on the origin of species, really - insight cruiseson the origin of species, really mohamed noor duke...
TRANSCRIPT
![Page 1: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/1.jpg)
On the origin of species, Really
Mohamed Noor Duke University
![Page 2: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/2.jpg)
Life on our planet is highly diverse
• … but that life seems to exist in discrete “clusters” at multiple levels…
![Page 3: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/3.jpg)
We readily recognize these
clusters and see as “natural”
• Can see which “is
not like the others”
based on DNA or
appearance.
• How did these
clusters come
about?
![Page 4: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/4.jpg)
Common descent
• Darwin argued in 1859 book for “universal
common descent” of all life- this explains
the natural clustering we see
• Since then, the evidence for this idea has
expanded greatly, particularly with growth
of genetics
![Page 5: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/5.jpg)
Common descent of families
![Page 6: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/6.jpg)
Common descent of life
![Page 7: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/7.jpg)
Common descent at finer scale
![Page 8: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/8.jpg)
Kirk Cameron on evolution
"There is something called microevolution- this is very different. Microevolution is adaptation within a species. Look at dogs- you've got the tiny chihuahua and the great dane. They're very different, but they're both dogs. Or horses. You've got zebras and donkeys ... very different, but they're horses. Horses produce horses, and dogs produce dogs. Adaptation within a species is totally different than man evolving from an entirely different species."
![Page 9: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/9.jpg)
In reality, EVOLUTION has
two fundamental processes • Change within a lineage
• Formation of new lineages (associated with split of existing lineage)
![Page 10: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/10.jpg)
In reality, EVOLUTION has
two fundamental processes • Change within a lineage
• Formation of new lineages (associated with split of existing lineage)
![Page 11: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/11.jpg)
In reality, EVOLUTION has
two fundamental processes • Change within a lineage
• Formation of new lineages (associated with split of existing lineage)
![Page 12: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/12.jpg)
New lineage formation leads
to the diversity of life on Earth
Tree of animal life
![Page 13: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/13.jpg)
New lineage formation leads
to the diversity of life on Earth
Tree of animal life Twig of animal life
![Page 14: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/14.jpg)
How do new forms persist as
new species? • Organisms exist in discrete clusters- don’t
observe in nature all intermediate forms...
• Darwin addressed this only indirectly-
considered species and genera to be
extension of “varieties”
![Page 15: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/15.jpg)
How do new forms persist as
new species? • Organisms exist in discrete clusters- don’t
observe in nature all intermediate forms...
• Darwin addressed this only indirectly-
considered species and genera to be
extension of “varieties”
![Page 16: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/16.jpg)
Some big questions on
origin of species
• What keeps these clusters separated?
• What evolutionary processes cause the
clusters to form in the first place?
• What is the genetic basis of species
formation?
Today’s talk
![Page 17: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/17.jpg)
What is a “species”
anyway??? On a practical level, decide based on
appearance… but how different do you
have to be?
![Page 18: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/18.jpg)
What is a “species”
anyway??? On a practical level, decide based on
appearance… but how different do you
have to be?
![Page 19: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/19.jpg)
What is a “species”
anyway??? On a practical level, decide based on
appearance… but how different do you
have to be?
![Page 20: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/20.jpg)
Most widely used concept:
“gene pools”
• Groups of interbreeding natural
populations that do not exchange genes
with other such groups
– Termed the “Biological Species Concept”
![Page 21: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/21.jpg)
“Barrier traits” separate gene
pools in two ways 1) Interbreeding doesn’t happen at all
• Live in different parts of common
environment
• Breed at different times of day or different
seasons
• Just not attracted to each other
![Page 22: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/22.jpg)
“Barrier traits” separate gene
pools in two ways 1) Interbreeding doesn’t happen at all
• Live in different parts of common
environment
• Breed at different times of day or different
seasons
• Just not attracted to each other
![Page 23: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/23.jpg)
“Barrier traits” separate gene
pools in two ways 2) Whoops! Well, interbreeding does not
result in gene exchange for other reasons
• Sperm don’t fertilize eggs of other species
• Hybrids die early in life
• Hybrids live but are sterile (dead-ends)
![Page 24: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/24.jpg)
“Barrier traits” separate gene
pools in two ways 2) Whoops! Well, interbreeding does not
result in gene exchange for other reasons
• Sperm don’t fertilize eggs of other species
• Hybrids die early in life
• Hybrids live but are sterile (dead-ends)
![Page 25: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/25.jpg)
Example: habitat differences
• Rhagoletis fruit flies – Two races in North America: breed exclusively on
apple or hawthorn berries
– Survival & reproduction better on “own” host
– Genetic differences
![Page 26: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/26.jpg)
Example: habitat differences
• Rhagoletis fruit flies – Two races in North America: breed exclusively on
apple or hawthorn berries
– Survival & reproduction better on “own” host
– Genetic differences
– Apple race JUST formed in last 120 years- before
1600s, no apple trees in USA
![Page 27: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/27.jpg)
Example: timing differences
• Cicadas- some species emerge every
13 years, and some every 17 years
– Until that time, burrow underground and
eat off tree roots
– Then emerge, drop exoskeleton, and call
– Only overlap once every 221 years!
