(CANCER RESEARCH 53, 2846-2851. June 15. IW]

p53 Alterations in Non-Small Cell Lung Cancers Correlate with MetastaticInvolvement of Hilar and Mediastinal Lymph Nodes1

Antonio Manchetti,2 Fiamma Buttitta, Giorgio Merlo, Francesca Diella, Silvia Pellegrini, Stefano Pepe,Paolo Macchiarmi,3 Antonio (lidia, C. Alberto Angeletti, Robert Callahan, Maria Bistocchi, and Francesco Squartini

Institute iff Pathological Anatomy and Histology ¡A.M., F. B., S. P.. M. B., F. S.¡unti Service of Thoracic Surgery ¡P.M.. A. C., C. A. A.I, University of Pisa, Pisa, Itetiv: FriedricMiesclier Institute ¡C.M./, Basel, Switzerland; Department of Medical Oncnlngv IS. P.I, University of Naples. Naples lta/\: and LI IB IF. D.. R. C./. NIH. Bethesda. Maryland20W2

ABSTRACT

Alterations of pS3 are one of the most common molecular changesfound in all types of lung tumors, suggesting a crucial role for p53 inbronchial carcinogencsis. However, the prognostic significance of pS3 abnormalities in lung cancer patients is still unclear. By using genetic andimmunohistochemical methods we have found p53 alterations in 40 of 53(75%) primary, resected non-small cell lung cancer. A strong association(P = 0.0015) was found between deletions on chromosome region 17pl3.3and /o.f mutations suggesting that loss of the wild-type p53 alíelemight be

necessary for tumorigenesis. Correlations to clinicopathological parameters showed that p53 alterations (structural aberration of the gene and/ornuclear accumulation of the protein) are significantly linked with meta-

static involvement of hilar and mediastinal lymph nodes (P < 0.01 ). Sincethe latter are well established prognostic factors for non-small cell lung

cancer. p53 aberrations may also be a predictor of tumor aggressiveness.

INTRODUCTION

Lung cancer has become a predominant cause of cancer-related

death throughout the world. From a clinicopathological point of viewa distinction is made between small cell lung carcinomas, which areextremely aggressive and treated mostly with chemotherapy, and othertypes (more than 75% of lung tumors) grouped together as NSCLC4

for which surgery is the treatment of choice when the disease islocalized ( 1). Smoking and other environmental carcinogens are wellknown risk factors; however, the biological events involved in thedevelopment of lung cancer are only beginning to be understood.Extensive studies using molecular and cellular techniques suggest thatbronchial carcinogenesis is a multistep process involving a cascade ofsomatic genetic changes (see Ref. 2 for review).

Mutations of the p53 gene, which encodes a Mr 53,000 nuclearphosphoprotein, are one of the most common genetic abnormalitiesfound in all types of lung tumors suggesting a crucial role for p53 inbronchial carcinogenesis (3-8). This gene was first considered as adominantly acting oncogene (9-11 ). It is now clear that the oncogenic

activity of p53 depends on the mutation of its coding sequence (12)and that the wild-type counterpart actually has a tumor suppressor

function (13, 14). Different mutations of p53 may have differenteffects on tumor development (see Ref. 15 for review). Some mutations are recessive and lead to the expression of an inactive protein,while others may exert a dominant loss of function effect in which themutant p53 overcomes the suppressor activity of the wild-type protein

by the formation of inactive complexes.

Received 5/27/92; accepted 4/7/93.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

1This work was supported in part by A.I.R.C. and CNR. ACRO. No. 9202272.39.2 To whom requests for reprints should be addressed, at Institute of Pathological

Anatomy and Histology. University of Pisa, via Roma 57. 56100 Pisa. Italy.1Present address: Department of Thoracic and Vascular Surgery and Heart-Lung

Transplantation. Hôpital Marie-Lannelongue (Paris-Sud University). 133 Avenue de laResistance. 92350 Plessis Robinson. Paris. France.

1The abbreviations used are: NSCLC, non-small cell lung cancer; PCR. polymerasechain reaction; SSCP. single strand conformation polymorphism; LOH. loss of heterozy-

gosity; cDNA, complementary DNA; CT. computed tomography.

The frequency of ¡>53abnormalities in lung cancer has been studiedby immunohistochemistry (5. 7. 16) or molecular biology techniques(direct sequencing, PCR-SSCP analysis) (3. 6, 8, 17). The immuno

histochemical approach is based on the assumption that mutations inthe p53 gene that are oncogenic can increase the half-lite of its protein

product (18). thus resulting in its accumulation to levels detectable byimmunohistochemical methods (19, 20). However, the actual numberof p53 aberrations can be underestimated by immunohistochemistryfor several reasons. Besides technical problems (?.#.. fixation or sample storing), it is well described that particular mutations (such asnonsense, splicing, or deletion) can affect the gene so that the proteinis not produced or the target epitopes are not available for the immu-noreaction (21, 22). Moreover, recent data would indicate that mis-

sense mutations do not always result in a sufficient stabilization of thep53 protein for its level to reach detectability by immunohistochemistry (23).

The direct identification of mutations with molecular biology methods can be performed with the PCR technology (24) and direct sequencing. However, this approach is time consuming and error pronespecially when analyzing large or medium-sized coding sequences.The recently developed PCR-SSCP technique (25) allows a simple

and quick detection of structural DNA aberrations including pointmutations. Although PCR-SSCP analysis is considered a very efficient

and sensitive method (8), in rare cases point mutations can escapedetection within a particular tumor DNA sequence. Generally thisreflects either an inability to separate the mutated strand from thewild-type strand by gel electrophoresis (26) or the mutation is present

in only a very small proportion of cells within the tumor sample.For all these reasons the use of a single technique may not be

sufficiently accurate to estimate ¡>53abnormalities. This may be particularly true considering a number of recent results indicating that indifferent cancer cell lines p53 overexpression can occur in the absenceof missense mutations (23). In this study we used several independenttechniques in order to perform a comprehensive analysis of p53 alterations in NSCLC and correlate them with established clinicopathological prognostic factors. Our results indicate that p53 abnormalitiesare extremely common in NSCLC and correlate with metastaticspread in hilar and mediastinal lymph nodes.

