosphorylation inradiation-induced activation of c-jun protooncogene in human lymphohe-matopoietic precursor cells. Cancer Res 1993; 53: 447–451.

18. Sahijdak WM, Yang C-R, Zuckerman JS, Meyers M, Boothman DA.Alterations in transcription factor binding in radioresistant humanmelanoma cells after ionizing radiation. Radiat Res 1994; 138: S47–S51.

19. Schreck R, Rieber P, Baeuerle PA. Reactive oxygen intermediates asapparently widely used messengers in the activation of the NF-êB transcrip-tion factor and HIV-1. EMBO J 1991; 10: 2247–2258.

20. Sherman ML, Datta R, Hallahan DE, Weichselbaum RR, Kufe DW.Ionizing radiation regulates expression of the c-jun protooncogene. ProcNatl Acad Sci USA 1990; 87: 5663–5666.

21. Uckun FM, Schieven GL, Tuel-Ahlgren, LM, et al. Tyrosine phosphoryla-tion is a mandatory proximal step in radiation-induced activation of theprotein kinase C signalling pathway in human B-lymphocyte precursors.Proc Natl Acad Sci USA 1993; 90: 252–256.

22. Wilson RE, Taylor SL, Atherton GT, Johnson D, Waters CM, Norton JD.Early response gene signalling cascades activated by ionising radiation inprimary human B cells. Oncogene 1993; 8: 3229–3237.

23. Pinkus R, Weiner LM, Daniel V. Role of oxidants and antioxidants inthe induction of AP-1, NF-kappa B, and glutathione S-transferase geneexpression. J Biol Chem 1996; 271: 13 422–13 429.

24. Woloschak GE, Chang-Liu C-M, Shearin-Jones P. Regulation of proteinkinase C by ionizing radiation. Cancer Res 1990; 50: 3963–3967.

25. Valerie K, Laster WS, Kirkham JC, Kuemmerle NB. Ionizing radiationactivates nuclear factor kappa B but fails to produce an increase in humanimmunodeficiency virus gene expression in stably transfected human cells.Biochemistry 1995; 34: 15 768–15 776.

26. Midgley CA, Owens B, Briscoe CV, Thomas DB, Lane DP, Hall PA.Coupling between gamma irradiation, p53 induction and the apoptoticresponse depends upon cell type in vivo. J Cell Sci 1995; 108: 1843–1848.

27. MacCallum DE, Hupp TR, Midgley CA, et al. The p53 response to ionisingradiation in adult and developing murine tissues. Oncogene 1996; 13:2575–2587.

28. Donehower LA, Harvey M, Slagle BL, et al. Mice deficient for p53 aredevelopmentally normal but susceptible to spontaneous tumours. Nature1992; 356: 215–221.

29. Smith CA, Williams GT, Kingston R, Jenkinson EJ, Owen JJT. Antibodiesto CD3/T-cell receptor complex induce death by apoptosis in immature Tcells in thymic cultures. Nature 1989; 337: 181–184.

30. Grove M, Plumb M. C/EBP, NF-êB, and c-Ets family members andtranscriptional regulation of the cell-specific and inducible macrophageinflammatory protein 1á immediate-early gene. Mol Cell Biol 1993; 13:5276–5289.

31. Zhou L-J, Ord DC, Hughes AL, Tedder TF. Structure and domainorganization of the CD19 antigen of human, mouse, and guinea pig Blymphocytes. Conservation of the extensive cytoplasmic domain. J Immunol1991; 147: 1424–1432.

32. Savini E, Biamonti G, Ciarrocchi G, Montecucco A. Cloning and sequenceanalysis of a cDNA coding for the murine DNA ligase I enzyme. Gene 1994;144: 253–257.

33. Okamura H, Tsutsui H, Komatsu T, et al. Cloning of a new cytokine thatinduces IFN-ã production by T cells. Nature 1995; 378: 88–91.

34. Gray PW, Glaister D, Chen E, Goeddel DV, Pennica D. Two interleukin 1genes in the mouse: cloning and expression of the cDNA for murineinterleukin 1 beta. J Immunol 1986; 137: 3644–3648.


35. Cross M, Mangelsdorf I, Wedel A, Renkawitz R. Mouse lysozyme M gene:isolation, characterization, and expression studies. Proc Natl Acad Sci USA1988; 85: 6232–6236.

36. Proffitt J, Crabtree G, Grove M, et al. An ATF/CREB-binding site isessential for cell-specific and inducible transcription of the murine MIP-1âcytokine gene. Gene 1995; 152: 173–179.

37. Buskin JN, Jaynes JB, Chamberlain JS, Hauschka SD. The mouse musclecreatine kinase cDNA and deduced amino acid sequences: comparison toevolutionarily related enzymes. J Mol Evol 1985; 22: 334–341.

