oxidized ldl induce c-reactive protein secretion in human ... in curs/19 3/2. sima anca.doc.pdf ·...

Annals of R.S.C.B., Vol. XIX, Issue 3, 2015, pp. 9 - 20 doi: 10.ANN/RSCB-2015-0028:RSCB Received 18 June 2015; accepted 01 July 2015.

The Romanian Society for Cell Biology ©, Annals of R. S. C. B., Vol. XIX, Issue 3, 2015, Anca V. Sima., pp. 9 – 20

9

Oxidized LDL induce C-reactive protein secretion in human macrophages through mechanisms involving oxidative stress

Running Head:

OX-LDL INDUCE CRP SECRETION IN HUMAN MACROPHAGES

G. M. SANDA (1), M. DELEANU (1) (2), M. SIMIONESCU (1), A.V. SIMA (1) *

1 Institute of Cellular Biology and Pathology “Nicolae Simionescu” of the Romanian Academy, Bucharest, Romania 2 Faculty of Biotechnology, University of Agronomical Sciences and Veterinary Medicine, Bucharest, Romania

*Corresponding author

Anca V. Sima, Ph.D.

Head, Lipidomics Department

Institute of Cellular Biology and Pathology “N. Simionescu” of the Romanian Academy

8, B.P. Hasdeu Street, Bucharest 050568, Romania

Phone: +40(0)21.319.4518, Fax: +40(0)21.319.4519, e-mail: [email protected]

Keywords: C-reactive protein, endoplasmic reticulum stress, macrophages, oxidized LDL, reactive

oxygen species.

Summary

The endoplasmic reticulum (ER) stress and

the oxidative stress play critical roles in the

activation of inflammatory reactions in

atherosclerosis. The aim of the present study

was to investigate C-reactive protein (CRP)

expression, an inflammatory cytokine known

to contribute to atherosclerosis and the

subsequent cardiovascular events, in human

macrophages. We asked whether oxLDL-

induced ER stress and oxidative stress in

human macrophages determine the secretion

of this molecule. To this purpose, cultured

human THP-1 macrophages were incubated

with oxLDL in the presence or absence of

inhibitors for ER stress (salubrinal, sodium

phenylbutyrate) or oxidative stress (N-acetyl

cysteine, apocynin). The results showed that

oxLDL-triggered ER stress (via the activation

of eukaryotic initiation factor-2 α and inositol

requiring-protein 1 α, the up-regulation of

C/EBP homologous protein) and oxidative

stress (by stimulation of NADPH oxidase

activity and ROS production) is followed by

the induction of CRP gene expression and

protein secretion in human macrophages.

Furthermore, we found that oxLDL-induced

CRP gene expression and protein secretion

were reduced by the inhibitors of oxidative

stress, and not by the inhibitors of ER stress.

These data demonstrate that oxLDL induce

CRP secretion from human macrophages via

a mechanism that involves the induction of

the oxidative stress.

Introduction

Atherosclerosis entails a complex disease

consequent to a lipid disorder or an

inflammatory process having as a result the

atheroma formation (Simionescu, 2007;

Simionescu and Sima, 2012). The initial event

is the accumulation of modified lipoproteins

(Lp) within the subendothelial space

(Simionescu et al., 1986; Sakalen et al., 2002,

Moore & Tabas, 2011). Lp that are trapped in

the arterial wall are susceptible to various

modifications (such as oxidation, glycation,

enzymatic and non-enzymatic cleavage,

aggregation), which render them pro-

inflammatory and induce the activation of the

overlying endothelial cells (Stancu et al.,

2012; Moore et al., 2013). The development

of atherosclerotic lesions due to the vascular

mailto:[email protected]



10

inflammation triggered by the modified Lp

begins with the infiltration of monocytes into

the arterial wall, where they differentiate into

macrophages, take up modified Lp and

become foam cells, that are a hallmark of the

atherosclerotic plaque (Steinberg & Witztum,

2002). Within the plaque, foam cells

contribute to the local inflammation through

secretion of pro-inflammatory mediators, such

as chemokines, cytokines, reactive oxygen

and nitrogen species, and matrix-degrading

proteases (Moore et al., 2013). As a

representative marker of the inflammatory

response, C-reactive protein (CRP)

participates in all stages of the atherosclerotic

process, and provides a pivotal link between

inflammation and atherogenesis (Kaperonis et

al., 2006). Plasma levels of oxidized low

density lipoproteins (oxLDL) are known to be

elevated in patients with type 2 diabetes and

coronary artery disease (CAD) and are

associated with a high risk of cardiac events

in the general population, as well as in

patients with stable CAD (Ehara et al., 2001;

Holvoet et al., 2004; Shimada et al., 2004).