MATERIALS AND METHODS

Patients. The tumors for this study were obtained from 53 consecutiveoperable non-small cell lung cancers patients who underwent thoracic surgery

between January and September 1991. All patients received no previous treatment by chemotherapy, immunotherapy. or thoracic radiation. Preoperativestaging included a routine detailed history and physical examination, biochemical survey, chest radiography, bronchoscopy. CT of the chest and upperabdomen, including the adrenal glands, and abdominal ultrasonograpy: preoperative CT scan of the brain was not routinely performed. Cervical mediasti-

noscopy or anterior mediastinotomy was done when there was mediastinallymph node enlargement of >1.5 cm evident on CT of the thorax (27).Following the results of the staging procedures, all patients underwent acomplete resection of their primary tumor. Resection was defined as completeif in the surgeons' judgment all known disease was completely resected, the

2846

Research. on October 6, 2020. © 1993 American Association for Cancercancerres.aacrjournals.org Downloaded from

/)5.f ALTERATIONS [N NSCLC

proximal resection margins were microscopically free of tumor, no knownmicroscopic intrathoracic disease remained, and the node or area proximal to

the most histologically involved node or area excised was microscopically freeof tumor: intraoperatively, a radical regional (intraparenchymal, intersegmen-

tal, or hilar) and mediastinal lymphadenectomy were routinely performed (28).Tumor samples and the matching normal lung tissues were snap-frozen inliquid nitrogen within 10 min of excision and stored at -80°C. Immediately

adjacent pieces of tumor tissue were processed for diagnostic histopathology.Histological classification and differentiation were assessed by light microscopy according to the World Health Organization criteria (29). Patient stage atthe time of diagnosis was based on the international staging system for lung

tumors (30).Immunohistochemistry. Immunohistochemical detection was performed

using the anti-p5.i monoclonal antibodies PAb 1801 (Ab-2; Oncogene Science.

Manhasset, NY) at 200 ng/ml and PAb240 (Ab3, Oncogene Science), at 500ng/ml. These antibodies recognize two independent denaturation resistantepitopes on p53 protein from amino acids 32-79 (PAbl801 ) and 156-335 (PAb240) (31, 32). Five-fun cryostat sections were air-dried, fixed in acetone for 10min. washed in phosphate-buffered saline, and incubated overnight at 4°Cwith

monoclonal antibody supernatant. Immunohistochemical staining was performed using the avidin-biotin-peroxidase complex technique (Vectastain ABCKit. Vector Laboratories, Burlingame. CA) according to the manufacturer's

recommendation. Positive controls were two known positive cases of humanbreast cancer. Negative controls were obtained by replacement of primaryantiserum with buffer. Only tumors which exhibited intense nuclear stainingthroughout the malignant epithelium were categorized as overexpressing p53.

DNA Preparation and Southern Hybridization. Genomic DNA was extracted from the tumors as described (33). Ten fig of DNA were digested withthe appropriate restriction enzyme and the resulting fragments were subjectedto electrophoresis in 0.8% agarose gels, transferred to Genetran 45 nylonmembranes (Fiasco. Wobum. MA), and baked for 2-3 h at 80°C.The membranes were prehybridized and then hybridized to random primer 12P-labeled

DNA probes. After the hybridization, the membranes were washed understringent conditions ( 15 imi NaCL/1.5 HIMsodium citrate. pH 7.5. at 65°Cfor

20 min) and autoradiographed. The DNA probe was the pYNZ22.1 (AmericanType Culture Collection, Rockville, MD) located on chromosomal region17pl3.3. This probe detects restriction fragments length polymorphism on bothPstl and BcimHl digested human DNA. In our study BamHI restriction enzyme(Boehringer Mannheim Biochemica. Mannheim. Germany) was used.

PCR Amplification and SSCP Analysis. The SSCP analysis (25) wasperformed on PCR-amplified genomic DNA fragments to screen for point

mutation in exons 4 through 9 of the p53 gene. The technique was optimizedas indicated by Spinardi et al. (26). Routinely. 100 ng of genomic DNA wereused in a 10-/J.I PCR reaction containing 10 m.MTris-HCl (pH 8.3), 1.5 minMgCl2, 50 niM KC1, 0.01% (w/v) gelatine, 1.25 m.Meach of four deoxynucle-

otide triphosphates (Boehringer Mannheim Biochemica), 1 JAMof each primer.0.5 (¿1of [a-32P]dCTP (3000 Ci/mmol. Amersham, Arlington. IL) and 0.25

units of Taq DNA polymerase (Perkin-ElmerCetus, Norwalk, CT). Six couplesof specific ¡ntronicprimers, the sequences of which were deduced from Chu-

makov et al. (34), were used:

Exon 4, sense: 5'-AGGACCTGGTCCTCTGACTG,anti: 5'-CATTGAAGTCTCATGGAAGC;

Exon 5, sense: 5'-TGACTTTCAACTCTGTCTCCT,anti: 5'-TCAGTGAGGAATCAGAGGCC;

Exon 6, sense: 5'-CTGGAGAGACGACAGGGCTG.anti: 5'-CCAGAGACCCCAGTTGCAAAC;

Exon 7, sense: 5'-CTCGCGCACTGGCCTCATCTT,ami: 5'-TCAGCGGCAAGCAGAGGCTG:

Exon 8, sense: 5'- GGACAGGTAGGACCTGATTTCCTTAC,anti: 5'-TGCACCCTTGGTCTCCTCCAC;

Exon 9. sense: 5'-GGTGGAGGAGACCAAGGGTGCAGTT,anti: 5'-CTGGAAACTTTCCACTTGAT.

