organization and architecture of aggr‐dependent promoters ... · transferred into the lac e. coli...

Acc

epte

d A

rtic

le

This article has been accepted for publication and undergone full peer review but has not

been through the copyediting, typesetting, pagination and proofreading process, which may

lead to differences between this version and the Version of Record. Please cite this article as

doi: 10.1111/mmi.14172

This article is protected by copyright. All rights reserved.

DR. DOUGLAS F BROWNING (Orcid ID : 0000-0003-4672-3514)

Article type : Research Article

For Molecular Microbiology Edited by DFB on 14/11/2018

Organization and architecture of AggR-dependent promoters from

Enteroaggregative Escherichia coli

Running Title: Regulation of AggR-dependent promoters in EAEC.

Muhammad Yasir 1,4, Christopher Icke 1, Radwa Abdelwahab 1, 2, James R. Haycocks 1, Rita E. Godfrey

1, Pavelas Sazinas 3, Mark J. Pallen 4, Ian R. Henderson 1,

Stephen J. W. Busby 1* and Douglas F. Browning 1*

1 Institute of Microbiology and Infection, School of Biosciences, University of Birmingham,

Birmingham, B15 2TT, UK.

2 Faculty of Medicine, Assiut University, Egypt.

3 Department of Biotechnology and Biomedicine, Technical University of Denmark, DK-2800 Kgs

Lyngby, Denmark.

4 Quadram Institute Bioscience, Norwich Research Park, Norwich, NR4 7UA, UK.

Acc

epte

d A

rtic

le


* For correspondence: SJWB Email: [email protected] Tel: +44 (0)121-414-5439.

DFB: Email: [email protected] Tel: +44 (0)121-414-5435.

Abstract

Enteroaggregative Escherichia coli (EAEC), is a diarrhoeagenic human pathogen commonly isolated

from patients in both developing and industrialized countries. Pathogenic EAEC strains possess

many virulence determinants, which are thought to be involved in causing disease, though, the

exact mechanism by which EAEC causes diarrhoea is unclear. Typical EAEC strains possess the

transcriptional regulator, AggR, which controls the expression of many virulence determinants,

including the attachment adherence fimbriae (AAF) that are necessary for adherence to human

gut epithelial cells. Here, using RNA-sequencing, we have investigated the AggR regulon from EAEC

strain 042 and show that AggR regulates the transcription of genes on both the bacterial

chromosome and the large virulence plasmid, pAA2. Due to the importance of fimbriae, we

focused on the two AAF/II fimbrial gene clusters in EAEC 042 (afaB-aafCB and aafDA) and

identified the promoter elements and AggR-binding sites required for fimbrial expression. In

addition, we examined the organization of the fimbrial operon promoters from other important

EAEC strains to understand the rules of AggR-dependent activation. Finally, we generated a series

of semi-synthetic promoters to define the minimal sequence required for AggR-mediated

activation and show that the correct positioning of a single AggR-binding site is sufficient to confer

AggR-dependence.

Key Words: Bacterial gene regulation/ EAEC/ AggR/ Promoter organization/ Fimbriae

Abbreviated Summary: Enteroaggregative Escherichia coli (EAEC) is a commonly isolated human

pathogen that causes mucoid diarrhoea. As EAEC virulence is controlled by the AggR master

transcription factor, we use RNA-sequencing to identify the AggR regulated genes in the pathogenic

EAEC strain 042. We report the structure of several AggR-dependent promoters in order to

understand the mechanism of AggR-mediated transcription activation.

Acc

epte

d A

rtic

le


Introduction

Enteroaggregative Escherichia coli (EAEC) is an important human pathogen that is responsible for

causing diarrhoea in both adults and children in industrialized and developing countries (Nataro et

al., 2006; Wilson et al., 2001; Okeke et al., 2000; Franca et al., 2013). It has been shown to elicit

travellers’ diarrhoea, paediatric diarrhoea and persistent diarrhoea in HIV-infected patients, as well

as extra-intestinal infections, such as urinary tract infections and septicaemia (Adachi et al., 2001;

Okeke et al., 2000; Durrer et al., 2000; Olesen et al., 2012; Herzog et al., 2014). EAEC strains have

been linked to a number of serious diarrhoeal outbreaks, including the food-borne outbreak caused

by a Shiga-toxin-producing EAEC O104:H7 in Germany in 2011, which infected over 4000 individuals

and resulted in 54 deaths (Itoh et al., 1997; Harada et al., 2007; Frank et al., 2011; Boisen et al.,

2015). In spite of its global importance as a human pathogen, the mechanisms by which EAEC causes

disease are still poorly understood. In some instances specific virulence determinants have been

identified, but as EAEC strains are extremely heterogeneous in nature, many determinants are not

present in all strains (Estrada-Garcia and Navarro-Garcia, 2012; Franca et al., 2013).

EAEC pathogenesis is thought to proceed by the colonisation of the human intestinal mucosa

followed by the production of various toxins, such as plasmid-encoded toxin (Pet), the Pic mucinase,

enteroaggregative heat-stable toxin (EAST-1) and Shigella enterotoxin 1 (ShET1), and the concurrent

triggering of inflammation (Henderson et al., 1999; Savarino et al., 1991; Fasano et al., 1997;

Estrada-Garcia and Navarro-Garcia, 2012; Harrington et al., 2009). Typical EAEC strains carry the

plasmid-encoded AggR transcription regulator protein, a member of the AraC-XylS family of

transcription factors (Nataro et al., 1994; Sarantuya et al., 2004). AggR co-ordinately activates the

expression of many genes thought to be required for pathogenesis, for example the attachment

adherence fimbriae (AAF) required for colonization, the anti-aggregative protein dispersin (Aap) and

its dedicated type I secretion system (T1SS) (Elias et al., 1999; Sheikh et al., 2002; Nishi et al., 2003;

Morin et al., 2013). As AggR is central to activating the expression of essential virulence genes, it is

key to understanding pathogenesis in this important human pathogen. Here, we use RNA-

sequencing (RNA-seq) to examine the AggR regulon in the pathogenic EAEC strain 042 and show that

AggR regulates genes on both the large virulence plasmid, pAA2, and the bacterial chromosome. As

fimbrial biogenesis is central to EAEC pathogenesis, we examine the organization and architecture of

AggR-dependent fimbrial promoters from EAEC strain 042 and from a number of other important

EAEC strains, identifying the different promoter elements and functional AggR-binding sites required

for expression.

Acc

epte

d A

rtic

le


Results

RNA-seq analysis of the AggR regulon in EAEC strain 042

AggR is the master regulator of EAEC virulence. Previously, Morin et al. (2013) examined the AggR

regulon, using micro-arrays, for the archetypal pathogenic strain EAEC 042. As micro-array analysis

can be influenced by probe design and genome annotation, and has issues with detecting low

abundance transcripts (Zhao et al., 2014), we repeated the analysis using high-throughput RNA-seq

methodology. Briefly, wild type EAEC 042 and an isogenic aggR mutant strain (EAEC 042 ΔaggR)

(Table S1) were grown in triplicate until mid-logarithmic growth in high glucose Dulbecco’s modified

Eagle’s medium (DMEM), which has been shown to induce biofilm formation and AggR-dependent

gene expression in EAEC (Sheikh et al., 2001; Morin et al., 2013), and RNA was isolated and

contaminating DNA removed. The isolated RNA was converted to cDNA and sequenced, generating

over 7 million reads each with >90% of reads aligning to the EAEC 042 genome. Genes were

considered to be differentially expressed if there was >1 log2-fold difference in expression

accompanied by an adjusted p-value <0.00001 between the mutant and the wild type strains. In

total, 112 genes were differentially expressed in EAEC 042 in comparison to the aggR mutant (Tables

S2 and S3). These genes were located on both the chromosome and the large pAA2 plasmid (Fig. 1).

Note that with the exception of EC042_pAA056, all the AggR-regulated genes identified by Morin et

al. (2013) were identified by our study (Tables S2 and S3).

Of the 112 genes that showed differential expression between the wild type and the aggR

mutant, 29 were located in clusters on the large virulence plasmid, pAA2 (Fig. 1B and Table S2). It is

of note that these genes are all confined to one half of the plasmid, whilst the genes required for

plasmid replication and conjugative transfer are located on the other half and are independent of

AggR control (Fig. 1B) (Chaudhuri et al., 2010). The expression of many of these genes has previously

been shown to be dependent on AggR, for example aggR itself, aar, which encodes a repressor of

AggR, the five genes encoding the Aat T1SS (aatPABCD) and its secreted substrate dispersin (aap),

EC042_pAA003 and EC042_pAA004 that encode proteins that are involved in biofilm formation, the

polysaccharide deacetylase encoded by shf, the Shigella flexneri virulence protein VirK and the

AAF/II fimbriae (aafDA and afaB-aafCB) (Morin et al., 2013; Morin et al., 2010; Santiago et al., 2014;

Nishi et al., 2003; Elias et al., 1999; Chaudhuri et al., 2010; Fujiyama et al., 2008). Many of the genes,

which are encoded on pAA2 and activated by AggR, have unknown function (e.g. EC042_pAA005,

EC042_pAA005A, EC042_pAA019, EC042_pAA020 and EC042_pAA061) and, thus, their potential role

in EAEC 042 pathogenicity is unclear.

Acc

epte

d A

rtic

le


From the genes differentially expressed in the aggR mutant, 83 were located on the

chromosome and many of these genes are located in chromosomal islands (Fig. 1A and Table S3), for

example the genes which encode the Aai type VI secretion system (T6SS) (EC042_4562 to

EC042_4583 (aaiA to aaiU)). This cluster consists of the 16 genes encoding the T6SS machinery and

four hypothetical proteins (EC042_4580, EC042_4581, EC042_4582, and EC042_4583) and has been

shown to be activated by AggR (Dudley et al., 2006; Morin et al., 2013). A second AggR activated

chromosomal island extends from EC042_3179A to EC042_3187 (Fig. 1A and Table S3). Previously,

Morin et al. (2013) identified EC042_3182 and EC042_3184 as being AggR regulated. Whilst many

genes within this region encode conserved proteins, with no homology to any known protein family

(e.g. EC042_3179A, EC042_3180 and EC042_3184), EC042_3181 is of note as it is homologous to the

transcription activator PerC from enteropathogenic E. coli, which regulates the LEE1 pathogenicity

island (Knutton et al., 1997).