![Page 28: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/28.jpg)
Example: preference
differences • North American fruit flies Drosophila
pseudoobscura and D. persimilis co-occur
& look identical, but “sing” different songs
– Females reject males singing wrong song
![Page 29: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/29.jpg)
Example: fertilization
specificity • Red and pink abalone spawn at similar
times, but sperm only fertilize females of
same species
– Molecular genetic studies have identified
several of the proteins (on sperm and egg)
mediating this species-specific interaction
![Page 30: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/30.jpg)
Example: fertilization
specificity • Red and pink abalone spawn at similar
times, but sperm only fertilize females of
same species
– Molecular genetic studies have identified
several of the proteins (on sperm and egg)
mediating this species-specific interaction
![Page 31: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/31.jpg)
Example: hybrid sickly/ dead
• Intertidal copepods from northern and
southern California produce sickly hybrids
– This inviability is associated with defects in
their mitochondrial electron transport system-
their means of getting energy
– Specific genes known
![Page 32: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/32.jpg)
Example: hybrid sterile
• Liger- hybrid of lion father and tiger mother.
Probably doesn’t happen in nature since
don’t overlap ranges. Males usually sterile.
• Zonkey- usually hybrid of zebra father and
donkey mother. Found in South Africa.
Usually sterile (especially males).
![Page 33: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/33.jpg)
Barrier traits act together
• Very few cases where one looks at two species and only sees a single barrier trait separating them.
• Still debated among some evolutionary biologists whether some barrier traits are more common “earlier” in divergence process.
• BUT, since 1930’s, genetic studies of
species formation have focused on
studying these traits.
![Page 34: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/34.jpg)
… and these barriers are not
always perfect…
• Estimates suggest 10-25% of species
hybridize with other species, and most of
these exchange some genes
• This does NOT undermine their
usefulness or their effect- still keep parts
of genome “distinct” into clusters
![Page 35: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/35.jpg)
Hybridizing species can
exchange some genes but not
others A B
![Page 36: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/36.jpg)
Hybridizing species can
exchange some genes but not
others A B
![Page 37: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/37.jpg)
Some “hybrid zones” have
persisted for thousands of
years • Diagnosable clusters persist despite many generations of gene exchange
• Example: house mouse hybrid zone in SE Europe estimated ~6000 years old
• Some genes more freely across zone, others don’t
![Page 38: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/38.jpg)
-- Tricky areas --
• What if geographically separated?
• What if the groups are asexual?
• “How much” gene exchange is too much?
![Page 39: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/39.jpg)
Quick recap:
• Species defined as diagnosable groups that don’t exchange genes
• Gene exchange prevented by (one or) multiple “barrier traits”
• Gene exchange need not be reduced to zero for groups to be “species”, but need to be diagnosable
![Page 40: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/40.jpg)
Some big questions on
origin of species
• What keeps these clusters separated?
• What evolutionary processes cause
the clusters to form in the first place?
• What is the genetic basis of species
formation?
Today’s talk
![Page 41: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/41.jpg)
What makes new species
evolve? • Formation of barrier traits
• Cordoning off of some or all of genome
from gene exchange
![Page 42: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/42.jpg)
What makes new species
evolve? • Formation of barrier traits
• Cordoning off of some or all of genome
from gene exchange
• Random/ stochastic processes
• Natural selection acting directly on traits to
prevent gene exchange
• Natural selection incidentally forming traits
![Page 43: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/43.jpg)
Models of species formation
1. Geographic isolation
• A) One population
• B) Become separated by mountain range or stream
• C) Changes happen within populations on opposite sides
• D) Come back into contact but now different
![Page 44: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/44.jpg)
What made these “changes”
happen?