The PCR reaction was programmed as follow: initial denaturation, 9' at 94°C;amplification. 2' at 94°C.2' at 55°C.3' at 70°Cfor 30 cycles; elongation, 15'at 72°C.After completion of the PCR reaction, the product was diluted 1:40 in

loading buffer (95% formamide-2 m.\i EDTA, pH 8.3). Two to 4 fil of the

diluted samples were denatured (5: at 90°C),immediately cooled on ice, and

loaded onto a nondenaturing 6% polyacrylamide gel. Electrophoresis wascarried out in the presence (at 20°C)or in the absence (at 4°C)of 10% glycerol

in the gel. Upon complete migration the gels were dried and subjected toautoradiography against a Kodak XAR-5 film at -80°C with an intensifying

screen.cDNA/PCR Amplification and Sequencing. Total RNA was isolated ac

cording to the method of Chomcynski and Sacchi (35). and cDNA was prepared using AMV reverse transcriptase (Boehringer Mannheim Biochemica).The p53 open reading frame was PCR amplified using primers located outsidethe p53 open reading frame (5'-GCTGACGGTGACACGCTTCCCTGG-3',sense: and 5'-ATCAGTGGGGAACAAGAAGTGGAG-3', antisense). Direct

sequencing of p53 was carried out on the PCR products of a second round ofamplification with a combination of two heminested primers lying within theopen reading frame (S'-ATGCGAATTCCAACTGGCCAAGACCTGCCC-TGTG-3', sense; and 5'-ATGCGAATTCAAAGCTGTTCCGTCCCAGT-AGATT-3'. antisense) and the two original primers. This procedure yielded

two overlapping p53 cDNA/PCR fragments (860 and 813 base pairs) whichwere separated by agarose gel, purified, and sequenced by the dideoxy chaintermination method, using the Sequenase 2.0 kit (United States Biochemical).

Flow Cytometric Analysis. DNA flow cytometry was performed on nuclear suspensions prepared from formalin-fixed, paraffin-embedded tumor

samples. Briefly, for each tumor sample (paraffin block) 2 sections of 50 firnwere dewaxed in xylene, rehydrated through 90. 80, 70, and 50% ethanol,washed twice in deionized water, and minced in 1 ml of 0.5% pepsin in 0.9%NaCl (pH 1.5) at 37°Cfor 30 min. Samples were filtered through a 30-/im poresized polyester filters and stained for 30 min at 37°Cin a propidium iodide

staining solution (50 fig/ml of propidium iodide in phosphate-buffered saline,

pH 7.4. plus 1 mg/ml RNase); all chemicals were from Sigma (St. Louis. MO).All samples were analyzed by a fluorescence-activated cell sorter scan flow-cytometer (Becton-Dickinson, Mountain View, CA) coupled with a Hewlett-

Packard computer. At least 35,000 events were collected for each sample. Thedetermination of the proliferative fraction was performed by the method ofDean (36).

Statistical Analysis. Contingency tables were used to examine the relationship between aberrations of p53 and each of the following variables:histology; metastatic involvement of lymph node; ploidy. Statistical association was determined by x2 analysis with Yates' continuity correction. A / test

was used to compare patients with altered p53 with respect to mean age atdiagnosis. A nonparametric (Mann-Witney) test was used to compare the

percentage of cells in S phase from tumors with normal or mutated p53. Allstatistical analysis were performed by the StatView 512+ Softwaren (Brainpower).

RESULTS

Fifty-three non-small cell lung cancers were studied. The meanpatient age was 61 years (range, 48-76 years). The most common

histológica! type (51%) was the epidermoid carcinoma, followed byadenocarcinoma (28%), bronchiole-alveolar carcinoma (15%). and

anaplastic large cell carcinoma (6%). The international staging systemfor lung tumors, based on the TNM parameters, was used to stage thetumors; data are shown in Table 1. Most of the cancers (81 %) were T2tumors. Seventeen cases (33%) showed metastatic involvement ofregional lymph nodes. Among these 11 were defined as N, (metastasisin ipsilateral peribronchial and/or ipsilateral hilar lymph nodes) and 6as N2 (metastasis in ipsilateral mediastinal and/or subcarinal lymphnodes). In two cases regional lymph nodes could not be assessed(NX). None of the patients showed distant metastasis (M) at the timeof presentation. On the basis of these data, 30 patients (59%) wereclassified at stage I, 11 (21%) at stage II, and 10 (20%) at stage III.

Immunohistochemical Analysis. Among the 53 primary lung carcinomas (Table 1), 5 (9.4%) were not suitable for the immunohis-

tochemical study (noninformative) because of the presence of diffuseareas of necrosis with nuclear pyknosis and karyolysis (ischemienecrosis is a common event in lung cancers). All of these 5 tumorsshowed a p53 mutation when examined by PCR-SSCP and 3 of them

2847

Research. on October 6, 2020. © 1993 American Association for Cancercancerres.aacrjournals.org Downloaded from

pS3 ALTERATIONS IN NSCLC

Table 1 ImmunoMstochemical and PCK-SSCP analysis of p53 alterations in NSCLC

and their correlation with TNM parameters

TumorsampleI245789II)11121314151617IX142l)21222324252627293031323536373839404l4243444546474849505153545657585960Immuno-

PCR-staining"SSCPh++++

5++6•H-f+

5++++

5•H-f+NI

5 +8+6NI8+

6++++5NI

7++++++

6+NI

8+++++++

765++

65+++NI

5+++8+++

85+++

66+8++++•H-f++++

5+++++

7++++P53

Alterations'AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAMétastasesN,N2N,N2N2N,N2N,N2N,NXN,N,N,N,N,N,N2NXPrimarylesionT,T2T2T2T2T,T,T2T,T:T2T2T2T2T2T,T2T.T.T2T,T:T2T2T2T2T2T2T2T2T2T2T2T2T2T2T,T2T,T2T,T2T2T2T2T2T2T2T,T2T3T2T)Stage1IIIIIIIIIIIIIIIIII1IIIIIII1IIIIIIIIIIIII1IIIIIIIII11111IIIIIIIIIIIIIIIIIIIIIIIIII

0.08). No correlation was observed between p53 overexpression andage, histological type, ploidy. and proliferative index.

