nutrient availability in the rhizosphere of coffee: shade ... · mean percentage rhizosphere effect...
TRANSCRIPT
![Page 1: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/1.jpg)
Nutrient Availability in the Rhizosphere of Coffee:
Shade-Tree and Fertilization Effects
by
Jake Warner Munroe
A thesis submitted in conformity with the requirements for the degree of Master of Science
Department of Geography
University of Toronto
© Copyright by Jake Warner Munroe, 2013
![Page 2: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/2.jpg)
ii
Nutrient Availability in the Rhizosphere of Coffee:
Shade-Tree and Fertilization Effects
Jake Warner Munroe
Master of Science
Department of Geography
University of Toronto
2013
Abstract
Shade tree incorporation is beneficial in coffee cropping systems under sub-optimal conditions.
This study was performed in lowland Costa Rica, at a 12-year-old experimental coffee farm. The
main objective was to compare the effect of a nitrogen fixing shade tree, Erythrina poeppigiana,
on nutrient availability in the rhizosphere of coffee under conventional fertilization.
Accumulation of nutrients (mineral N, available P, and exchangeable base cations) in
rhizosphere relative to bulk soil was greater under shade than full sun. Low nitrate availability in
rhizosphere soil of full sun coffee was explained by root-induced acidification relative to bulk
soil, as abundance of ammonia-oxidizing bacteria (AOB), which mediate nitrification, were
positively correlated with pH. Organic fertilization enhanced AOB abundance and altered soil
bacterial community structure relative to conventional fertilization. This study indicates clear
effects of shade-tree presence on nutrient availability at the micro-scale, management of which is
critical for stability of coffee agroforestry systems.
![Page 3: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/3.jpg)
iii
Acknowledgements
I am very grateful for the support and guidance of my supervisor, Dr. Marney Isaac,
throughout this process. Your insightful advice and direction combined with an approach that
allowed for individual creativity was really beneficial. I am grateful to Dr. Roberta Fulthorpe for
so enthusiastically agreeing to assist me with the microbial component of my project and, along
with Dr. Nathan Basiliko, for participating as a member of my defense committee.
I am thankful to Gabriela Soto for her practical advice during my fieldwork at CATIE
and to Dr. Elias de Melo. Thank you to Luis Romero, the Farm Manager at CATIE, for
providing important information on management practices at the site. I am also grateful to
Patricia Leandro and Manrique González for generously providing lab space, and to Claudio, for
his endless patience and assistance in the lab despite our language barrier.
I would also like to thank all of the other people who have helped me at some point along
the way. Learning how to conduct independent research requires the support of others at every
turn. For invaluable practical assistance with molecular biology lab techniques, I am incredibly
grateful to Roxana Shen, and to Nicole Rickers, for her help with real-time PCR. Thank you to
all of the others who assisted me, including my lab-mates, volunteers, and staff at UTSC. I am
also grateful to the Ontario Graduate Scholarship (OGS), the Dept. of Geography Graduate
Expansions Fund, and NSERC (Discovery Grant to M. Isaac) for funding.
And last, but certainly not least, thank you to my family and friends for their steady
support and encouragement throughout the past two years.
![Page 4: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/4.jpg)
iv
Table of Contents Abstract ......................................................................................................................................... ii
Acknowledgements ...................................................................................................................... iii
List of Tables ............................................................................................................................... vi
List of Figures .............................................................................................................................. vii
Chapter 1: Introduction ............................................................................................................... 1 1.1 Research context ........................................................................................................... 1
1.2 Research background, objectives, and hypotheses ....................................................... 3
Chapter 2: Agroforestry Systems and Nutrient Dynamics in the Rhizosphere ...................... 7
2.1 Multistrata agroforestry systems ................................................................................... 8
2.2 The role of nitrogen fixation in agroforestry ................................................................ 8
2.2.1 N inputs by nitrogen fixing trees .......................................................................... 9
2.2.2 Nutrient cycling by Erythrina poeppigiana ........................................................ 10
2.3 The rhizosphere in agroforestry systems .................................................................... 11
2.4 The rhizosphere ........................................................................................................... 12
2.5 Nutrient availability in the rhizosphere....................................................................... 14
2.5.1 Rhizosphere effects on pH .................................................................................. 15
2.5.2 Mineral N dynamics in the rhizosphere .............................................................. 16
2.6 Ammonia oxidation .................................................................................................... 17
Chapter 3: Costa Rica’s Coffee Sector: Past and Present....................................................... 20
3.1 Introduction ................................................................................................................. 20
3.2 Smallholder coffee producers in Costa Rica ............................................................... 21
3.3 The role of state agricultural research institutions in promoting the modernization of
the coffee sector ............................................................................................................... 22
3.4 The impact of modernization on Costa Rican smallholders ....................................... 25
3.5 Conclusions ................................................................................................................. 26
Chapter 4: Site Description and Methodology ......................................................................... 28 4.1 Site description ........................................................................................................... 28
4.2 Sample selection ......................................................................................................... 31
4.3 Sampling protocol ....................................................................................................... 34
4.4 Soil nutrient analysis ................................................................................................... 34
4.5 Soil microbial analysis ................................................................................................ 35
4.5.1 Denaturing Gradient Gel Electrophoresis ........................................................... 36
4.5.2 Real-time PCR assays ......................................................................................... 36
4.6 Statistical analyses ...................................................................................................... 38
Chapter 5: Results....................................................................................................................... 39
5.1 Bulk soil chemical characteristics ............................................................................... 39
5.2 Rhizosphere effects on nutrient properties ................................................................. 39
![Page 5: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/5.jpg)
v
5.2.1 Rhizosphere effects on nutrient properties within management treatments ....... 42
5.2.2 Magnitude of rhizosphere effect on soil nutrients .............................................. 45
5.3 Relative quantification of bacteria .............................................................................. 45
5.3.1 Relative amoA gene abundance .......................................................................... 45
5.3.2 Correlates of soil chemical and biological parameters ....................................... 48
5.4 Bacterial community structure in bulk soil ................................................................. 48
Chapter 6: Discussion
6.1 Rhizosphere effects on nutrient availability ............................................................... 53
6.1.1 Rhizosphere effects on mineral N availability .................................................... 53
6.1.2 Rhizosphere effects on available P ..................................................................... 55
6.1.3 Rhizosphere effects on exchangeable base cation concentrations ...................... 57
6.2 Management treatment effects on the magnitude of the rhizosphere effect ............... 57
6.2.1 The effect of shade trees ..................................................................................... 57
6.2.1.1 Ammonium ................................................................................................. 58
6.2.1.2 Nitrate ......................................................................................................... 60
6.2.2 The effect of fertility management ..................................................................... 62
6.2.3 Bulk soil properties ............................................................................................. 64
Chapter 7: Conclusions .............................................................................................................. 67
References .................................................................................................................................... 69
Appendix ...................................................................................................................................... 76
![Page 6: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/6.jpg)
vi
List of Tables
Table 1. Fertilization and pest/weed control protocols at the experimental coffee farm of the
Centro Agronómico Tropical de Investigación y Enseñanza (CATIE) ........................................ 30
Table 2. Soil pH, NO3-, NH4
+, available P, and exchangeable Ca2+, Mg2+, and K+ concentrations
in bulk soil under full sun management with conventional fertilization (FS-C), shade with
conventional fertilization (S-C), and shade with organic fertilization (S-O) at 0-20cm .............. 40
Table 3. Soil chemical and biological properties of rhizosphere and bulk soil of coffee under all
treatments (pooled) at 0-20cm and 20-40cm soil depths. Values are mean ± SE and sample size
refers to number of samples within a soil fraction (rhizosphere or bulk) at a given soil depth .... 41
Table 4. Soil pH and exchangeable base cation concentrations (mean ± SE) in bulk and
rhizosphere soil at 0-20cm (n=9 per management treatment, per soil fraction) and 20-40cm depth
(n=3 per management treatment, per soil fraction) ....................................................................... 44
Table 5. amoA abundance (relative to total bacteria) in rhizosphere and bulk soil fractions across
all three management treatments at 0-20cm. Data are means (n=3 per management treatment, per
soil fraction) ± SE of samples pooled by block before real-time PCR assay (n=3 per block, per
soil fraction). Note, S-C values are used twice in t-tests as the common treatment combination to
comparisons in which i) fertility and ii) shade are held constant ................................................. 47
![Page 7: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/7.jpg)
vii
List of Figures
Figure 1. A conceptual model of nutrient dynamics in a multistrata agroforestry system with a
nitrogen-fixing tree. The NFT fixes atmosphere nitrogen and inputs it primarily via leaf litter-fall
and branch prunings, which decompose and are mineralized at the soil surface. Other nutrients
are cycled from lower soil depths by the tree and deposited in organic form at the litter layer. The
tree modifies light levels, which in the system under study in Costa Rica, has been shown to
enhance the photosynthetic rates of coffee. Inorganic nutrients reach to crop roots via a
combination of mass flow and diffusion, which are driven by transpiration and soil concentration
gradients. Roots affect nutrient availability within the rhizosphere through the release of labile
carbon exudates, as well as H+ ions and enzymes. Carbon-rich exudates drive microbe-mediated
mineralization of native soil organic matter in the root zone, which can result in the release of
mineral N (and other nutrients) via microbial turnover. Diagram at bottom right adapted from
Paterson, 2003 ............................................................................................................................... 13
Figure 2. Map of CATIE experimental coffee farm with delineation of sub-plots sampled as part
of study. Structural pattern of coffee grown in E. poeppigiana shade plots shown, along with
example of sampling within a single subplot ................................................................................ 32
Figure 3. Coffee growing under E. poeppigiana shade (Block 3, Intensive Organic subplot, June
2012). Stump-coppiced tree in centre of picture; full-size Erythrina trees in a row on right side of
picture ........................................................................................................................................... 33
Figure 4. Mean NO3-, NH4
+, and available P concentrations in bulk and rhizosphere soil of coffee
under all three management treatments (FS = full sun; S = shade; C = conventional fertilization;
O = organic fertilization) at (a) 0-20cm depth and (b) 20-40cm depth. Significant differences
between rhizosphere and bulk soils within management treatments are indicated by different
letters (paired t-test, P <0.05). Bars represent ± SE; n=9 per soil fraction for 0-20cm; n=3 per soil
fraction for 20-40cm ..................................................................................................................... 43
Figure 5. Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee
grown under FS-C, S-C, and S-O management treatments (FS = full sun; S = shade; C =
conventional fertilization; O = organic fertilization) at 0-20cm depth (n=9 per management
treatment). Significant differences in magnitude of rhizosphere effect between FS-C and S-C are
denoted by different lower case letters (t-test, P <0.05) and by upper case letters between S-C
and S-O (t-test, P <0.05). Bars represent standard error of the mean ........................................... 46
Figure 6. Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) on amoA
gene abundance relative to total bacteria abundance at 0-20cm (n=3 per treatment; bars are
standard error). Significant difference between conventionally fertilized full sun and shade
treatments denoted by lower case letters; between organic and conventional fertilization by
capital letters (t-test; P <0.05). Asterix denotes a significant rhizosphere effect
(t-test; P <0.05) ............................................................................................................................. 49
Figure 7. Rhizosphere soil NO3- concentration (mg kg-1) in relation to soil pH at 0-20cm soil
depth under FS-C management (n=9) ........................................................................................... 50
![Page 8: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/8.jpg)
viii
Figure 8. Relative amoA gene abundance as a function of pH in bulk and rhizosphere soil at 0-
20cm as pooled by fertilization treatment (FS-C + S-C; n=11, one outlier removed). Data points
represent block mean values for amoA and pH. Bars represent standard error (n=3) of mean pH
values ............................................................................................................................................ 51
Figure 9. (a) DGGE profiles of 16S ribosomal DNA obtained using universal bacterial primers
from bulk soil (0-20 cm) from all three treatments combinations (FS-C, S-C, S-O). Lanes 2-6
represent samples from FS-C; lanes 7-9 represent samples from S-C; and lanes 10-12 are
samples from S-O. Lanes 1 and 14 are an identical profile from S-O, used as a ladder for
normalization. (b) DGGE-derived dendogram (without lanes 1, 2, 3, or 14), as determined by
unweighted pair group method with arithmetic mean (UPGMA) ................................................ 52
![Page 9: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/9.jpg)
1
Chapter 1
Introduction
1.1 Research context
Coffee is one of the most valuable agricultural exports and it is estimated to employ over
25 million worldwide (Ricketts et al, 2004). Since the 1950s, full-sun coffee cultivation has
emerged as a new mode of production in contrast to the traditional shade-grown model
throughout Central America. In this system, fossil fuel-derived inputs substitute for the functions
of intercropped trees. While higher yields can be achieved under optimal conditions, they come
at the expense of high up-front production costs, loss of biodiversity, and environmental
degradation in fragile upper watersheds (Perfecto et al, 2005; Haggar et al, 2011). This
monoculture production model has not been widely applicable for Costa Rican growers, of which
the vast majority have a small land base and limited capital (Haggar et al, 2011). In response to
this and the opening of markets for “shade-grown” coffee, research efforts have focussed on
improving tree-based coffee production. Essential to such research is an understanding of the
biophysical interactions between shade trees and the associated coffee crop, and how positive
interactions can be maximized through proper management practices.
It is generally acknowledged that the benefits of shade-tree incorporation occur under less
favourable conditions (Beer et al, 1998; DaMatta, 2004). Full sun coffee provides higher yields
when climatic conditions are optimal and there are no severe nutrient or non-nutrient limitations
(Beer et al, 1998; DaMatta, 2004). Beneficial effects of shade trees on coffee yield become
noticeable at low or very high altitudes and under poor edaphic conditions (Beer et al, 1998).
Shade-tree incorporation has also been found to be beneficial when low or moderate levels of
external inputs are used (Haggar et al, 2011). In the case of the leguminous shade trees, this
benefit can be derived from fixed nitrogen, as well as improved nutrient cycling.