• New, random mutations arose in one population but not the other
• Environment different on the two sides, so different gene forms were favored by natural selection
• NOT selection for barrier effect specifically
![Page 45: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/45.jpg)
Concept
• Gene exchange is a “homogenizing force” in evolution
• If have long period of time with NO gene exchange, easier to diverge into two differentiated populations
![Page 46: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/46.jpg)
Concept
• Gene exchange is a “homogenizing force” in evolution
• If have long period of time with NO gene exchange, easier to diverge into two differentiated populations
![Page 47: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/47.jpg)
Evidence
• Many species boundaries match
geographic barriers (past or
present)
– Point Conception, CA: 21 species of
snails, algae, and barnacles have
ranges ending there, and close
relatives on other side
![Page 48: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/48.jpg)
Evidence
• Many species boundaries match
geographic barriers (past or
present)
– Point Conception, CA: 21 species of
snails, algae, and barnacles have
ranges ending there, and close
relatives on other side
• Experimental studies’
– Selection experiment
![Page 49: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/49.jpg)
Models of species formation
2. Geographic isolation, but
regain contact before
speciation
• A) One population
• B) Become separated by mountain range or stream
• C) Changes happen within populations on opposite sides
• D) Come back into contact but now a little different
• E) Continued divergence and formation of barrier traits
![Page 50: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/50.jpg)
Making hybrids is “bad”
• Anything that helps animals pass on their
genes favored by selection
• Species hybrids often sterile
• Producing sterile species hybrids costly
– Genes not passed on in sterile hybrids
– Waste gametes and parental efforts
![Page 51: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/51.jpg)
Making hybrids is “bad”
• Selection favors individuals who mate with
their own type
– Reduces breeding with other species ‘cuz bad
![Page 52: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/52.jpg)
Making hybrids is “bad”
• Selection favors individuals who mate with
their own type
– Reduces breeding with other species ‘cuz bad
• This selection only operates in populations
where you CAN mate with the
other species
![Page 53: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/53.jpg)
• Species that look exactly alike
• Hybrid males sterile (so bad at passing on
genes), hybrid females fertile
• Mate in nature, though not very much
• Native to North America and co-occur in
some areas
Noor’s PhD study (1995):
Drosophila pseudoobscura
D. persimilis
![Page 54: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/54.jpg)
Noor 1995
![Page 55: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/55.jpg)
High discrimination
Low discrimination
Noor 1995
![Page 56: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/56.jpg)
More Evidence
• Differences in sexually-preferred characters in areas enhanced where species overlap
– Pied & collared flycatcher
![Page 57: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/57.jpg)
Models of species formation
3. No geographic isolation
• A) One population
• B) See partitioning into distinct types, interbreeding
reduced
• C) Continued divergence and formation of barrier traits
![Page 58: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/58.jpg)
Why split?
• Distinct niches, filled by types in which
intermediates (or switchers) are less fit.
– Trade-offs in adaptation.
• Requires strong natural selection.
![Page 59: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/59.jpg)
Evidence
• Crater lake cichlids
– Lakes isolated
historically
– Diverse niches within
– Nearest relatives all in
same lake
![Page 60: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/60.jpg)
Evidence 2
• Lake stickleback forms
– Open water vs deep forms
– Distinct niches – hybrids ecologically inferior
– Preferentially mate with their own type
– *2 forms evolve repeatedly in different lakes*
![Page 61: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/61.jpg)
Diversity of answers…
• Can have natural selection incidentally
cause new species
• Can have natural selection directly drive
formation of new species
• Random processes can contribute
• How often each???
![Page 62: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/62.jpg)
Quick recap:
• From geographic patterns, can infer evolutionary
processes causing species splits
• Evidence for diverse modes of species
formation, and diverse roles of natural selection
or random processes
• Frequency uncertain- that’s the big question
now.
![Page 63: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/63.jpg)
Some big questions on
origin of species
• What keeps these clusters separated?
• What evolutionary processes cause the
clusters to form in the first place?