PCR-SSCP and Sequence Analysis. The PCR-SSCP analysis wasperformed on tumor-derived genomic DNA to cover exons 4 through

9. This region of p53 harbors more than 95% of the point mutationsso far described in NSCLC (17). Individual exons were amplifiedusing intronic primers in order to yield fragments with nucleotidelengths of 359, 290, 184, 209, 237, and 186 for exon 4, 5, 6, 7, 8, and9, respectively. The SSCP analysis of these fragments showed bandswith mobility shift (Fig. 2), indicating a structural aberration of thep53 gene, in 25 (47%) of the 53 tumors examined. Tumors 19 and 51exhibited a double mutation of the p53 gene in exon 5, 8 and 6, 8,respectively. These two tumors did not show alíeleloss when examined by PCR-SSCP or restriction fragments length polymorphism

analysis suggesting that two independent mutations have inactivatedboth p53 alíeles.However, these results do not exclude the possibilitythat both mutations are located on the same alíele.The nature andallelic location of this two double aberrations are currently underinvestigation. Ten (37%) of the 27 mutations were detected in exon 5,8 (30%) in exon 6, 6 (22%) in exon 8 and 3 (11%) in exon 7. We didnot observe mutations in exon 4 and 9. To exclude the possibility thata shift in the electrophoretic mobility of the p53 fragments was due tothe presence of a polymorphism (37) or a germ line mutation, theSSCP analysis was performed in all cases using matching normal andtumor DNA from the same patient. No mutations or known polymorphisms were found in normal lung samples. As reported in Table 1, 10tumors showed a diffuse and strongly positive immunostaining, in theabsence of a SSCP abnormality. In order to exclude the possibility of

" Percentage of immunoreactive cells; +,75-1009E-. NI, noninformative.

h Numbers, p53 exons harboring the mutation.* A, alteration of p53.

++, 15^t9%; +++. 50-74%; ++++,

were metastatic. Monoclonal antibodies PAb 1801 and PAb 240 gavesimilar results: 28 (58%) of the 48 informative samples were scoredpositive. The immunostaining was nuclear in all instances with variable weak cytoplasmic reaction. We never observed p53 expression innonneoplastic epithelial, stromal, or inflammatory cells. Most of thetumors positive for p53 (17 of 28; 61%) exhibited a diffuse, intensenuclear staining in the majority (50-100%) of the neoplastic cells

(Fig. \A). Four out of 7 tumors with less than 15% of the neoplasticcells having nuclear staining (Fig. Iß)were later found to be negativefor/75.? mutation by PCR-SSCP analysis. Although a trend indicating

an association between a lymph node metastatic involvement andpositive p53 immunostaining was evident (11 of 14 informative tumors with lymph node metastasis overexpressed p53) the data werenot significant (P = 0.13). Similarly an apparent association wasfound between p53 overexpression and advanced clinical stages (P =

»•

Fig. 1. Immunohtstochemical staining for the p53 protein in two non-small icarcinomas with a high (A) and low (ß)frequency of positive tumor cells.

2848

Research. on October 6, 2020. © 1993 American Association for Cancercancerres.aacrjournals.org Downloaded from

p53 ALTERATIONS IN NSCLC

CDCMI-

Fig. 2. PCR-SSCP analysis of exons 5-8 of thep53 gene in NSCLC samples. Arrows, bands withmobility shift.

OCM CM

HCN

LO COCM CM

LOcon co

EXON 5 EXON 6 EXON 7 EXON 8

mutations not recognized by the SSCP assay, we decided to directlysequence the entire p53 cDNA in these 10 tumors. Also this exhausting analysis failed to demonstrate mutations in the coding region ofthe p53 gene. A slightly higher percentage of metastatic tumors ( 10 of17; 59%) showed a p53 aberration when examined by PCR-SSCP

analysis, but again the difference with respect to nonmetastatic tumorswas not statistically significant. No correlations were present between¡)53mutations investigated by PCR-SSCP and the other clinicopatho-

logical parameters examined.AlíeleLoss on Chromosome 17pl3.3. Genomic DNA from lung

tumor samples and from the matching normal lung tissues from thesame patients were subjected to Southern blot analysis for LOH usingprobe pYNZ22.1 which identifies a multiallele VNTR locus on chromosome region 17pl3.3. Forty-five (85%) of the 53 patients analyzedwere constitutionally heterozygous (informative) at this locus. Fifty-

one % of the informative tumors showed a large difference in bandintensity of one of the two alíelesindicating a reduction to hemizy-

gosity (Fig. 3). No homozygous losses of the pYNZ22.1 locus wereobserved in the tumor DNAs tested. A strong correlation (P = 0.0015)

was observed between alleile deletions on chromosome 17pl3.3 andp53 mutations detected by PCR-SSCP analysis: 16 of the 20 tumors

with LOH at the pYNZ22.1 locus had a structural aberration of theremaining p53 alíele(Table 2).

N T N T N

26 37 57Fig. 3. Loss of constitutional heterozygosity on chromosome 17pl3.3 in three non-

small cell lung carcinomas. DNA samples from normal </V)and tumor (T) tissues weredigested with Bam\\\ and hybridized to the pYNZ22.1 probe.

Table 2 Correlation between mutations of the p53 gene and deletions onchromosome 17pl3

p53 mutations

Deletions"LOHNormalTotalPositive16420Negative71825Total232245

"/) = 0.0015 by x2 analysis.