38. Derynck R, Jarrett JA, Chen EY, Goeddel DV. The murine transforminggrowth factor-beta precursor. J Biol Chem 1986; 261: 4377–4379.

39. Pennica D, Hayflick JS, Bringman TS, Palladino MA, Goeddel DV.Cloning and expression in Escherichia coli of the cDNA for murine tumornecrosis factor. Proc Natl Acad Sci USA 1985; 82: 6060–6064.

40. Kadhim MA, Walker CA, Plumb MA, Wright EG. No association betweenp53 status and á-particle-induced chromosomal instability in human lym-phoblastoid cells. Int J Radiat Biol 1996; 69: 167–174.

41. Jackson P, Shield M, Buskin J, et al. p53-dependent activation of the mouseMCK gene promoter: identification of a novel p53-responsive sequence andevidence for cooperation between distinct p53 binding sites. Gene Expression1995; 5: 19–33.

42. Griffiths SD, Goodhead DT, Marsden SJ, et al. Interleukin 7-dependent Blymphocyte precursor cells are ultrasensitive to apoptosis. J Exp Med 1994;179: 1789–1797.

43. Kasid U, Suy S, Dent P, Ray S, Whiteside TL, Sturgill TW. Activation ofRaf by ionizing radiation. Nature 1996; 382: 813–816.

44. Chen YR, Wang X, Templeton D, Davis RJ, Tan TH. The role of c-JunN-terminal kinase (JNK) in apoptosis induced by ultraviolet C and gammaradiation. Duration of JNK activation may determine cell death andproliferation. J Biol Chem 1996; 271: 31 929–31 936.

45. Testolin L, Carson C, Wang Y, Walker PR, Armato U, Sikorska M. Junand JNK kinase are activated in thymocytes in the response to VM26 andradiation but not glucocorticoids. Exp Cell Res 1997; 230: 220–232.

46. Suy S, Anderson WB, Dent P, Chang E, Kasid U. Association of Grb2 withSos and Ras with Raf-1 upon gamma irradiation of breast cancer cells.Oncogene 1997; 15: 53–61.

47. Bailly S, Fay M, Israel N, Gougerot-Pocidalo MA. The transcription factorAP-1 binds the human interleukin 1 alpha promoter. Eur Cytok Netw 1996;7: 125–128.

48. Collart MA, Bauerle P, Vassalli P. Regulation of tumor necrosis factoralpha transcription in macrophages: involvement of four êB-like motifs andof constitutive and inducible forms of NF-êB. Mol Cell Biol 1990; 10:1498–1506.

49. Hiscott J, Marois J, Garoufalis J, et al. Characterization of a functionalNF-êB site in the human interleukin 1â promoter; evidence for a positiveautoregulatory loop. Mol Cell Biol 1993; 13: 6231–6240.

50. Kim S-J, Angel P, Lafyatis R, et al. Autoinduction of transforming growthfactor beta 1 is mediated by the AP-1 complex. Mol Cell Biol 1990; 10:1492–1497.

51. Wulczyn FG, Krappmann D, Scheidereit C. The NF-kappa B/Rel and Ikappa B gene families: mediators of immune response and inflammation. JMol Med 1996; 74: 749–769.

52. Plumb MA, Wright E. Macrophage inflammatory protein 1á. In: GarlandJM, Queensberry PJ, Hilton DJ, eds. Colony Stimulating Factors. NewYork: Marcel Dekker 1997; 421–444.

53. Han J, Beutler B, Huez G. Complex regulation of tumor necrosis factormRNA turnover in liopolysaccharide-activated macrophages. Biochim Bio-phys Acta 1991; 1090: 22–28.

54. Wittemore L-A, Maniatis T. Postinduction turnoff of beta-interferon geneexpression. Mol Cell Biol 1990; 64: 1329–1337.

55. Shaw G, Kamen R. A conserved AU sequence from the 3* untranslatedregion of GM-CSF mRNA mediates selective mRNA degradation. Cell1986; 46: 659–667.

56. Goldberg MA, Gaut CC, Bunn HF. Erythropoietin mRNA levels aregoverned by both the rate of gene transcription and posttranscriptionalevents. Blood 1991; 77: 271–277.

57. Roderick TH. The response of twenty-seven inbred strains of mice to dailydoses of whole-body X-irradiation. Radiat Res 1963; 20: 631–639.

58. Mori N, Okumoto M, van der Valk MA, et al. Genetic dissection ofsusceptibility to radiation-induced apoptosis of thymocytes and mapping ofRapop 1, a novel susceptibility gene. Genomics 1995; 25: 609–614.

59. Watson GE, Lorimore SA, Clutton SM, Kadhim MA, Wright EG. Geneticfactors influencing á-particle-induced chromosomal instability. Int J RadiatBiol 1997; 71: 497–503.

J. Pathol. 186: 24–30 (1998)

p53-dependent x-ray-induced modulation of cytokine mrna levelsin vivo

Documents