Interestingly, genes associated with flagellar motility were down regulated in the aggR

mutant, whilst antigen 43 (Agn43) homologues (EC042_4803, flu1, and flu2) were up regulated,

suggesting that AggR might regulate motility and cell aggregation in EAEC 042 (Table S3). To

investigate this, the relative expression of three flagella genes (fliA, flgB, and fliC) and EC042_4803

was assessed by qRT-PCR. Results in Fig. S1 and Table S4 demonstrated that there was no

statistically significant difference in the expression of fliA, flgB, fliC or EC042_4803 between the wild

type EAEC 042 and the aggR mutant. Furthermore, there was no difference in their cell motility as

observed on agar motility assay plates (Fig. S2). As the expression of flagella genes is known to be

stochastic (Spudich and Koshland, 1976; Korobkova et al., 2004) and as agn43 homologues are phase

variable (Henderson et al., 1997), we propose that the differential expression observed in our RNA-

seq experiment for these genes is likely due to stochastic variation and phase variation, respectively,

rather than direct regulation by AggR.

In order to confirm a direct role of AggR in the transcription of genes that showed some of

the largest differential expression in our RNA-seq experiment (i.e. aafD, afaB, aap, aatP and aaiA),

and to identify the AggR-dependent promoters that control their expression, ~400 bp of upstream

DNA was amplified by PCR to generate the aafD100, afaB100, aap100, aatP100 and aaiA100

promoter fragments (Table S1). Each fragment was cloned into the low copy number lac expression

vector, pRW50, to generate lacZ transcriptional fusions (Table S1) and pRW50 constructs were

transferred into the lac E. coli K-12 strain, BW25113. To investigate the role of AggR, cells also

carried either plasmid pBAD/aggR, which encodes AggR expressed from an arabinose-inducible

promoter, or empty pBAD24 vector as a control (Table S1) (Sheikh et al., 2002). Transformants were

Acc

epte

d A

rtic

le


grown with shaking in LB medium to mid-logarithmic phase, either with or without AggR induction

by arabinose, and measured β-galactosidase activities were taken as a proxy for promoter activity.

Results detailed in Fig. S3 show that for host cells carrying pRW50, containing each of the upstream

regulatory region fragments, measured β-galactosidase levels are higher than levels with empty

pRW50, showing that promoter activity is associated with each fragment. Furthermore, expression

was markedly increased by arabinose in the presence of pBAD/aggR, but not increased with

pBAD24. Thus, we conclude that each tested fragment carries an AggR-dependent promoter,

corroborating the results of our RNA-seq analysis for these promoters.

Analysis of the AAF/II fimbrial operon promoters from EAEC 042

During infection, EAEC cells bind to human epithelial cells, using their AAF fimbriae (Harrington et al.,

2006). Due to the importance of fimbriae in EAEC pathogenesis and the role of AggR in their

expression, we sought to characterize in detail the promoters that control the expression of the

EAEC 042 AAF/II fimbrial genes. The AAF/II fimbrial genes are organized into two clusters (aafDA and

afaB-aafCB) on the pAA2 virulence plasmid (Fig. 1B) (Elias et al., 1999). Figs. 2A and 3A detail the

DNA sequence of the aafD100 and afaB100 promoter fragments, which carry DNA upstream of aafD

and the afaB pseudogene, respectively. Note that each fragment is flanked by EcoRI and HindIII sites,

which were introduced to aid cloning, and sequences are numbered from the HindIII site. Inspection

of both sequences identified several matches to the proposed AggR-binding site consensus (Morin et

al., 2010) (Figs. 2A and 3A). Therefore, to identify the essential sequences for AggR-induced

promoter activity, we initially focused on the aafD100 promoter fragment and constructed nested

deletions from the EcoRI end of the fragment. Each shortened fragment (i.e. aafD99, aafD98,

aafD97, aafD96, aafD95 and aafD94) (Fig. 2A; Table S1) was cloned into pRW50 and each plasmid

construct was transferred into BW25113 cells, carrying pBAD/aggR or pBAD24. β-galactosidase

activity was measured, as before, and results in Fig. 2B show that aafD96 is the shortest fragment

where full AggR-dependent induction is retained, with induction being greatly reduced for aafD95

and absent for aafD94. To identify the transcript start, we extracted RNA from BW25113 cells

carrying pRW50/aafD96 and containing either pBAD/aggR or pBAD24. Fig. 2C shows the result of the

primer extension analysis, analysed by polyacrylamide gel electrophoresis, and identifies two clear

bands, corresponding to transcripts starting at positions 56 and 54 of the cloned sequence (Fig. 2A).

Note that these bands are seen in the sample from cells carrying pBAD/aggR but not with pBAD24.

Examination of the aafD96 DNA sequence upstream of positions 56 and 54 revealed a potential -10

hexamer element (5-TAGCAT-3) and a potential AggR-binding site (5-GTTTATTTATC-3), based on

Acc

epte

d A

rtic

le


previously established consensus sequences (Browning and Busby, 2016; Morin et al., 2010) (Fig.

2A). Therefore, to investigate the role of these sequences, site-directed mutagenesis was used to

introduce the 65C and 92C/90C substitutions into the aafD96 fragment, to disrupt each element (Fig.

2A). Mutant derivatives were cloned into pRW50, transferred into BW25113 cells, carrying

pBAD/aggR or pBAD24, and the promoter activity determined. Results in Fig. 2D show that AggR-

dependent promoter activity from the aafD96 fragment was greatly decreased by these

substitutions, consistent with our proposal of these elements as the -10 hexamer and AggR-binding

site at the aafD promoter.

To locate the essential promoter sequences required for afaB-aafCB expression, we also

constructed nested deletions of the afaB100 promoter fragment (Fig. 3A). Again, each of the shorter

fragments (afaB99, afaB98 and afaB97) (Fig. 3A; Table S1) was cloned into pRW50 and promoter

activity determined. Results in Fig. 3B show that afaB100 is the only fragment where AggR-

dependent induction is observed. Thus, to identify the start of transcription, we again extracted RNA

from BW25113 cells carrying pRW50/afaB100 with either pBAD/aggR or pBAD24. Fig. 3C shows the

result of the primer extension analysis and identifies two bands, corresponding to transcripts

starting at positions 280 and 266 of the cloned sequence (Fig. 3A), which were only present in the

sample from cells carrying pBAD/aggR. Examination of the afaB100 DNA sequence upstream of

these positions revealed a potential -10 element (5-TATCTT-3) and AggR-binding site

(5-TTTTTATTATC-3) (Fig. 3A). These elements were, therefore, disrupted by introducing the 293C

and 320C/318C substitutions into the promoter region (Fig. 3A) and mutant afaB100 fragments were

cloned into pRW50. As expected, AggR-dependent promoter activity was substantially decreased by

these substitutions (Fig. 3D), consistent with our hypothesis that these sequences constitute a

functional -10 element and AggR-binding site at the afaB promoter. Previously, Elias et al. (1999)

predicted that the promoter controlling aafCB expression was immediately upstream of aafC.

Therefore, using our dual reporter system, we checked for promoter activity in different afaB-aafCB

fragments. However, we could not find any evidence of a second promoter (Fig. S4). Thus, our

results with both aafD and afaB promoter fragments indicate that each EAEC 042 AAF/II fimbrial

gene cluster is expressed from a single upstream AggR-dependent promoter.

Other EAEC fimbrial operon promoters possess similar promoter organization

To date, five AAF systems (AAF/I to AAF/V) have been identified in EAEC strains and the genes that

encode these fimbrial components, together with the corresponding chaperones and ushers, are all

Acc

epte

d A

rtic

le


found on large virulence plasmids (Bernier et al., 2002; Boisen et al., 2008; Elias et al., 1999; Jonsson

et al., 2015; Savarino et al., 1994). As the promoters that control the expression of different AAF

variants have not been characterized, we investigated some of these promoters in more detail to

uncover their promoter organization and determine whether AggR regulates them similarly. It has

been shown that EAEC strain 17-2 and the highly virulent Shiga-toxin-producing EAEC O104:H4 strain

C227-11, produce AAF/I fimbriae, and the fimbrial genes are organized in a single operon (aggDCBA)

(Rohde et al., 2011; Rasko et al., 2011; Savarino et al., 1994). Therefore, to identify the fimbrial

operon promoter from EAEC 17-2, PCR was used to amplify the DNA upstream of aggD to generate

the aggD100 promoter fragment (Fig. 4A). This was cloned into pRW50 and assayed for promoter

activity in BW25113 cells, carrying either pBAD24 or pBAD/aggR, as before. Results detailed in Fig.

4B show that expression from aggD100 fragment was greatly increased by AggR induction,

confirming that the EAEC 17-2 aggD promoter is AggR regulated. To pinpoint the location of

important regulatory sequences, nested deletions were constructed and the shortened fragments

(i.e. aggD99, aggD98 and aggD97) were cloned into pRW50 and assayed (Fig. 4). Results in Fig. 4B

show that AggR-mediated induction is absent with the aggD97 fragment, and that aggD98 is the

shortest of the fragments where AggR-dependent promoter activity is observed. Examination of the

aggD98 DNA sequence revealed a potential promoter -10 element (5-TATAAT-3) and an AggR-

binding site (5-ATTTTTTTAGC-3) (Fig. 4A). Disruption of these elements in the aggD98 fragment, by

introducing the 60C and 86C substitutions, respectively, greatly decreased promoter expression (Fig.

4C), supporting our proposal that these are the functional -10 element and AggR-binding site at this

promoter.

Savarino et al. (1994) noted that the EAEC 17-2 AAF/I aggD promoter carried six direct

repeats of the hexamer 5'-TCAAGT-3', which are positioned between the -10 element and the aggD

translation initiation codon (Fig. S5). Interestingly, these repeats are more extensive in the aggD

promoters from other pathogenic EAEC strains, e.g. the EAEC O104:H4 strain C227-11 possesses 15

repeats (Table S5 and Fig. S5). As such tandem repeats are unusual in bacteria and can play a role in

gene expression (Browning and Busby, 2016), we examined if the different number of repeats

carried by the EAEC 17-2 and C227-11 aggD promoters affected promoter activity. Results detailed

in Fig. S5 show that the two promoters had similar promoter activity and, thus, although these

repeat tracts are substantial, they do not appear to influence aggD promoter activity.