Correlation of p53 Abnormalities with Clinicopathological Features. Forty of the 53 (75%) tumors examined showed a p53 alteration detected by PCR-SSCP or immunohistochemical analysis (Table

1). Table 3 reports the correlation between p53 aberrations and severalClinicopathological parameters. All of the 13 tumors which were p53negative with both methods were not metastatic; on the other hand, allof the 17 tumors with metastatic involvement of thoracic lymph nodesshowed a p53 alteration when examined by PCR-SSCP or immunohistochemical analysis. This data was significant (x2 = 8.72; P <0.01 after Yates' correction). It is interesting to note that among the 6

early stage tumors, classified as T, (less than 3 cm in the greatestdimension), only the 3 tumors with altered p53 show a metastaticspread in hilar/mediastinal lymph nodes. The distribution of stagesfor those patients with tumors showing a p53 alteration was significantly different from those with tumors having a normal p53(X2 = 8.35; P = 0.015). In advanced stages (II and III) of disease all

except 1 (95%) of the 21 tumors showed p53 alterations, whereas 40%of tumors from stage I patients werep53 negative. No association wasobserved between aberrations of p53 and age, histológica! type,ploidy, and proliferative index.

DISCUSSION

Different technical approaches have been used to investigate thefrequency of p53 aberrations in NSCLC. Caamano et al. (7) using animmunohistochemical technique with monoclonal antibodies PAb1801 and PAb 421 found overexpression of p53 in 50% of NSCLC. Asimilar incidence (43%) was recently reported by Quinnlan (16) usingonly the pAblSOl. Chiba et al. (6) described that in 45% of NSCLC,p53 mutations were detected by RNase protection and cDNA sequencing. By a PCR-SSCP assay Kishimoto et al. (17) showed p53 aber

rations in 52% of NSCLC, whereas a much higher incidence (74%)was found by Mitsudomi et al. (8) in NSCLC cell lines. In order toobtain an accurate estimation of the incidence of p53 alterations inNSCLC we decided to carry out a comprehensive analysis using

2849

Research. on October 6, 2020. © 1993 American Association for Cancercancerres.aacrjournals.org Downloaded from

p.5.( ALTERATIONS [N NSCLC

Table 3 Relaliomilip between p53 alteration ami ciinienriatolo^icut parametersin NSCLC

ParametersAverage

age at diagnosis(yr)Histologieal

typeSquamousAdenocarcinomaBronchiolo-alveolarcarcinomaLarge

cellcarcinomaNodal

involvement*MetastasisFree

fromtumorStaging'1

1IIIIIPloidy*Euploid

AneuploidAverage

proliferatile index (%)'/>5.?

positive61.7

+6.920

1262172118|]910

3022.7

±10p53

negative61.7

±7.87

32101312012

924.1

±12.6p

value"NSNS(>.(X)90.015NSNS

" NS, nonsignificant.'*Two cases were not informative.' Seventeen cases were not informative.

genetic and immunohistochemical techniques. We expected a highdegree of concordance between SSCPand immunohistochemical data.To our surprise the concordance was only 54%. Seven cases werepositive by SSCP but stained negative for p53. These cases can beexplained considering that particular mutants have been described thatwould result in absence of p53 staining (22). More intriguing was thefact that in a total of 15 cases a positive immunostaining was observedin the absence of a SSCP abnormality. Of these 15 cases, however, 5cases showed a very low fraction of positive cells, possibly too low fordetection by SSCP. On the remaining 10 tumors, the immunostainingwas strong and diffuse (between 50 and 100% of the neoplastic cellswere positive) while the SSCP assay repeated in different electro-

phoretic conditions and the sequence analysis failed to show structuralaberrations of the p53 gene. Considering that we never found p53overexpression in normal cells and that immediately adjacent tumorsamples were processed for DNA extraction and immunohistochem-

istry, the nuclear accumulation of p53 in these 10 tumors may beacquired by alternative means, besides the presence of a missensemutation. For instance, the overexpression of a p53 binding protein,such as mdm-2 (38), might sequester the p53 protein from its normal

degradation pathway and results in higher levels of inactive p53 in thecell. In fact, the mdm-2 gene was found to be amplified in humansarcomas (39). It would be interesting to correlate the status of mdm-2

gene with overexpression of p53 in a series of NSCLC. Our resultsindicate that p53 alterations (structural abnormalities of the geneand/or overexpression of the protein) are extremely frequent (75%) inprimary resected NSCLC, by far the most frequent molecular changesoccurring in this type of tumor. Amplifications of the myc, ras, anderhB protooncogenes families (40-42), point mutations of the ras

gene family (43, 44), expression of neu (45), inactivation of theretinoblastoma gene (46-48), and deletions of the short arm of chro

mosome 3 (49) have been reported, but none of these changes occurred in more than 44% of primary NSCLC.

The search for a potential prognostic role of p53 aberrations inhuman cancer was the main goal of several studies. Associations werefound between p53 abnormalities and poor prognosis or tumor progression in different human malignancies (50-54). Most of the studies

on p53 alterations in NSCLC failed to find any correlation with knownprognostic factors (7, 8, 17). In this report we did not observe anysignificant correlation between p53 abnormalities detected by immu-

nohistochemistry or PCR-SSCP alone and the several clinicopatho-

logical parameters examined. However, by cumulating the results ofthe immunohistochemical and PCR-SSCP analysis, we found a significant association between p53 aberrations (mutations and/or over-

expression) and metastatic involvement of hilar/mediastinal lymphnodes: all of the metastatic tumors showed p53 alterations wheninvestigated with PCR-SSCP and immunohistochemislry. Since none

of the tumors which were p53 negative with both techniques had ametastatic lymph node involvement, the SSCP-immunohistochemical