![Page 10: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/10.jpg)
2
Arabica coffee, which is the exclusive species grown in Costa Rica, evolved as a tropical
forest understorey shrub in Ethiopia (DaMatta, 2004). Climatic conditions at this latitude and
altitude (1600-2800m) are characterized by a steady, warm (20 ºC) air temperature and well
distributed rainfall for 8 months of the year (DaMatta, 2004). The presence of shade trees can
serve to buffer fluctuations in temperature for coffee in whatever climate it is being cultivated
(Beer et al, 1998). Shaded coffee plants have a longer life expectancy than coffee grown in full
sun, a benefit that has been attributed to reduced plant exhaustion (Beer et al, 1998; DaMatta,
2004). Reduced light levels can exacerbate pest and disease problems if shade is not properly
managed, but prevent strong biennial yield fluctuations common to unshaded coffee (Beer et al,
1998; DaMatta, 2004).
Shade tree incorporation can also serve to improve nutrient availability for associated
coffee plants. In the case of nitrogen-fixing shade trees, significant inputs of nitrogen (N) can be
made available to coffee through litter and pruning deposition, as well as root and nodule
turnover (Beer et al, 1998; Snoeck et al, 2000; Nygren et al, 2012). Higher rates of soil N
mineralization have been found under coffee shaded by Erythrina poeppigiana, a nitrogen-fixing
shade tree, compared to full sun coffee in two separate Costa Rican coffee systems (Beer et al,
1998; Haggar et al, 2011). Cycling of other nutrients, such as phosphorus, potassium,
magnesium, and calcium can be substantial, especially when regular branch pruning is performed
(Beer et al, 1998; Nair et al, 1998).
While the effects of shade tree incorporation have been fairly well described in terms of
aboveground metrics, much is unknown regarding belowground dynamics in coffee agroforestry
systems. As Beer et al (1998) assert, belowground processes in these systems remain a ‘black
box’, of which the underlying biological and chemical mechanisms are poorly understood.
![Page 11: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/11.jpg)
3
Specifically, the belowground mechanisms by which shade-tree incorporation improves coffee
performance under low external inputs have not been fully uncovered. These mechanisms are
difficult to address, as they are highly affected by both aboveground physiological adaptations to
shade as well as plot-level management effects on soil properties. The rhizosphere – the zone of
interaction between live roots and the soil – represents a region that can provide insight as to
differences in nutrient availability between shade and full sun coffee.
1.2 Research background, objectives, and hypotheses
The rhizosphere represents a soil fraction, distinct from bulk soil in its chemical,
physical, and biological properties (Gobran and Clegg, 1996; Phillips and Fahey, 2008; Zhao et
al, 2010), which is rarely considered when determining nutrient status in soils. In addition to root
structure, nutrient acquisition is dependent upon biochemical changes and interactions with
microorganisms in this soil zone (Richardson et al, 2009). Roots release enzymes, H+ ions, and
carbon-rich molecules that can increase nutrient availability through a variety of mechanisms
(Rengel and Marschner, 2005). These plant-mediated activities can in turn be affected by
aboveground environmental conditions (Grayston et al, 1996). Facilitative nutrient effects of
intercropping have been observed within the rhizosphere of herbaceous crop species (Hinsinger
et al, 2009; Isaac et al, 2012); little is known, however, of the effects of shade trees on nutrient
availability in the rhizosphere of coffee. By examining the gradient of available nutrients
between rhizosphere and bulk soil of coffee in monoculture and under shade, I hoped to uncover
how shade tree incorporation affects nutrient acquisition occurring at a micro-scale.
Additionally, I seek to relate differences in the magnitude of rhizosphere-to-bulk
gradients to levels of external inputs. As previously mentioned, shade trees are reportedly
beneficial in systems in which external inputs are low. Interestingly, enhanced rhizosphere
![Page 12: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/12.jpg)
4
accumulation of nutrients has been observed under nutrient-poor edaphic conditions in non-
agroforestry systems (Wang and Zabowski, 1998; Phillips and Fahey, 2008). In order to assess
whether root-induced effects on nutrient availability differ according to soil nutrient status, I
investigated nutrient availability in the rhizosphere of shaded coffee, under intensive (organic)
vs. moderate (conventional) fertilization. Note that throughout this paper, the rhizosphere effect
will refer to the difference between rhizosphere soil and bulk soil, with a positive rhizosphere
effect meaning that a particular nutrient is present in a higher concentration in rhizosphere
relative to bulk soil.
In accordance with the concepts introduced above, I propose the following hypotheses for the
coffee-shade system under study:
1) The rhizosphere effect will be positive for mineral nitrogen, available phosphorus, and
exchangeable base cations across treatments. Coffee root exudation of labile carbon will
stimulate microbial activity and nutrient cycling at the root zone, which will result in
nutrient accumulation in the rhizosphere.
2) The magnitude of the positive rhizosphere effect on nutrients will be greater for
conventionally fertilized coffee grown in association with a N2-fixing shade tree versus in
full sun, due to modifications of coffee plant physiology under shade.
3) The magnitude of the rhizosphere effect will be greater for shade-grown coffee under
conventional fertilization than organic fertilization, as explained by plant carbon
allocation theory, which predicts decreased carbon flow (and therefore exudation) to
roots in fertile soils.
![Page 13: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/13.jpg)
5
To address these hypotheses, I will draw upon a research site in Costa Rica in which
coffee grown in full sun can be compared to coffee grown under the shade of Erythrina
poeppigiana, a nitrogen-fixing shade tree common to coffee agroforestry systems in that country.
At the 12-year-old site, high external input fertilization (henceforth referred to as organic
fertilization) can be compared with moderate levels of fertilization (henceforth referred to as
conventional fertilization). Early research at this site has indicated that the incorporation of E.
poeppigiana has the greatest effect on coffee productivity under low nutrient input conditions
(Haggar et al, 2011). It is believed that under such conditions, the ecological services of the
leguminous shade tree – in terms of N2 fixation and nutrient cycling – become realized to a fuller
extent than when external inputs compensate for them (Haggar et al, 2011).
Previous work at the same site by L. Campbell has demonstrated that under conventional
fertilization, shade tree incorporation results in enhanced photosynthetic rates in coffee relative
to full sun. Campbell (2012) observed significantly higher photosynthetic rates at light saturation
(Amax) under conventionally fertilized coffee grown under shade as compared to monoculture
coffee. Additionally, shaded plants showed a trend towards higher photosynthetic nitrogen use
efficiency and had significantly greater leaf phosphorus (P) content and photosynthetic
phosphorus use efficiency (Campbell, 2012). As no significant correlations were found between
soil nutrients (available P, total N) and coffee leaf parameters at the whole plot level, the author
suggested that leaf trait differences observed under shade were primarily driven by shade effects.
Indeed, shade levels (49-69%) were within the optimal range for a shade-adapted perennial such
as coffee (Campbell, 2012). A positive effect of shade on stomatal conductance, which in turn
was positively correlated with Amax values, points to a possible mechanism underlying the
![Page 14: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/14.jpg)
6
facilitative physiological adaptation. Some observations, however, were not satisfactorily
explained.
In a vector analysis, in which relative biomass, nutrient concentrations and nutrient
content of coffee leaves were compared relative to full-sun conventionally fertilized coffee,
several observations of interest were made. While leaf biomass was universally greater under the
shade of E. poeppigiana and Chloroleucon eurycyclum, another nitrogen-fixing tree intercropped
at the site, N and P content often did not keep pace – a phenomenon known as a dilution effect
(Campbell 2012). Under Erythrina shade and conventional fertilization, however, N leaf
concentration was found to maintain sufficiency, i.e., N uptake kept pace with increased leaf
biomass. Despite this, soil analyses did not present a difference in soil N content between these
plots. Campbell (2012) explained the phenomenon as follows:
“Differences in leaf nutrient response appear to be divided by species, with coffee grown
below Erythrina appearing to be able be better able to match increases in leaf biomass by
increasing leaf nutrient content, presumably via increased nutrient uptake within these
environments.” (italics added for emphasis)
It was with this interesting, yet only partially explained observation in mind that this study was
designed; with the purpose of probing the effects of E. poeppigiana incorporation on nutrient
availability at the root-soil interface of coffee.
Here within, I will describe nutrient dynamics and rhizosphere processes in agroforestry
systems by focussing on coffee agroforestry and drawing on other systems when necessary. I
will then place this thesis within the larger socio-political framework of Costa Rica’s coffee
sector, both past and present. Next, I will provide a detailed methodological approach and
![Page 15: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/15.jpg)
7
present novel results, particularly on the first-time use of molecular techniques to quantify the
abundance of ammonia oxidizing bacteria in a coffee agroforestry system. Finally, I will
interpret my findings within the larger literature on rhizosphere processes and coffee agroforestry
nutrient dynamics.
![Page 16: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/16.jpg)
8
Chapter 2 Agroforestry Systems and Nutrient Dynamics in the Rhizosphere
2.1 Multistrata agroforestry systems
Multistrata agroforestry systems are tree-crop based land use systems with two or more
vegetation layers, which include more than one tree species (Schroth et al, 2001). They range
from highly diverse homegardens to dual-species plantations. Multistrata systems are ubiquitous
throughout the humid and semi-humid tropics and crops commonly grown under the simplified
plantation form, such as coffee and cacao, hold tremendous global economic importance
(Schroth et al, 2001; Isaac et al, 2007; Nygren et al, 2012). The incorporation of a tree over-
storey serves a variety of purposes, which include light and temperature regulation, enhanced
nutrient and water cycling, organic matter accumulation, pest regulation, and, when nitrogen-
fixing trees (NFT) are used, nitrogen input.
2.2 The role of nitrogen fixation in agroforestry
Although natural ecosystems of the humid tropics have relatively open N cycles and high
levels of available nitrogen (Martinelli et al, 1999), export of N in harvest and reduced nutrient
cycling can cause N to be a growth-limiting factor (Kurppa et al, 2010). Application of inorganic
chemical fertilizers can maintain soil fertility levels, but are often inaccessible and unaffordable
for smallholder farmers (Haggar et al, 2011). Additionally, N fertilizers can have low use
efficiency and have detrimental environmental impacts, such as transformation into nitrous
oxides (Nygren et al., 2012). Through enhanced structural and functional diversity, trees within
agroforestry systems can partially restore N cycling in highly simplified cropping systems.
Nitrogen-fixing trees commonly used in agroforestry systems can derive anywhere from 10-92%
of their N from the atmosphere (Nygren et al, 2012); they represent an important source of N
![Page 17: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/17.jpg)
9
input. In Costa Rica, coffee is commonly cultivated under the shade of the regularly pruned NFT
Erythrina poeppigiana.
2.2.1 N inputs by nitrogen fixing trees
Many common NFTs fix sufficient nitrogen to meet current and potentially increasing N
needs of woody perennial crops, including coffee (Nygren et al., 2012). Certain management
practices, such as green pruning, elevate N2 fixation levels and serve to maximize fixation rates.
Of the nitrogen that is fixed, it can make its way to the crop via a number of different pathways,
which include: decomposition and mineralization of donor organic matter (Haggar et al., 1993;
Sierra & Nygren, 2006); release and subsequent uptake of N-rich donor exudates (Paynel et al.,
2001; Jalonen et al, 2009); and transfer by common mycorrhizal networks (He et al., 2009;
Jalonen et al, 2009). For the purposes of this review, I will focus on transfer that occurs via
decomposition and mineralization.
Aboveground nitrogen transfer refers exclusively to decomposition and mineralization of
aboveground biomass of the NFT (e.g. leaf litter and branch prunings). Belowground transfer
refers to any process that occurs solely in the soil, such as nodule and root turnover. Snoeck et al
(2000) found a range of 14.3-42.3% of N transferred to coffee plants by associated shade trees
and woody cover crops at field sites in Burundi. The researchers also demonstrated that
approximately 75% of fixed N was transferred via mineralization of aboveground mulch, while
25% of N transfer occurred belowground. Within a cut-and-carry silvopastoral system, Sierra
and Nygren (2006) found that approximately one third of nitrogen in associated grass N was
derived from Gliricidia sepium, a NFT, despite the removal of its prunings and leaf litter. Kurppa
et al (2010) observed N transfer from Gliricidia sepium and Inga edulis to cacao saplings
without any litter-fall or pruning residue.
![Page 18: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/18.jpg)
10
Pruning of shade trees within multistrata agroforestry systems is performed to limit light
and root competition between tree and crop. As a consequence of branch pruning, acropetal
movement of carbon from roots to stems results in the death of tree root tissue and nodules
(Chesney and Nygren, 2002). Total turnover of Erythrina poeppigiana nodules has been
observed due to twice-yearly complete pruning of branches (Nygren and Ramírez, 1995), as has
a decrease in over 50% root mass (Nygren and Campos, 1995; Muñoz and Beer, 2001). Partial
pruning, in which 1-2 branches are left on the tree, is a traditional practice on Costa Rican coffee
farms (Chesney and Nygren, 2002). Thus, belowground transfer of N represents an important,
yet often overlooked contribution to crop-available N, in addition to nutrients from litter-fall and
prunings.
2.2.2 Nutrient cycling by Erythrina poeppigiana
As Beer et al (1998) assert, the characteristics of nutrient cycling within a particular
agroforestry system depend upon the above and belowground biomass productivity and biomass
decomposition rate of the tree species selected. When pruned 2-3 times annually, Erythrina
poeppigiana can replenish the litter layer with quantities of nutrients, in organic form, equivalent
to those commonly applied to coffee farms through inorganic fertilizers (Beer, 1988). At the
study site of this thesis, bi-annually pruned E. poeppigiana was estimated to produce 6352 kg ha-
1 from litter-fall and 7837 kg ha-1 from prunings in one year (Haggar et al, 2011). Within the
biomass of those prunings was 236 kg ha-1 N, 20.70 kg ha-1 P, and 128 kg ha-1 K (Haggar et al,
2011). According to Beer (1988), the return of nutrients by of E. poeppigiana is estimated to
comprise 90-100% of nutrients stored in the aboveground biomass. He cites a range of 331-461,
22-35, 162-264, 243-328, and 48-76 kg ha-1 year-1 of N, P, K, Ca and Mg inputs, respectively
(dry weight) from litter under various E. poeppigiana-coffee agroforestry systems (Beer, 1988).
