our mother of consolation parishpentecost sunday - 044 - live + jesus may 31, 2020 - pentecost...
TRANSCRIPT
Pentecost Sunday - 044 -
Live + Jesus
May 31, 2020 - Pentecost Sunday
Our Mother of Consolation Parish Administered by the Oblates of St. Francis de Sales and the Sisters of St. Joseph
Parish Mission Prayer Let us pray our Parish Mission Prayer each day.
Nourished by the Word and Eucharist, we, the members of Our Mother of Consolation Parish, strive to create a vital, welcoming Catholic faith community that embraces each person. Acknowledging our blessings and supporting one another, we humbly serve the needs of God’s people and work to be the presence of Christ in our world.
Our Parish Community extends a warm welcome to all our guests and visitors. If you would like to register as a member of our Parish Community, please contact the Parish Office.
9 E. Chestnut Hill Avenue • Philadelphia, PA 19118 • 215-247-0430 • www.omcparish.com
Mass Schedule
Monday - Friday 7:00AM Saturday Daily No Mass Saturday Vigil 4:30PM Sunday 7:30AM
9:00AM 11:00 AM
Low Gluten Hosts are available; Check in at the in the Sacristy before Mass.
Reconciliation (Confessions) Saturday: 3:30 to 4:00 PM Wednesday: 7:00 to 8:00 PM
Private Prayer The Chapel, located in the Oblate Residence, is open weekdays 6:00M to 6:00PM.
The Church is open Wednesday 7:00 to 8:00 PM with confessions available.
Eucharistic Adoration Adoration of the Blessed Sacrament takes place in the Oblate Residence Chapel on the First Friday of the month (September to June) - 7:30AM to 5:30PM. Vespers & Benediction - 5:30 PM.
Stay Connected with Flocknotes Join our parish Flocknotes for timely updates. To sign-up for Text OMC to 84576 or visit the parish homepage
Pentecost Sunday - 044 - 2
Lord Hear Our Prayer
We Pray for……
All medical professionals, civic officials, and the first responders on the frontlines of the Coronavirus.
Those serving in our military, especially: Jack Anthony, Thomas F. Burke, John Dobbins, Eric Duckworth, Christopher Gaiters, Tim Gallagher, Clint Hajek, Thomas Howe, Stephen R. Irwin, Christian Kostis, Alexander S. Martin, Jack R. Martin, Edward T. McCann, Brendan McCormick, Sean O’Neill, Thomas O’Neill, Anthony Palombi, Billy Roust, Christian A. Stout, Ryan Sullivan Those who have died, especially: victims of the Coronavirus, Giacomo Portolese, Jane Becker, Linda Flannagan Burak
Those who are sick and homebound, especially: Stephanie Anderson, Elyssa Antinucci, Gloria Antinucci, Robert Bencker, Anne Thornton Bradley, Katie Brennan, Rozanne Brickley, Hilary Bruce, Chuck Boyle, Baby Bryn Elizabeth Busby, Anna Carpino, Eileen Cawley, Megan Conboy, Winston Chin-Ahin, Georgette Cook, Hugh Cregan, Carol Davis, Rosemarie Dietz, Mario Diliberty, Ann and Tom Dougherty, Joan Gain, Bill Gregg, Agnes Grossman, Tom Hauer, Dutch Highland, Ed Hooven, Ric Johnson, Charles Joyner, Marian Joyner, Sheila Kendall, Marie King, Dale Kinley, Richard Koelle, Heather Koelle, Tascha Konopelski-Knowlton, Bobby Langdon, Jr., Eli Lewin-Tankel, Jennifer Leaming Lyons, Mary MacFarland, Gail Maletta, James Mazzone, Molly McClure, George McCombie, Jimmy McGillian, Ryan Mellor, Vera Morangello, Robyn Muldrow, Kevin O’Brien, Carole O’Hare, Theresa Nocero, Beth Palan, Darryl Palmer, Ken Patrick, JoAnn Cullen Perott, Dominic Pironti, John Paul Pironti, William Patrick Pironti, Richard Porth, Theresa Pupis, Will Rackin, Megan Ramus, Sr. Cathy Rebello, SSD, Gene Reilly, Michael Reinking, Robert Richey, III, Joseph Rizzo Jr., Joseph Rizzo Sr., Kiersten Reilly, Ernest Robinson, Rosemary Schoendorfer, David Sickles Sr., Matt Sokol, Bernadette Smith, Walter Stelmat, Caroline Sweeney, Michael Sweeney, Chris Tama, Lt. Ryan Timoney, Diane Towey, Sr. Clare Tully SSJ, Alice Georgia Unsworth, Darrin Wood, and those who care for them.