analysis seems to be a useful method of screening for the presence oftumors with a lower tendency to metastasize. A statistically significantassociation between p53 abnormalities and advanced stages of thedisease was also observed: all but one of the tumors (95%) frompatients with advanced stages (II/III) were positive for p53 alteration.However, since most of the patients (60%) with stage I disease had/:>5.i-positive tumors, we can speculate that despite the increasing

frequency of p53 alteration with later stages of NSCLC, p53 activation may be a rather early event that confers a particularly aggressivetumor phenotype. A similar analysis of premalignant lesion, lungcarcinomas, and local recurrences of p53 negative tumors would helpin understanding the role of p53 in tumor progression. A number ofother clinicopathological parameters were examined for possible cor-

relation(s) with p53 alterations. No association was found between thelatter and age of patients, histológica! type, ploidy. and proliferativeindex. A survival analysis could not be performed since the follow-up

period was too short to draw conclusions.According to the Knudson's (55) hypothesis, inactivation (dele

tions) of both alíelesof the p53 gene is required for full oncogenesis.In this report LOH at the chromosomal region 17pl3.3, near the p53locus, were observed in 16 of 20 informative tumors with structuralaberrations of the p53 gene. In addition, in two cases without LOHtwo mutation were present, presumably in both alíeles.The highlysignificant correlation (P < 0.0015) between p53 mutations and deletions on chromosome I7p, detected by the pYNZ22.1 probe, suggestthat a common molecular mechanism may be operating duringNSCLC progression. However, 4 of the 20 (20%) tumors with p53mutations did not show deletion when investigated with thepYNZ22.1 probe. Considering that pYNZ22.l probe and p53 arelocated at a certain distance on the short arm of chromosome 17, wecan postulate two possible explanations: («)a deletion of p53 mayhave occurred which did not extend to pYNZ22.1 : and (b) a particularp53 mutation (dominant loss of function) of a single alíelemay besufficient for transformation: further investigations using additionalchromosome 17 markers are necessary to clarify this point.

In conclusion our data indicate that the use of genetic and immunohistochemical techniques is required to obtain an accurate estimation of p53 abnormalities in NSCLC. Taken in a broad sense p53alterations (mutations and or overexpression) are by far the mostcommon molecular changes so far detected in NSCLC and correlatewith the spread of tumor into hilar and mediastinal lymph nodes.Since the latter are well established prognostic factors for NSCLC,p53 alterations may also be a useful predictor of tumor aggressiveness.

REFERENCES

1. Mountain. C. F. Biologic, physiologic and technical determinants in surgical therapyfor lung cancer. In: M. ¡.Strauss (ed.). Lung Cancer: Clinical. Diagnosis and Treatment, pp. 245-260. New York: Gruñeand Stratton. Inc., 1983.

2. Viallet, J.. and Minna. J. D. Dominant oncogenes and tumor suppressor genes in thepathogenesis of lung cancer. Am. J. Respir. Cell Mol. Bio]., 2: 225-232. 1990.

3. Takahashi, T., Ñau. M. M.. Chiba. I.. Birrer. M. J.. Rosenberg. R. K., Vinocour, M.,Levitt. M., Pass, H.. Gazdar. A. F.. and Minna. J. D. />5.*:a frequent target for geneticabnormalities in lung cancer. Science (Washington DO. 24ti: 491-494. 1989.

4. Nigro. J. M.. Baker. S. J.. Precinger. A. C.. Jessup. J. M., Hosteller. R.. Cleary. K.,Bigner, S. H., Davidson. N.. Baylin. S.. Devilee. P.. Glover. T.. Collins. F. S.. Weston.

2X50

Research. on October 6, 2020. © 1993 American Association for Cancercancerres.aacrjournals.org Downloaded from

SJ ALTERATIONS IN NSCLC

A.. Modali. R., Harris. C. C., and Vogelstein. B. Mutations in the p53 gene occur indiverse human tumor types. Nature (Lond.). 342: 705-708. 1989.

5. Iggo. R.. Gatter. K.. Bartek. J-, Lane, D., and Harris. A. L. Increased expression ofmutant forms of/)5.i oncogene in primary lung cancer. Lancet. 335: 675-679. 1990.

6. Chiba. I.. Takahashi. T.. Ñau. M. M.. D'Amico. D.. Curie!. D. T.. Mitsudomi. T..

Buchhagen. D. L.. Carbone. D.. Piantadosi. S.. Koga. H.. Reissman. P. T.. Slamon. D.J.. Holmes. E. C. and Minna. J. D. Mutations in thep.5.* gene are frequent in primary,resected non small cell lung cancer. Oncogene. 5: 1603-1610, 1990.

7. Caamano. J.. Ruggeri. B.. Momiki, S., Sickler. A.. Zhang. S. Y.. and Klein-Szanto. A.J. P. Detection of p53 in primary lung tumors and nonsmall cell lung carcinoma celllines. Am. J. Pathol.. 139: 839-845. 1991.

8. Mitsudomi. T.. Steinberg. S. M.. Nau. M. M.. Carbone. D.. D' Amico. D.. Bodner. S..

Oie, H. K.. Linnoila. R. !.. Mulshine. J. L.. Minna. J. D., and Gazdar, A. F. p53 genemutations in non small cell lung cancer cell lines and their correlation with thepresence of ras mutations and clinical features. Oncogene. 1: 171-180, 1992.

9. Eliyahu. D.. Raz, A.. Gruss. P., Givol, D.. and Oren, M. Participation of p53 cellulartumor antigen in transformation of normal embryonic cells. Nature (Lond.) 312:646-649, 1984.

10. Parada, L. F., Land, H., Weinberg. R. A.. Wolf, D., and Rotter. V. Cooperation betweengene encoding p53 tumor antigen and ras in cellular transformation. Nature (Lond.).312: 649-651, 1984.

11. Bienz, B., Zakut-Houri. R.. Givol. D., and Oren. M. Analysis of the gene coding forthe murine cellular tumor antigen pS3. EMBO J.. .*: 2179-2183. 1984.

