on-demand diagnosis of tb and rifampin- resistance using

23
On-demand diagnosis of TB and rifampin- resistance using the Xpert MTB/RIF assay: the present and the future. David Alland, MD Chief, Division of Infectious Diseases New Jersey Medical School-UMDNJ Newark, NJ. USA.

Upload: others

Post on 22-Jul-2022

4 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: On-demand diagnosis of TB and rifampin- resistance using

On-demand diagnosis of TB and rifampin- resistance using the Xpert MTB/RIF assay:

the present and the future.

David Alland, MDChief, Division of Infectious DiseasesNew Jersey Medical School-UMDNJNewark, NJ. USA.

Page 2: On-demand diagnosis of TB and rifampin- resistance using

Conflict of interest

Dr. Alland is the Principal Investigator of two NIH grants which include Cepheid as collaborators.

Is a member of a group of investigators who receive royalty payments for molecular beacons licenses.

Cepheid has licensed molecular beacons for use in the Xpert MTB/RIF assay.

Page 3: On-demand diagnosis of TB and rifampin- resistance using

Xpert MTB/RIF assay development goals

•Sensitive and specific M. tuberculosis detection

•Detection of rifampin resistance

•Rapid, simple virtually hands-free operation.

•Reduction in biohazard

Page 4: On-demand diagnosis of TB and rifampin- resistance using

GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTG TCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG

507

rpoB

533* ** * * *** **** * *

81 base pair core region** *** ** ****

*** ****

InsertionTTC

InsertionTTCATG

DeletionCCATTC

DeletionGGCACC

DelAAC

DeletionCAGAAC

DeletionGACCAG

DeletionAATTCATGG

DeletionGAACAA

Rifampin resistance

Adapted from: Musser. 1995. Clin. Microbiol. Rev. 8:496.

•Mutations map to a single “core region” of the rpoB gene •Accounts for ~ 95% of clinical rifampin-resistance.

Page 5: On-demand diagnosis of TB and rifampin- resistance using

The rpoB core region is flanked by M. tuberculosis – specific DNA sequences.

Thus, it is possible to test for M. tuberculosis and rifampin-resistance simultaneously, targeting a single amplicon

Page 6: On-demand diagnosis of TB and rifampin- resistance using

Molecular Beacon

Target

Hybrid

A molecular beacon assay to detect TB and mutations in the rpoB core region

By labeling each molecular beacon with a different

fluorophore, it is possible to perform the entire assay in a

single well.

Page 7: On-demand diagnosis of TB and rifampin- resistance using

Rifampin-resistant TB contains 1-2 rpoB mutations (95% sensitivity).(Five-color PCR performed in a single well.)

El Hajj et al., J. Clin. Microbiol. 2001

Page 8: On-demand diagnosis of TB and rifampin- resistance using

Lid

PCR Tube

Cartridge Body(11 Fluid Chambers and overmolded gasket)

Syringe Barrel

Cap/Ultrasonic Interface

Rotary Valve/Filter and Ultrasonic Lysis or

SPBRegion

Cartridge Foot

Valve body Ports . .

Molded Prefilterbottom of chamber 3

Ports for PCR tube

Cephied GenXpert Cartridge Exploded View

Page 9: On-demand diagnosis of TB and rifampin- resistance using

Cartridge A – Valve Body

Port -Direct Path Output Port - Filter Path

Ultrasonic horn

Filter

Plunger in Syringe BarrelPlunger stripping feature at top of syringe barrel

Glass Beads

Before

After

Page 10: On-demand diagnosis of TB and rifampin- resistance using
Page 11: On-demand diagnosis of TB and rifampin- resistance using
Page 12: On-demand diagnosis of TB and rifampin- resistance using

Limit of detection (LOD) of M. tuberculosis DNA

Based on 20 replicates per concentration tested

Page 13: On-demand diagnosis of TB and rifampin- resistance using

Limit of detection (LOD) of M. tuberculosis cells spiked into sputum

Based on 20 replicates per concentration tested

Page 14: On-demand diagnosis of TB and rifampin- resistance using

Exclusivity Panel- NTM

M. avium SmTM. avium SmDM. intracellulare 35790M. intracellulare 35776M. kansasiiM. malmoenseM. abscessusM. asiaticumM. celatumM. chelonaeM. flavescens