Public Masses resume at OMC Saturday, June 6 - 4:30 Vigil Mass
Announced Masses Intensions
Monday, June 1
Irvin & Sarah Scharas req by John & Angela Duffy
Tuesday, June 2
Theresa Pupis req by OMC Parish
Wednesday, June 3
Joanne Hoffman req by William & Cynthia Hoffman
Thursday, June 4
OSFS & SSJ Vocations
Friday, June 5 Ellen Maher
req by OMC Parish
Saturday, June 6
In Thanksgiving to Our Lady of Fatima req by Toni White
4:30 Vigil - Hank & Anne Letter req by Phil & Kit McGovern
Sunday, June 7
7:30 AM Grace & Michael D’Alfonso req by Toni White
9:00 AM Bill & Roni Bruno req by The Family
11:00 AM Anne H. O’Neill req by The Anne Boyle Family
Please be assured that all Mass intentions are being fulfilled
Digital Bulletin During the YELLOW Phase the bulletin will continue to only be available in a digital format. A link is available on the parish homepage and will be sent weekly via Flocknote. A few copies of the bulletin will be available in Church for those without internet. If you have a bulletin notice, please send it to Sr. Christine, at least one week in advance of publication: [email protected]
Prayers for the Sick and Homebound
If there is anyone you would like added or
removed from our Sick & Homebound Listing,
please call the Parish Office at 215-247-0430.
Pentecost Sunday - 044 - 3
Stewardship of Treasure “Renewing Our Mission”
“Give to the Lord as he has given to you, generously, according to your means.”
Sirach 35:12
Thanks for your support of our Parish and our ministries, especially during this time of uncertainty. Your consistent contributions to the Parish are greatly appreciated.
If you have not already done so, the Parish Finance Council invites you to consider online giving as a way of supporting the Sunday Collection, especially during this time when we will not have our in pew Sunday Collection.
Online giving is a convenient and secure way of continuing your financial support of the parish at a time when we needed it most.
We are continuing to meet our salary & benefit obligations to all our full & part time employees. Realizing that all our income is impacted by the present crisis, any financial support you can give is appreciated.
To sign-up for OMC Online Giving
Click HERE
Prayer Hint for the Week:
Are you having difficulty coming to quiet when you pray? Try breathing slowly and pray these words: “Be still and know I am God…. Be still and know I AM… Be still and know… Be still…Be…” Slowly repeat this verse from Psalm 46 as often as you need to throughout the day… and ask for the grace to just “BE” in God’s presence in the present!
A Thought from St. Francis de Sales
“To live according to the spirit is to love according to the spirit.”
Parish Updates
Parish Offices will be open beginning Monday, June 7 - 9:00AM to 4:00 PM
Please wear a mask in the office.
Masses will resume at OMC Saturday, June 6 at 4:30 PM
Please see guidelines on page 8
Mass Schedule Monday - Friday 7:00AM Saturday Daily No Mass Saturday Vigil 4:30PM Sunday 7:30AM
9:00AM 11:00 AM
Low Gluten Hosts are available; Check in at the in the Sacristy before Mass.