![Page 19: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/19.jpg)
11
Given the disproportionately high abundance of coffee fine roots in the top 20 cm of soil under
intercropping with E. poeppigiana (Mora, 2012), significant nutrient acquisition from these
aboveground organic materials is likely substantial.
2.3 The rhizosphere in agroforestry systems
As early as 1977, researchers sought to investigate the dynamics of nutrient acquisition at
the root zone under intercropping. Nair and Rao (1977) observed enhanced microbial activity in
the rhizosphere of coconut intercropped with cacao relative to monoculture coconut. Specifically
they observed higher total bacteria, fungi, phosphorus-solubilizing bacteria, and N2-fixing
bacteria under intercropping. Additionally, there was higher organic carbon in the rhizosphere of
intercropped coconut, which the authors attributed to litter-fall contributions from cacao (Nair
and Rao, 1977). They concluded that intercropping improves microbial activity in the
rhizosphere of coconut and suggested that increased P mobilization, nitrogen fixation, and
release of growth-promoting substances by microorganisms may partially explain increased
coconut yields. Since that study, few (if any) investigations of the effects of intercropping on
rhizosphere properties in agroforestry systems have been performed. Indeed, very little
knowledge has been added to this early finding, despite its pertinence for understanding positive
effects of intercropping within agroforestry systems.
Within multistrata agroforestry systems, light alteration may modify the capacity of
shaded crop to uptake these nutrients. As Grayston et al (1996) note, photosynthetic rates
determine quantity of carbon assimilation, which in turn affect exudation. Thus, the capacity of a
crop under the shade of a NFT to meet its nutritional requirements is impacted by both the
mineralizable organic matter available through litter-fall, prunings, and root turnover, and by
shade effects on crop physiology. As the pool of literature on nutrient availability at the
![Page 20: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/20.jpg)
12
rhizosphere is limited within agroforestry systems, in these next sections I will review the
rhizosphere effect in general and its impact on nutrients in the root zone of various tree species.
2.4 The rhizosphere
Nutrient acquisition is more than simply a function of the movement of soluble nutrients
to the root via mass flow and diffusion. In Figure 1, I illustrate the major influences of
intercropped shade trees within a coffee agroforestry system, as well as the pathways by which
the associated coffee crop acquires nutrients. Rhizosphere processes have long been known to
play an important role in nutrient cycling within both managed and natural systems. The
rhizosphere is generally defined as the region of soil influenced by the presence of plant roots
(Gobran and Clegg, 1996; Turpault et al, 2005; Richardson et al, 2009). This zone is modified by
a variety of root activities, including nutrient uptake, proton release, and exudation of carbon-
rich molecules (Grayston et al, 1996); it is the region at which the plant can exert a level of
control over nutrient availability (Rengel and Marschner, 2005). For example, plants are known
to invoke mechanisms in response to inadequate nutrient availability, including altered root and
exudation of organic compounds and protons (Rengel and Marschner, 2005). The resulting
changes in the rhizosphere drive shifts in microbial abundance and diversity which in turn
influences nutrient availability (Rengel and Marschner, 2005).
![Page 21: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/21.jpg)
13
Figure 1. A conceptual model of nutrient
dynamics in a multistrata agroforestry system
with a nitrogen-fixing tree. The NFT fixes
atmosphere nitrogen and inputs it primarily via
leaf litter-fall and branch prunings, which
decompose and are mineralized at the soil
surface. Other nutrients are cycled from lower
soil depths by the tree and deposited in organic
form at the litter layer. The tree modifies light
levels, which in the system under study in Costa
Rica, has been shown to enhance the
photosynthetic rates of coffee. Inorganic
nutrients reach to crop roots via a combination of
mass flow and diffusion, which are driven by
transpiration and soil concentration gradients.
Roots affect nutrient availability within the
rhizosphere through the release of labile carbon
exudates, as well as H+ ions and enzymes.
Carbon-rich exudates drive microbe-mediated
mineralization of native soil organic matter in
the root zone, which can result in the release of
mineral N (and other nutrients) via microbial
turnover.
Diagram at bottom right adapted from Paterson,
2003.
![Page 22: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/22.jpg)
14
2.5 Nutrient availability in the rhizosphere
A variety of observations have been made with respect to the rhizosphere effect on
nutrient availability in woody perennial plants. In a nutrient-poor, sandy soil, significantly higher
NH4+ concentrations and lower NO3
- concentrations were observed in rhizosphere soil of three
different tree species (Zhao et al, 2010). The authors attributed this phenomenon to enhanced
microbial immobilization and root uptake of NO3- in the rhizosphere. Turpault et al (2005), in
their study of a mature Douglas fir stand, found an accumulation of NH4+ in the rhizosphere from
0-60cm depth, but for NO3- found accumulation only below 20cm depth. A positive rhizosphere
effect on net N mineralization was observed under various tree species (red oak, yellow birch,
sugar maple) at two different experimental sites (Phillips and Fahey, 2008). Interestingly, the
effect was reduced by fertilization in some cases; this occurred to an even greater degree with
regards to phosphatase activity. It was postulated that enhanced carbon allocation belowground
by plants under nutrient limitation may serve to enhance the effect on mineral nutrient
availability in the rhizosphere.
In a Norway spruce stand in Sweden, Yanai et al (2003) found rhizosphere enrichment of
potassium (K), calcium (Ca), and magnesium (Mg), despite a model-based prediction of their
depletion. The authors cite the role of root and microbial-induced organic matter mineralization
and mineral weather as a possible explanation for the discrepancy between the observed results
and the simulation, which only considered uptake rates relative to mass flow of nutrients.
Turpault et al (2005) also observed accumulation of K, Ca, Mg, as did Wang and Zabowski
(1998) in rhizosphere soil solution of unfertilized Douglas fir seedlings at two different sites. No
rhizosphere effect on Ca, Mg, N, or P was observed at the fertilized site in the latter study, which
was attributed to a masking of rhizosphere and bulk differences by the fertilizer (Wang and
![Page 23: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/23.jpg)
15
Zabowski, 1998). In a temporal study of exchangeable cation availability under mature Norway
spruce and beech stands, Collignon et al (2011) found rhizosphere enrichment of base cations
across all four seasons. In the acidic, nutrient-poor site, a positive correlation between carbon
content and % base saturation provided support for the role of rhizosdeposition in enhancing
nutrient availability (Collignon et al, 2011).
As for available phosphorus (P), results vary widely. Zhao et al (2010) found an
enrichment of P in the rhizosphere across all tree species, while Turpault et al (2005) observed a
strong depletion at 20-60cm depth. In the former study, significantly greater levels of acid
phosphatase activity were observed in rhizosphere versus bulk soil; in the latter, the authors
suggested high P uptake and low mobility as explanatory factors. Gobran et al (1998) found
higher rhizosphere P, and both organic and inorganic P in the unfertilized Norway spruce stand
were significantly correlated with the organic matter content in both bulk and rhizosphere soil.
Findings such as these demonstrate the capacity of living roots to alter their physico-chemical
environment so as to enhance the availability of a typically sparingly soluble element such as
phosphorus.
2.5.1 Rhizosphere effects on pH
As with mineral N, P, and base cations, various, sometimes contradictory, findings have
been made regarding the concentration gradient of H+ from rhizosphere to bulk soil. Gobran and
Clegg (1996) observed a decrease in pH from bulk to rhizosphere in the aforementioned Norway
spruce stand, though it was only statistically significant in one of three horizons. Zhao et al
(2010) also found slight acidification of the rhizosphere, though only in one species under study.
In the previously discussed Douglas fir site, Turpault et al (2005) found rhizosphere
![Page 24: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/24.jpg)
16
acidification, but noted that opposing observations existed in others studies of the same site. The
authors proposed that rhizosphere acid-base status fluctuation is a result of temporal shifts in the
interactive influences of CO2 respiration, organic acid exudation, and ion uptake on H+
concentration (Turpault et al, 2005). In the study of Wang and Zabowski (1998), both negative
and positive H+ gradients were observed in different seasons; however, a high NH4+:NO3
-
rhizosphere ratio was consistently associated with acidification, and a low ratio with higher
rhizosphere solution pH. This observation was explained by the dynamic balance between H+
released during NH4+ uptake and OH- or HCO3
- release linked with NO3- uptake (Wang and
Zabowski, 1998).
2.5.2 Mineral N dynamics in the rhizosphere
Nitrogen uptake in the rhizosphere and movement within plant-soil systems is unique to
other nutrients, and as such, deserves brief explanation. Ammonium (NH4+) and nitrate (NO3
-)
represent the major forms of N that are taken up by plants (Jackson et al, 2008). Their
availability is governed by mineralization of organic N to ammonia and its subsequent
nitrification to NO3-, both of which are microbially-mediated processes (Richardson et al, 2009).
Both inorganic forms of nitrogen reach the root surface by a combination of mass flow (i.e.
movement in soil solution driven by transpiration) and diffusion; under low soil N conditions
root distribution and expansion play an important role in N acquisition (Yanai et al, 2003;
Richardson et al, 2009). Uptake of NH4+ results in acidification of the rhizosphere, as protons are
released to balance the charge, and NO3- uptake raises pH due to an influx of protons
(Richardson et al., 2009). Unlike phosphorus, which can be solubilized and made plant-available
directly by root exudates (Chen et al, 2002), the availability of N in natural systems and low-
external-input systems is almost entirely dependent upon microbial activity. In bulk soil,
![Page 25: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/25.jpg)
17
populations of free-living microorganisms make organic sources of N plant-available through
mineralization and nitrification (Chapin III et al, 2002). This process is particularly important in
the rhizosphere, where C-rich exudates can support rapid cycling of organic matter and make N
available in inorganic forms (Jackson et al, 2008; Hinsinger et al, 2009).
Carbon and nitrogen cycles are closely linked, and availability of C, via exudation, root
turnover, and soil organic matter, can drive microbial processes that release soil N for plants to
use (Jackson et al., 2008). The rhizosphere is typically N-limited for microbial growth, in
contrast to C-limitation that is often pervasive in bulk soil (Hinsinger et al., 2009). Plants release
a variety of molecules through their roots; these exudates have been estimated to comprise
anywhere from 5-10% (Jackson et al., 2008) to 40% (Grayston et al, 1996) of total
photosynthetically-fixed C. As a consequence of C-rich root exudation, which represents an
easily usable energy source for microorganisms, rhizosphere microbes decompose native soil
organic matter at an accelerated rate to meet their N requirements (Rengel and Marschner, 2005;
Hinsinger et al., 2009). Inorganic N released from soil organic matter decomposition is believed
to be more easily absorbed by bacteria in the short term; however, plants have been shown to
take up the majority of N in the long term (Jackson et al., 2008). Experimentally, this has been
shown to be due to the microbial loop, a process in which initially-immobilized N is released
over time as microfauna, such as protozoa and nematodes, consume rhizosphere bacteria
(Ingham et al, 1985; Griffith, 1994; Peterson, 2003).
2.6 Ammonia oxidation
Nitrification, the conversion of ammonia to nitrate, is a critically important process
within agriculture systems. It plays a crucial role in governing the transformation of N inputs,
whether they are applied in organic or inorganic form. Ammonia oxidation, in which ammonia is
![Page 26: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/26.jpg)
18
converted to nitrite, is the rate-limiting step of nitrification (Kowalchuk and Stephen, 2001). It is
performed by chemolitho-autotrophic ammonia-oxidizing bacteria (AOB), which have the
unique ability to rely solely on the conversion of ammonia to nitrite for their energy needs
(Kowalchuck and Stephen, 2001). For many years, it was believed that ammonia oxidation was
performed only by bacteria (Jia and Conrad, 2009). Recently, however, the existence of both
anaerobic ammonia-oxidizing bacteria (anammox) and ammonia-oxidizing archaea (AOA) has
been confirmed.
Despite the common observation of greater AOA gene abundance in soils (Leininger
et al., 2006; Chen et al., 2008; Nicol et al., 2008), Jia and Conrad (2009) recently demonstrated
that AOB dominate functionally in situ in an agricultural soil. In other words, nitrate production
was better explained by bacterial rather than archaeal nitrification (Jia and Conrad, 2009). The
authors point out that while AOA do not necessarily use ammonia-oxidation as a sole energy
source, as AOB do, which may account for observed discrepancies between AOA gene
abundance and relative functional importance in soil nitrification (Jia and Conrad, 2009).
Regardless, for the purposes of this thesis, only AOB will be considered.
Ammonia-oxidizing bacteria are encompassed within two monophyletic lineages: the
beta-proteobacteria, which include Nitrosomonas and Nitrospira genera, and the
gammaproteobacteria, which contains the Nitrosococcus genus (Rotthauwe et al, 1997; Junier et
al, 2010). The ecological and physiological characteristics of these bacteria have traditionally
been difficult to understand due to challenges in culturing; this has changed in recent years,
however, with the application of molecular techniques (Okano et al, 2004). Early polymerase
chain reaction (PCR) primers targeted the 16s rRNA gene to identify AOB, though it was soon
discovered that they did not always accurately reflect physiological function (Junier et al, 2010).
![Page 27: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/27.jpg)
19
Functional marker genes that code for essential enzymes involved in ammonia oxidation have
been used with greater efficacy. One of the most commonly used functional markers is amoA, a
gene that encodes the alpha-subunit of ammonia monooxygenase (AMO), a critical enzyme
required for ammonia oxidation (Rotthauwe et al, 1997). Various primer sets have been
developed that target the amoA gene with varying degrees of specificity (Junier et al, 2010).