12. Jenkins. J. R., Rudge. K.. Chumakov. P.. and Currie. G. A. The cellular oncogene p53can be activated by mutagenesis. Nature (Lond.). 317: 816-818. 1985.

13. Finlay. C. A., Hinds. P. W., and Levine, A. J. The p53 proto-oncogene can act as asuppressor of transformation. Cell, 57: 1083-1093. 1989.

14. Mercer. W. E.. Amin. M.. Sauve, G. J.. Appella. E.. Ullrich, S. J.. and Romano, J. W.Wild type human p53 is antiproliferative in SV40-trunsformed hamster cells. Oncogene, 5: 973-980, 1990.

15. Levine. A. J., Momand. J.. and Finlay. C. A. The p53 tumor suppressor gene. Nature(Lond.), 351: 453-456, 1991.

16. Quinlan. D. C., Davidson, A. G.. Summers, C. L.. Warden. H. E.. and Doshi. H. M.Accumulation of p53 protein correlates with a poor prognosis in human lung cancer.Cancer Res., 52: 4828-4831, 1992.

17. Kishimoto. Y.. Murakami. Y. Shiraishi. M.. Hayashi. K.. and Sekiya. T. Aberrationsof the p53 tumor suppressor gene in human non-small cell lung carcinomas of thelung. Cancer Res.. .52: 4799-4804. 1992.

18. Finlay. C. A.. Hinds, P. W.. Tan. T. H.. Eliyahu. D., Oren, M., and Levine, A. J.Activating mutations for transformation by p53 produce a gene product that forms anhsc7()-/)5.i complex with an altered half-life. Mol. Cell. Biol.. 8: 531-539. 1988.

19. Rodrigues. N. R.. Rowan. A.. Smith, M. E., Kerr, I. B., Bodmer. W. F., Gannon. J. V..and Lane. D. P. p53 mutations in colorectal cancer. Proc. Nati. Acad. Sci. USA. 87:7555-7559. 1990.

20. Purdie. C. A.. O'Grady. J., Piris. J., Wyllie. A. H.. and Bird, C. C. p53 expression in

colorectal tumors. Am. J. Pathol., 138: 807-813, 1991.

21. Arai. N., Nomura. D.. Yokota. K., Wolf. D., Brill, E.. Shohat. O.. and Rotter. V.Immunologically distinct p53 molecules generated by alternative splicing. Mol. Cell.Biol.. 6: 3232-3239. 1986.

22. Bodner. S. M.. Minna. J. D.. Jensen. S. M., D' Amico. D.. Carbone. D.. Mitsudomi.

T. Fedorko. J.. Buchhagen. D. L.. Nau. M. M.. Gadzar. A. F., and Linnoila. R. I.Expression of mutant p53 proteins in lung cancer correlates with the class of p53 genemutation. Oncogene, 7: 743-749, 1992.

23. Thomas, D. W. p53 in tumor pathology: can we trust immunocytochemistry? J.Pathol., 166: 329-330, 1992.

24. Mullis. K. B.. and Faloona. F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol., /55: 335-350. 1987.

25. Orita. M.. Suzuki. Y., Sekiya. T.. and Hayashi. K. Rapid and sensitive detection ofpoint mutations and DNA polymorphisms using the polymerase chain reaction. 5:Proc. Nati. Acad. Sci. USA, 874-879. 1989.

26. Spinardi, L.. Mazars, R.. and Theillet. C. Protocols for an improved detection of pointmutations by SSCP. Nucleic Acid Res.. 19: 4009. 1991.

27. Macchiarmi, P., Hardin. M.. and Angeletti, C. A. Long-term evaluation of intrapleuralBacillus Calmette-Guerin with or without adjuvant chemotherapy in completelyresected stages II and III non-small-cell lung cancer. Am. J. Clin. Oncol., 14: 291-

297. 1991.28. Macchiarmi, P.. Buonaguidi. R.. Hardin. M.. Mussi. A., and Angeletli. C. A. Results

and prognostic factors of surgery in the management of non-small cell lung cancerwith solitary brain metastasis. Cancer (Phila.). f>ft:3(X)-404. 1991.

29. World Health Organization. The World Health Organization. Histological typing oflung tumors. Am. J. Clin. Pathol.. 77: 123-136. 1982.

30. Mountain. C. F. A new international staging system for lung cancer. Chest. 89:225S-233S. 1986.

31. Banks, L.. Matlashewski, G.. and Crawford, L. Isolation of human-/>5.i-specificmonoclonal antibodies and their use in the studies of human p53 expression. Eur. J.

Biochem.. 15V: 529-534. 1986.32. Harlow. E.. Crawford, L., Pirn, D. C.. and Williamson, N. M. Monoclonal antibodies

specific for simian virus 40 tumor antigen. J. Virol.. 3V: 861-869. 1987.

33. Blin. N.. and Stafford. D. W. A general method for isolation of high molecular weightDNA from eucaryotes. Nucleic Acid Res., 3: 2303-2308. 1976.

34. Chumakov, P. M.. Almazov. V. P.. and Jenkins, J. R. Nucleic Acid Res.. 19: 4804.1991.

35. Chomczynski. P., and Sacchi. N. Single step method of RNA isolation by acidguanidinium thiocvanate-phenol-chloroform extraction. Anal. Biochem.. 762: 156-

159. 1987.36. Dean. P. N. Data analysis and cell cycle kinetics research, in: J. W. Gray and Z.

Darzynkiewicz (eds.l. Techniques in the Cell Cycle Analysis, pp. 154-178. Clifton.

NJ: Human Press. Inc.. 1987.37. Mazars, G. R.. Jeanteur. P.. Lynch. H. T.. Lenoir. G.. and Theillet. C. Nucleotide

sequence polymorphism in a hotspot mutation region of the p53 gene. Oncogene, 7:781-782, 1992.