It was reported that the endoplasmic

reticulum (ER) stress is activated in

macrophages from human atherosclerotic

lesions (Feng et al., 2003; Myoishi et al.,

2007). Existing data show that oxLDL induce

ER stress during the formation of

macrophage-derived foam cells (Yao et al.,

2014). It was reported that the ER stress

determines the secretion of pro-inflammatory

cytokines, such as CRP in HepG2 cells

(Chung et al., 2011) and interleukin-1β in

U937 macrophages (Kim et al., 2014). The

generated oxidative stress and reactive

oxygen species (ROS) are integral

components of ER stress and not just

consequences of the ER stress induction

(Hotamisligil, 2010). The generated ROS up-

regulate the production of pro-inflammatory

cytokines, such as CRP in U937 macrophages

and endothelial cells (Li et al., 2011; Han et

al., 2010). Reports show that oxLDL and

other oxidized lipids trigger the intracellular

generation of ROS and the cellular oxidative

stress in macrophages (Leonarduzzi et al.,

2005; Vindis et al., 2006) and may induce ER

stress (Malhotra & Kaufman, 2007).

We hypothesized that oxLDL can determine

CRP synthesis and secretion from human

macrophages in culture through the activation

of ER stress and oxidative stress. We report

here that oxLDL stimulate NADPH oxidase

and the ensuing ROS production, the process

leading to the secretion of CRP. Materials and methods

Reagents

RPMI-1640 medium, phorbol-12-myristate-

13-acetate (PMA), tunicamycin (TM), N-

acetyl cysteine (NAC), apocynin (Apoc),

dihydroethidium (DHE), 2',7'-

dichlorofluorescein diacetate (DCFH-DA)

and thiazolyl blue tetrazolium bromide (MTT)

were purchased from Sigma-Aldrich, St.

Louis, MO, USA. Primary antiobodies against

human CRP (mouse monoclonal), and

horseradish peroxidase-conjugated goat

secondary antibodies against mouse or rabbit

IgG were obtained from Abcam, Cambridge,

UK. The antibodies to human β-actin (mouse

monoclonal), IRE1α (rabbit polyclonal),

KDEL ER Marker (mouse monoclonal),

sodium phenylbutyrate (PBA) and salubrinal

were purchased from Santa Cruz

Biotechnology, Santa Cruz, CA, USA. The

antibodies to phospho-eIF2α (Ser51, rabbit

polyclonal) and eIF2α (mouse monoclonal)

were obtained from Cell Signaling, Beverly,

MA, USA. 4-hydroxy-nonenal (4-HNE) and

(±)9-hydroxy-10E,12Z-octadecadienoic acid

cholesteryl ester (9-HODE) were obtained

from Cayman Chemicals, Ann Arbor, MI,

USA.

Isolation of human lipoproteins and

preparation of oxLDL

LDL was isolated from human plasma of

healthy donors from the Blood Transfusion

Center, Bucharest by density gradient

ultracentrifugation in Optima LE-80 or XP-80

ultracentrifuges (Beckman Coulter

International SA, Nyon, Switzerland).

Copper-oxidized LDL (oxLDL) was prepared



11

and characterized as previously described

(Sima et al., 2010).

Cell culture and experimental design

Human leukemic monocytic THP-1 cell line

was grown in RPMI-1640 culture medium

supplemented with 10% heat-inactivated fetal

calf serum (EuroClone, Siziano, Italy),

penicillin (100 U/ml) and streptomycin

(100µg/ml). For macrophage differentiation,

THP-1 cells were seeded at a density of

106/ml into 6-well plates in standard growth

medium supplemented with 100nM PMA for

72h. In all the experiments, macrophages

were incubated with native LDL (nLDL) or

oxLDL at a concentration of 100μg

protein/ml in serum free-medium (RPMI-

1640 with antibiotics) for 24h. Macrophages

cultured in the same conditions except the

exposure to LDL were used as control cells.

Induction of ER stress was obtained by

adding an UPR activator, tunicamycin (TM, 1

µg/ml) that inhibits protein glycosylation

[25]. Alternatively, THP-1 macrophages were

exposed for 24h to 10 and 20 μM 4-

hydroxynonenal (4-HNE) or to 1 and 3 μg/ml

9-HODE. Reduction of the ER stress was

attained by adding a chemical chaperone, 20

mM 4-phenylbutyrate (PBA) or a selective

inhibitor of eukaryotic translation initiation

factor 2α (eIF2α), 5 µM salubrinal. Decrease

of the oxidative stress was achieved using the

general antioxidant, 5 mM N-acetyl-cysteine

(NAC) or a NADPH oxidase inhibitor, 50 µM

apocynin (Apoc).

Evaluation of cell viability

Cell viability was measured as a function of

the mitochondrial activity using a cell growth

determination assay based on tetrazolium salt

(MTT, Sigma, St. Louis, MO, USA).

Measurement of the intracellular reactive

oxygen species production

The intracellular ROS production in

macrophages was assessed using

dihydroethidium (DHE) (Zhao et al., 2005)

and dichlorofluorescein-diacetate (DCFH-

DA) (Cathcart et al., 1983), as described

earlier (Sima et al., 2010; Ungvari et al.,

2003) and expressed as relative fluorescence

units (RFU) per microgram of total cell

protein. The NADPH oxidase (NADPHox)

activity was determined as previously

described (Ungvari et al., 2003) and

expressed as relative light units (RLU) per

microgram of total cell protein. Lipid

peroxides levels in culture media were

measured as thiobarbituric acid reactive

substances (TBARS) by UHPLC method

(Seljeskog et al., 2006) and expressed as

malondialdehyde (MDA) pmoles/ml.