Several studies have used amoA as a functional biomarker to gain insights as to the
relationships between AOB and mineral N pools within agricultural systems. At two separate
depth categories, Jia and Conrad (2009) observed increases in bacterial copy number for the
amoA gene only in soil samples in which nitrate concentrations increased. A clear, positive effect
of ammonium fertilizer application was observed on amoA abundance, and NO3- concentration
was positively correlated with amoA abundance over nearly all time points (Jia and Conrad,
2009). Okano et al (2004) used real time PCR as well and found amoA gene abundance to be
consistently positively correlated with a decrease in ammonia and rise in nitrate, the by-product
of ammonia oxidation. These results demonstrate the applicability of using the amoA gene in
understanding bacterial-driven transformations within soil environments, and ultimately for
relating root-induced effects to microbial activity in the rhizosphere.
![Page 28: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/28.jpg)
20
Chapter 3 Costa Rica’s Coffee Sector: Past and Present
3.1 Introduction
Coffee has provided livelihoods for rural Costa Ricans for over one hundred and fifty
years. Known as el grano de oro (“the golden bean”), its cultivation has sustained communities
comprised primarily of smallholders. In the 1950s, the state used research, extension, and
economic policies to stimulate widespread planting of new, higher-yielding varieties and the
adoption of fertilizers and agrochemicals. This approach resulted in a drastic increase in
productivity that made Cost Rica the Latin American leader in modern coffee production. While
the benefits of this process were felt unevenly within the coffee economy, the position of
smallholder coffee farmers in Costa Rica has historically been enviable relative to other
countries. With the failure of the managed international coffee market in 1989 and the concurrent
spread of neoliberal, free trade oriented development policy, the position of the small-scale
coffee producer has changed drastically. Most have been forced to reduce costly fertilizer and
agrochemical inputs and reduce upkeep; some have been able to access niche markets for
environmentally friendly and socially just coffee; others, after waiting patiently for years for
prices to rebound, have left the business altogether.
In this chapter, I will provide a brief historical background on the role of the state in the
coffee sector and examine the influence of public agricultural research in Costa Rica’s
development throughout the post-war era. Specifically, I will investigate the potential for public
agricultural research institutions to seek out and extend viable alternatives to small-scale coffee
producers in the wake of the coffee crisis. I will discuss both the obstacles to such action within
the context of globally-dominant neoliberal economic policy. As a social democracy with a
![Page 29: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/29.jpg)
21
history of successful public institutions (Haglund, 2006) and relatively egalitarian distribution of
land and resources, Costa Rica provides a prime example of the tension between social
democracy and neoliberal ideology as it relates to the state’s relationship with petty commodity
producers.
Central to this investigation is reconciling production-oriented agricultural research of the
past sixty years with the complex and nuanced objectives of addressing ecological and socio-
economic sustainability today. Environmental degradation, high input costs, and economic
vulnerability associated with modernized production have necessitated the discovery and
implementation of new research directions, especially to address the needs of small-scale
farmers. A multidisciplinary approach is required that considers the political, economic and
social factors that have contributed to the current position of the Costa Rican coffee farmer. I use
the International Assessment of Agricultural Knowledge, Science, and Technology for
Development (IAASTD) as a framework by which to define sustainable development in the
Costa Rica’s coffee sector. I discuss the role of the Centro Agronómico Tropical de
Investigación y Enseñanza (CATIE), the Costa Rican-based inter-governmental research
institution with whom this thesis research was conducted, to highlight opportunities and
challenges for agricultural research in the contemporary coffee economy.
3.2 Smallholder coffee producers in Costa Rica
Coffee was originally introduced to Costa Rica in 1806 and initial adoption of the crop by
the colony’s primarily peasant population was slow (Seligson, 1980). By the end of the 19th
century, however, Costa Rica was exporting over 20 million tonnes annually (Winson, 1989). By
the early-mid 20th century, significant socio-economic differentiation had occurred within the
![Page 30: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/30.jpg)
22
coffee economy, with the emergence of a distinct set of classes: the processor oligopoly; the
wealthy but non-processor producers; smallholders and; semi-proletarian and fully proletarian
households dependent upon wage labour in haciendas (Gudmundson, 1995).
Of all other major agricultural export activities in Latin America post mid-19th century,
coffee was the most amenable to small-scale cultivation (Gudmundson, 1995). This has been
attributed to the fact that, unlike sugar for example, growing coffee profitably did not necessarily
require large production units, farm sizes, or intensive investment in mechanization
(Gudmundson, 1995). Additionally, labour demand was high only during harvest (typically
November and December), during which time immediate and extended family labour could be
used (Gudmundson, 1995; Sick, 1997). Indeed, in Costa Rica the numerical importance of
smallholders is evident from property registries throughout the 19th century, as well as the Coffee
Census of 1935 (Gudmundson, 1995; Winson, 1989). By the early-mid 1900s, however,
increasing concentration of land ownership and division of smallholdings, as well as out-
migration contributed to the precarious position of the smallholder (Gudmundson, 1995). Despite
the numerical predominance of smallholder coffee farmers, in socio-economic and political
terms they have historically been subordinated by the elite classes (Winson 1989).
3.3 The role of state agricultural research institutions in promoting the modernization of
the coffee sector
In the wake of successful coup in 1948, state intervention became the driving force
behind an economic development model intimately linked with social reform (Winson 1989).
Intervention within the coffee sector was comprehensive, and central to it was technology
transfer and agricultural extension used to modernize coffee production. The government argued
that taxes were needed to finance programmes to stimulate rural development and raise
![Page 31: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/31.jpg)
23
productivity in the agrarian sector. In 1952 legislation was passed that provided government a
percentage of revenues from coffee processors (Winson, 1989). This, among other forms of
taxes, resulted in a more than six-fold increase in government revenue by 1954 as compared to
1938 (Winson, 1989). These funds provided the state with essential resources with which to
intervene economically and to fund agricultural research and extension aimed at modernizing the
coffee sector.
In 1950, coffee yields in Costa Rica were among the lowest in Latin America (Winson,
1989). Cultivation practices were seen as backward and exploitive of soil resources and
production increases were limited by land availability and labour costs (Winson, 1989). For
large, capitalist farms, high labour costs made expansion unprofitable, and small-scale farmers
struggled to sustain their families without supplementary income from wage labour on capitalist
farms (Gudmundson, 1995; Winson, 1989). The approach of the government, newly endowed
with tax-derived resources, was to facilitate increased per-area productivity (Winson, 1989). The
original policy objective was to include all farmers in the process, including those unable to
finance the necessary measures for modernization (Winson, 1989). However, as Winson (1989)
argues, the roots of the inequalities between coffee producers were never fully confronted by the
government.
State-led efforts to modernize the coffee sector were extremely successful in terms of
productivity increases. Costa Rica saw a total production increase of three hundred percent from
1950 to 1973, with an increase in land cultivation of only sixty percent (Winson, 1989). Into the
1980s, Costa Rica had among the highest productivity per hectare in the world (Samper, 2010).
Modernized production was based upon new, higher yielding hybrid varieties, the abandonment
![Page 32: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/32.jpg)
24
or reduction of shade tree intercropping, and intensive use of fertilizers and agro-chemicals
(Perfecto et al, 1996; Winson, 1989). The government subsidized the importation of fertilizers
(Winson, 1989) and established long-term credit programmes through the National Bank that
provided loans for producers to invest in re-planting with new varieties. While such economic
instruments played a critical role in modernization, state agricultural research institutions
established the foundation for change.
During the post-1948 period of modernization in Costa Rica, development of the planting
techniques and technological inputs of intensive coffee cultivation was driven by state
institutions, namely the Coffee Office, the Ministry of Agriculture and Livestock, and the Centre
for Investigations in Coffee (CICAFE) (now ICAFE), which operated research stations in a
variety of different ecological zones (Winson, 1989). These state institutions undertook:
cultivation of new hybrid varieties in order to increase yields, increase disease resistance and
improve structure for mechanized harvesting; fertilizer application experimentation; propagation
of high yielding varieties for distribution; and, assessment of new, intensive planting and pruning
protocols (Winson, 1989). Similar research was performed on a variety of crops throughout Latin
America, as public institutions became the drivers of agricultural modernization during this
period (Kaimowitz, 1993). The goal of increased productivity was paramount – for coffee in
Costa Rica, and in general across Latin America (IAASTD, 2008). [See the entry for IAASTD
under references.] Public extension agents played a key role in the transfer of state-led research
and innovation to producers; they provided the essential link between research and adoption of
new knowledge and technology.
![Page 33: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/33.jpg)
25
3.4 The impact of modernization on Costa Rican smallholders
While small and medium scale coffee farmers have enjoyed relative prosperity within
Costa Rica’s modernized coffee economy Sick (1997; 2008), inequalities have arisen – and been
reinforced – by the agrarian development process in Costa Rica. Flaws in the production model
have become more evident in recent years, with increased economic and ecological vulnerability,
particularly for smallholders.
The shift to reduced-shade, chemical-intensive production has resulted in deforestation,
soil erosion, watershed pollution and loss of biodiversity throughout coffee-growing regions
(Borkhataria et al, 2012; Haggar et al, 2011; Perfecto et al, 1996). Furthermore, removal of shade
trees from production systems hampers important ecosystem functions, which threatens long-
term agroecosystem sustainability and entrenches dependence upon external inputs.
Alternatively, high-diversity shade coffee production systems have been noted to support high
levels of biodiversity (Perfecto et al, 1996). Relative to other Central American countries, Costa
Rica has a relatively high proportion of land under modernized cultivation (Perfecto et al, 1996).
It is the smallholders of Costa Rica, for whom fully “modernized” technology was either not
accessible or appropriate, who have maintained less technologically-intensive production
systems that have helped maintain forest habitat and biodiversity. As Costa Rica has shifted
away from economic dependence on agro-exports and more towards eco-tourism, it could be
argued that this activity has been economically beneficial. Unfortunately, it is also this group that
has struggled the most in recent years to maintain livelihoods in coffee farming (Sick, 2008).
With the collapse of the managed international coffee market in 1989, in addition to
accelerated production in Vietnam and Brazil and stagnant demand in Western markets, the
![Page 34: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/34.jpg)
26
coffee crisis occurred (Petchers and Harris, 2008). Throughout the subsequent years, which have
seen volatile and supressed coffee prices, production costs have risen. Due to pressure from the
International Monetary Fund, Costa Rica devalued the colón in 1990, which resulted in higher
fertilizer and agro-chemical costs for producers (Sick, 1997). Though coffee no longer represents
Costa Rica’s primary agricultural export, as of 2008 it remained the primary crop for over 78,000
small-scale farmers in the country’s highlands (Sick, 2008). Such farmers have been placed in a
precarious position. They are highly vulnerable to large drops in price, especially given the at
least partial dependence of many on purchased fertilizer and agrochemical inputs.
One of the earliest responses of farmers to the coffee crisis was to cut back on fertilizers
and agrochemicals (Sick, 1997). Longer-term approaches have included conversion to low
external input farming systems, gaining certification for already-existent intercropped shade trees
and ecologically-sound management practices, re-incorporation of tree crops, and diversification
with other cash and/or subsistence crops (Samper, 2010). Such trends present opportunities for
the protection of biodiversity, improved watershed health, and reforestation (Perfecto et al,
1996), as well as the potential for ecologically and economically sustainable coffee production
for smallholders.
3.5 Conclusions
For over one hundred and fifty years, Costa Rican coffee smallholders have been in the
tenuous position of participating in the international commodity market. Despite market
fluctuations and domestic power imbalances within the sector, coffee has provided livelihoods
for generations of small-scale farmers. Since the coffee crisis, the viability of those livelihoods
![Page 35: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/35.jpg)
27
has been severely compromised. At this same time, the environmental consequences of
modernized coffee production are coming to light.
In the early years of Costa Rica’s social democracy, with hard-fought political, economic,
and social reform, the state established an active role in enhancing the coffee sector. While the
benefits of state-led modernization were not distributed entirely equally, there is no doubt of the
end result: Costa Rica became one of the most productive per-area coffee nations in the world.
Now that domestic and global economic and environmental conditions have changed, the
challenges facing the small-scale coffee producer are complex, and require a flexible range of
solutions. These solutions are dependent upon a foundation of agricultural knowledge and
technology – generated by public institutions for the public good – that will enable farmers to
adapt in ways that are both ecologically and economically sustainable.
The scientific research within this thesis aims to contribute to such a foundation.
Additionally, it is my hope that this chapter has made evident the importance of partnerships
between Canadian universities and public research institutions in the developing world towards
fostering more sustainable agricultural systems.
![Page 36: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/36.jpg)
28
Chapter 4 Site Description and Methodology
4.1 Site Description
The study was performed at an experimental coffee farm managed by the Centro
Agronómico Tropical de Investigación y Enseñanza (CATIE), located in Turrialba, Costa Rica.
The site is situated in a low altitude (685m above sea level), wet (3,200 mm annual rainfall
annually) coffee zone that lacks a distinct dry season (Haggar et al, 2011). The soil on site is
classified as both Typic Endoaquept and Typic Endoaquult, and is characterized as mixed
alluvial with poor-medium fertility; prior to 2000, it was in sugar cane production (Mora and
Beer, 2012). Coffee (Coffea arabica L. var. Caturra) was planted originally at a density of 8,000
plants per hectare. At the time of sampling (June 2012), coffee plants within the same row were
planted 1 m apart and rows were separated by a distance of 2 m (Figure 1). For those treatment
plots that included E. poeppigiana, trees were spaced every 12 m within a row and 8 m between
rows, which formed a 12 x 8 m repeating rectangular structural pattern. Additionally, a severely
coppiced E. poeppigiana existed in the middle of each 12 x 8 m rectangle (Figure 1). This is a
modification of the original 4 x 6 m tree spacing pattern that was reduced in 2007 in order to
manage shade levels (personal communication with Farm Manager).