Reconciliation (Confessions) Saturday: 3:30 to 4:00 PM Wednesday: 7:00 to 8:00 PM
Week of May 17, 2020 ................... $ 11,803
Weekly Budgeted ............................ $13,600
Fiscal Year-to-Date 2019-20 .......... $629,259
Year-to-Date Budgeted 2019-20 .... $639,200
Oblates in Ecuador ........................... $16,728
Pentecost Sunday - 044 - 4
Pentecost Sunday - 044 - 5
Our Mother of Consolation Parish School is accepting applications for the 2020/2021 Academic year
OMC teachers have transitioned to an online, virtual classroom style of teaching during this time of crisis. Virtual learning has maintained engagement and continuity of learning outside of the traditional classroom environment. Our Core curriculum and high standards have been maintained and our children are utilizing various platforms for a digital course of studies.
We welcome you to speak to our Principal and learn about the strength of our Academic programs and the acceptance of our 8th grade students into the high schools of their choice! For more information please visit our school website at: www.omcschool.com or email our Principal, Mrs. Patricia Sheetz. [email protected]
Thanks to everyone who supported and participated in OMC Parish School Virtual Spring Soiree!
The Feast of Pentecost
Pentecost marks the occasion of God sending the Holy Spirit upon Jesus' disciples after his Resurrection. The book of Acts describes how the disciples were gathered together in one place on the day of Pentecost. The Jewish feast of Pentecost (Shavuot or the Feast of Weeks) was a day that commemorated the giving of the law to Moses, a day soon to be marked as well by the giving of the Holy Spirit. On Pentecost, the Holy Spirit gave the disciples the strength to fulfill their commission to spread the Good News of Jesus. The Solemnity of Pentecost, which crowns and fulfills the Easter season, is a good time to pray for a deeper indwelling of the Holy Spirit.
Prayer to the Holy Spirit
Come, Holy Spirit, fill the hearts of your faithful. And kindle in them the fire of your love. Send forth your Spirit and they shall be created. And you shall renew the face of the earth.
Virtual Spiritual Community With the upcoming celebration of Pentecost, we remember that Jesus sent his Spirit into our world and no amount of social distancing can hold back the Spirit of God within us and among us. Even as we plan to open the parish in stages, we know some will not be able to fully participate for a variety of reasons. If you would like to connect with other parishioners for a virtual spiritual community, please email Diane Maguire at [email protected] by Monday, June 1.
Pentecost Sunday - 044 - 6
Parish Faith Formation Sr. Christine Konopelski, SSJ - Pastoral Associate for Faith Formation
Pre-Baptism Class via ZOOM! Sunday, June 14 ~ 1:00 PM
Expecting your first child? First time parents need to attend a Pre-Baptism class to Prepare for this special sacramental moment. The next class being
offered is on Sunday, June 14 at 1:00 PM via Zoom. Pre-registration is required. Contact Sister Christine at 215-247-0430
Family and Faith Resource
Attention Parents of children in Grades K to 5! Here is a way to continue to deepen the faith of your children throughout the summer months. Download this free resource from Sadlier Religion - Faith and Family Summer Kit. Just click on the image to the right and download the resource. Enjoy hours of summer faith and family time at home!
Looking for Something??? You might Consider….
In this time of COVID-19, when physical distancing is the order of the day, Cranaleith Spirituality Center is offering programs via Zoom!
Me and God - Coloring and Reflection Virtual Anytime for Adults
Fun With My Family - Coloring and Reflection Virtual Anytime for Families (w/ Children 7+)
Evening of Contemplative Prayer Monday 25, 2020, 7 - 8 PM
Knit, Crochet, Pray Together Tuesday, May 26, 2020, 1 - 2:30 PM
Pentecost Sunday - 044 - 7
Congratulations to the Class of 2020
Parish Religious Education Program Registration 2020 - 2021
Do you have a child entering first grade in public school in September 2020? Or do you have children who need religious education or preparation for
Sacraments? If so, it is time to register your son or daughter for the Parish Religious Education Program (PREP) which also begins in September!
Children need to be entering first grade and be six by September 1 to attend.
In addition, if you have a child currently in a special needs learning situation, talk with us regarding preparation for the Sacraments.