Alignment of the nucleotide sequence of the AAF/I and AAF/II fimbrial operon promoters

(Fig. 5A) indicated that in each case, the DNA binding site for AggR is located 21 or 22 bp upstream

from the -10 element. This suggests that all AggR-dependent fimbrial promoters may have similar

Acc

epte

d A

rtic

le


promoter organization. Using this information, we examined the DNA upstream of the agg3D and

agg4D genes, which are the first genes in the AAF/III and AAF/IV fimbrial operons from the

pathogenic EAEC strains 55989 and C1010-00, respectively, and identified suitably positioned AggR-

binding sites and -10 elements (Bernier et al., 2002; Boisen et al., 2008) (Figs. 5A and S6). To

investigate the regulation of these AAF variants, the DNA upstream of agg3D and agg4D was cloned

into plasmid pRW50, to generate the agg3D100 and agg4D100 promoter fragments, and point

mutations were introduced to disrupt the potential AggR-binding sites and -10 elements identified

(Figs. 5A and S6). The β-galactosidase activity of BW25113 cells, carrying these constructs, was then

measured, as before. Results in Fig. 5B and 5C indicated that expression from both the wild type

agg3D100 and agg4D100 fragments, respectively, is dependent on AggR and that disruption of the

proposed AggR-binding sites and -10 elements, in each fragment, completely abolished promoter

activity. Thus, we have identified important elements controlling agg3D and agg4D expression and

our results are in agreement with a common promoter organization existing for many EAEC AggR-

dependent promoters.

AggR-dependence can be conferred by a single correctly positioned AggR-binding site

Our data suggest that a single correctly positioned AggR-binding site may be all that is required to

confer AggR-dependent regulation on target promoters. To test this, we generated a series of semi-

synthetic promoters in which the functional AggR-binding site from the aafD promoter was

transplanted into the well characterized E. coli melR promoter, known to be dependent on activation

by the cyclic AMP receptor protein (CRP) (Webster et al., 1988). To do this, we used the previously

constructed CCmelR promoter, which carries a consensus DNA site for CRP. Fig. 6A shows the base

sequence of the promoter elements in the resulting fragments, denoted DAM20 to DAM23, where

the melR promoter CRP site is replaced by a DNA site for AggR, located 20 to 23 bp upstream from

the melR promoter -10 element (5-CATAAT-3). These fragments, together with the CCmelR

fragment, were cloned into pRW50. BW25113 cells, containing either pBAD/aggR or pBAD24, were

transformed with these recombinant plasmids and promoter activities were determined. The

β-galactosidase activity measured in cells containing pRW50/CCmelR and pRW50/DAM20 showed no

increase on induction of AggR expression (Fig. 6B). However, measured activity in cells containing

pRW50/DAM21, pRW50/DAM22 and pRW50/DAM23 showed a four-, eight- and two-fold increase in

expression levels, respectively, compared to the control without AggR (Fig. 6B). Thus, we conclude

that transplanting a single AggR-binding site into a promoter can confer AggR-dependence and that

a spacing of 22 bp between the DNA site for AggR and the -10 element is optimal for induction.

Acc

epte

d A

rtic

le


Discussion

Using an RNA-seq approach we identified the genes regulated by AggR in the archetypal pathogenic

EAEC strain 042. Some members of the AggR regulon are conserved hypothetical genes with

unknown function and their regulation by AggR suggests a possible role in EAEC 042 intestinal

colonization. As EAEC strains are heterogeneous in nature, further investigation of these candidate

genes has the potential to enhance our knowledge of EAEC pathogenicity.

The main aim of this study was to determine the organization and architecture of AggR-

dependent promoters. Focusing on the fimbrial operon promoters in EAEC strain 042, we found

single AggR-dependent promoters upstream of the aafDA and afaB-aafCB regions on the pAA2

virulence plasmid that encode genes for fimbrial assembly. The aafD promoter is located

immediately upstream of the aafD gene, which encodes the AAF/II chaperone protein, whilst the

afaB promoter is upstream of the afaB pseudogene, which is followed by functional aafC and aafB

genes, encoding the fimbrial usher protein and the fimbrial adhesin, respectively (Figs. 1B, 2A, 3A

and S4). It is of note that the level of expression from the aafD promoter is considerably higher than

that of afaB (Figs. 2 and 3) with the fold increase in RNA sequence reads for aafDA genes being

higher than that of the aafCB genes (Table S2). As the aafD promoter controls the expression of the

AafD chaperone and AafA fimbrial subunit, both of which are required in large amounts, in

comparison to the AafC usher protein and AafB adhesin, this regulation is likely to help ensure that

each component of the AAF/II fimbriae are made to the appropriate level. For the other AAF systems

examined (e.g AAF/I, AAF/III and AFF/IV) the fimbrial genes exist in a single operon and were

expressed from a strong upstream AggR-regulated promoter that had similar organization to the

EAEC 042 fimbrial promoters (Fig. 5A).

Previous studies have shown that DNA sites for AggR binding resemble sites for the Rns

‘master’ regulator from enterotoxicogenic E. coli (ETEC) (Munson, 2013) and, following studies of the

aggR promoter, a consensus sequence was also suggested for AggR, in which the importance of a

TATC motif and an A base, seven nucleotides upstream of this motif, was highlighted (Morin et al.,

2010). Thus, we first identified putative DNA sites for AggR by using this consensus. Based on the

promoters characterized here, we now propose a revised consensus logo for the AggR-binding site

and AggR-dependent promoters (Fig. 7). Note that, in our AggR-binding site consensus the upstream

A base, noted by Morin et al. (2010), is not always conserved (Fig. 5A and 7A). Indeed, using the aafD

promoter from EAEC 042, which has a G at this positon, we observed that any base can be tolerated

at this position, with only a small effect on AggR-dependent activation (Fig. S7). For each fimbrial

promoter, we found a single functional DNA site for AggR, located 21 to 22 base pairs upstream from

Acc

epte

d A

rtic

le


the promoter -10 element and this juxtaposition suggests that bound AggR must overlap the -35

element and is able to interact directly with Domain 4 of the RNA polymerase σ subunit. This is

consistent with AggR being a member of the AraC-XylS family of bacterial transcription factors, many

of which activate transcription initiation by making such a direct contact that serves to assist the

recruitment of RNA polymerase to the target promoter (Martin and Rosner, 2001; Egan, 2002;

Browning and Busby, 2004). It is also evident from our promoter logo that the DNA between AggR-

binding site and the -10 element contains phased A/T tracts (Fig. 7B), which is indicative of bent

DNA. Indeed, modelling of the aggD, aafD and afaB promoters suggests that AggR-dependent

promoters possess a bent promoter architecture (Fig. S8). Our experiment, where a single DNA site

for AggR was ‘transplanted’ into the context of the E. coli melR promoter, indicates that it is easy for

AggR-dependence to be conferred onto a target promoter (Fig. 6). Since AggR-binding sites are

relatively degenerate, essentially consisting of a conserved TATC motif with an upstream A/T tract, it

may be simple for the promoters expressing A/T-rich horizontally acquired genes, to become AggR-

dependent and assimilated into the AggR regulon.

As our transcriptomics data identified a number of genes that had not previously been

included in the AggR regulon (Fig. 1; Tables S2 and S3) (Morin et al., 2013) we used the information

from our AggR-dependent promoter logo (Fig. 7B) to interrogate the genes identified in our RNA-seq

data set. Thus, we were able to find AggR binding-sites and suitably positioned -10 promoter

elements (with a spacing of 21 to 23 bp) upstream of many leading genes in the transcription units

that we found to be AggR regulated on both pAA2 and the chromosome (Tables 1 and 2,

respectively). This analysis confirmed the organization of AggR-dependent promoters characterized

by this study (i.e. aggR, aatP, aap and aaiA) and it is of note that these promoter sequences are

conserved in other pathogenic EAEC strains, e.g. C227-11 and 55989, suggesting that these genes

are similarly regulated in these strains (Fig. S9).

AggR-dependent biofilm formation is a hallmark of EAEC infection and, in addition to the

expression of AAF fimbriae, other plasmid-encoded genes are required (e.g. EC042_pAA003,

EC042_pAA004 and shf) (Czeczulin et al., 1997; Morin et al., 2013; Fujiyama et al., 2008). Our

analysis indicates chromosomally-encoded genes, EC042_4006 (yicS) and bssS, are also AggR

regulated (Tables 2 and S3). Both genes have been implicated in biofilm formation in E. coli, whilst

YicS plays a role in pathogenicity in avian pathogenic E. coli (Verma et al., 2018; Domka et al., 2006).

Thus, it is likely that AggR deploys both specialised plasmid- and chromosomally-encoded factors to

ensure formation of its trademark biofilm.

Acc

epte

d A

rtic

le


Strikingly, AggR appears to control the expression of a number of transposases and

transposon remnants (Tables S2 and S3) and putative AggR-dependent promoters are located

upstream of these transcription units (Tables 1 and 2). This suggests that genomic rearrangements,

on both the chromosome and the pAA2 plasmid, may occur more frequently in EAEC 042 during the

initiation of the AggR virulence programme and lead to genome evolution, something which has

been observed in other bacterial species (Singh et al., 2014; Wan et al., 2017; Lindsay, 2014).

AggR belongs to a subgroup of AraC-XylS family members, which control virulence gene

regulation, and includes Rns/ CfaD/ CfaR from ETEC and VirF from Shigella flexneri. These family

members are highly similar and often interchangeable, for example Rns can replace VirF in S. flexneri

and CfaR can complement for the loss of AggR in EAEC (Porter et al., 1998; Nataro et al., 1994; Caron

and Scott, 1990). However, it is worth noting that this arrangement is not always reciprocal, as VirF

is unable to replace Rns in ETEC, and this might reflect subtle differences in the mechanisms by

which each regulator activates transcription (Porter et al., 1998). As well as directly activating

transcription, both Rns and VirF have been shown to activate at promoters by counteracting the

repressive effects of the heat-stable nucleoid structuring protein, H-NS, which silences many

horizontally acquired genes (Jordi et al., 1992; Tobe et al., 1993; Murphree et al., 1997; Singh et al.,

2016). Experiments, which examined AggR-dependent activation at the afaB and aafD promoters in

an hns null strain (Fig. S10), indicated that, although H-NS marginally represses both promoters,

AggR still substantially activates transcription in the absence of H-NS. Consistent with this, a recent

transcriptomic analysis in EAEC 042 indicated that neither afaB nor aafD were derepressed by the

absence of H-NS or its homologue H-NS2 (EC042_2824) (Prieto et al., 2018). Therefore, we propose

that, at the afaB and aafD promoters, AggR primarily activates transcription by directly interacting

with RNA polymerase rather than alleviating H-NS repression.