M. fortuitumM. genevensesM. gordonaeM. marinumM. scrofulaceumM. simiaeM. szulgaiM. thermoresistableM; trivialeM. xenope

Page 15: On-demand diagnosis of TB and rifampin- resistance using

Exclusivity PanelAcinetobacter baumanii Legionella pneumophila Staphylococcus aureusAcinetobacter calcoaceticus Leuconostoc mesenteroides Staphylococcus capitisActinomyces israellii Listeria grayi Staphylococcus epidermidisActinomyces meyeri Listeria monocytogenes Staphylococcus haemolyticusBacillus cereus Moraxella catarrhalis Staphylococcus hominisBacillus subtilis Morganella morganii Staphylococcus lugdunensisBordetella parapertussis Mycoplasma pneumoniae Stenotrophomonas maltophiliaBordetella pertussis Neisseria gonorrhoeae Streptococcus equi Campylobacter jejuni Neisseria lactamica Streptococcus pyogenes Candida albicans Neisseria meningitidis Streptococcus agalactiaeChlamydia pneumonia Neisseria mucosa Streptococcus constellatusCitrobacter freundii Nocardia asteroides Streptococcus mitis Corynebacterium diptheriae Nocardia asteroides Streptococcus mutansCorynebacterium pseudodiptheriticum Nocardia cyriageorgica Streptococcus pneumoniaeCorynebacterium xerosis Nocardia farcinica Streptococcus uberisCryptococcus neoformans Pasteurella multocida Veillonella parvula Enterobacter aerogenes Peptostreptococcus anaerobius Stenotrophomonas maltophilia Enterobacter cloacae Porphyromonas gingivalis Yersinia pestisEnterococcus avium Prevotella melaninogenica VIRUSEnterococcus faecalis Propionibacterium acnes AdenovirusEnterococcus faecium Proteus mirabilis Herpes simplex virus 1 Escherichia coli Proteus vulgaris Herpes simplex virus 2Escherichia coli O157H7 Providencia alcalifaciens Influenzavirus AFusobacterium nucleatum Pseudomonas aeruginosa Influenzavirus BHaemophilus influenzae Rhodococcus equi ParaInfluenza 2Haemophilus parahemolyticus Salmonella enterica ParaInfluenza 3Haemophilus parainfluenzae Salmonella typhi Respiratory Syncytial Virus AHistoplasma capsulatum Serratia marcescens Respiratory Syncytial Virus BKingella kingae Shigella boydii Rhinovirus 6 Klebsiella pneumoniae Shigella flexneri Rhinovirus 16

Page 16: On-demand diagnosis of TB and rifampin- resistance using

Inclusivity / Exclusivity results

Resistance Detected

Resistance Not

DetectedMtb Rif R 37 0 0Mtb Rif S 0 42 0

NTM 0 0 21Bacteria 0 0 73

Fungi 0 0 4Virus 0 0 8

Organism

Xpert MTB/RIF ResultMtb Positive

Mtb Negative

*Mtb tested at 4X limit of detection. All others tested at 106 genomes per reaction.

*

Page 17: On-demand diagnosis of TB and rifampin- resistance using

Phenotypic rifampin resistance versus Xpert MTB/RIF resistance. What causes discrepant results?

Affecting sensitivity

•Rifampin-resistant mutations occurring outside of the rpoB core region.

•Patients infected with both susceptible and resistant strains.

Affecting specificity

•Phenotypic drug-susceptibility test method.

•Liquid testing methods (MGIT) do not appear to be as accurate as LJ or agar proportions or molecular methods (Hain, Xpert or DNA sequencing).

•Xpert-specific issues to be discussed by Mark Perkins.

Page 18: On-demand diagnosis of TB and rifampin- resistance using

Biosafety?

Page 19: On-demand diagnosis of TB and rifampin- resistance using

Effect of Sample Reagent on Mtb viability (A) and assay sensitivity (B).

Based on 150 cfu in 1 ml sputum

Page 20: On-demand diagnosis of TB and rifampin- resistance using

05

101520253035404550

7H10 MGIT 7H10 MGIT 7H10 MGIT

3 :1 SR 2:1 SR Mycoprep (no SR)

No.

of s

ampl

es

MTB Positive MTB Negative Contaminated

*

* Only 9 colonies present in the single solid media culture-positive sample** Time to positive culture on three liquid culture-positive samples delayed an average of 13.1 days with SR treatment.

Sample reagent (SR) tuberculocidal activity: 15 min treatment on strongly smear-positive sputum samples from TB patients

**

Page 21: On-demand diagnosis of TB and rifampin- resistance using

Six stage Andersen Impactor Biosampler

Solid culture Liquid culture

Page 22: On-demand diagnosis of TB and rifampin- resistance using

Aerosol Viability During Manual Steps

5 X 108 cfu BCG spiked into sputum.

SR added 15 min wait then sample pipetted in and out of three Xpert TB cartridge over 15 min time period (equivalent to loading >30 cartridges)

Sputum smeared/layered on 10 microscope slides over 10 min period.

Mean cfu/m3 air detected over 3 experiments

Anderson impactor BioSampler

0 0

16 324

Page 23: On-demand diagnosis of TB and rifampin- resistance using

CepheidMartin JonesDavid PersingPeter DaileyJoann KopKen HoEllen WallaceMichelle OwenRichard RodgersBill McMillian

FINDMark PerkinsCatharina BoehmeRanald Southerland Support: NIH grant: 52523 & The

Foundation for Innovative Diagnostics

Alland lab (NJMS-UMDNJ) Amy PiatekDanica HelbElizabeth StorySoumitesh ChakravortyBola Alade-GbamiPadmapriya BanadaRobert BlakemoreKevin Fennelly

PHRIFred KramerSanjay TayagiHiyam El-HajjSalvatore Marras

Montefiore Med CtrMichael Levi