We are accepting children in Year 1 to 6. Children in Year 7 are admitted on a case by case basis and only if they are coming from a Catholic School.
First priority is given to OMC Parishioners. To register contact Sr. Christine at 215-247-0430 or [email protected].
Thank You…. ...for helping to stock our food pantry.
The need is still great, please keep the
food coming.
...for cooking Caring for Friends
Meals. The need is great as well!
Supplies are available in the rectory
vestibule.
Celebrating Sacraments of Initiation
Celebration of Baptism Anytime with 10 or fewer people
First Eucharist (2020 rescheduled) Saturday, September 26, 11:00 AM
Confirmation (2020 rescheduled) Bishop Edward M. Deliman Sunday, October 4, 2:00 PM
Questions? Contact Sister Christine at 215-247-0430 or [email protected]
Pentecost Sunday - 044 - 8
Guidelines for Resuming Mass at OMC
Archbishop Pérez has announced that parishes of the Archdiocese of Philadelphia will be able to resume public Masses the weekend of June 6 and 7. We will begin with the Saturday Vigil Mass on June 6. We look forward to welcoming you back! Let us keep our eyes fixed on Jesus as we make our way back to the in-person celebration of the Mass.
While our county remains in the Yellow Phase of statewide reopening, all of us need to do our part to make sure that our return to Mass is a peaceful and safe experience for all. We will begin cautiously and with the best of intentions. We will all need to practice patience and to be flexible.
We ask everyone to follow these guidelines:
GENERAL POINTS
• The obligation to attend Mass on Sundays continues to be lifted during the Yellow Phase.• Since the obligation to attend Mass on Sunday continues to be lifted, you may choose to attend a
weekday Mass (Monday – Friday).• If you feel uncomfortable attending Mass, please do not to attend.• Please stay home if you are sick.• Please stay home if you are at higher risk of severe illness with COVID19. If you are uncertain about
your risk status, please consult your doctor and also the CDC Guidelines at the link below. https://www.cdc.gov/coronavirus/2019-ncov/need-extra-precautions/people-at-higher-risk.html
• The bathroom will only be available for emergency use. Please see the usher for a key. You will need towipe down & disinfect all surfaces after use. Parents are asked to accompany their children to thebathroom
• We are installing a system to livestream Mass. Once it is installed, we plan to livestream all Sunday, andpossibly Weekday Masses, via our parish YouTube channel. The recorded Sunday Mass will beavailable throughout the week.
MASS SCHEDULE – Due to social distancing requirements the seating at Mass will be limited
Weekday Mass: Monday thru Friday 7:00 AM
Saturday Mass: The 8:00 AM Saturday Mass and confessions will not resume at this time. All Mass intentions for Saturday morning will be rescheduled for another day.
Sunday Mass : Saturday Vigil Mass 4:30 PM Sunday Masses 7:30 – 9:00 – 11:00 AM
Confessions : Saturday 3:30 to 4:00 PM Wednesday 7:00 to 8:00 PM
BEFORE COMING TO MASS
• Please wash your hands for 20 seconds using soap and water.• When exiting your car, please put on a face mask or cloth covering. Face coverings are to be used
throughout the entire Mass. Exceptions to this are “children younger than 2 years old, anyone who hastrouble breathing, and anyone who is incapacitated or otherwise unable to remove the cloth facecovering without assistance” (CDC Guidelines).
• Please do not come to Mass if you are sick or are at higher risk for severe illness with COVID19.• Missalettes & hymnals will not be in the pews during this period. You are welcome to bring your own
missal/readings with you.
Pentecost Sunday - 044 - 9
ENTERING THE CHURCH
• Enter Church through the main doors ONLY. Please follow the directions of the ushers.• Exit Church through the side doors ONLY• The aisles will be one way: The center aisle towards the altar, the side aisles will be away from the
altar. When exiting the Church, please use the side aisles and exit through the side doors. Kindlyobserve directional signs.