Coffee bushes are stump pruned, typically every 3-5 years, based upon their productive
potential for following harvest (Haggar et al, 2011; pers. comm. with Farm Manager). Under all
sub-plot treatments except intensive conventional, pruning of E. poeppigiana is performed
biannually, leaving a minimum of three branches. All pruned material (branches and leaves) is
left to decompose on-site.
![Page 37: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/37.jpg)
29
At this site, the whole plot treatment is shade level, comprised of full sun (coffee
monoculture) and shade of a number of timber and N2-fixing shade trees, intercropped singly and
in combination with one another. Additionally, there are four sub-treatments, which are based on
varying degrees of nutrient inputs and pest management, two of which (medium conventional
and intensive organic) are described in Table 1. Three replicates were established to form a
randomized block design. For the purpose of this study, sampling was performed only from
coffee grown in monoculture (full sun) and coffee grown under the shade of Erythrina
poeppigiana (Walp.) O.F. Cook, a compact N2-fixing shade tree commonly used within Costa
Rican coffee systems. Under the former, samples were collected only from the moderate
conventional sub-plot treatment; under the latter, samples were collected from both moderate
conventional and intensive organic sub-plot treatments.
![Page 38: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/38.jpg)
30
Table 1. Fertilization and pest/weed control protocols at the experimental coffee farm of the
Centro Agronómico Tropical de Investigación y Enseñanza (CATIE)
Management Subplot Treatment
Medium conventional Intensive organic aSoil amendments
bAnnual inputs
Nitrogen (N)
Phosphorus (P)
Potassium (K)
200 kg ha-1 year-1 18–15–6–2
(N, P, K, Mg and B)
22.5 kg ha-1 year-1 NH4NO3
Foliar application: B, Zn
(once a year)
150 kg ha-1
10 kg ha-1
75 kg ha-1
20 tons ha-1 year-1 coffee pulp
7.5 tons ha-1 year-1 chicken manure
200 kg Kmag ha-1 year-1
200 kg phosphoric rock ha-1 year-1
287 kg ha-1
205 kg ha-1
326 kg ha-1
Disease control
Fungicide (2.4g L-1) Atemi or
copper sulfate (CuSO4), once
per year
No fungicide application
Weed control Regular mechanical removal
of weeds with string trimmer.
Herbicide application within
coffee rows (Round-up®
(10ml L-1))
No herbicide application. Mechanical
removal of weeds as required by string
trimmer
aAcquired from Mora and Beer, 2012. bDo not include nutrients recycled by E. poeppigiana or N inputted by nitrogen fixation
![Page 39: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/39.jpg)
31
4.2 Sample selection
Three coffee plants were selected within in each subplot from 3 different trees, for a total
of 9 plants per subplot (Figure 2): 9 under full sun with moderate conventional fertilization,
henceforth referred to as full sun-conventional (FS-C); 9 under E. poeppigiana with moderate
conventional fertilization, henceforth shade-conventional (S-C); and 9 under E. poeppigiana with
intensive organic fertilization, henceforth shade-organic (S-O). Shade trees were selected on the
basis of being a main Erythrina tree (see Figure 2 and 3) of average height and canopy size.
Coffee plants were selected based on the following criteria: minimum of 3 years since last stump
pruning, within 3m of E. poeppigiana trunk (Figure 2), directly under the tree’s canopy, and
deemed to represent average height and health for the subplot. Under FS-C, plants were selected
by using the above criteria and super-imposing the 12 x 8 m repeating pattern of the E.
poeppigiana (Figure 2). As no intensive organic treatment exists for full sun coffee due to
difficultly in establishing and maintaining monoculture coffee organically, it was not included.
Sampling was typically performed between the hours of 8am and 12pm in the month of June,
just prior to pruning of all Erythrina trees.
![Page 40: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/40.jpg)
32
Figure 2. Map of CATIE experimental coffee farm with delineation of sub-plots sampled as part
of study. Structural pattern of coffee grown in E. poeppigiana shade plots shown, along with
example of sampling within a single subplot.
![Page 41: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/41.jpg)
33
Figure 3. Coffee growing under E. poeppigiana shade (Block 3, Intensive Organic subplot, June
2012). Stump-coppiced tree in centre of picture; full-size Erythrina trees in a row on right side of
picture.
![Page 42: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/42.jpg)
34
4.3 Sampling protocol
After surface litter and detritus was cleared, 4 soil cores (8 cm diameter, 20 cm depth;
1000.7 cm3) were taken at 0-20 cm and 20-40 cm (block 2 only) depths at 25 cm from the base
of the each selected coffee plant. They were pooled to give one composite sample per plant, per
depth. From the pooled soil cores, rhizosphere soil was obtained from soil (less than 1 cm in
diameter) that adhered to coffee fine roots (<2 mm) after consistent gentle shaking. This was
performed on all fine roots present from all 4 cores except for very small fragments. Soils were
placed in thin, breathable plastic bags and placed in shade until further subsampling. Bulk
samples were obtained from pooled soil that was mixed thoroughly after rhizosphere soil and
fine root removal, and quartered on-site to a final wet mass of 100-300g. Nine rhizosphere soil, 9
bulk soil, and 9 fine root samples were obtained per shade-fertilization treatment (0-20 cm) and 3
samples each for rhizosphere soil, bulk soil, and fine roots per shade-fertilization treatment (20-
40 cm).
4.4 Soil nutrient analysis
Rhizosphere and bulk soils were placed in open containers and left to air-dry for 2-4
weeks, after which they were ground with a mortar and pestle and sieved to <2 mm. All analysis
was conducted simultaneously on bulk and rhizosphere soils. Air-dried soils were extracted for
orthophosphate with Bray’s 1 (1.5 g: 15 mL), shaken at high speed for 5 minutes, and filtered
through #1 Whatman filter paper. Nitrates and ammonium were extracted using 2M KCl (2.0 g:
20 mL; 1 g: 10 mL for 20-40cm samples due to limited sample mass), shaken for 30 minutes,
and filtered through #1 Whatman filter paper. Quantification was determined colourimetrically,
![Page 43: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/43.jpg)
35
using flow injection analysis (Lachat QuikChem). Soil pH was measured in a 1: 5 soil to water
solution with a pH meter (Mettler Toledo FiveEasy pH meter, Mississauga, Ontario).
Magnesium, calcium, and potassium were extracted simultaneously with ammonium
acetate at pH 7 (2 g: 20 mL; 1 g: 10 mL for 20-40cm samples). All extracts were shaken for 15
minutes, filtered through #1 Whatman filter paper, and quantified against certified elemental
standards using an atomic absorption spectrophotometer (Perkin Elmer AAnalyst 200).
Total N and C were determined using an Elemental Analyzer (Thermo Flash 2000,
Thermo Scientific, MA, USA). Samples were weighed to the thousandth of a milligram,
combusted at 1800 °C, and values were determined against a known standard (ascorbic acid). A
standard reference was placed at intervals of every 15 samples to provide a check for the
accuracy of readings.
4.5 Soil microbial analysis
Subsampling of soils for DNA extraction was performed within 2-6 hours of collection.
For rhizosphere soils, a subsample of approximately 0.5 g was obtained from soil within storage
bag that had fallen off of the roots. This soil was placed in a Ziploc bag and into a freezer (-
20°C) within 30 minutes. For bulk soils, the quartered subsample from the field was spread out
to a depth of 1 inch and 10-12 portions were randomly selected to a total mass of approximately
2g. This soil was placed in a Ziploc bag and into a freezer (-20°C) within 30 minutes.
Total community DNA was extracted using PowerSoil DNA Isolation Kit (MoBio
Laboratories, Carlsbad, CA, USA) within 2-4 weeks of freezing. Instructions were followed
according manufacturer’s protocol, with the exception that isolated DNA was eluted with 200
µL, not 100 µL, in the final step. Prior to the extraction procedure, fine root tissue was removed
from the sample with the use of ethanol-sterilized tweezers.
![Page 44: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/44.jpg)
36
4.5.1 Denaturing Gradient Gel Electrophoresis
Polymerase chain reactions (20 uL) were performed on soil DNA extracts using the
universal bacterial primer set of 341F (GC) and 907R (both at 10 µM). The GC represents the
GC clamp present in the 5’ end of the 341F primer, and has the following sequence: 5’-
CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG -3’. It is added to prevent
the complete dissociation of the two DNA strands and allows for improved detection of variants
in the sequence (Muyzer & Smalla, 1998). The PCR reactions were carried out in a PTC-100
thermal cycler (MJ Research Inc., St. Bruno, QC, Canada) under the following conditions: initial
denaturing at 95˚C for 5 minutes followed by 35 cycles of: denaturing at 95˚C for 1 min.,
annealing at 56˚C for 1 min. and extension at 72˚C for 1 min.; final extension at 72˚C for 10
minutes. A portion of the product (4 uL) was visualized on a 1% agarose gel to confirm
amplification and the remainder was run in a pre-prepared denaturing gradient gel. The 6%
polyacrylamide gel had a gradient of 40-70% denaturing solution and was run in a DGGE-2001
Tank (C.B.S. Scientific Co, Del Mar, CA, USA) in 0.5 X Tris-acetate-EDTA buffer for 20 hours
at 70V and 58˚C. The gel was stained with 15 uL of 0.5 mg mL-1 of ethidium bromide stain in
300 mL of 0.5X TBE buffer for 30 minutes before being visualized in a UV-light box. Images
were captured using a digital camera, saved, and uploaded to GelCompar II software (Applied
Maths, Austin, TX, USA).
4.5.2 Real-time PCR assays
Real-time quantitative PCR was performed using SYBR green chemistry (Kapa
Biosystems, Woburn, MA, USA). Each assay was conducted on a 96-well plate with 3 replicates
for each standard and sample. DNA was pooled by block for each soil fraction (rhizosphere and
![Page 45: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/45.jpg)
37
bulk) within each management treatment, with an equal quantity of DNA contributed from each
sample (i.e. n=9 for each treatment became n=3). All pooled DNA samples were diluted to 3
ng/µL. Amplification was performed in 20 µL reaction volumes (10.0 µL SYBR Green PCR
Master Mix, 8.2 µL water, 0.4 µL forward primer, 0.4 µL reverse primer, 1.0 µL template DNA).
PCR conditions were 10 min at 95 ºC, followed by 45 cycles of 95 ºC for 30s, 45s at 58 ºC, and
72 ºC for 30s, followed by a dissociation curve stage of 15 s at 95 ºC, 30 s at 60 ºC and 15 s at 95
ºC. The 7300 Real-time PCR system (Applied Biosystems, CA, USA) was used with a threshold
level of Delta Rn = 0.2. Amplicon specificity was confirmed by dissociation curve characteristics
and by performing gel electrophoresis on a 1% agarose gel.
A relative standard curve method was used to perform relative quantification of samples.
The universal bacterial primer pair 341F (no GC clamp) and 907R was used as an endogenous
control for which cycle number at threshold (CT) values of the target gene (amoA) was
normalized against. The primers amoA-1F (5’-GGGGTTTCTACTGGTGGT - 3’) and amoA-2R
(5’- CCCCTCKGSAAAGCCTTCTTC - 3’), which amplify a region of the ammonia oxygenase
gene in ammonia-oxidizing bacteria, were used (Rotthauwe et al, 1997). An environmental soil
sample known to be positive for amoA was diluted and used as a standard. Two-fold dilutions
from 1x to 0.010x (16s) and 1x to 0.050x (amoA) concentrations of amoA-positive control were
used to create 5 and 4-point standard curves, respectively. All sample CT values for both 16s and
amoA amplifications fell within the range of the standard curves.
Triplicate results of real-time PCR CT values were averaged. Standard error of triplicate
CT values was calculated for each sample, and those that had a SE greater than 0.5 were re-
assayed. Relative gene abundance of amoA was determined by comparing average CT value of
the sample against a linear regression of the standard CT as a function of dilution factor. Values
![Page 46: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/46.jpg)
38
for amoA were normalized by dividing each sample’s quantity of template amoA DNA (as
calculated from the standard curve) by the standard curve-derived value of its endogenous
control (16s).
4.6 Statistical analyses
Paired t-tests were used to assess mean difference between rhizosphere and bulk soil for
all nutrients within treatments. Two-sample t-tests were used to assess differences in the
magnitude of rhizosphere effect ([(Rhizosphere-Bulk)/Bulk]*100%) between treatments.
Comparisons were made between two shade levels with fertility held constant (FS-C to S-C) and
between two fertility levels with shade held constant (S-C to S-O). Correlations were performed
between soil chemical parameters and between chemical parameters and amoA abundance, both
within individual soil fractions and with rhizosphere and bulk soil pooled.
Denaturing gradient gel electrophoresis profiles were analyzed by cluster analysis.
Curve-based clustering was performed using the Pearson correlation coefficient and similarities
displayed as a dendrogram. The unweighted pair group with mathematical averages (UPGMA)
method was used to calculate the dendrogram. Analyses were performed using Gel Compar II
software (Applied Maths, Austin, TX, USA).
Normality of residuals was tested using the Shapiro-Wilk test. Data was log-transformed
to correct for non-normality. The Lund's Critical Value was compared with the highest absolute
value of the data set to test for outliers; any outliers found were removed. All statistical analyses
were performed using SAS version 9.2 (SAS Institute Inc. Cary, NC, USA). A type I error rate
was set at 0.05 for all statistical tests.
![Page 47: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/47.jpg)
39
Chapter 5 Results
5.1 Bulk soil chemical characteristics
Soils fertilized conventionally under shade had lower pH, lower available P, and higher
nitrate and exchangeable potassium at 0-20cm (Table 2). Soil in shade-tree plots under organic
management had much higher pH, approximately ten-fold greater available P, and more
exchangeable calcium and magnesium than conventionally-fertilized shade plots at 0-20cm
(Table 2).