Analysis of mRNA expression by real-time

PCR

Total RNA was isolated from cultured

macrophages using the GenElute mRNA

Miniprep Kit (Sigma-Aldrich, St. Louis, MO,

USA). The M-MLV Reverse Transcriptase kit

(Invitrogen, Carlsbad, CA, USA) was

employed for the reverse-transcription of

RNA, then the amplification and

quantification of the resulting complementary

DNA (cDNA) was done by the SYBR Select

master mix (Applied Biosystems, Carlsbad,

CA, USA). Real-time PCR was carried out

using the ViiA7 real-time PCR system

(Applied Biosystems, Life Technologies,

Carlsbad, USA) employing human specific

primers for sXBP1, XBP1, CHOP, CRP and

β-actin (as housekeeping gene)

(Supplementary Table 1).



12

Supplementary Table 1. Primers used for real-time PCR analysis.

Gene GeneBank

accession number Sequences of oligonucleotide primers

Amplicon

size (bp)

sXBP1 NM_005080.3

NM_ 001079539.1

FW: 5'-GCAGGTGCAGGCCCAGT-3'

RW: 5'-GAATGCCCAACAGGATATCAGACT-3' 100

uXBP1 NM_005080.3

NM_ 001079539.1

FW: 5'-

TGGAACAGCAAGTGGTAGATTTAGAA -3'

RW: 5'-CATCCCCAAGCGCTGTCTT -3'

125

CHOP NM_001195053.1 FW: 5'-CAGATGAAAATGGGGGTACCT -3'

RW: 5'-AGAAGCAGGGTCAAGAGTGGT -3' 86

CRP NM_000567.2 FW: 5'-GTGTTTCCCAAAGAGTCGGATACT -3'

RW: 5'-CCACGGGTCGAGGACAGTT -3' 116

β-actin

NM_001101.3

FW: 5'-GTCTTCCCCTCCATCGT -3'

RW: 5'-CGTCGCCCACATAGGAAT -3' 82

The relative quantification was achieved by

the Fit-Point method (Livak & Schmittgen,

2001) based on SYBR-Green detection.

Immunoblot assays

Total cell proteins were extracted using a

RadioImmuno Precipitation Assay (RIPA)

lysis buffer containing protease and

phosphatase inhibitors. The culture media

collected from macrophages were

concentrated by ultrafiltration with Amicon

Ultracentrifugal filters with a 10 kDa-cutoff

(Milipore, Billerica, MA, USA). Equal

amounts of cell proteins or equal volumes of

culture media were subjected to SDS-PAGE,

transferred onto nitrocellulose (NC)

membranes and blocked in Tris-buffered

saline (TBS) containing 0.1% Tween 20 and

5% bovine serum albumin (BSA) or 5% skim

milk (Millipore). The NC membranes were

incubated sequentially with primary

antibodies followed by HRP–conjugated

second antibodies; an enhanced

chemiluminescence (ECL) kit (Thermo

Scientific Pierce, Rockford, IL, USA or

Applichem, USA) and an ImageQuant

LAS4000 imaging system (GE Healthcare

Biosciences, Pittsburgh, PA, USA) were used

to visualize the proteins. The relative protein

expression was determined by densitometric

analysis using ImageQuant-TL software (GE

Healthcare Biosciences, Pittsburgh, PA,

USA). On the Western blots, the protein

expression was normalised to β-actin and that

of phosphoproteins to the respective total

protein expression. The protein expression of

the secreted proteins in the culture media was

normalized to the total cell protein.

Statistical analysis

GraphPad 5.0 (GraphPad Software, Inc., La

Jolla, CA, USA) was employed for statistical

analysis. Statistical evaluation was done by

independent two-tailed (Student’s) T-test; a p

value less than 0.05 was considered

statistically significant. Data were expressed

as mean ± standard deviation (SD).



13

Results and discussions

Oxidized LDL induce ER stress

In order to establish the concentration of

oxLDL to be used in the experiments,

macrophages were exposed to 100 µg/ml and

200 µg/ml of oxLDL added to the culture

media for 24h. The results showed that

oxLDL at 100 µg/ml decreased the cell

viability only by 10% (p<0.05), whereas at

200 µg/ml was cytotoxic and reduced cell

viability by 47% (p<0.001). In similar

conditions, 1 µg/ml TM diminished cell

viability by 29% (p <0.001) (Supplementary

Figure 1). Consequently, for further

experiments oxLDL at 100 µg/ml culture

media was employed.