• Hand sanitizers will be available at the Church entrance, you may also bring your own.• Single-use worship aids will be available as you enter church. Kindly take it home with you or dispose
of it in the recycling bins at the exits. Please do not leave the worship aid in the pew.• Parish bulletins will continue to be available electronically, there will be a few copies available for
those who do not have internet.
SEATING
• When taking your seat, please honor all posted signs about where you may sit. One half of every-otherpew will be open to ensure proper social distancing. Pews will be clearly marked.
• Members of the same household may sit together as normal. Otherwise, only two unrelated people to apew with proper distancing.
DURING MASS
• There will be only a cantor and musician for Sunday Masses. Singing will be limited, and everyone is expected to continue to wear their face covering throughout Mass, especially when singing.
• There will be no offertory procession or collection . We urge you to continue the use of online giving or mailing your contribution to the parish office. A basket will be available in the back of Church for those who wish to bring their offering to Mass.
• There will be no physical contact during the Sign of Peace.• The Precious Blood will not be distributed.
RECEPTION OF HOLY COMMUNION
• Communion with be distributed with reverence and care.• Process up the center aisle, single file, observing social distancing as indicated on the floor markings.• Please wait by the 1st pew as the person in front of you receives Communion.• You are asked to receive Communion in the hand..• Please leave you mask in place until the person in front of you has received Communion and has moved
at least 6 feet away.• If you receive Low-gluten hosts, please check-in at the sacristy.
EXITING THE CHURCH
• At the conclusion of Mass, please exit the Church using the side aisles and side doors only and proceeddirectly to your car.
• We will not be greeting parishioners after Mass during this time. Please do not congregate for anyreason.
• We ask that you leave your mask on until you get to your car.
Please be assured that we will follow the guidelines from the CDC for sanitation as we resume public Masses. To view the CDC guidelines, visit: https://www.cdc.gov/coronavirus/2019-ncov/php/faith-based.html. We have also taken the extra measure and have contracted with Atalina Global Services for an three-step disinfecting and sanitizing regimen for all surface areas in Church.
We are truly thrilled to welcome back our worshipping community as we resume the celebration of Mass. We will need to make adjustments as we implement these protocols, which will give us all the opportunity to practice patience. Most importantly, however, we will be celebrating the Eucharist together.
Pentecost Sunday - 044 - 10
A Salesian Perspective
The Seven Gifts of the Holy Spirit - DeSales Spirituality Services -
Holy Spirit and the gifts of the Holy Spirit. “Some people speak of them as fruits,” wrote St. Francis de Sales. “The description that St. Paul gives them in his letter to the Galatians is: a harvest of love, joy, peace, patience, kindness, generosity, forbearance, gentleness, faith, courtesy, temperateness, purity.” Other people think of them as gifts, dividing them into wisdom knowledge, and the like, as St. Paul does in his first Letter to the Corinthians. For my purpose here, I shall simply group them together under the seven gifts mentioned by Isaiah.” (Pulpit and Pew, p. 145) Speaking of gifts, the gift that Francis de Sales gives us is an appreciation of how the seven gifts of the Holy Spirit work together in helping us to climb the ladder of devotion. No mere intellectual appreciation here; no, Francis offers us a sure path for growing in holiness. “The first of the Holy Spirit’s gifts, the first rung as we begin to work our way up the ladder, is the gift of fear. This fear is of two kinds: a lower sort and a higher one, as I call them. In this, we fear God in two ways: as the one who punishes evildoers, or as the one who rewards the virtuous. This gift of fear goes straight to the heart, and incites it to yield the fruit of repentance.” (Ibid) Fear is the beginning of wisdom. But there are five more steps in between.