5.2 Rhizosphere effects on nutrient properties
In general, soil nutrients were present in greater quantities in rhizosphere soil compared
to bulk soil. Rhizosphere soil of coffee under all management treatments had higher total N (P =
0.005), total C (P = 0.003), NO3- (P <0.0001), NH4
+ (P <0.0001), available P (P <0.0001), Ca2+
(P = 0.0006), Mg2+ (P <0.0001), and K+ (P = 0.005) concentrations than bulk soil under all
management treatments at 0-20cm soil depth (Table 3). There was no significant difference,
however, between pH of rhizosphere and bulk soil at 0-20cm. Deeper in the soil profile, at 20-
40cm soil depth, total N (P = 0.031), NO3- (P = 0.014), NH4
+ (P <0.0001), and exchangeable
Mg2+ (P = 0.006) and K+ (P = 0.04) were significantly greater in the rhizosphere soil fraction
(Table 3). There were no significant differences between rhizosphere and bulk soil at 20-40cm
for exchangeable Ca2+ or available P. Relative amoA abundance did not differ significantly
between rhizosphere and bulk soil at either soil depth.
![Page 48: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/48.jpg)
40
Table 2. Soil pH, NO3-, NH4
+, available P, and exchangeable Ca2+, Mg2+, and K+ concentrations
in bulk soil under full sun management with conventional fertilization (FS-C), shade with
conventional fertilization (S-C), and shade with organic fertilization (S-O) at 0-20cm.
Treatment pH NO3
-
(mg kg-1)
NH4+
(mg kg-1)
PO43-
(mg kg-1)
Ca2+
(cmol+ kg-1)
Mg2+
(cmol+ kg-1)
K+
(cmol+ kg-1)
FS-C 5.12 ± 0.21 0.76 ± 0.10 1.63 ± 0.16 3.82 ± 0.21 0.315 ± 0.034 0.154 ± 0.008 0.077 ± 0.008
S-C 4.88 ± 0.16 1.37 ± 0.22 1.18 ± 0.18 2.57 ± 0.25 0.297 ± 0.041 0.135 ± 0.013 0.270 ± 0.061
T-test * * * *
S-C 4.88 ± 0.16 1.37 ± 0.22 1.18 ± 0.18 2.57 ± 0.25 0.297 ± 0.041 0.135 ± 0.013 0.270 ± 0.061
S-O 7.14 ± 0.04 1.19 ± 0.17 1.22 ± 0.07 23.40 ± 1.94 1.651 ± 0.072 0.393 ± 0.010 0.262 ± 0.044
T-test ** ** ** **
* Denotes significant difference between bulk and rhizosphere soils at P<0.05
** Denotes significant difference between bulk and rhizosphere soils at P<0.01
![Page 49: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/49.jpg)
41
Table 3. Soil chemical and biological properties of rhizosphere and bulk soil of coffee under all
treatments (pooled) at 0-20cm and 20-40cm soil depths. Values are mean ± SE and sample size
refers to number of samples within a soil fraction (rhizosphere or bulk) at a given soil depth.
Parameter Sample
size
0-20cm soil depth Sample
size
20-40cm soil depth
Rhizosphere Bulk Rhizosphere Bulk
% N α5 a0.58 ± 0.07 b0.36 ± 0.04 β6 a0.29 ± 0.04 b0.20 ± 0.01
% C 5 a5.59 ± 0.67 b3.45 ± 0.36 - - -
pH 27 a5.66 ± 0.21 a5.71 ± 0.20 - - -
NO3-
(mg kg-1) 27 a2.29 ± 0.30 b1.11 ± 0.11 9 a4.23 ± 1.20 b0.536 ± 0.087
NH4
+
(mg kg-1) 27 a3.26 ± 0.26 b1.34 ± 0.09 9 a4.91 ± 0.51 b1.21 ± 0.15
PO4
3-
(mg kg-1) 27 a17.76 ± 3.53 b9.93 ± 1.97 9 a2.68 ± 1.09 a3.63 ± 0.79
Ca2+
(cmol+ kg-1) 27 a0.957 ± 0.174 b0.754 ± 0.128 9 a0.577 ± 0.089 a0.577 ± 0.085
Mg2+
(cmol+ kg-1) 27 a0.380 ± 0.039 b0.228 ± 0.024 9 a0.203 ± 0.013 b0.156 ± 0.011
K+
(cmol+ kg-1) 27 *a0.287 ± 0.040 *b0.203 ± 0.030 9 a0.138 ± 0.018 b0.096 ± 0.013
Relative
amoA
abundance
9
a0.482 ± 0.048
a0.425 ± 0.032
3
a0.318 ± 0.027
a0.287 ± 0.052
a Different letters between rhizosphere and bulk soil per depth represent significant difference at
P < 0.05 (Paired t-test) α Includes 2 rhizosphere-bulk paired samples full sun coffee with conventional fertilization, 1
from shaded coffee with conventional fertilization, and 2 from shaded coffee with organic
fertilization β Only includes samples from shade and full sun coffee with conventional fertilization
![Page 50: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/50.jpg)
42
5.2.1 Rhizosphere effects on nutrient properties within management treatments
Concentrations of soil NO3- within each of the three management treatments was
significantly greater (FS-C: P = 0.009; S-C: P = 0.0001; S-O: P = 0.013) in rhizosphere
compared to bulk soil at 0-20cm soil depth (Figure 4a). Soil NH4+ within each of the three
management treatments was also significantly greater (FS-C: P <0.0001; S-C: P = 0.0002; S-O:
P <0.0001) in rhizosphere soil (Figure 4a). Similarly, at 0-20cm there was a significant
accumulation (FS-C: P =0.024; S-C: P = 0.0004; S-O: P <0.0001) of available P in rhizosphere
soil within each management treatment (Figure 4a). At 20-40cm soil depth, a similar trend was
observed under all treatments (Figure 4b), though significant differences for NO3- existed
exclusively for coffee under shade with conventional fertilization (P = 0.005) and in
conventionally fertilized plots (FS-C: P = 0.017; S-C: P = 0.02) for NH4+. Available P in bulk
soil, however, was greater than rhizosphere P, though only significantly so for coffee grown
under full sun with conventional fertilization (P = 0.014) (Figure 4b).
Differences between rhizosphere and bulk soil in pH were not observed at 0-20cm except
under FS-C management, in which rhizosphere soil had a significantly lower (P = 0.0012) pH
(Table 4). Rhizosphere exchangeable magnesium was significantly greater (FS-C: P = 0.0006; S-
C: P <0.0001; S-O: P <0.0001) under all treatments at 0-20cm than bulk soil and under FS-C (P
= 0.044) at 20-40cm (Table 4). Despite consistent indications of enhanced exchangeable
potassium in the rhizosphere across treatments and depth categories, the only significant
accumulation of K+ in the rhizosphere was only observed under FS-C management at 0-20cm (P
= 0.0002) (Table 4).
![Page 51: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/51.jpg)
43
Figure 4. Mean NO3-, NH4
+, and available P concentrations in bulk and rhizosphere soil of coffee
under all three management treatments (FS = full sun; S = shade; C = conventional fertilization;
O = organic fertilization) at (a) 0-20cm depth and (b) 20-40cm depth. Significant differences
between rhizosphere and bulk soils within management treatments are indicated by different
letters (paired t-test, P <0.05). Bars represent ± SE; n=9 per soil fraction for 0-20cm; n=3 per soil
fraction for 20-40cm.
a
aa
b
bb
0
1
2
3
4
5
6
7
FS-C S-C S-O
NO
3-(m
g kg
-1)
a
a
a
a
bb b
0
1
2
3
4
5
6
7
FS-C S-C S-O
NH
4+(m
g kg
-1)
a a
a
bb
b
0
5
10
15
20
25
30
35
40
45
FS-C S-C S-O
Ava
ilab
le P
(m
g kg
-1)
a
a
a
a b a
0
1
2
3
4
5
6
7
FS-C S-C S-O
NO
3-(m
g kg
-1)
ba
a
a
b
b a
0
1
2
3
4
5
6
7
FS-C S-C S-O
NH
4+(m
g kg
-1)
a a
a
ab
a
0
5
10
15
20
25
30
35
40
45
FS-C S-C S-O
Ava
ilab
le P
(m
g kg
-1)
![Page 52: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/52.jpg)
44
Table 4. Soil pH and exchangeable base cation concentrations (mean ± SE) in bulk and
rhizosphere soil at 0-20cm (n=9 per management treatment, per soil fraction) and 20-40cm depth
(n=3 per management treatment, per soil fraction).
Depth Management
treatment Soil fraction pH Ca2+ (cmol+ kg-1) Mg2+ (cmol+ kg-1) K+ (cmol+ kg-1)
0-20 cm FS-C Bulk 5.12 ± 0.07 0.315 ± 0.034 0.154 ± 0.008 0.077 ± 0.008
Rhizosphere 4.98 ± 0.08 0.317 ± 0.058 0.238 ± 0.021 0.131 ± 0.013
Paired t-test * * *
S-C Bulk 4.88 ± 0.05 0.297 ± 0.041 0.135 ± 0.013 0.270 ± 0.060
Rhizosphere 4.85 ± 0.06 0.381 ± 0.041 0.258 ± 0.019 0.377 ± 0.096
Paired t-test *
S-O Bulk 7.14 ± 0.04 1.65 ± 0.07 0.393 ± 0.010 0.262 ± 0.044
Rhizosphere 7.13 ± 0.06 2.17 ± 0.11 0.647 ± 0.020 0.350 ± 0.044
Paired t-test ** **
20-40 cm FS-C Bulk - 0.483 ± 0.069 0.123 ± 0.016 0.098 ± 0.037
Rhizosphere - 0.470 ± 0.086 0.181 ± 0.029 0.108 ± 0.020
Paired t-test *
S-C Bulk - 0.352 ± 0.019 0.168 ± 0.009 0.071 ± 0.008
Rhizosphere - 0.371 ± 0.030 0.201 ± 0.015 0.127 ± 0.015
Paired t-test
S-O Bulk - 0.892 ± 0.043 0.178 ± 0.012 0.114 ± 0.012
Rhizosphere - 0.888 ± 0.108 0.228 ± 0.020 0.175 ± 0.045
Paired t-test
* Denotes significant difference between bulk and rhizosphere soils at P <0.05
** Denotes significant difference between bulk and rhizosphere soils at P <0.01
![Page 53: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/53.jpg)
45
5.2.2 Magnitude of rhizosphere effect on soil nutrients
The mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) was
significantly greater for coffee grown under shade with conventional fertilization (S-C) than
coffee grown in full sun with conventional fertilization for NO3- (P = 0.0135), NH4
+ (P = 0.0324)
and exchangeable magnesium (P = 0.0169) (Figure 5). The magnitude of the rhizosphere effect
was greater under conventionally fertilized shaded coffee than full sun coffee for available P (P
= 0.1121) and exchangeable calcium (P = 0.0553), though not significantly so. There were no
significant differences in mean percentage rhizosphere effect for coffee grown under organically
versus conventionally fertilized shade treatments, though exchangeable magnesium (P = 0.0509)
and available P (P = 0.1501) tended towards accumulation in the rhizosphere under conventional
fertilization (Figure 5).
5.3 Relative quantification of bacteria
5.3.1 Relative amoA gene abundance
Differences in bacterial amoA gene abundance (as normalized to total bacteria
abundance) were detected between soil fractions and between treatments. While the relative
abundance of amoA did not differ with the incorporation of shade under conventional
fertilization, it was significantly greater in bulk soil (P = 0.0327) of organic versus
conventionally-fertilized shade treatments at 0-20cm (Table 5). The only significant difference
between rhizosphere and bulk soil at 0-20cm was found under organic fertilization, in which
rhizosphere amoA abundance (0.609 ± 0.090) was significantly greater (P = 0.0396) than bulk
soil (0.531 ± 0.075).
There were no significant differences between shade and fertilization treatments on the
magnitude of the rhizosphere effect on amoA abundance at 0-20cm. A mean positive effect was
observed in plots with shade (S-C and S-O); due to the high variance under S-C, only S-O had a
![Page 54: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/54.jpg)
46
Figure 5. Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee
grown under FS-C, S-C, and S-O management treatments (FS = full sun; S = shade; C =
conventional fertilization; O = organic fertilization) at 0-20cm depth (n=9 per management
treatment). Significant differences in magnitude of rhizosphere effect between FS-C and S-C are
denoted by different lower case letters (t-test, P <0.05) and by upper case letters between S-C
and S-O (t-test, P <0.05). Bars represent standard error of the mean.
-50
0
50
100
150
200
250
300
% R
hiz
osp
her
e Ef
fect
FS-C
S-C
S-O
a
a
a
a
a
a
bA A
bA
A
bA
A
bA
A
bA
A
aA
A
NO3
-
NH4
+ PO4
3- Ca
2+ Mg
2+ K
+
![Page 55: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/55.jpg)
47
Table 5. amoA abundance (relative to total bacteria) in rhizosphere and bulk soil fractions across
all three management treatments at 0-20cm. Data are means (n=3 per management treatment, per
soil fraction) ± SE of samples pooled by block before real-time PCR assay (n=3 per block, per
soil fraction). Note, S-C values are used twice in t-tests as the common treatment combination to
comparisons in which i) fertility and ii) shade are held constant.
Relative abundance of amoA
Management Rhizosphere soil Bulk soil
FS-C 0.368 ± 0.056 aA 0.392 ± 0.017 aA
S-C 0.470 ± 0.088 aA 0.368 ± 0.056 aA
S-C 0.470 ± 0.088 aA 0.368 ± 0.056 aA
S-O 0.609 ± 0.090 aA 0.531 ± 0.075 bB
a – rows are not significantly different with same lower case letter
(paired t-test; P <0.05)
A – columns with same upper case letter are not significantly different
between treatment (t-test; P <0.05)
![Page 56: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/56.jpg)
48
statistically significant positive rhizosphere effect (Figure 6). Soils under coffee grown in full
sun with conventional fertilization (FS-C) did not show a significant mean rhizosphere effect on
amoA abundance at 0-20cm.