Fig. 1. Oxidized LDL trigger ER stress in human macrophages. The cells were incubated with 100 µg/ml of native LDL

(nLDL) or oxidized LDL (oxLDL) or 1 µg/ml tunicamycin (TM) for 24h. Control macrophages (C) were cultured in the

same conditions without LDL exposure. (A, B, C) Phospho-eIF2α (p-eIF2α), eIF2α, IRE1α and KDEL-motif-bearing

proteins (Grp94 and Grp78) were normalized to β-actin and expressed as fold change vs. C. (D, F) Unspliced XBP1

(uXBP1) and its spliced form (sXBP1) and CHOP mRNA levels were determined by real-time PCR relative to β-actin

and expressed as fold change vs. C . All data are presented as mean ± SD. *p<0.05, **p<0.01, ***p<0.001 vs. nLDL.

#p<0.05, ##p<0.01, ###p<0.001 vs. oxLDL.

The experiments showed that incubation of

macrophages with 100 µg/ml oxLDL induced

the activation of eIF2α and IRE1α manifested

by a 2-fold increase of the phosphorylation

level of eiF2α (p-eIF2α/eIF2α, p<0.05) above

the values obtained for nLDL, but comparable

to the effect induced by the cells incubation

with TM (2.3-fold, p<0.05) (Figure 1A).

Similarly, both oxLDL and TM increased

significantly the protein expression of IRE1α

(1.5-fold, p<0.01) as compared to nLDL

(Figure 1B). In contrast, oxLDL induced a

modest increase of the ER resident

chaperones protein expression, Grp94 (32%)

and Grp78 (44%), whereas TM significantly

increased both Grp94 (3-fold, p<0.01) and

Grp78 (4-fold, p<0.01) in macrophages

(Figure 1C). Other experiments revealed that

oxLDL did not activate XBP1 splicing, while

TM significantly increased the gene



14

expression of both sXBP1 (14-fold,

p<0.001) and uXBP1 (21-fold, p<0.001), as

shown in Figure 1D. Nonetheless, the CHOP

gene expression was significantly augmented

by oxLDL (2.5-fold, p<0.001), and especially

amplified by TM (25-fold, p<0.001) (Figure

1E). Together, these results indicated that

oxLDL induce ER stress through the

activation of eIF2α and IRE1α and up-

regulation CHOP.

Oxidized LDL stimulates ROS production

To assess the pro-oxidant effect of oxLDL on

macrophages and the mechanism involved,

the cellular NADPHox activity was

determined. The results revealed that the

NADPHox activity was significantly

enhanced by oxLDL (55%, p<0.01) as

compared to nLDL, but was similar to the

effect of TM (78%, p<0.01) (Figure 2A). We

questioned whether in our experimental

condition, oxLDL induce an intracellular

ROS production in macrophages. The results

showed that oxLDL stimulated significantly

the intracellular ROS, both as O2- (29%,

p<0.001) and as H2O2 (77%, p<0.01),

compared to nLDL (Figure 2B, C). The cells

exposure to TM induced a similar increase of

O2- level (21%, p<0.01) and no increase for

H2O2 (Figure 2B). This effect was associated

with a significant increase of the MDA levels

present in the culture media, mostly for the

cells incubated with oxLDL (20-fold,

p<0.05), and less for those exposed to TM

(2.7-fold, p<0.05) (Figure 2D).

Fig. 2. Oxidized LDL induce ROS production in human macrophages. Cells were incubated with 100 µg/ml native LDL

(nLDL), 100 µg/ml oxidized LDL (oxLDL) or 1 µg/ml tunicamycin (TM) for 24h. Control macrophages (C) were

cultured in the same conditions in the absence of LDL exposure. Macrophages were preincubated with 5 mM NAC or

50 µM Apoc for 2h before incubation with 100 µg/ml oxLDL. NADPH oxidase activity was determined by lucigenin-

enhanced chemiluminescence assay (A), expressed as relative luminiscence units per microgram of total cell protein

and represented as fold change vs. C. ROS level was determined using DHE for superoxide (O2-) detection (B, E) and

DCFH-DA for hydrogen peroxide (H2O2) detection (C,F), expressed as relative fluorescence units per microgram of

total cell protein and represented as fold change vs. C or oxLDL. Lipid peroxides levels in culture media were assessed

as TBARS by UHPLC and expressed as malondialdehyde (MDA) pmoles/ml (D). All data are presented as mean ± SD.

*p<0.05, **p<0.01, ***p<0.001 vs. nLDL. ##p<0.01, ###p<0.001 vs. oxLDL.



15

Exposure to 5 mM NAC, a free radicals

scavenger, and to the specific inhibitor of

NADPHox, 50 µM Apoc, reduced oxLDL-

induced O2- generation in macrophages

(18%, p<0.001 and 13%, p<0.01,

respectively) (Figure 2E), while H2O2

production was reduced only by 5 mM NAC

(43%, p<0.01) (Figure 2F). Together, these

experiments indicate that oxLDL stimulate

ROS production through the activation of

NADPHox.