“The second gift of the Holy Spirit is piety. The gift of piety is a specific virtue connected with justice. It comes down to a simple matter of doing justice: of giving due honor, reverence and love, not only to God as our supreme creator and loving Father, but to our brothers and sisters as well.” (Ibid) Piety is not about doing extra. Piety is about being just: giving others their due. The Holy Spirit’s third gift — still working our way upwards — is the gift of knowledge.” This gift surpasses rhetorical knowledge. “This knowledge is essential if we are to make full use of the first two gifts: we need to know how to behave towards the God we mean to fear and love. We need to know how to avoid evil; we need to know how to accomplish good.” (Ibid) This knowledge enables us to recognize those things that lead to death, as well as those things that give life. “After the gift of knowledge comes fortitude, the fourth gift. This is absolutely essential to us. The ability to tell good from evil is of little use if we lack the strength to engage the one and avoid the other.” (Ibid) The next gift, as we continue to climb, is the gift of counsel: fortitude, without counsel, would be rashness. While fear causes us to break away from sinful habits and knowledge helps us to see what is wrong, we still need the assistance of counsel if we are to
tackle what knowledge has taught us.” (Ibid) Five down (or up)! Two to go. “What follows is the gift of understanding. This gift enables us to see and penetrate the beauty and the perfection of the mysteries of faith. While we might listen to sermons and read very widely, we can easily remain ignorant of divine mysteries if we lack the gift of understanding.” “Following the gift of understanding is the gift of wisdom, which gratifies the soul with every blessing. This gift helps us to see deeply the excellence of God’s law: not to talk or to preach about it, but to practice it.” (Ibid) Of course, these gifts are not given to us that we might enrich ourselves alone. In his Treatise on the Love of God, Francis wrote that these seven gifts must ultimately benefit others through our practice of the twelve fruits of the Spirit; and by living a life of Beatitude. On which rung on the ladder of devotion do you find yourself today?
Pentecost Sunday - 044 - 11
Our Mother of Consolation Parish Information 9 E. Chestnut Hill Ave. • Philadelphia, PA 19118 • 215-247-0430 • Fax 215-247-2506
www.omcparish.com
The Parish Office is Closed until further notice
Tuition/Business Hours Monday thru Thursday - 9:00 AM to 4:00 PM
Ministry of Disability Accommodations [email protected]
Entrance Ramp – located in the courtyard.
Seating – Available in the front pew for those with difficulty walking. Wheelchair space adjacent
Sound Amplification System - Available in the sacristy for those with hearing impairment.
Low Gluten Hosts – Available in the Sacristy.
Sacrament of Marriage Please contact the parish office at least nine months prior to the wedding date you desire and before making any other arrangements.
The Sacrament of Baptism Are you expecting your first child? Parents must participate in a preparation session prior to the Baptism, usually during pregnancy.
RCIA: Rite of Christian Initiation of Adults The RCIA is the sacramental process by which a person seeks full initiation into the Catholic Church through the Sacraments of Initiation (Baptism, Confirmation, and Eucharist). If you are interested in learning more about becoming a Catholic, please contact the Parish Office.
Ministry to the Sick & Homebound Please help us to remain informed about parishioners who are hospitalized, homebound, or in a nursing facility. If you know of someone who wishes to celebrate the Sacrament of Anointing of the Sick, please contact the Parish Office.
Oblates of St. Francis de Sales
Fr. Bob Bazzoli, OSFS - Pastor [email protected]
Fr. John McGinley, OSFS - In Residence [email protected]
Fr. Robert Mulligan, OSFS - In Residence [email protected]
Parish Staff
Mrs. Mary Cassidy - Director of Parish Services [email protected]
Mrs. Barbara Chandler - Choir Director [email protected]
Mrs. Suzanne Danella - Bookkeeper/Tuition Officer [email protected]
Sr. Christine Konopelski, SSJ - Pastoral Associate [email protected]
Deacon Joe Nines - Permanent Deacon [email protected]
Mr. Dave Vogelbacker - Business Manager [email protected]
Parish Pastoral Council: [email protected] Bob Bazzoli, OSFS, Christopher Blatney, Nora Blatney, Mike Breen, Howie Brown, Maria Della Porta, Kirsten Edling, Anna Fontenot, Beth Hagovsky, Christine Kennedy, Christine Konopelski, SSJ, Elizabeth Matthew, Maura Matthews, Scott Perricelli, Nancy Sullivan, Suzanne Danella (Secretary)
Parish Finance Council: [email protected] Bob Bazzoli, OSFS, Justin Brennan, Jaclyn Senior Brown, Walter Clayton, Jim Cosgrove, David Hilton, Maureen Malloy, Matt Mihalich, Suzanne Danella (Secretary)
Our Mother of Consolation Parish School
17 E. Chestnut Hill Ave ♦ Philadelphia, PA 19118 www.omcschool.com ♦ 215-247-1060
Mrs. Patricia Sheetz - Principal [email protected]
Mrs. Suzanne Lasek - Director of Admissions [email protected]
Mr. Paul Cillo - School Minister [email protected]
044 Our Mother of Consolation-Philadelphia (i) John Patrick Publishing Company 1-800-333-3166 • www.jppc.net
BASEMENT WATERPROOFINGMOLD REMEDIATIONFOUNDATION REPAIR
215-427-1727www.RightwayWaterproofi ng.com
FREE INSPECTIONLicensed & Insured
Family Owned and Operated Since 1987
Church
Member
Discounts
Experience Peace of Mind:Pre-Arrange Your Burial at an
Archdiocese of Philadelphia Cemetery.