5.3.2 Correlates of soil chemical and biological parameters
Exclusively for the 0-20cm soil depth, under conventionally fertilized full sun coffee
rhizosphere soil NO3- was significantly positively correlated (r = 0.828; n = 9; P = 0.006) with
pH (Figure 7). Significant correlations between pH and NO3- were not observed in bulk soil
under conventionally fertilized full sun coffee or in either soil fraction under any other treatment
(see Appendix for correlation coefficient matrices). Relative amoA relative abundance was
positively correlated (r = 0.830; n = 11; P = 0.0016) with soil pH under conventional fertilization
when bulk and rhizosphere soils were analyzed together (Figure 8). Although it was expected to
find a similar trend under organic fertilization (for which pH ranged from 6.8 to 7.3), there was
no significant correlation between amoA abundance and pH for pooled bulk and rhizosphere soil.
5.4 Bacterial community structure in bulk soil
Denaturing gradient gel electrophoresis was performed on bulk soil samples (0-20 cm
depth) from all three management treatment combinations (Figure 9a). Clustering analysis
(independent of band intensity) revealed approximately 85% similarity between DGGE banding
patterns of organically and conventionally managed soils (Figure 9b). Amongst soils managed
with shade and organic fertilization, bacterial banding patterns shared 95% or greater similarity.
There was no distinct clustering by shade level (FS-C vs. S-C) (Figure 9b), and all
conventionally managed soils shared more than 91% similarity in banding patterns.
![Page 57: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/57.jpg)
49
Figure 6. Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) on amoA
gene abundance relative to total bacteria abundance at 0-20cm (n=3 per treatment; bars are
standard error). Significant difference between conventionally fertilized full sun and shade
treatments denoted by lower case letters; between organic and conventional fertilization by
capital letters (t-test; P <0.05). Asterix denotes a significant rhizosphere effect (t-test; P <0.05).
![Page 58: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/58.jpg)
50
Figure 7. Rhizosphere soil NO3- concentration (mg kg-1) in relation to soil pH at 0-20cm soil
depth under FS-C management (n=9).
0
0.5
1
1.5
2
2.5
4.6 4.7 4.8 4.9 5 5.1 5.2 5.3 5.4 5.5
NO
3-(m
g kg
-1)
pH
r = 0.828
p = 0.006
![Page 59: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/59.jpg)
51
Figure 8. Relative amoA gene abundance as a function of pH in bulk and rhizosphere soil at 0-
20cm as pooled by fertilization treatment (FS-C + S-C; n=11, one outlier removed). Data points
represent block mean values for amoA and pH. Bars represent standard error (n=3) of mean pH
values.
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
4.6 4.7 4.8 4.9 5.0 5.1 5.2 5.3 5.4 5.5
Rel
ativ
e am
oA
ab
un
dan
ce
pH
r = 0.830p = 0.002
![Page 60: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/60.jpg)
52
Figure 9. (a) DGGE profiles of
16S ribosomal DNA obtained
using universal bacterial primers
from bulk soil (0-20 cm) from
all three treatments
combinations (FS-C, S-C, S-O).
Lanes 2-6 represent samples
from FS-C; lanes 7-9 represent
samples from S-C; and lanes 10-
12 are samples from S-O. Lanes
1 and 14 are an identical profile
from S-O, used as a ladder for
normalization. (b) DGGE-
derived dendogram (without
lanes 1, 2, 3, or 14), as
determined by unweighted pair
group method with arithmetic
mean (UPGMA).
a
b
![Page 61: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/61.jpg)
53
Chapter 6 Discussion
6.1 Rhizosphere effects on nutrient availability
6.1.1 Rhizosphere effects on mineral N availability
I hypothesized that mineral nitrogen concentrations would be higher in rhizosphere soil
of coffee relative to bulk soil under all shade and nutrient treatments. When pooled, my data
supported this hypothesis for ammonium and nitrates at 0-20cm and 20-40cm soil depth. As
Zhao et al (2010) assert, accumulation or depletion of extractable nutrients in rhizosphere soil is
governed by the balance between rates of extractable nutrient release and uptake by plants and
microorganisms. In my study, accumulation of ammonium in the rhizosphere of coffee indicates
that rates of N mineralization was exceeding ammonium uptake by coffee roots and
immobilization by microorganisms at the time of sampling. Similarly, accumulation of nitrate in
rhizosphere soil suggests that rates of nitrification were out-pacing root and microbial uptake of
nitrates.
There are several possible explanations for these phenomena. Dijkstra et al (2009)
observed a positive relationship between plant-released carbon and gross N mineralization, and
others (Phillips and Fahey, 2006; Zhao et al, 2010) have accounted for enhanced mineralization
rates with rhizodeposition. Although it is a herbaceous species, increased root exudation by
Kentucky bluegrass (Poa pratensis) was found to stimulate microbial activity, which resulted in
higher soil inorganic N (Hamilton and Frank, 2001). Thus, enhanced mineral N concentrations in
the rhizosphere may simply be a function of enhanced mineralization of native soil organic
matter.
![Page 62: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/62.jpg)
54
Accumulated rhizosphere ammonium may also be explained by root-zone feeding of soil
microfauna on bacteria (Ingham, 1985). This phenomenon is known to occur in spatially discrete
regions, including the rhizosphere, and has been estimated to account for approximately 30% (on
average) of total net nitrogen mineralization across various temperate ecosystems (Griffiths,
1994). Herman et al (2006), however, could not explain enhanced rates of gross N mineralization
in rhizosphere soil of slender wild oats through bacterial and protozoa population dynamics.
Given that the populations of bacterial-feeders are controlled by losses of soluble carbon from
roots (Griffiths, 1994), it seems possible that enhanced exudation of coffee under shade could
result in greater bacterial predation and mineral N turnover in the rhizosphere relative to coffee
under full sun in my system. Unfortunately, an investigation of the potential mechanisms of
rhizosphere nitrogen availability was beyond the scope of my study.
The accumulation of nitrate in rhizosphere soils of coffee indicates that, in general,
nitrate in-flow by mass flow and diffusion and its production by nitrification occurred at greater
rates than root uptake or microbial nitrate immobilization. This finding disagrees with Zhao et al
(2010), who, despite measuring enhanced potential net nitrification, found depleted nitrate
concentration in the rhizosphere of three different tree species. They suggest that in N-limited
soils such as theirs, N-limitation in the rhizosphere may result in microbe-mediated N
immobilization (Zhao et al, 2010). Clearly, this was not the case at my site. Additionally, as
drainage was sufficient on site due to the presence of deep trenches, denitrification was not
considered to be a significant factor in N transformation. The trend towards greater relative
ammonia-oxidizing bacteria abundance in rhizosphere soil under shade treatment at 0-20cm,
though only statistically significant under organic fertilization, partially supports the observation
of enhanced NO3- in the rhizosphere.
![Page 63: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/63.jpg)
55
6.1.2 Rhizosphere effects on available P
Accumulation of available P was observed in the rhizosphere of coffee across all
management treatments at 0-20cm soil depth, which supports my hypothesis. There are several
possible explanations for this observation. Under organic fertilization, in which soil pH values
ranged from 6.8 to 7.4, rhizosphere acidification through root H+ release stood as a possible
mechanism by which P availability could have been enhanced in the rhizosphere. At 0-20cm soil
depth under shade with organic fertilization, however, rhizosphere acidification relative to bulk
soil was not observed, nor was a significant correlation between available P and pH in the
rhizosphere. Under conventional fertilization, in which soil pH values ranged from 4.7 to 5.4,
coffee rhizosphere acidification relative to bulk soil was observed under full sun management at
0-20cm soil depth. Despite this, acidification at such a low soil pH is not typically associated
with enhanced P availability, which typically occurs between pH 5.5-7 (Hinsinger et al, 2003).
Additionally, there was no significant correlation under conventionally fertilized soils between
pH and available P. Therefore, I assert that P accumulation in the rhizosphere was not directly
related to pH under either conventional or organic fertilization.
In previous studies, rhizosphere P accumulation was attributed to increased acid
phosphatase activity (Zhao et al, 2010) and organic acid exudation (Gobran and Clegg, 1998),
the latter through formation of stable aluminum complexes. Enhanced phosphatase activity has
been observed in rhizosphere compared to bulk soil across a variety of species, and phosphatase
release is believed to be a general plant response to P deficiency (Richardson et al, 2009).
Additionally, organic anions (which are similar to organic acids), are known to facilitate P
mobilization via desorption and chelation of cations (Richardson et al, 2009). As with mineral N
accumulation, enhanced rhizosphere P may also simply be a function of the priming effect of
![Page 64: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/64.jpg)
56
rhizodeposition on making P plant-available from native soil organic matter (Hinsinger et al,
2009). I did not include measurement of such processes within my study; nevertheless, my
results demonstrate that P availability (at 0-20cm) is determined by more than the balance
between uptake and diffusion.
Deeper in the soil profile at the 20-40cm soil depth, rhizosphere P was not significantly
different on average between bulk and rhizosphere soil fractions when treatments were pooled. It
was, however, significantly depleted in coffee plants under conventionally fertilized shade
management. As Richardson et al (2009) state, orthophosphate diffusion is insufficient to
overcome root-zone gradients in most soils. In this case, it is possible that root release of acid
phosphatase and/or C exudation to stimulate microbial solubilizing and cycling activity did not
occur to the same extent at a lower depth under this particular treatment combination. This
resulted in P mobilization rates that did not keep pace with root uptake in the rhizosphere.
Phosphorus depletion has been observed by others, including Turpault et al (2005) in the
rhizosphere of mature Douglas fir. The difference in rhizosphere soil available P in
conventionally fertilized coffee plants by depth may be explained in terms of resource allocation
patterns within the coffee plant. Given a presumably greater pool of mineral and organic
unavailable P higher in the soil profile, coffee plants may allocate more metabolic resources – in
the form of phosphatase and C exudates to stimulate microbial activity – to phosphorus
acquisition at 0-20cm than 20-40cm. This remains an open question, however, and the spatial
distribution of soil P dynamics an interesting area for further research.
![Page 65: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/65.jpg)
57
6.1.3 Rhizosphere effects on exchangeable base cation concentrations
When pooled across management treatments, base cations were significantly accumulated
in rhizosphere soil at both depths (except calcium at 20-40cm). This agrees with my original
hypothesis. Once again, enhanced decomposition of native soil organic matter may partially
explain this phenomenon. Turpault et al (2005), who observed increased exchangeable base
cations in rhizosphere soil, stated that increased organic C due to root exudation results in
increased exchangeable base cation concentrations. Gobran and Clegg (1996) also found
increased base saturation in rhizosphere soil, in a mature Norway spruce stand. They explained
the observation by arguing that increased electrical conductivity reduces organic matter
ionization and decreases aluminum complexation in rhizosphere soil (Gobran and Clegg, 1996),
which can in turn open up space for base cations. Additionally, as Hinsinger et al (2009) state,
rhizosphere accumulation of calcium, magnesium, and sometimes potassium may also occur
simply due to their movement in soil solution via mass flow exceeding plant demand.
6.2 Management treatment effects on the magnitude of the rhizosphere effect
In the above section I discussed general differences in nutrient availability in rhizosphere
and bulk soil, regardless of shade and fertility management practices. In the next section, I
consider how shade tree incorporation and fertilization regime effect the magnitude of
differences between rhizosphere and bulk soil. To do so, I draw upon broader ecological
literature and incorporate my findings on soil biological activity.
6.2.1 The effect of shade trees
The magnitude of the rhizosphere effect was significantly greater under shade coffee than
full sun coffee for all plant-available nutrients and exchangeable base cations except potassium.
![Page 66: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/66.jpg)
58
This finding is consistent with my hypothesis, which was that the difference between rhizosphere
and bulk soil nutrient concentrations would be greater under shade, due to induced modifications
in coffee physiology. There are a number of possible mechanisms by which the incorporation of
N2-fixing E. poeppigiana shade trees in the shade treatments of this study contributed to a greater
positive difference between rhizosphere and bulk soil nutrient properties.
6.2.1.1 Ammonium
The most probably explanation for the difference in rhizosphere effect on ammonium
concentration is underpinned by different photosynthetic capacity observed under shade versus
full sun coffee (Campbell, 2012). As others have noted, the quantity of carbon assimilated by
plants is determined by photosynthetic rates, and as such, photosynthetic capacity should modify
root exudation (Grayston et al, 1996). At the study site, coffee grown under shade was shown to
have enhanced photosynthetic rates in both low and high light conditions as compared to full sun
coffee (Campbell, 2012). Kuzyakov and Cheng (2001) demonstrated the tight coupling of
rhizosphere respiration (i.e. root respiration and rhizomicrobial respiration of exudates and dead
roots) with plant photosynthetic capacity. Reductions in exuded C were observed with reduced
photosynthesis, which in turn led to a subsequent decrease of the rhizosphere priming effect (the
ability of microbes to decompose additional soil organic matter in the root zone) (Kuzyakov and
Cheng, 2001). Although the mechanisms by which photosynthetic capacity is enhanced under
coffee-shade intercropping system are unique and more nuanced, the relationship between
photosynthetic capacity and acceleration of native soil organic matter decomposition in the
rhizosphere is clear.
![Page 67: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/67.jpg)
59
As previously mentioned, Dijkstra et al (2009) have demonstrated that plant available N
is directly linked with root-primed soil C, which itself is a function of the quantity of C exuded
by roots. This relationship only existed, however, when soil inorganic N concentrations were low
(Dijkstra et al, 2009). Under conventional fertility management, coffee at the site under study in
this thesis is fertilized with one-half the optimal inorganic N recommended for optimal
production (Haggar et al, 2011). One could therefore argue that similarly to the low soil N
observed in the study of Dijkstra et al (2009), N availability under conventionally fertilized soils
is growth-limiting. Though it was beyond the scope of this study to estimate C exudation, shaded
coffee may have enhanced ammonium availability in the rhizosphere relative to full sun coffee
due to enhanced rhizodeposition.