Oxidized LDL and their oxidation products

induce CRP gene expression and secretion

in human macrophages

To assess whether the oxidative milieu affects

the secretion of CRP, we set up experiments

to investigate the effect of oxLDL on CRP

expression and secretion in macrophages. The

results showed that in these cells, oxLDL

induced a 3-fold increase of CRP mRNA

(p<0.001) above the values obtained for

nLDL (controls) and similar to the values

given by 1 µg/ml TM (4.5-fold, p<0.001)

(Figure 3A). Consistent with the gene

expression results, oxLDL induced a

significant increase of the secreted CRP

compared to nLDL in the cells’ culture media

(4-fold, p<0.01); a high level of secreted CRP

was obtained also upon the incubation of the

cells with TM (7-fold, p<0.01) (Figure 3B).

Fig. 3. Oxidized LDL induce CRP mRNA and

secretion in human macrophages. Cells were incubated

with 100 µg/ml native LDL (nLDL), 100 µg/ml

oxidized LDL (oxLDL) or 1 µg/ml tunicamycin (TM)

for 24h. Control macrophages (C) were cultured in the

same conditions without LDL exposure. (A) CRP

mRNA levels were measured by real-time PCR relative

to β-actin and expressed as fold change vs. C. (B)

Secreted CRP was quantified in the culture media,

normalized to β-actin and expressed as fold change vs.

C. All data are presented as mean ± SD. **p<0.01,

***p<0.001 vs. nLDL. #p<0.05, ##p<0.01 vs. oxLDL.

These studies were extended employing

two main lipid peroxidation products that are

components of oxLDL, 4-HNE and 9-HODE.

Incubation of human macrophages with 10 or

20 µM 4-HNE or 1 or 3 µg/ml 9-HODE

induced a concentration-dependent up-

regulation of CRP gene expression and that of

the secreted protein in the culture media,

compared to control cells. The CRP mRNA

levels in the cells exposed to 10 or 20 µM 4-

HNE increased by 5-fold (p<0.001) and 13-

fold (p<0.001), respectively, while the

exposure to 1 or 3 µg/ml of 9-HODE induced

an increase of 1.8-fold (p<0.001) and 11-fold

(p<0.001) respectively (Figure 4A). The CRP

secreted by macrophages in the culture media

increased 7-fold (p<0.001) and 13-fold

(p<0.01), respectively, in the cells incubated



16

with 10 µM and 20 µM 4-HNE. A similar

phenomenon was detected in cells incubated

with 9-HODE, which induced a 3-fold (1

µg/ml, p<0.001) and a 10-fold (3 µg/ml,

p<0.001) increase of the secreted CRP

(Figure 4B).

Fig. 4. Lipid oxidation products from oxidized LDL

induce CRP mRNA and secretion in human

macrophages. Cells were exposed to 10 and 20 µM 4-

HNE or 1 and 3 µg/ml 9-HODE for 24h. Control

macrophages (C) were cultured in the same conditions

without LDL exposure. (A) CRP mRNA levels were

measured by real-time PCR relative to β-actin and

expressed as fold change vs. C. (B) Secreted CRP was

quantified in the culture media, normalized to β-actin

and expressed as fold change vs. C. All data are

presented as mean ± SD. $$$p<0.001 vs.C.

Oxidized LDL-induced CRP secretion from

human macrophages is mediated by

oxidative stress

To reveal whether the ER stress triggering is

involved in the oxLDL-induced secretion of

CRP from macrophages, the cells were

incubated with oxLDL in the presence of the

inhibitors of ER stress, 5 µM salubrinal or 20

mM PBA. The results showed that none of

the tested inhibitors affected CRP mRNA and

protein secretion from macrophages exposed

to oxLDL (data not shown).

To elucidate whether the oxidative stress

activation is responsible for the secretion of

CRP from macrophages, the cells were

incubated with oxLDL in the presence of

oxidative stress inhibitors, 5 mM NAC or 50

µM Apoc. The results of these experiments

showed that both inhibitors decreased

oxLDL-induced CRP mRNA, namely NAC

73% (p<0.001) and Apoc 48% (p<0.01). In

addition, NAC reduced the CRP secreted by

oxLDL-exposed macrophages by 24%

(p<0.05). (Figure 5A, B). These results

corroborate well and support the implication

of the oxidative stress in CRP expression and

secretion by macrophages.



17

Fig. 5. Oxidative stress mediates oxidized LDL-

induced CRP secretion in human macrophages. Cells

were preincubated with 5 mM NAC or 50 µM Apoc for

2h before adding 100 µg/ml oxLDL for 24h. (A) CRP

mRNA levels were measured by real-time PCR relative

to β-actin and expressed as fold change vs. oxLDL. (B)

Secreted CRP was quantified in cells’ media,

normalized to β-actin and expressed as fold change vs.

oxLDL. All data are presented as mean ± SD.

#p<0.05, ###p<0.001 vs. oxLDL.

The data obtained in this study show that

exposure of human macrophages to oxLDL

induces: (i) ER stress, as revealed by the

activation of eIF2α and IRE1α, and up-

regulation of CHOP gene expression; (ii)

oxidative stress, as manifested by stimulation

of NADPHox activity and ROS production

and (iii) CRP gene and protein expression,

and secretion mediated by the oxidative

stress.