• What is the genetic basis of species
formation?
Today’s talk
![Page 64: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/64.jpg)
Genetics of species formation =
genetics of barrier traits
• By knowing genetic differences between
species causing barrier traits, can see
genetics of species formation
• … but can’t do genetics between species
(easily) since, by definition, can’t do a
“genetic cross”…
![Page 65: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/65.jpg)
Get around this problem
using incompletely separated
species • Again, barriers are not always “perfect”,
and sometimes weaker in lab than in
nature
• Often one sex is sterile/ dead (XY), and
can study the genetic basis of this by
crosses to the other sex
![Page 66: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/66.jpg)
Why are hybrids sterile???
• Hybrids only have the genes of their parent
species: rarely “new” genetic material
• No gene “functions” to cause sterility
– More likely disruption of a normal function
• Likely interactions between genetic material
from one species with genetic material from the
other
• Can map sterility within the genome through
genetic crosses
![Page 67: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/67.jpg)
• Genetic mapping by crosses seeks
to associate differences in “letters”
between individuals with traits
(e.g., eye color)
Individual 1
AAGGATCAGCAGCGACGACGCGGGACATCGAGCGA
Individual 2
ATGGATCAGCAGCGACGACGCGGGACATCGAGGGA
![Page 68: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/68.jpg)
Genetic mapping –
like a family tree
AA TT
AT AT AT AT AT AT TT
TT TT TT AT AT AT
Let’s look at eye color… if see right gene,
![Page 69: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/69.jpg)
Genetic mapping –
like a family tree
AA TT
AT AT AT AT AT AT TT
TT TT TT AT AT AT
Let’s look at eye color… if see right gene,
CC GG
CG CG CG CG CG CG GG
GG CG CG GG CG GG
… for a gene far from the eye color…
![Page 70: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/70.jpg)
Workhorses of genetics:
Drosophila fruit flies
• Thousands of species, including many
recently diverged
• Genome sequences
• Easy to rear/ cross
![Page 71: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/71.jpg)
Some results!
• Sterility often results from an interaction between genes on the “X” and genes elsewhere.
• The bad interaction from genes on the “X” is recessive (like blue eyes)- that’s why males (Xy) are more often sterile than females (XX).
![Page 72: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/72.jpg)
Some results!
• Sterility often results from an interaction between genes on the “X” and genes elsewhere.
• The bad interaction from genes on the “X” is recessive (like blue eyes)- that’s why males (Xy) are more often sterile than females (XX).
• Underlying genes unusually different in DNA sequence between species: suggests changes driven by natural selection.
![Page 73: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/73.jpg)
Darwin was right!
• Hybrid sterility “is not a specially endowed quality, but is
incidental on other acquired differences,” (p. 245) and is
caused by a hybrid's “organization having been
disturbed by two organizations having been
compounded into one” (p. 266).
• Natural selection appears to be a
major contributor.
• Also a major contributor to other
barrier traits.
![Page 74: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/74.jpg)
Quick recap:
• Sterility often results from an
interaction between genes on the “X”
and genes elsewhere.
• Natural selection seems to be
involved in driving these gene forms.
![Page 75: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/75.jpg)
IMPLICATIONS:
• Human-induced habitat destruction is
reducing the number of species worldwide
– Bad for humans in part because increases
vulnerability to flood & drought, crop failure,
spread of disease, and water contamination
• This research looks at the other end of the
process: species formation -> extinction
![Page 76: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/76.jpg)
IMPLICATIONS:
• Not just losing existing species, but losing
species that were “just beginning to form”
– Lake Victoria cichlids choose mates by
coloration
– Turbidity (human-induced) in water reducing
mate choice, so now mating more at random
– Species that would have formed, now won’t…
Cyanobacteria,
Algal blooms, etc.
![Page 77: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/77.jpg)
… and we strive to continue
to understand and explain…
![Page 78: On the origin of species, Really - InSight CruisesOn the origin of species, Really Mohamed Noor Duke University Life on our planet is highly diverse •… but that life seems to exist](https://reader036.vdocuments.site/reader036/viewer/2022070916/5fb6556343d19d48240fd68d/html5/thumbnails/78.jpg)
THANK YOU!
And see related talk by Dr. Michael Benton
Friday, October 7, 6:30pm
“Origins of Modern Biodiversity”