To characterize AggR-dependent promoters, we, as have others, used a simple two-plasmid

system with a laboratory strain of E. coli K-12 as host (Dudley et al., 2006; Morin et al., 2010). As

expected for promoters that control the expression of virulence determinants, coupling of

expression to AggR is tight, with high induction ratios. For some AraC-XylS family members that

control bacterial virulence, specific host-derived signals are often sensed by the protein, which

modulates the transcription factors activity (Yang et al., 2009; Childers et al., 2011). However,

neither temperature nor specific molecules, such as bicarbonate ions or bile salts, seem to play a

major role in AggR-dependent activation (Morin et al., 2013) (Table S6). Thus, it is unclear what

signal, if any, is sensed by AggR, especially as we were able to observe AggR-dependent activation in

laboratory E. coli K-12, without any special induction conditions. It is of note that in EAEC, AggR

Acc

epte

d A

rtic

le


activity is controlled by the Aar repressor protein (Santiago et al., 2014), which could explain why we

were able to detect AggR-dependent activity in its absence. Thus, it is clear that understanding the

signal and mechanism by which the AggR-mediated regulation is initiated in EAEC strains will be key

to understanding and designing small molecule inhibitors which can short-circuit virulence in this

important E. coli pathotype.

Experimental Procedures

Bacterial strains, plasmids, primers and growth conditions

The bacterial strains, plasmids and promoter fragments used in this study are listed in Table S1. The

oligonucleotide primers used for primer extension analysis and to amplify and mutate the various

DNA fragments are listed in Table S7. Standard procedures for PCR, cloning and DNA manipulation

were used throughout (Sambrook and Russell, 2001). All DNA fragments used in this study are

flanked by EcoRI and HindIII sites and the DNA sequence of each fragment is numbered from the

base adjacent to the HindIII site. Base substitutions are defined by the position of the nucleotide

base altered and the substituted base introduced. Cells were routinely grown in Lysogeny Broth (LB

medium) at 37ºC with shaking. To measure promoter activities, fragments were cloned into the lac

expression vector pRW50 (Lodge et al., 1992) and maintained with 15 g ml-1 tetracycline. To

examine the effect of aggR expression, cells were transformed with either pBAD/aggR or pBAD24,

which were maintained in cells with 100 µg ml-1 ampicillin or carbenicillin. AggR expression, using

pBAD/aggR, was induced by the inclusion of 0.2% w/v arabinose in the medium, where appropriate

(Sheikh et al., 2002).

RNA isolation, rRNA depletion and cDNA synthesis for RNA-seq

Triplicate overnight cultures of EAEC 042 and EAEC 042 aggR were used to inoculate 50 ml of

Dulbecco’s modified Eagle’s medium with 0.45% glucose (DMEM high glucose) (Sigma) to an OD600 of

0.05. Cultures were grown at 37ºC with shaking to an OD600 of 0.6. RNA was isolated using an RNeasy

Mini Kit (Qiagen) and contaminating DNA was removed using an RNase-free DNase kit (Qiagen). The

quality of the RNA was checked using an Agilent RNA 6000 Nano Chip (Agilent Technologies). RNA

samples with a RIN (RNA integrity number) above 8 were then used for RNA-seq. A total of 3.5 g of

isolated RNA was used for each sample for rRNA depletion using a Ribo-Zero™ rRNA Removal Kit for

bacteria (Illumina). Successful rRNA depletion was confirmed using an Agilent RNA 6000 Pico Chip

Acc

epte

d A

rtic

le


(Agilent Technologies). The TruSeq® Stranded mRNA LT Sample Prep Kit (Illumina) was used to

produce cDNA libraries, which were sequenced using a MiSeq Desktop Sequencer (Illumina). Raw

sequence data was deposited under accession number PRJEB27566.

Differential gene expression analysis

Sequencing reads were filtered using Trimmomatic-0.36 and reads that did not pass the filter were

discarded (Bolger et al., 2014). Filtered reads were aligned using Burrows-Wheeler aligner to the

EAEC 042 chromosome (FN554766.1) and the EAEC 042 pAA2 plasmid (FN554767.1) (Li and Durbin,

2010; Chaudhuri et al., 2010). The alignment of reads to genes was counted using featureCounts

(Liao et al., 2014). DESeq2 was used to determine differentially expressed genes (Love et al., 2014).

Genes were termed differentially expressed if there was a >1 log2-fold difference and an adjusted p-

value < 1E–5 between wild type EAEC 042 and the ΔaggR mutant.

qRT-PCR

For qRT-PCR analysis, overnight cultures of EAEC 042 pBAD24, EAEC 042 aggR pBAD24 and EAEC

042 aggR pBAD/aggR, in triplicate, were used to inoculate 4 ml DMEM high glucose supplemented

with 100 g ml-1 carbenicillin to a final OD600 of 0.05. Cultures were grown at 37ºC with shaking as

described above. At an OD600 of 0.4, L-arabinose was added to a final concentration of 2%. Cultures

were grown for 1 hour and RNA was extracted as described above. DNA was removed using TURBO

DNA-free™ (Ambion). RNA was reverse transcribed to cDNA using the Tetro cDNA Synthesis Kit

(Bioline). Reactions for qRT-PCR were prepared using the manufacturer’s instructions for the Brilliant

III Ultra-Fast SYBR® Green QPCR Master Mix (Agilent Technologies) and primers are detailed in Table

S7. Relative gene expression was calculated using the 2–CT method (Livak and Schmittgen, 2001),

with the polA gene used as a reference.

Motility assays

Triplicate cultures of EAEC 042 ΔaggR pBAD24 and EAEC 042 ΔaggR pBAD/aggR were grown from

overnight cultures to an OD600 of 1, each culture was inoculated into the centre of LB 0.25% agar

plate supplemented with 0.2% L-arabinose and incubated for 16 hours at 37ºC. Plates were assessed

for a difference in motility.

Acc

epte

d A

rtic

le


Promoter fragment and plasmid construction

The promoter fragments aafD100, afaB100, aggD100, aap100, aatP100 and aaiA100 were amplified

by PCR using the primer pairs listed in Table S7 with EAEC 042 or EAEC 17-2 genomic DNA as

template. The aggD101, agg3D100 and agg4D100 promoter fragments from EAEC strains C227-11,

55989 and C1010-00, respectively, were synthesized by Invitrogen Life Technologies. All DNA

fragments are flanked by EcoRI and HindIII sites to facilitate cloning into pRW50 to generate lacZ

transcriptional fusions. For shorter fragments, amplification was carried out using pRW50/aafD100,

pRW50/afaB100 and pRW50/aggD100 as a template with the respective primers detailed in Table

S7. Point mutations were introduced into fragments using megaprimer PCR, when necessary (Sarkar

and Sommer, 1990). All constructs were verified by Sanger DNA sequencing.

Bioinformatic analysis of DNA sequences

DNA target sites for the binding of AggR and the closely related Rns protein have been previously

investigated, using in vivo and in vitro approaches (Morin et al., 2010; Munson, 2013). From these

studies, it has been proposed that the potential AggR-binding site consensus sequence is 5-

AnnnnnnTATC-3. Thus, based on this consensus, promoter fragments were screened for potential

AggR-binding sites on both strands, allowing for one mismatch to this consensus sequence. When

predicted sites were found not to be necessary for AggR-mediated regulation, as judged by deletion

analysis, they were discounted. Potential AggR-binding sequences, present in the smallest AggR-

regulated fragment, were then investigated using mutational analysis to identify the functional site.

The WebLogo motifs for the AggR-binding site consensus sequence and AggR-dependent

promoter organization were generated by the WebLogo server

(http://weblogo.berkeley.edu/logo.cgi) (Crooks et al., 2004) using sequences from the EAEC 042

aafD, afaB, aap, aatP, aaiA and aggR promoters, the EAEC 17-2 aagD promoter, the EAEC 55989

aag3D promoter and the EAEC C1010-00 aag4D promoter (Fig. 5) (Yasir, 2017; Morin et al., 2010).

The 3D models of DNA promoter architecture, for the EAEC 17-2 aggD and EAEC 042 aafD and afaB

promoters, were produced by the model.it server using standard parameters

(http://pongor.itk.ppke.hu/dna/model_it.html#/modelit_intro) (Munteanu et al., 1998) and PyMOL

(Schrodinger, 2010).

Acc

epte

d A

rtic

le


To identify AggR-dependent promoters from our RNA-seq data (Tables S2 and Table S3) 600

bp of DNA upstream of the first gene in each operon was searched for AggR-binding sites, using the

consensus sequence WWWWWWWTATC (Fig. 7A), only allowing two mismatches in the A/T rich

tract and no mismatches in the conserved TATC motif. The presence of a -10 element was then

examined by determining if there was a suitable match to the -10 region consensus sequence

(TGnTATAAT) at a spacing of 21 to 23 bp, ensuring that first A in the -10 hexamer was present, as this

is an important determinant of promoter strength (Browning and Busby, 2004).

Assays of promoter activity

To assay the expression from promoter derivatives cloned into the lac expression vector pRW50,

E. coli K-12 BW25113 lac strain was transformed with each construct and -galactosidase activity

was measured as described in our previous work (Jayaraman et al., 1987). AggR was expressed from

pBAD/aggR, which carries aggR cloned downstream of the arabinose inducible promoter, paraBAD

(Sheikh et al., 2002). Cells were grown in LB medium at 37°C with shaking to mid-logarithmic phase

(OD650 = 0.4-0.6) and 0.2% w/v arabinose was included in the medium to induce AggR expression,

where appropriate. -galactosidase activities are expressed as nmol of ONPG hydrolysed min-1 mg-1

dry cell mass and each activity is the average of three independent determinations.