We previously reported that oxLDL and

their two major lipid peroxidation products,

4-HNE and 9-HODE, induce ER stress in

human macrophages by the activation of

eIF2α and c-Jun N-terminal kinase

(SAPK/JNK) signalling pathways (Niculescu

et al., 2013). In the present study, we show

that oxLDL increase the protein expression of

ER stress sensor IRE1α, which is involved in

the c-Jun N-terminal kinase pathway and up-

regulate CHOP gene expression, data that are

in good agreement with Yao et al., 2013.

Reportedly, oxLDL and oxidized lipids

trigger intracellular generation of ROS and

cellular oxidative stress (Leonarduzzi et al.,

2005). Our experiments established that

oxLDL stimulate ROS production (O2- and

H2O2) in human cultured macrophages

through the activation of NADPH oxidase.

The results corroborate well with the reported

similar increases of H2O2 production in

RAW264.7 (Lee et al., 2014) and J774

macrophages (Bae et al., 2009).

In the present study, we demonstrate that

oxLDL, as well as two oxidation-generated

lipid components of oxLDL, 4-HNE and 9-

HODE, induce the secretion of CRP from

macrophages, in good agreement with Li et

al., 2015. We also found that TM, a well-

known ER and oxidative stress inducer,

increases the CRP gene expression and

protein secretion in macrophages. The

inhibition of ER stress, such as the treatment

with salubrinal or PBA, did not influence

CRP secretion. The pre-incubation of

macrophages with antioxidants, such as NAC

or apocynin, decreased oxLDL-induced CRP

gene expression and protein secretion. These

data indicate that oxLDL-induced CRP

secretion from macrophages is associated

with ROS production, in good agreement with

a report from literature that showed the

involvement of ROS in the angiotensin II-

induced CRP expression in U937

macrophages (Li et al., 2011).



18

In vivo, the local effect of CRP secretion

from macrophages may have an important

impact on the adjacent endothelial cells in the

atheroma. We have previously reported that

CRP induces a decrease of the gene and

protein expression of endothelial nitric oxide

synthase and the increase of the intracellular

reactive nitrogen species levels in human

endothelial cells in culture (Toma et al.,

2012). In addition, we have shown that CRP

increases the phosphorylation of pro-

inflammatory signalling molecules (p65

subunit of NF-kB and p38MAPK) and

induces increased MCP-1 expression in HEC

(Toma et al., 2012).

Conclusions

Our data demonstrate that oxLDL contribute

in part to the development of the

atherosclerotic plaques by inducing the

activation of the NADPH oxidase, the

ensuing ROS production, and the secretion of

pro-inflammatory molecules from

macrophages, such as CRP, which contribute

to the development and destabilization of the

plaque.

Acknowledgements

The authors thank Ms. Daniela Rogoz and

Ms. Cristina Dobre for their skilful technical

assistance. This work was supported by the

Romanian Academy, the Romanian Ministry

of National Education PN-II-PT-PCCA-2011-

3.1-0184 project (grant number PCCA-

127/2012), co-financed (GMS) by the

European Social Fund through Sectorial

Operational Program Human Resources

Development 2007-2013 (project

POSDRU/159/1.5/S/133391). References

Baec, Y.S., Lee, J.H., Choi, S.H., Kim, S., Almazan,

F., Witztum, J.L., Miller, Y.I.: Macrophages

generate reactive oxygen species in response to

minimally oxidized low-density lipoprotein: toll-

like receptor 4- and spleen tyrosine kinase-

dependent activation of NADPH oxidase 2, Circ.

Res., 104, 210-218, 2009.

Cathcart, R., Schwiers, E., Ames, B.N.: Detection of

picomole levels of hydroperoxides using a

fluorescent dichlorofluorescein assay, Anal.

Biochem., 134, 111-116, 1983.

Chung, J., Shin, D.Y., Zheng, M., Joe, Y., Pae, H.O.,

Ryter, S.W., Chung, H.T.: Carbon monoxide, a

reaction product of heme oxygenase-1, suppresses

the expression of C-reactive protein by

endoplasmic reticulum stress through modulation of

the unfolded protein response, Mol. Immunol., 48,

1793-1799, 2011.

Erbay, E., Babaev, V.R., Mayers, J.R., Makowski, L.,

Charles, K.N., Snitow, M.E., Fazio, S., Wiest,

M.M., Watkins, S.M., Linton, M.F., Hotamisligil,

G.S.: Reducing endoplasmic reticulum stress

through a macrophage lipid chaperone alleviates

atherosclerosis, Nat. Med., 15, 1383-1391, 2009.

Ehara, S., Ueda, M., Naruko, T., Haze, K., Itoh, A.,

Otsuka, M., Komatsu, R., Matsuo, T., Itabe, H.,

Takano, T., Tsukamoto, Y., Yoshiyama, M.,

Takeuchi, K., Yoshikawa, J., Becker, A.E.:

Elevated levels of oxidized low density lipoprotein

show a positive relationship with the severity of

acute coronary syndromes, Circulation, 103, 1955-

1960, 2001.