38. Momand, J.. Zambetti. G. P.. Olson. D. C.. George, D., and Levine, A. J. The mdm-2oncogene product forms a complex with the p53 protein and inhibits p53-mediatedtransactivation. Cell, 69: 1237-1245, 1992.

39. Oliner, J. D., Kinzler, K. W., Meltzer, P. S.. George, D. L., and Vogelstein, B.Amplification of a gene encoding a/>5.i-associated protein in human sarcomas. Nature(Lond.), 358: 80-83, 1992.

40. Cline. M. J.. and Battifora, H. Abnormalities of proto-oncogenes in non-small celllung cancer. Correlation with tumor type and clinical characteristics. Cancer (Phila.).60: 2669-2674. 1987.

4L Shiraishi. M.. Noguchi, M., Shimosato, Y.. and Sekiya, T. Amplification of proto-oncogenes in surgical specimens of human lung carcinomas. Cancer Res.. 49: 6474-

6479. 1989.42. Slebos, R. J. C.. Evers. S. G.. Wagenaar. S. S. C.. and Rodenhuis. S. Cellular

protooncogenes are infrequently amplified in untreated non-small cell lung cancer. Br.J. Cancer. 59: 76-80, 1989.

43. Rodenhuis, S.. Slebos, R. J. C.. Boot. A. J. M.. Evers, S. G.. Moot, W. J., Wagenaar.S. S.. van Bodegom. P. C.. and Bos. J. L. Incidence and possible clinical significanceof K-ras oncogene activation in adenocarc¡..oma of the lung. Cancer Res., 48:5738-41. 1988.

44. Mitsudomi, T.. Viallet. J.. Mulshine. J. L.. Linnoila. R. I.. Minna. J. D.. and Gazdar,A. F. Mutation of ras gene distinguish a subset of non-small-cell lung cancer cell linefrom small-cell lung cancer cell lines. Oncogene, 6: 1353-1362. 1991.

45. Weiner. D. B.. Nordberg. J.. Robinson. R.. Nowell, P. C.. Gazdar, A.. Greene, M. L,Williams, W. V.. Cohen. J. A., and Kern. J. A. Expression of the neu gene-encodedprotein (PI85neu) in human non-small cell carcinomas of the lung. Cancer Res.. 50:421^425, 1990.

46. Harbour. J. W., Lai, S-L.. Whang-Peng, J., Gazdar. A. F. Minna. J. D.. and Kaye, F.J. Abnormalities in structure and expression of the human retinoblastoma gene inSCLC. Science (Washington DC), 241: 353-357, 1988.

47. Yokota, J., Akiyama. T. Fung. Y. K.. Benedict. W. F, Namba. Y., Hanaoka, M.. Wada,M.. Terasaki. T.. Shimosato. Y, and Sugimura. T. Altered expression of the retinoblastoma (RB) gene in small cell carcinoma of the lung. Oncogene, 3: 471—475,1988.

48. Horowitz, J. M.. Park. S. H., Bogenmann. E., Cheng, J. C., Yandell, D. W.. Kaye, F.J.. Minna. J. D.. Dryja. T. P.. and Weinberg. R. A. Frequent inactivation of theretinoblastoma anti-oncogene is restricted to a subset of human tumor cells. Proc.Nati. Acad. Sci. USA. 87: 2775-2779, 1990.

49. Whang-Peng. J.. Knutsen. T.. Gazdar. A.. Steinberg. S. M.. Oie. H., Linnoila, I.,Mulshine. J.. Nau. M.. and Minna. J. D. Nonrandom structural and numerical chromosome changes in non-small-cell lung cancer. Genes Chromos. Cancer. 3: 168-188.

1991.50. Davidoff. A. M.. Hemdon II. J. E.. Glover. N. S., Kerns. B. J.. Pence. J. C., Iglehart.

J. D., and Marks. J. R. Relation between p53 overexpression and established prognostic factors in breast cancer. Surgery (St. Louis). 110: 259-264. 1991.

51. Thor. A. D.. Moore. D. H., II. Edgerton. S. M.. Kawasaki. E. S., Reihsaus. E.. Lynch.H. T. Marcus. J. N.. Schwartz. L., Chen, L-C, Mayall. B. H.. and Smith. H. S.

Accumulation of p53 tumor suppressor gene protein: an independent marker ofprognosis in breast cancer. J. Nati. Cancer Inst.. 84: 845-854. 1992.

52. Thompson. A. M.. Anderson. T. J.. Condie. A., Prosser. J.. Chetty. U., Carter. D. C.,Evans. H. J.. and Steel. C. M. p53 alíelelosses, mutations and expression in breastcancer and their relationship to clinico-pathological parameters. Int. J. Cancer, 50:528-532. 1992.

53. Effert, P. J., Neubauer, A., Walther, P. J.. and Liv. E. T. Alteration of the p53 gene areassociated with the progression of a human prostate carcinoma. J. Urol.. 147: 3-8.1992.

54. Sidranskv. D., and Mikkelsen. T. Clonal expansion of p53 mutant cells is associatedwith brain tumor progression. Nature (Lond.). ^55: 6363-6365. 1992.

55. Knudson. A. G. Mutation and cancer: statistical study of retinoblastoma. Proc. Nati.Acad. Sci. USA. 68: 820-823. 1971.

2851

Research. on October 6, 2020. © 1993 American Association for Cancercancerres.aacrjournals.org Downloaded from

1993;53:2846-2851. Cancer Res   Antonio Marchetti, Fiamma Buttitta, Giorgio Merlo, et al.   Metastatic Involvement of Hilar and Mediastinal Lymph Nodes

Alterations in Non-Small Cell Lung Cancers Correlate withp53

  Updated version

  http://cancerres.aacrjournals.org/content/53/12/2846

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/53/12/2846To request permission to re-use all or part of this article, use this link

Research. on October 6, 2020. © 1993 American Association for Cancercancerres.aacrjournals.org Downloaded from