Primer extension assay

Primer extension analysis was carried our as described in our previous work (Lloyd et al., 2008).

E. coli K-12 BW25113 cells, carrying various pRW50 derivatives and either pBAD/aggR or pBAD24,

were grown in LB medium, containing 0.2% w/v arabinose, until mid-logarithmic phase. RNA was

extracted using an RNeasy Kit (Qiagen) and hybridized to 32P end-labelled D49724 primer, which

corresponds to sequence downstream of the HindIII site in pRW50 (Table S7). Primer extension

products were run on a 6% denaturing polyacrylamide gel, containing 1 x TBE, and were analysed

using a Bio-Rad Molecular Imager FX and Quantity One software (Bio-Rad). Gels were calibrated

using an M13 sequence ladder, which was generated using a T7 sequencing kit (USB) with single

stranded M13mp18 phage DNA and the M13 Universal Primer (Table S7).

Acc

epte

d A

rtic

le


Acknowledgements

This work was generously supported by a Darwin Trust of Edinburgh PhD studentship to MY and by

the Industrial Biotechnology Catalyst (Innovate UK, BBSRC, EPSRC) to support the translation,

development and commercialization of innovative Industrial Biotechnology processes.

Conflict of Interest

The authors declare no conflict of interest.

Author Contributions

DFB, SJWB, MP, IRH and MY conceived and designed the research project. MY, CI, RA and REG

performed the experiments, aided by DFB, JRH and PS. MY, CI, SJWB, IRH and DFB wrote the

manuscript with input from all authors.

References

Adachi, J.A., Jiang, Z.D., Mathewson, J.J., Verenkar, M.P., Thompson, S., Martinez-Sandoval, F.,

Steffen, R., Ericsson, C.D. and DuPont, H.L. (2001) Enteroaggregative Escherichia coli as a

major etiologic agent in traveler's diarrhea in 3 regions of the world. Clin Infect Dis 32: 1706-

1709.

Bernier, C., Gounon, P. and Le Bouguenec, C. (2002) Identification of an aggregative adhesion fimbria

(AAF) type III-encoding operon in enteroaggregative Escherichia coli as a sensitive probe for

detecting the AAF-encoding operon family. Infect Immun 70: 4302-4311.

Boisen, N., Melton-Celsa, A.R., Scheutz, F., O'Brien, A.D. and Nataro, J.P. (2015) Shiga toxin 2a and

Enteroaggregative Escherichia coli--a deadly combination. Gut Microbes 6: 272-278.

Boisen, N., Struve, C., Scheutz, F., Krogfelt, K.A. and Nataro, J.P. (2008) New adhesin of

enteroaggregative Escherichia coli related to the Afa/Dr/AAF family. Infect Immun 76: 3281-

3292.

Bolger, A.M., Lohse, M. and Usadel, B. (2014) Trimmomatic: a flexible trimmer for Illumina sequence

data. Bioinformatics 30: 2114-2120.

Browning, D.F. and Busby, S.J. (2004) The regulation of bacterial transcription initiation. Nat Rev

Microbiol 2: 57-65.

Browning, D.F. and Busby, S.J. (2016) Local and global regulation of transcription initiation in

Acc

epte

d A

rtic

le


bacteria. Nat Rev Microbiol 14: 638-650.

Caron, J. and Scott, J.R. (1990) A rns-like regulatory gene for colonization factor antigen I (CFA/I) that

controls expression of CFA/I pilin. Infect Immun 58: 874-878.

Chaudhuri, R.R., Sebaihia, M., Hobman, J.L., Webber, M.A., Leyton, D.L., Goldberg, M.D.,

Cunningham, A.F., Scott-Tucker, A., Ferguson, P.R., Thomas, C.M., Frankel, G., Tang, C.M.,

Dudley, E.G., Roberts, I.S., Rasko, D.A., Pallen, M.J., Parkhill, J., Nataro, J.P., Thomson, N.R.

and Henderson, I.R. (2010) Complete genome sequence and comparative metabolic profiling

of the prototypical enteroaggregative Escherichia coli strain 042. PLoS One 5: e8801.

Childers, B.M., Cao, X., Weber, G.G., Demeler, B., Hart, P.J. and Klose, K.E. (2011) N-terminal residues

of the Vibrio cholerae virulence regulatory protein ToxT involved in dimerization and

modulation by fatty acids. J Biol Chem 286: 28644-28655.

Crooks, G.E., Hon, G., Chandonia, J.M. and Brenner, S.E. (2004) WebLogo: a sequence logo

generator. Genome Res 14: 1188-1190.

Czeczulin, J.R., Balepur, S., Hicks, S., Phillips, A., Hall, R., Kothary, M.H., Navarro-Garcia, F. and

Nataro, J.P. (1997) Aggregative adherence fimbria II, a second fimbrial antigen mediating

aggregative adherence in enteroaggregative Escherichia coli. Infect Immun 65: 4135-4145.

Domka, J., Lee, J. and Wood, T.K. (2006) YliH (BssR) and YceP (BssS) regulate Escherichia coli K-12

biofilm formation by influencing cell signaling. Appl Environ Microbiol 72: 2449-2459.

Dudley, E.G., Thomson, N.R., Parkhill, J., Morin, N.P. and Nataro, J.P. (2006) Proteomic and

microarray characterization of the AggR regulon identifies a pheU pathogenicity island in

enteroaggregative Escherichia coli. Mol Microbiol 61: 1267-1282.

Durrer, P., Zbinden, R., Fleisch, F., Altwegg, M., Ledergerber, B., Karch, H. and Weber, R. (2000)

Intestinal infection due to enteroaggregative Escherichia coli among human

immunodeficiency virus-infected persons. J Infect Dis 182: 1540-1544.

Egan, S.M. (2002) Growing repertoire of AraC/XylS activators. J Bacteriol 184: 5529-5532.

Elias, W.P., Jr., Czeczulin, J.R., Henderson, I.R., Trabulsi, L.R. and Nataro, J.P. (1999) Organization of

biogenesis genes for aggregative adherence fimbria II defines a virulence gene cluster in

enteroaggregative Escherichia coli. J Bacteriol 181: 1779-1785.

Estrada-Garcia, T. and Navarro-Garcia, F. (2012) Enteroaggregative Escherichia coli pathotype: a

genetically heterogeneous emerging foodborne enteropathogen. FEMS Immunol Med

Microbiol 66: 281-298.

Fasano, A., Noriega, F.R., Liao, F.M., Wang, W. and Levine, M.M. (1997) Effect of shigella enterotoxin

1 (ShET1) on rabbit intestine in vitro and in vivo. Gut 40: 505-511.

Franca, F.L., Wells, T.J., Browning, D.F., Nogueira, R.T., Sarges, F.S., Pereira, A.C., Cunningham, A.F.,

Lucheze, K., Rosa, A.C., Henderson, I.R. and de Luna, M. (2013) Genotypic and phenotypic

characterisation of enteroaggregative Escherichia coli from children in Rio de Janeiro, Brazil.

Acc

epte

d A

rtic

le


PLoS One 8: e69971.

Frank, C., Werber, D., Cramer, J.P., Askar, M., Faber, M., an der Heiden, M., Bernard, H., Fruth, A.,

Prager, R., Spode, A., Wadl, M., Zoufaly, A., Jordan, S., Kemper, M.J., Follin, P., Muller, L.,

King, L.A., Rosner, B., Buchholz, U., Stark, K. and Krause, G. (2011) Epidemic profile of Shiga-

toxin-producing Escherichia coli O104:H4 outbreak in Germany. N Engl J Med 365: 1771-

1780.

Fujiyama, R., Nishi, J., Imuta, N., Tokuda, K., Manago, K. and Kawano, Y. (2008) The shf gene of a

Shigella flexneri homologue on the virulent plasmid pAA2 of enteroaggregative Escherichia

coli 042 is required for firm biofilm formation. Curr Microbiol 56: 474-480.

Harada, T., Hiroi, M., Kawamori, F., Furusawa, A., Ohata, K., Sugiyama, K. and Masuda, T. (2007) A

food poisoning diarrhea outbreak caused by enteroaggregative Escherichia coli serogroup

O126:H27 in Shizuoka, Japan. Jpn J Infect Dis 60: 154-155.

Harrington, S.M., Dudley, E.G. and Nataro, J.P. (2006) Pathogenesis of enteroaggregative Escherichia

coli infection. FEMS Microbiol Lett 254: 12-18.

Harrington, S.M., Sheikh, J., Henderson, I.R., Ruiz-Perez, F., Cohen, P.S. and Nataro, J.P. (2009) The

Pic protease of enteroaggregative Escherichia coli promotes intestinal colonization and

growth in the presence of mucin. Infect Immun 77: 2465-2473.

Henderson, I.R., Hicks, S., Navarro-Garcia, F., Elias, W.P., Philips, A.D. and Nataro, J.P. (1999)

Involvement of the enteroaggregative Escherichia coli plasmid-encoded toxin in causing

human intestinal damage. Infect Immun 67: 5338-5344.

Henderson, I.R., Meehan, M. and Owen, P. (1997) A novel regulatory mechanism for a novel phase-

variable outer membrane protein of Escherichia coli. Adv Exp Med Biol 412: 349-355.

Herzog, K., Engeler Dusel, J., Hugentobler, M., Beutin, L., Sagesser, G., Stephan, R., Hachler, H. and

Nuesch-Inderbinen, M. (2014) Diarrheagenic enteroaggregative Escherichia coli causing

urinary tract infection and bacteremia leading to sepsis. Infection 42: 441-444.

Itoh, Y., Nagano, I., Kunishima, M. and Ezaki, T. (1997) Laboratory investigation of enteroaggregative

Escherichia coli O untypeable:H10 associated with a massive outbreak of gastrointestinal

illness. J Clin Microbiol 35: 2546-2550.

Jayaraman, P.S., Peakman, T.C., Busby, S.J., Quincey, R.V. and Cole, J.A. (1987) Location and

sequence of the promoter of the gene for the NADH-dependent nitrite reductase of

Escherichia coli and its regulation by oxygen, the Fnr protein and nitrite. J Mol Biol 196: 781-

788.