Feng, B., Yao, P.M., Li, Y., Devlin, C.M., Zhang, D.,

Harding, H.P., Sweeney, M., Rong, J.X.,

Kuriakose, G., Fisher, E.A., Marks, A.R., Ron, D.,

Tabas, I.: The endoplasmic reticulum is the site of

cholesterol-induced cytotoxicity in macrophages,

Nat. Cell Biol., 5, 781-792, 2003.

Fu, Y., Luo, N., Lopes-Virella, M.F., Garvey, W.T.:

The adipocyte lipid binding protein (ALBP/aP2)

gene facilitates foam cell formation in human THP-

1 macrophages, Atherosclerosis, 165, 259-269,

2002.

Han, C., Liu, J., Liu, X., Li, M.: Angiotensin II induces

C-reactive protein expression through ERK1/2 and

JNK signaling in human aortic endothelial cells,

Atherosclerosis, 212, 206-212, 2010.

Holvoet, P., Kritchevsky, S.B., Tracy, R.P., Mertens,

A., Rubin, S.M., Butler, J., Goodpaster, B., Harris,

T.B.: The metabolic syndrome, circulating oxidized

LDL, and risk of myocardial infarction in well-

functioning elderly people in the health, aging, and

body composition cohort, Diabetes, 53, 1068-1073,

2004.

Hotamisligil, G.S.: Endoplasmic reticulum stress and

the inflammatory basis of metabolic disease, Cell,

140, 900-917, 2010.

Kaperonis, E.A., Liapis, C.D., Kakisis, J.D.,

Dimitroulis, D., Papavassiliou, V.G.: Inflammation

and atherosclerosis, Eur. J. Vasc. Endovasc. Surg.,

31, 386-393, 2006.

Kim, S., Joe, Y., Jeong, S.O., Zheng, M., Back, S.H.,

Park, S.W., Ryter, S.W., Chung, H.T.: Endoplasmic

reticulum stress is sufficient for the induction of IL-

1beta production via activation of the NF-kappaB

and inflammasome pathways, Innate Immun., 20,



19

799-815, 2014.

Lee, S.J., Thien Quach, C.H., Jung, K.H., Paik, J.Y.,

Lee, J.H., Park, J.W., Lee, K.H.: Oxidized low-

density lipoprotein stimulates macrophage 18F-

FDG uptake via hypoxia-inducible factor-1alpha

activation through Nox2-dependent reactive oxygen

species generation, J. Nucl. Med., 55, 1699-1705,

2014.

Leonarduzzi, G., Chiarpotto, E., Biasi, F., Poli, G.: 4-

Hydroxynonenal and cholesterol oxidation products

in atherosclerosis, Mol. Nutr. Food Res., 49, 1044-

1049, 2005.

Li, S.F., Hu, Y.W., Zhao, J.Y., Ma, X., Wu, S.G., Lu,

J.B., Hu, Y.R., Wang, Y.C., Gao, J.J., Sha, Y.H.,

Zheng, L., Wang, Q.: Ox-LDL upregulates CRP

expression through the IGF2 pathway in THP-1

macrophages, Inflammation, 38, 2, 576-583, 2015.

Li, M., Liu, J., Han, C., Wang, B., Pang, X., Mao, J.:

Angiotensin II induces the expression of c-reactive

protein via MAPK-dependent signal pathway in

U937 macrophages, Cell Physiol. Biochem., 27, 63-

70, 2011.

Malhotra, J.D., Kaufman, R.J.: Endoplasmic reticulum

stress and oxidative stress: a vicious cycle or a

double-edged sword?, Antioxid. Redox Signal., 9,

2277-2293, 2007.

Moore, K.J., Sheedy, F.J., Fisher, E.A.: Macrophages

in atherosclerosis: a dynamic balance, Nat. Rev.

Immunol., 13, 709-721, 2013.

Moore, K.J., Tabas, I.: Macrophages in the

pathogenesis of atherosclerosis, Cell, 145, 341-355,

2011.

Myoishi, M., Hao, H., Minamino, T., Watanabe, K.,

Nishihira, K., Hatakeyama, K., Asada, Y., Okada,

K., Ishibashi-Ueda, H., Gabbiani, G., Bochaton-

Piallat, M.L., Mochizuki, N., Kitakaze, M.:

Increased endoplasmic reticulum stress in

atherosclerotic plaques associated with acute

coronary syndrome, Circulation, 116, 1226-1233,

2007.

Niculescu, L.S., Sanda, G.M., Sima, A.V.: HDL

inhibits endoplasmic reticulum stress by stimulating

apoE and CETP secretion from lipid-loaded

macrophages, Biochem. Biophys. Res. Commun.,

434, 173-178, 2013.