• Save today through pre-planning• Convenient terms for all of your burial needs
• Traditional in ground, mausoleum & cremation options available at most cemeteries
CALL 215-352-4001 TODAY
Jim BenincasaOffi ce: 215.247.3600
Cell: 215-850-6020 Email: [email protected] Email: [email protected]
ParishionerParishionerLic #AB 047145-LLic #AB 047145-L8039 Germantown Ave., Philadelphia, PA 191188039 Germantown Ave., Philadelphia, PA 19118
(215) 572-62422860 Mount Carmel Ave., Glenside, PA
[email protected] • www.stahlelectric.com
Residential CommercialHIC Registration #PA 013780
GUTTER DOCTO215-322-7400215-322-7400
Mallory’s Army FoundationUnited Together In The Fight Against Bullying...
Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com
(973) 440-8657 [email protected]
It’s easy to join our mailing list! Just send your email address by text message:
Text MALLORYSARMY to 22828 to get started.
Message and data rates may apply.
This Space is Available!800-333-3166 ext. 161
or visit www.jppc.net
What’s My Name?The #WHATSMYNAME
Movement asks everyone
to simply ask drivers
“What’s my name?” before
entering their vehicle to
make sure it is the car they
are supposed to enter.
In Remembrance of Samantha Josephson
#WHATSMYNAME
P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P L E A S E P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !
BUILD YOUR COMMUNITYBUILD YOUR COMMUNITY
- Shop Local -- Shop Small -
Local, trusted, proven, effective, supportive, referrrals, relationships, affordable, repetitous, versatile, lasting.
This describes the power of...affordable, reepppppppppppppppetitous, versatile, lastinggggg. pppppppppppppppp
Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!Call 1.800.333.3166!
044 Our Mother of Consolation-Philadelphia (b) John Patrick Publishing Company www.jppc.net 1-800-333-3166
Coupe Flowers, Inc.625 Bethlehem Pike
Erdenheim, PA 19038 (215) 836-7330 (215) 836-2057 Fax William Coupe
814 Bethlehem Pk., Erdenheim, PA 19038
215-233-2231215-233-2231
David V. Peake, JR., Supvr.Janice H. Mannal, F.D.
CRAFT Funeral Home of
ERDENHEIM
825 Bethlehem PikeSuite 200
Flourtown, PA 19031
CHESTNUTHILL DENTAL
215-242-6404215-242-6404
Robin F. Gallagher, DMDGlenn A. Familant, DDS
E
RYANRYAN LANDSCAPING LANDSCAPINGFor All Your Landscaping Needs
215-247-5852215-247-5852FRANK MASTRONI
Local Diocese Member
® ROOFING ROOFING SIDINGSIDING
REMODELINGREMODELING
Mc BRIEN CONTRACTING • Roofi ng & Siding • Additions & Remodeling • Finished Basements• Porches & DecksFULLY INSUREDAll Work OverseenBy Owner
• Complete Carpentry Services • Storm Windows & Doors • Replacement Windows • Gutters & Spouting
FreeEstimates
(215) 233-1150Over 30 Years of Serving Montgomery County with Quality Home Improvements
Plumbing • HeatingCooling • Fuel Oil
Healthy Home Comfort
DWYERFamily owned since 1875
WALTER A. DWYER, INC.