Jonsson, R., Struve, C., Boisen, N., Mateiu, R.V., Santiago, A.E., Jenssen, H., Nataro, J.P. and Krogfelt,

K.A. (2015) Novel aggregative adherence fimbria variant of enteroaggregative Escherichia

coli. Infect Immun 83: 1396-1405.

Jordi, B.J., Dagberg, B., de Haan, L.A., Hamers, A.M., van der Zeijst, B.A., Gaastra, W. and Uhlin, B.E.

(1992) The positive regulator CfaD overcomes the repression mediated by histone-like

Acc

epte

d A

rtic

le


protein H-NS (H1) in the CFA/I fimbrial operon of Escherichia coli. Embo j 11: 2627-2632.

Knutton, S., Adu-Bobie, J., Bain, C., Phillips, A.D., Dougan, G. and Frankel, G. (1997) Down regulation

of intimin expression during attaching and effacing enteropathogenic Escherichia coli

adhesion. Infect Immun 65: 1644-1652.

Korobkova, E., Emonet, T., Vilar, J.M., Shimizu, T.S. and Cluzel, P. (2004) From molecular noise to

behavioural variability in a single bacterium. Nature 428: 574-578.

Li, H. and Durbin, R. (2010) Fast and accurate long-read alignment with Burrows-Wheeler transform.

Bioinformatics 26: 589-595.

Liao, Y., Smyth, G.K. and Shi, W. (2014) featureCounts: an efficient general purpose program for

assigning sequence reads to genomic features. Bioinformatics 30: 923-930.

Lindsay, J.A. (2014) Evolution of Staphylococcus aureus and MRSA during outbreaks. Infect Genet

Evol 21: 548-553.

Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression data using real-time

quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-408.

Lloyd, G.S., Hollands, K., Godfrey, R.E. and Busby, S.J. (2008) Transcription initiation in the

Escherichia coli K-12 malI-malX intergenic region and the role of the cyclic AMP receptor

protein. FEMS Microbiol Lett 288: 250-257.

Lodge, J., Fear, J., Busby, S., Gunasekaran, P. and Kamini, N.R. (1992) Broad host range plasmids

carrying the Escherichia coli lactose and galactose operons. FEMS Microbiol Lett 74: 271-276.

Love, M.I., Huber, W. and Anders, S. (2014) Moderated estimation of fold change and dispersion for

RNA-seq data with DESeq2. Genome Biol 15: 550.

Martin, R.G. and Rosner, J.L. (2001) The AraC transcriptional activators. Curr Opin Microbiol 4: 132-

137.

Morin, N., Santiago, A.E., Ernst, R.K., Guillot, S.J. and Nataro, J.P. (2013) Characterization of the AggR

Regulon in Enteroaggregative Escherichia coli. Infect Immun 81: 122-132.

Morin, N., Tirling, C., Ivison, S.M., Kaur, A.P., Nataro, J.P. and Steiner, T.S. (2010) Autoactivation of

the AggR regulator of enteroaggregative Escherichia coli in vitro and in vivo. FEMS Immunol

Med Microbiol 58: 344-355.

Munson, G.P. (2013) Virulence regulons of enterotoxigenic Escherichia coli. Immunol Res 57: 229-

236.

Munteanu, M.G., Vlahovicek, K., Parthasarathy, S., Simon, I. and Pongor, S. (1998) Rod models of

DNA: sequence-dependent anisotropic elastic modelling of local bending phenomena.

Trends Biochem Sci 23: 341-347.

Murphree, D., Froehlich, B. and Scott, J.R. (1997) Transcriptional control of genes encoding CS1 pili:

negative regulation by a silencer and positive regulation by Rns. J Bacteriol 179: 5736-5743.

Acc

epte

d A

rtic

le


Nataro, J.P., Mai, V., Johnson, J., Blackwelder, W.C., Heimer, R., Tirrell, S., Edberg, S.C., Braden, C.R.,

Glenn Morris, J., Jr. and Hirshon, J.M. (2006) Diarrheagenic Escherichia coli infection in

Baltimore, Maryland, and New Haven, Connecticut. Clin Infect Dis 43: 402-407.

Nataro, J.P., Yikang, D., Yingkang, D. and Walker, K. (1994) AggR, a transcriptional activator of

aggregative adherence fimbria I expression in enteroaggregative Escherichia coli. J Bacteriol

176: 4691-4699.

Nishi, J., Sheikh, J., Mizuguchi, K., Luisi, B., Burland, V., Boutin, A., Rose, D.J., Blattner, F.R. and

Nataro, J.P. (2003) The export of coat protein from enteroaggregative Escherichia coli by a

specific ATP-binding cassette transporter system. J Biol Chem 278: 45680-45689.

Okeke, I.N., Lamikanra, A., Czeczulin, J., Dubovsky, F., Kaper, J.B. and Nataro, J.P. (2000)

Heterogeneous virulence of enteroaggregative Escherichia coli strains isolated from children

in Southwest Nigeria. J Infect Dis 181: 252-260.

Olesen, B., Scheutz, F., Andersen, R.L., Menard, M., Boisen, N., Johnston, B., Hansen, D.S., Krogfelt,

K.A., Nataro, J.P. and Johnson, J.R. (2012) Enteroaggregative Escherichia coli O78:H10, the

cause of an outbreak of urinary tract infection. J Clin Microbiol 50: 3703-3711.

Porter, M.E., Smith, S.G. and Dorman, C.J. (1998) Two highly related regulatory proteins, Shigella

flexneri VirF and enterotoxigenic Escherichia coli Rns, have common and distinct regulatory

properties. FEMS Microbiol Lett 162: 303-309.

Prieto, A., Bernabeu, M., Aznar, S., Ruiz-Cruz, S., Bravo, A., Queiroz, M.H. and Juarez, A. (2018)

Evolution of Bacterial Global Modulators: Role of a Novel H-NS Paralogue in the

Enteroaggregative Escherichia coli Strain 042. mSystems 3.

Rasko, D.A., Webster, D.R., Sahl, J.W., Bashir, A., Boisen, N., Scheutz, F., Paxinos, E.E., Sebra, R., Chin,

C.S., Iliopoulos, D., Klammer, A., Peluso, P., Lee, L., Kislyuk, A.O., Bullard, J., Kasarskis, A.,

Wang, S., Eid, J., Rank, D., Redman, J.C., Steyert, S.R., Frimodt-Moller, J., Struve, C., Petersen,

A.M., Krogfelt, K.A., Nataro, J.P., Schadt, E.E. and Waldor, M.K. (2011) Origins of the E. coli

strain causing an outbreak of hemolytic-uremic syndrome in Germany. N Engl J Med 365:

709-717.

Rohde, H., Qin, J., Cui, Y., Li, D., Loman, N.J., Hentschke, M., Chen, W., Pu, F., Peng, Y., Li, J., Xi, F., Li,

S., Li, Y., Zhang, Z., Yang, X., Zhao, M., Wang, P., Guan, Y., Cen, Z., Zhao, X., Christner, M.,

Kobbe, R., Loos, S., Oh, J., Yang, L., Danchin, A., Gao, G.F., Song, Y., Li, Y., Yang, H., Wang, J.,

Xu, J., Pallen, M.J., Wang, J., Aepfelbacher, M. and Yang, R. (2011) Open-source genomic

analysis of Shiga-toxin-producing E. coli O104:H4. N Engl J Med 365: 718-724.

Sambrook, J. and Russell, D.W., (2001) Molecular cloning : a laboratory manual. Cold Spring Harbor

Laboratory Press, Cold Spring Harbor, N.Y.

Santiago, A.E., Ruiz-Perez, F., Jo, N.Y., Vijayakumar, V., Gong, M.Q. and Nataro, J.P. (2014) A large

family of antivirulence regulators modulates the effects of transcriptional activators in

Gram-negative pathogenic bacteria. PLoS Pathog 10: e1004153.

Sarantuya, J., Nishi, J., Wakimoto, N., Erdene, S., Nataro, J.P., Sheikh, J., Iwashita, M., Manago, K.,

Acc

epte

d A

rtic

le


Tokuda, K., Yoshinaga, M., Miyata, K. and Kawano, Y. (2004) Typical enteroaggregative

Escherichia coli is the most prevalent pathotype among E. coli strains causing diarrhea in

Mongolian children. J Clin Microbiol 42: 133-139.

Sarkar, G. and Sommer, S.S. (1990) The "megaprimer" method of site-directed mutagenesis.

Biotechniques 8: 404-407.

Savarino, S.J., Fasano, A., Robertson, D.C. and Levine, M.M. (1991) Enteroaggregative Escherichia coli

elaborate a heat-stable enterotoxin demonstrable in an in vitro rabbit intestinal model. J Clin

Invest 87: 1450-1455.

Savarino, S.J., Fox, P., Deng, Y. and Nataro, J.P. (1994) Identification and characterization of a gene

cluster mediating enteroaggregative Escherichia coli aggregative adherence fimbria I

biogenesis. J Bacteriol 176: 4949-4957.

Schrodinger, LLC, (2010) The PyMOL Molecular Graphics System, Version 1.3r1.

Sheikh, J., Czeczulin, J.R., Harrington, S., Hicks, S., Henderson, I.R., Le Bouguenec, C., Gounon, P.,

Phillips, A. and Nataro, J.P. (2002) A novel dispersin protein in enteroaggregative Escherichia

coli. J Clin Invest 110: 1329-1337.

Sheikh, J., Hicks, S., Dall'Agnol, M., Phillips, A.D. and Nataro, J.P. (2001) Roles for Fis and YafK in

biofilm formation by enteroaggregative Escherichia coli. Mol Microbiol 41: 983-997.

Singh, G., Srinivasan, R., Cheng, J., Peng, Z., Fujimura, K., Baek, M.S., Panzer, A.R., Tringe, S.G., Chen,

F., Sorek, R., Weng, L., Bristow, J., Wiener-Kronish, J.P. and Lynch, S.V. (2014)

Rearrangement of a large novel Pseudomonas aeruginosa gene island in strains isolated

from a patient developing ventilator-associated pneumonia. J Clin Microbiol 52: 2430-2438.