Pahl, H.L., Baeuerle, P.A.: A novel signal transduction

pathway from the endoplasmic reticulum to the

nucleus is mediated by transcription factor NF-

kappa B, EMBO J., 14, 2580-2588, 1995.

Seljeskog, E., Hervig, T., Mansoor, M.A.: A novel

HPLC method for the measurement of

thiobarbituric acid reactive substances (TBARS). A

comparison with a commercially available kit, Clin.

Biochem., 39, 947-954, 2006.

Shimada, K., Mokuno, H., Matsunaga, E., Miyazaki,

T., Sumiyoshi, K., Miyauchi, K., Daida, H.:

Circulating oxidized low-density lipoprotein is an

independent predictor for cardiac event in patients

with coronary artery disease, Atherosclerosis, 174,

343-347, 2004.

Sima, A.V., Botez, G.M., Stancu, C.S., Manea, A.,

Raicu, M., Simionescu, M.: Effect of irreversibly

glycated LDL in human vascular smooth muscle

cells: lipid loading, oxidative and inflammatory

stress, J. Cell. Mol. Med., 14, 2790-2802, 2010.

Simionescu, M.: Implications of early structural-

functional changes in the endothelium for vascular

disease, Arterioscler. Thromb. Vasc. Biol., 27, 266-

274, 2007.

Simionescu, M., Sima A.V., Morphology of

atherosclerotic lesions. In: Inflammation and

Atherosclerosis, pp.19-37, 2012. Edited by G. Wick

and C. Grundtman, Springer-Verlag, Wien.

Simionescu, N., Vasile, E., Lupu, F., Popescu, G.,

Simionescu, M.: Prelesional events in

atherogenesis. Accumulation of extracellular

cholesterol-rich liposomes in the arterial intima and

cardiac valves of the hyperlipidemic rabbit, Am. J.

Pathol., 123, 109-125, 1986.

Skalen, K., Gustafsson, M., Rydberg, E.K., Hulten,

L.M., Wiklund, O., Innerarity, T.L., Boren, J.:

Subendothelial retention of atherogenic lipoproteins

in early atherosclerosis, Nature, 417, 750-754,

2002.

Stancu, C.S., Toma, L., Sima, A.V.: Dual role of

lipoproteins in endothelial cell dysfunction in

atherosclerosis, Cell Tissue Res., 349, 433-446,

2012.

Steinberg, D., Witztum, J.L.: Is the oxidative

modification hypothesis relevant to human

atherosclerosis? Do the antioxidant trials conducted

to date refute the hypothesis?, Circulation, 105,

2107-2111, 2002.

Toma, L., Sanda, G.M., Stancu, C.S., Rogoz, D., Sima,

A.V.: Combined effect of inflammatory C-reactive

protein and hyperglycemia on endothelial cell

dysfunction, Annals of the Romanian Society for

Cell Biology, 17, 29-36, 2012.

Torres, M., Forman, H.J.: Redox signaling and the

MAP kinase pathways, Biofactors, 17, 287-296,

2003.

Ungvari, Z., Csiszar, A., Edwards, J.G., Kaminski,

P.M., Wolin, M.S., Kaley, G., Koller, A.: Increased

superoxide production in coronary arteries in

hyperhomocysteinemia: role of tumor necrosis

factor-alpha, NAD(P)H oxidase, and inducible

nitric oxide synthase, Arterioscler. Thromb. Vasc.

Biol., 23, 418-424, 2003.

Vindis, C., Escargueil-Blanc, I., Elbaz, M., Marcheix,

B., Grazide, M.H., Uchida, K., Salvayre, R., Negre-

Salvayre, A.: Desensitization of platelet-derived

growth factor receptor-beta by oxidized lipids in

vascular cells and atherosclerotic lesions:

prevention by aldehyde scavengers, Circ. Res., 98,

785-792, 2006.

Yao, S., Miao, C., Tian, H., Sang, H., Yang, N., Jiao,

P., Han, J., Zong, C., Qin, S. Endoplasmic

reticulum stress promotes macrophage-derived

foam cell formation by up-regulating cluster of

differentiation 36 (CD36) expression, J. Biol.

Chem., 289, 4032-4042, 2014.

Yao, S., Zong, C., Zhang, Y., Sang, H., Yang, M., Jiao,

P., Fang, Y., Yang, N., Song, G., Qin S.: Activating

transcription factor 6 mediates oxidized LDL-



20

induced cholesterol accumulation and apoptosis in

macrophages by up-regulating CHOP expression, J.

Atheroscler. Thromb., 20, 94-107, 2013.

Zhao, H., Joseph, J., Fales, H.M., Sokoloski, E.A.,

Levine, R.L., Vasquez-Vivar, J., Kalyanaraman, B.:

Detection and characterization of the product of

hydroethidine and intracellular superoxide by

HPLC and limitations of fluorescence, Proc. Natl.

Acad. Sci. U. S. A., 102, 5727-5732, 2005.

oxidized ldl induce c-reactive protein secretion in human ... in curs/19 3/2. sima anca.doc.pdf ·...

Documents