(215) 248-4300
www.dwyerhomecomfort.com
ROOFINGAll Types of Roofi ng
Slate • Copper • Gutters • Repair & RestorationFREE ESTIMATEShalsteadroofi [email protected]
215.806.7944Parish Member Since 1971
Gary L Stevens, DDSFAMILY DENTISTRY
1030 E. Willow Grove Ave.Wyndmoor, PA 19038Phone: 215-233-1700215-233-1700Fax: 215-233-1730215-233-1730
Emergency: [email protected]
The Oblates ofSt. Francis de Sales
Pillars of Gentle Strengthwww.oblates.orgwww.oblates.org
If you want to be a pillar If you want to be a pillar of strength for others, consider a of strength for others, consider a
vocation as an Oblate Priest vocation as an Oblate Priest or Brother. To learn more about or Brother. To learn more about
the Oblates of St. Francis de Sales, the Oblates of St. Francis de Sales, please contact please contact
Fr. Tim McIntire, OSFSFr. Tim McIntire, [email protected]@oblates.us
610-282-1100 ext. 1393610-282-1100 ext. 1393
Please pray for vocations.
ALL NATURAL GRASS FED BEEF
Ground Beef - Steaks1 Piece to Bulk
Pick Up or Delivery
215-435-6274Michael & Frances Jones - Parishioners
www.MorelandCattleCompany.com
In Our 4th Decade of Quality Service
French Drains • Foundation Repair • Mold Remediation
215-639-8500www.morganbasementwaterproofing.com
All Work Guaranteed
7241 Hollywood RoadFt. Washington
Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we
can help Save you money with your monthly payments on your
commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four season customer
service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600
Philadelphia, PA 19103
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg
y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis
cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfornfornfornfornfornfornfornformatimammmmmmammmmmm o
echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n
acturing - Chemical &&&&&&&&&&&l &l & l & l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens
dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans
ortation &&&&& & && & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker
CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia
ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforcforcforcforcforceement, Public Safety - O
To all those nforcement, Public Sanforcement, Public Sa
essentiallture - Energylture - EnergyWater aste TraWater aste Tra
workerscs - Public Wors - Public WorCommunicatioCommunicatio
keeping echnology Wochnology Woovernment Wovernment W
us safe,acturing Caterials Finanaterials Finan
yournicationnicationWorkerWorke
service isovernment Workovernment Workacturing Chemacturing Chem
invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar
ment, Public Safety - OSafety - Othan
k yo
u
g gyWatateatttatatatattaaaaaa rwaswaswawaswaswawwwaswaswwwwwasswasawaw ste -tetttttttttteee Transportation & Log
cccscccccc - PPPPPPPPPPPPPPubliubliubliubliublililublibbliububuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrkrkkkkkrr & - & -& -&& -&& -&&&& -&& -&&&&& -&&&& -&& InfrInfInfrnfrInfInfrnfrIInffI ffInI fnfI fInfnfInnnfn astructuCCoCoCoCoCoCCoCCoCCoCooCCCCCCCCC mmunmmunmmmmmmunmmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicaticatcaticatcatcatcatcattcatcatcatcattcatcatcatcatccacatcccacc ionsionsionsonsionononsonsiooionssonsonsonsiononoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornforforfnfnfornfornfornfornforfofornfornforrrfornnfforrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmatim
echhhhhhhhhnolonononoonnoloonolonnoln lonolonoooloonnnn onolonoln oonoo ggy Wgggg orkers - Community
WeddingInvitations WeddingInvitations & Holiday Cards& Holiday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from conveniently from your home or offi ce.your home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted
FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!