Singh, K., Milstein, J.N. and Navarre, W.W. (2016) Xenogeneic Silencing and Its Impact on Bacterial

Genomes. Annu Rev Microbiol 70: 199-213.

Spudich, J.L. and Koshland, D.E., Jr. (1976) Non-genetic individuality: chance in the single cell. Nature

262: 467-471.

Tobe, T., Yoshikawa, M., Mizuno, T. and Sasakawa, C. (1993) Transcriptional control of the invasion

regulatory gene virB of Shigella flexneri: activation by VirF and repression by H-NS. J

Bacteriol 175: 6142-6149.

Verma, R., Rojas, T.C.G., Maluta, R.P., Leite, J.L., Nakazato, G. and de Silveira, W.D. (2018) Role of

hypothetical protein YicS in the pathogenicity of Avian Pathogenic Escherichia coli in vivo

and in vitro. Microbiol Res 214: 28-36.

Wan, T.W., Higuchi, W., Khokhlova, O.E., Hung, W.C., Iwao, Y., Wakayama, M., Inomata, N., Takano,

T., Lin, Y.T., Peryanova, O.V., Kojima, K.K., Salmina, A.B., Teng, L.J. and Yamamoto, T. (2017)

Genomic comparison between Staphylococcus aureus GN strains clinically isolated from a

familial infection case: IS1272 transposition through a novel inverted repeat-replacing

mechanism. PLoS One 12: e0187288.

Acc

epte

d A

rtic

le


Webster, C., Gaston, K. and Busby, S. (1988) Transcription from the Escherichia coli melR promoter is

dependent on the cyclic AMP receptor protein. Gene 68: 297-305.

Wilson, A., Evans, J., Chart, H., Cheasty, T., Wheeler, J.G., Tompkins, D. and Smith, H.R. (2001)

Characterisation of strains of enteroaggregative Escherichia coli isolated during the

infectious intestinal disease study in England. Eur J Epidemiol 17: 1125-1130.

Yang, J., Dogovski, C., Hocking, D., Tauschek, M., Perugini, M. and Robins-Browne, R.M. (2009)

Bicarbonate-mediated stimulation of RegA, the global virulence regulator from Citrobacter

rodentium. J Mol Biol 394: 591-599.

Yasir, M. (2017) Regulation of virulence determinants in enteroaggregative Escherichia coli.

Ph.D. Thesis. University of Birmingham, Birmingham, UK.

Zhao, S., Fung-Leung, W.P., Bittner, A., Ngo, K. and Liu, X. (2014) Comparison of RNA-Seq and

microarray in transcriptome profiling of activated T cells. PLoS One 9: e78644.

Acc

epte

d A

rtic

le


Table 1. Potential AggR-dependent promoters located on plasmid pAA2 from EAEC strain 042.

Gene Name Promoter sequence a Spacing Distance to

(bp) b start (bp) c

EC042_pAA003

CAGCAATTAACTATTGCTATAATAATATCTATTATTTTTTTTGTTTTGATTTATCATTTAATTTTTT

ATAGATAA 22 101

EC042_pAA003

ATCTATTATTTTTTTTGTTTTGATTTATCATTTAATTTTTTATAGATAAAATAACTTTTTGGTTTTT

AATATAGT 22 75

EC042_pAA005A

CAGCAATCAACTATTGCTATAATAATATCTATTTTTTGATTTATTTTGTTTTAGCATGTAAAAGTTT

AGAAAAAG 22 56

EC042_pAA006

TGTATATCAAAGAGTCAGTAATAATTATCCCTATAAAGCTAAGAGATAAAAAAACAAGAAATGCAAA

ATTCTGCC 22 481

aatP d

TTATTATCATAAACTTATAGTTATATATCCCTTAGTTATTAATAGTTGGGTACATTATATAGTGTTT

CCAATAAC 21 100

EC042_pAA019

ACATAAAAAGTGATCATGGCAATAATATCCGGAAATCTAGTAACTATGCTAAATTACAGGATGACTG

TTTTTCTA 22 370

EC042_pAA019

TAATTAAGCAATACTCATAAAATTATATCAAATATGATTTTTAGCTGTAATAACATTATCAGATGGA

ACGTGCAG 21 47

afaB d

TATTTTAATGATTCCGTGTTTTTATTATCATTATGTGACATTCCTGCACTGTATCTTTAATAGGTGG

GCTGGGCA 22 303

Acc

epte

d A

rtic

le


EC042_pAA033

CTAAATGCCTTCAATATATTGTATATATCAACCAATATGATAAAGTTATTCGTATTATTAACATTCA

GAACAATC 23 415

aafD d

TAAAGTCTGCACAGTGGTGTTTATTTATCTTTTTAGTAACTTTGTTTTAAGTAGCATATTAACTTAA

TCGTAAAA 22 75

EC042_pAA051

TTCAAGAATTACTTCAGATTTGATATATCTTATATCAAAGATCGAAAACAACAAAAAAATTATAGAG

TCAATTTA 22 493

EC042_pAA051

ATTACTTCAGATTTGATATATCTTATATCAAAGATCGAAAACAACAAAAAAATTATAGAGTCAATTT

ATATATCG 21 486

EC042_pAA051

AAAAAAATTATAGAGTCAATTTATATATCGGCTGTAAGCTTCTTTTCTGATAAAGTCAGAAACATAA

TCGAGAAA 21 441

EC042_pAA051

TAAAAGCCAATAAAAACATGTTTCATATCATTATTTGAGATTGCTATAAACATATTGAGATGGCTGA

AGTTGGTG 21 97

aggR d

ACGTATTTTATATGAGTTAAAAATATATCTTTTTATTGATAAGAGTTAGGTCATTCTAACGCAGATT

GCCTGATA 22 73

EC042_pAA053

GACAAATAAGGTTGGAGTCCAAAAATATCGTGCTCTAACCGAATGGGTTAAATAATATCTAGCTCTA

GCTAAAAT 21 314

aap d

ACACTCGATATATGTTGCTATTTTTTATCTGGCCGCAACTCTTATTTATGCTAGCCTTCTAAAAGGA

GGGGCGGC 22 134

aar

AGGGGGTCAGCTCACAAAATAAAGGTATCTTCCAGCACGGAGCAATAGACGTAACAATCACTTAAAA

AAACGGAG 22 179

Acc

epte

d A

rtic

le


aar

AAAAATCTACATTGTGTCATTATTCTATCCTTCCGATATCTTATCATGTTATAAATTCCAGAAAAGA

GAACATTG 22 48

EC042_pAA061

AGTGGCTGCGTTACGTCATTGAACATATCCAGGACTGGCCGGCAAACCGGGTACGCGATCTGTTGCC

CTGGAAAG 22 161

EC042_pAA061

AAAGTTGATCTGAGCTCTCAGTAAATATCAATACGGTTCTGACGAGCCGCTTACCAGCGACCAATCG

ATGAACGG 22 90

a Promoters were aligned to the AggR binding site consensus (WWWWWWWTATC), only allowing a

maximum of 2 mismatches within the A/T tract region, and the extended -10 region consensus

(TGnTATAAT). Each element is underlined and matches to each consensus are bold.

b Distance between the AggR binding site and the -10 hexamer element.

c Distance between the AggR binding site and the predicted translational start site of each gene.

d Characterized AggR-dependent promoter.

Acc

epte

d A

rtic

le


Table 2. Potential AggR-dependent promoters located on the chromosome of EAEC strain 042.

Gene Name Promoter sequence a Spacing Distance to

(bp) b start (bp) c

bssS

GTACGTTATGCCGCAGCGAATAATTTATCGGTTATTGGCGCAACAAAAGAAGATAAACAGCGCATTA

GCGAAATT 22 383

flgB

TGTGGCCTGCACATTAACCTGTAAATATCGTTTGTCGTTACCGCAGCGTGCCAACACATTCACATTG

CCCCACAG 22 408

cspI

ATGGTGTTCTGGTTTGTTACAAATTTATCTGAAGCAGTCATTGTTATAATTTTATTATTTGTACCTC

TTGAGATT 23 124

fliE

ACTGGTAGGCTTTGCTACCAGAAATTATCCGGGAGATGAAAATGTCAGCGATACAGGGGATTGAAGG

GGTTATCA 22 12

EC042_2219

TCTCCTTATACTAAAGAAATAATCATATCAAAATAAAAATTCACAACAGTGCAACATTAAAAAATAC

AACCAACA 23 491

EC042_2219

GGAGATAATATTATGTCAAAAAAAATATCAGCCATTGCTTATAACTCATTATATGTCAACATGGGTC

ACTATAAC 22 5

EC042_2249

CTTAGCCGATTTTCTGTAAGGATTTTATCGTGTCAGACACACTCCCCGGGACAACACTTCCCGACGA

CAATCACG 23 457

EC042_2249

TACCCTCAGCAGTTGTGGTTACGTTTATCTGGCTGTTTATCCGACGCCCGAAATGAAAAATTAACTC

TCCAGAAT 22 123

EC042_2249

TCACCACGCCACTTTTCCATTTTTATATCTGCATATCAGGAAAATCTTCAGTATGAAAACATTACCT

GTATTACC 22 23

Acc

epte

d A

rtic

le


EC042_3188

TCACTGACACTGATGTCTGTTTTATTATCGCCTTTATCTCTTCAGGCCGCGGATACCAGATCACGCA

GAGTATGA 22 24

EC042_4006

TGATGTGTTGTCAGTTTCACTTTTTTATCCTTTTTTTAATCGTTAACTGACTATAATGGCAAGATCA

CTACGATT 22 200

EC042_4430

TTTGTTTCATTAATTTTGTGAACTATATCACAATTGATTGTTTGTTAGCCAGATTAGGCCGTGACTT

TTATTGCC 22 286

EC042_4430

ATTCCTGTAGGAAATTAGTTTTGAATATCAATGAATTATTTTTATTCAGGTGACGATTAAAAAGGTA

TCAATTTC 22 154

EC042_4430

TTTATTCAGGTGACGATTAAAAAGGTATCAATTTCAAATCAGGCAAAAGTGCTATTTATACCGTAAG

ATTTATCT 23 114

aaiA d

GTTATATCATTAATCAGCAAAAATGTATCACATGCTCACTTTCTTTTTATGGTATCACTATATAGAA

TCCATGAA 23 237

a Promoters were aligned to the AggR binding site consensus (WWWWWWWTATC), only allowing a

maximum of 2 mismatches within the A/T tract region, and the extended -10 region consensus

(TGnTATAAT). Each element is underlined and matches to each consensus are bold.

b Distance between the AggR binding site and the -10 hexamer element.

c Distance between the AggR binding site and the predicted translational start site of each gene.

Sequence corresponding to the open reading frame of each gene is in red, where applicable.

d Characterized AggR-dependent promoter.

Acc

epte

d A

rtic

le


Figure Legends

Fig. 1. AggR-regulated genes in EAEC strain 042.

The figure shows the differential gene expression observed between wild type EAEC 042 and its

aggR mutant on A. the chromosome and B. plasmid pAA2, as determined by RNA-seq.

A. The data is displayed in rings from the outside inwards. The outermost red lines identify some of

the differentially expressed genes (which are labelled with their gene name or number), followed by

the base coordinates of the chromosome (labelled in Mb). The annotated genes of EAEC 042 are

indicated in the forward and reverse orientation (light blue and dark blue, respectively). The EAEC

042 chromosomal regions of difference (RODs) as identified by Chaudhuri et al. (2010) are presented

in orange. The inner most circle shows the log2 fold difference for each gene compared between

wild type EAEC 042 and the aggR mutant. Positively differential expressed genes are presented in

green and negatively differentially expressed genes are in red.

B. The rings depicting the data for plasmid pAA2 are the same as for the EAEC 042 chromosome in A.

Note that base numbering for pAA2 is in Kb.

Fig. 2. Analysis of the aafD100 promoter fragment from EAEC strain 042.

A. The panel shows the base sequence of the EAEC 042 aafD100 regulatory region fragment, which

includes the start of the aafD coding sequence. The sequence is flanked by upstream EcoRI and

downstream HindIII sites and is numbered from the base immediately upstream of the HindIII site.

The limits of the aafD99, aafD98, aafD97, aafD96, aafD95 and aafD94 nested deletions are indicated

by flags. The proposed promoter -10 hexamer element is underlined, the experimentally determined

transcript start sites are indicated by bent horizontal arrows and the initiating ATG codon is in bold.

Potential AggR-binding sites are indicated by horizontal arrows, with functional and non-functional

sites denoted by dark and light shading, respectively. Each site is aligned with the AggR-binding

consensus (Morin et al., 2010). The locations of the 65C and 92C/ 90C substitutions, which disrupt

the -10 element and the functional AggR-binding site, respectively, are shown.

B. The panel illustrates measured β-galactosidase activities in E. coli K-12 BW25113 ∆lac cells,

containing pRW50 carrying the aafD100 fragment, shortened derivatives, or no insert. Cells also

carried either pBAD/aggR (grey bars) or pBAD24 (black bars).

Acc

epte

d A

rtic

le


C. The panel shows an autoradiogram of a denaturing polyacrylamide gel run to determine the

primer extension products from RNA synthesis initiating at the aafD promoter in BW25113 cells

carrying pRW50/aafD96. AggR (+) and AggR (-) indicates cells carried pBAD/aggR or pBAD24.

Reactions are calibrated with the M13mp18 phage reference sequence (A, C, G and T), which serves

as sequence ladder. Primer extension products, produced in the presence of AggR, are indicated by

arrows.

D. The panel shows the β-galactosidase activities of BW25113 cells, containing pRW50 carrying

either the aafD96 fragment or mutant derivatives. Cells also carried either pBAD/aggR (grey bars) or

pBAD24 (black bars).

In panels B. and D. cells were grown in LB medium in presence (+) or absence (-) of 0.2% arabinose.

-galactosidase activities are expressed as nmol of ONPG hydrolysed min-1 mg-1 dry cell mass. Each

activity is the average of three independent determinations and standard deviations are shown for

all data points.

Fig. 3. Analysis of afaB100 promoter fragment from EAEC strain 042.

A. The panel shows the base sequence of the EAEC 042 afaB100 regulatory region fragment flanked

by upstream EcoRI and downstream HindIII sites. The sequence is numbered from the base

immediately upstream of the HindIII site. The limits of the afaB99, afaB98 and afaB97 nested

deletions are indicated by flags. The proposed -10 hexamer element is underlined and the

experimentally determined transcript start sites are indicated by bent horizontal arrows. Potential

AggR-binding sites are indicated by horizontal arrows, with functional and non-functional sites

denoted by dark and light shading, respectively. Each site is aligned with the AggR-binding consensus

(Morin et al., 2010). The location of the 293C and 320C/ 318C substitutions, which disrupt the -10

element and the functional AggR-binding site, respectively, is shown.

B. The panel illustrates measured β-galactosidase activities in E. coli K-12 BW25113 cells containing

pRW50, carrying the afaB100 fragment, shortened derivatives, or no insert. Cells also carried either

pBAD/aggR (grey bars) or pBAD24 (black bars).

C. The panel shows an autoradiogram of a denaturing polyacrylamide gel run to determine the

primer extension products from RNA initiating from the aafD promoter in BW25113 cells, carrying

pRW50/afaB100. AggR (+) and AggR (-) indicates cells carried pBAD/aggR or pBAD24. Reactions are

Acc

epte

d A

rtic

le


calibrated with the M13mp18 phage reference sequence (A, C, G and T), which serves as sequence

ladder. Primer extension products, produced in the presence of AggR, are indicated by arrows.

D. The panel shows the β-galactosidase activities in BW25113 cells containing pRW50 carrying either

the afaB100 fragment or mutant derivatives. Cells also carried either pBAD/aggR (grey bars) or


In panels B. and D. cells were grown in LB medium in presence (+) or absence (-) of 0.2% arabinose.



all data points.

Fig. 4. Analysis of aggD100 promoter fragment from EAEC strain 17-2.

A. The panel shows the base sequence of the EAEC 17-2 aggD100 regulatory region fragment, which

includes the start of the aggD coding sequence. The sequence is flanked by upstream EcoRI and

downstream HindIII sites and is numbered from the HindIII site. The limits of the aggD99, aggD98

and aggD97 nested deletions are indicated by flags. The proposed -10 hexamer element is

underlined and the initiating ATG codon is in bold. Potential AggR-binding sites are indicated by

horizontal arrows, with functional and non-functional sites denoted by dark and light shading,

respectively. Each site is aligned with the AggR-binding consensus (Morin et al., 2010). The location

of the 60C and 86C substitutions, which disrupt the -10 element and the functional AggR-binding

site, respectively, is shown.

B. The panel illustrates measurements of β-galactosidase expression in E. coli K-12 BW25113 ∆lac

cells, containing pRW50 carrying the aggD100 fragment, shortened derivatives, or no insert. The

cells also carried either pBAD/aggR (grey bars) or pBAD24 (black bars).

C. The panel shows the β-galactosidase activities of BW25113 cells containing pRW50 carrying either

the aggD98 fragment or mutant derivatives. Cells also carried either pBAD/aggR (grey bars) or


In panels B. and C. cells were grown in LB medium in presence (+) or absence (-) of 0.2% arabinose.



all data points.

Acc

epte

d A

rtic

le


Fig. 5. Analysis of EAEC 55989 agg3D100 and EAEC C1010-00 agg4D100 promoter fragments.

A. The panel shows the sequences of AggR-dependent fimbrial promoters investigated in this study.

The AggR-binding sites are bold type and the -10 hexamer elements are indicated by grey lines. The

underline double arrowheads mark the distance between AggR-binding sites and -10 hexamer

elements.

B. The panel illustrates the β-galactosidase activities of BW25113 cells containing pRW50 carrying

various agg3D100 and agg4D100 promoter derivatives, from EAEC strains 55989 and C1010-00. Cells

also carried either pBAD/aggR (grey bars) or pBAD24 (black bars) and were grown in LB medium in

presence (+) or absence (-) of 0.2% arabinose. -galactosidase activities are expressed as nmol of

ONPG hydrolysed min-1 mg-1 dry cell mass. Each activity is the average of three independent

determinations and standard deviations are shown for all data points. The 307C and 331C/ 333C

substitutions disrupt the -10 element and AggR-binding site, respectively, in the EAEC 55989

agg3D100 promoter fragment, whilst the 186C and 211C/ 213C substitutions disrupt the

corresponding sequences in the EAEC C1010-00 agg4D100 fragment (see Fig. S4).

Fig. 6. Construction and analysis of semi-synthetic AggR-dependent promoters.

A. The panel ilustrates the DNA sequence of the CCmelR promoter region and the DAM20, DAM21,

DAM22 and DAM23 promoter constructs. In these promoters, the AggR-binding site from the aafD

promoter has been transplanted at different distances from the -10 elements (20 bp to 23 bp). The

CRP-binding half-sites in the CCmelR promoter are italicized and underlined. Thick black lines

indicate the aafD promoter sequence transplanted, with the AggR-binding site in bold, and the -10

elements are indicated by grey lines. Sequence is numbered from the CCmelR promoter transcript

start site (+1).

B. The panel illustrates the measured β-galactosidase activities in BW25113 cells, containing pRW50

carrying the CCmelR and various DAM promoter derivatives. Cells also carried either pBAD/aggR

(grey bars) or pBAD24 (black bars). Cells were grown in LB medium in presence (+) or absence (-) of

0.2% arabinose. -galactosidase activities are expressed as nmol of ONPG hydrolysed min-1 mg-1 dry

cell mass. Each activity is the average of three independent determinations and standard deviations

are shown for all data points.

Acc

epte

d A

rtic

le


Fig. 7. The AggR-binding site consensus.

The figure shows motifs for: A. the AggR-binding site consensus sequence and B. AggR-dependent

promoter organization. Motifs were generated using the WebLogo server (Crooks et al., 2004) with

sequences from the EAEC 042 aafD and afaB promoters, the EAEC 17-2 aagD promoter, the EAEC

55989 aag3D promoter and the EAEC C1010-00 aag4D promoter identified by experiments in Figs. 2

to 5, the aap, aatP and aaiA promoters identified by similar experiments by Yasir (2017) and the

AggR binding site at the aggR promoter (Morin et al., 2010).

Acc

epte

d A

rtic

le


organization and architecture of aggr‐dependent promoters ... · transferred into the lac e. coli...

Documents