Additionally, inputs of organic matter from shade tree prunings and litter-fall may be
responsible for observed differences in rhizosphere effects between shade and full sun coffee.
Decomposable organic C is a soil factor than significantly influences the rhizosphere priming
effect (Pausch et al, 2013). A greater percentage of organic matter in the soil represents a larger
pool of mineralizable N, particularly if it includes additional inputs of N via biological N2-
fixation derived from E. poeppigiana. While measurements at the site from 2004 (Haggar et al,
2011) indicate that shade tree incorporation did not appreciably increase soil organic matter
content at 0-10cm depth relative to full sun plots, much may have changed since then. In a 10-
year-old cacao agroforestry system with E. poeppigiana, Beer et al (1990) observed a 24
ton/hectare increase in soil organic matter reserve over 0-45cm depth over a 10-year period of
shade tree intercropping. In my study, soil was sampled exclusively from coffee plants within 3m
of the N2-fixing shade tree, underneath its canopy. As one would imagine, organic matter
contribution of shade trees through litter-fall is spatially heterogeneous; it is concentrated close
![Page 68: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/68.jpg)
60
to the tree (Rao, 1998). Unfortunately, I did not perform analysis of soil organic matter content;
thus, its effects on the magnitude of the rhizosphere effect on ammonium concentration are
unknown. A recent study on N2-fixation capacity at my study site concluded that these shade
trees are fixing up to 40% of their N from atmospheric sources, though exclusively under the
organic fertilization regime (Campbell et al, 2013). It is presumable that some of this N source,
which is absent under full sun management, is stimulating both soil N dynamics and coffee plant
growth.
6.2.1.2 Nitrate
The magnitude of the rhizosphere effect on nitrate concentration was substantially greater
under conventionally-fertilized shade coffee than full sun coffee. As no other known studies have
been performed on coffee rhizosphere nutrient properties, there is no direct basis for comparison
of this observation. Zhao et al (2010), however, found significantly different magnitudes of
rhizosphere effects on net nitrification rates under mature Siberian elm, Simon poplar, and
Mongolian pine tree species. Despite finding greater net nitrification rates in the rhizosphere
under all three species, nitrates were universally found to be depleted in rhizosphere soil, thus
indicating faster rates of nitrate uptake than nitrification (Zhao et al, 2010). This study was
conducted in monoculture tree stands, however, with no ability to compare the effects of a
secondary species, in my case a shade tree, on rhizosphere properties.
In my study, I found significant correlations between soil chemical and biological
parameters that help explain the observed difference in magnitude of rhizosphere effect on
nitrate concentration between shade treatments. The mean ratio of ammonium to nitrate
concentration in rhizosphere soil of full sun coffee was quite high relative to shaded coffee at 0-
![Page 69: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/69.jpg)
61
20cm soil depth. Within rhizosphere soil of conventionally fertilized, full sun coffee – the only
management treatment in which significant acidification of rhizosphere soil was observed – there
was a significant positive correlation between nitrate concentration and pH. Additionally, the
relative abundance of ammonia-oxidizing bacteria (AOB), as estimated by the relative
abundance of the amoA gene, was positively correlated with pH across bulk and rhizosphere
soils under conventional fertilization.
Taken together, these relationships suggest an association between acidity of rhizosphere
soil of coffee under conventional, full sun management and suppressed nitrification rates.
Alteration of pH is well known by-product of ammonium uptake. Net release of protons occurs
as a result of ammonium uptake and can lead to rhizosphere acidification (Hinsinger et al, 2009;
Richardson et al, 2009). Previous research on Douglas fir trees found that higher ammonium
relative to nitrate in rhizosphere soil resulted in a lower rhizosphere pH (Wang and Zabowski,
1998). Acidity also affects the activity of AOB. In fact, significant batch growth of ammonia
oxidizing bacteria in liquid growth media rarely occurs below pH 7 (Nicol et al, 2008) and rates
of nitrification and ammonia oxidation are significantly depressed in acid soils (de Boer and
Kowalchuk, 2001).
In addition to the effect of ammonium uptake on pH levels, reduced ammonium
availability decreases AOB populations (Okano et al, 2004; Cavagnaro et al, 2008). Thus, the
positive correlation between pH and AOB abundance may be an indirect reflection of
ammonium uptake rates on AOB populations. Indeed, pH alone did not seem to govern AOB
abundance or rhizosphere nitrate concentrations: higher mean AOB abundance was found in the
rhizosphere of conventionally-fertilized shaded coffee, despite its lower mean pH values than in
the rhizosphere of conventionally-fertilized full sun coffee. Additionally, the mean rhizosphere
![Page 70: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/70.jpg)
62
effect on AOB abundance under conventionally-fertilized shaded (positive) and full sun coffee
(negative) accurately reflected differences in the magnitude of the rhizosphere effect on nitrate
concentration. Further, it supports the utility of using AOB population abundance to explain
differences in rhizosphere nitrate concentrations under conventional fertilization. Ultimately, my
data indicates that the relative abundance of AOB, as estimated by real time-PCR analysis of the
ammonia monooxygenase gene, is a useful indicator of nitrification activity under conventional
fertilization at this site.
6.2.2 The effect of fertility management
I hypothesized that the rhizosphere effect on nutrient availability would be more
pronounced under low nutrient conditions. Organically fertilized bulk soils had significantly
higher available P, exchangeable calcium, and exchangeable magnesium at 0-20cm soil depth
than conventionally fertilized bulk soils. Mineral N concentrations, however, did not differ
between organic and conventionally fertilized bulk soils, nor did exchangeable potassium. Thus,
I will focus attention on those nutrients that were deficient in bulk soil under conventional
management relative to organic management.
While there were no significant differences in the magnitude of the rhizosphere effect
between organic and conventionally fertilized shade treatments, there was trend towards a
greater rhizosphere effect on available P and exchangeable magnesium under conventional
fertilization. Due to the fact that the rhizosphere effect is driven by carbon release from roots,
either as a factor stimulating microbial activity (Fontaine et al, 2003) or directly as organic acids
(Richardson et al, 2009; van Schöll et al, 2006), a decrease in its magnitude may be explained by
plant C allocation theory, which predicts decreased C flow to roots in fertile soils (Phillips and
![Page 71: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/71.jpg)
63
Fahey, 2008). van Schöll et al (2006) measured exudation of low molecular weight organic
anions, molecules known to enhance mineral weathering, in response to nutrient deficiencies. In
response to phosphorus deficiency, pine seedling increased overall exudation, while increased
exudation of oxalate was found in response to magnesium deficiency (van Schöll et al, 2006).
Phillips and Fahey (2008) found a decreased rhizosphere effect on phosphatase enzyme activity
in red oak and yellow birch stands fertilized with 58 kg P ha-1 yr-1 relative to unfertilized stands.
The difference in mean rhizosphere effect on available P between conventionally and
organically fertilized treatments also possibly occurred due to higher arbuscular mycorrhizal
fungi (AMF) colonization of conventionally fertilized coffee plants. Coffea arabica is known to
be colonized by AMF (Vaast and Zasoski, 1992). High P fertilization is known to greatly
decrease arbuscular mycorrhizal biomass in mycorrhizal plants (Smith et al, 2011). Lower
available P levels in bulk soil at 0-20cm under conventional fertilization, therefore, may have
stimulated greater mycorrhizal colonization and resulted in increased mycorrhizae-solubilized P
in the rhizosphere. However, without biomass or AMF colonization estimates under the two
fertility treatments, it is difficult to ascertain the role that AMF played in P acquisition at the
rhizosphere.
Overall, there was not sufficient evidence to demonstrate that the magnitude of the
rhizosphere effect was enhanced under conventional fertilization for nutrients that were present
in relatively low concentrations. However, given the trend across all nutrients (particularly
available P and exchangeable magnesium) towards a higher mean rhizosphere effect, the impact
of bulk soil fertility on root-induced changes in nutrient availability is a pertinent area for further
research within coffee agroforestry systems.
![Page 72: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/72.jpg)
64
6.2.3 Bulk soil properties
A significantly higher relative abundance of ammonia-oxidizing bacteria was found
under shade-organic versus shade-conventional management at both soil depths. This finding
may be indicative of a more abundant, steady supply of substrate (ammonium) for ammonia-
oxidation. Okano et al (2004) observed significantly greater AOB populations in an annually
fertilized field relative to an unfertilized control field, despite acquiring measurements 8 months
after fertilizer application. They suggest that ammonia fertilization may have long term, indirect
effects on AOB populations through increasing crop biomass production and subsequent soil
organic matter accumulation (Okano et al, 2004). Average coffee height and biomass (Campbell,
2012) were higher under organic versus conventional fertilization at my site. Along with high
annual inputs of organic materials with organic fertilization, this may have contributed to
significantly elevated soil organic matter levels in bulk soils observed under organic fertilization
(Haggar et al, 2011). Similarly to Okano et al (2004), these conditions in turn may serve to
maintain AOB populations at higher levels than under conventional fertilization.
Such differences in biological soil properties have important implications for the rate at
which organic inputs from shade trees are decomposed and mineralized in plant-available forms.
Although rates of mineralization and nitrification were not measured as part of this study, the
higher abundance of AOB under the organically-fertilized shade treatment indicates that nutrient
cycling may be occurring more rapidly than in conventionally fertilized plots. This could
subsequently elevate the rate at which plant-available nutrients are produced, which has
important implications for coffee nutrient acquisition. Rates of nutrient turnover were not probed
in this single-time-point study, however, and remain an important area of consideration when
comparing conventional to organic fertilization.
![Page 73: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/73.jpg)
65
While I have focused on the differences between rhizosphere and bulk soil in this
research, it is well known that bulk soil properties affect rhizosphere processes. Chemical factors
of bulk soil, such as organic C and mineral N (Pausch et al, 2013), as well as biological factors,
like microbial community structure, can govern the nature of root-induced effects at the
rhizosphere. Previous research has demonstrated that soil properties in some instances can
control microbial community structure to a greater degree than do root-induced effects (Buyer et
al, 2002). As soil microorganisms are the drivers of organic matter decomposition and nutrient
cycling in the soil, management effects on their dynamics has important implications. The effect
of fertility management on bulk soil properties was further borne out by the observation of
distinct differences in bacterial community structure between organic and conventional
treatments at 0-20cm.
Given that DGGE profiles clustered according to fertilization and not shade-tree
presence, it would appear that fertility management is the main driver of bacterial community
structure at 0-20cm soil depth. Modifications of microbial community structure can have
important implications for soil function. For example, Waldrop et al (2000) observed
compositional shifts in a soil microbial community associated with land use change that were
correlated with enzyme activities involved in phosphorus solubilization and lignocellulose
degradation. The alteration in bacterial community structure in response to organic fertilization
therefore may have important effects on soil functioning; a phenomenon that has been hinted at
in my investigation by a greater abundance of ammonia-oxidizing bacteria.
Additionally, it is possible that shade-tree effects on soil bacterial communities exist at
my site, but were just not detected at the soil depth of 0-20cm. The effect of shade tree
incorporation on soil bacterial dynamics would likely only be detected in the top few
![Page 74: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/74.jpg)
66
centimeters, where the impact of litter-fall and tree prunings is greatest. Given that the greatest
fine root density of coffee under Erythrina poeppigiana exists in the top 5-10cm of soil at the
site (Mora, 2011), modification of bacterial community structure and function at depths
shallower than 20cm holds great potential to impact nutrient availability. This is another
promising avenue of inquiry with important implications for linking microbial function to
nutrient effects of shade-tree intercropping in coffee agroforestry systems.
![Page 75: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/75.jpg)
67
Chapter 7 Conclusions
Very little past research has endeavoured to uncover the effects of shade-tree
intercropping within agroforestry systems on nutrient dynamics at the root-soil interface. In this
study, I compared nutrient availability in rhizosphere soil of coffee to bulk soil under the shade
of a N2-fixing tree common to Costa Rican coffee agroforestry systems. In doing so, I
demonstrated that mineral N, available P, and exchangeable base cations are accumulated in the
root zone to a greater degree under shaded coffee than monoculture coffee. This suggests that
bulk soil nutrient status, which at my site was nearly identical under shade and full sun
management, does not always provide an accurate metric of nutrient availability for the crop.
Furthermore, it calls into question to applicability of basing plot-scale management on bulk soil
samples that do not reflect nutrient status in the zone of plant uptake.
Comparisons between shade and full sun management were made under conventionally
fertilized coffee that received only one half of the optimally recommended nutrient inputs.
Previous research at the study site demonstrated substantial aboveground physiological
adaptations of coffee to shade-tree incorporation under this fertilization regime. These adaptions,
which include increased photosynthetic capacity under shade, may have driven the enhanced
rhizosphere effect. Other aboveground properties, however, such as increased leaf nutrient
content, may have been the result of enhanced nutrient availability in the rhizosphere under
shade management. Thus, an enhanced rhizosphere effect may be a result of aboveground, leaf-
level adaptation, and simultaneously an underlying mechanism by which shade-tree
intercropping improves plant nutrient status.
![Page 76: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/76.jpg)
68
My results illustrate that in order to uncover mechanisms behind differences in
rhizosphere nutrient availability, an integrated methodological approach is required. I
quantitatively compared functionally-relevant bacterial populations across shade and fertilization
treatments and between bulk and rhizosphere soil. In doing so, I was able to provide a likely
explanation for reduced nitrate availability in the rhizosphere of conventionally-fertilized full sun
coffee relative to shaded coffee. Additionally, I detected differences in ammonia-oxidizer
populations between organically and conventionally fertilized bulk soils, which indicated
accumulated effects of management on bulk soil processes. Given the central role of soil biology
in rhizosphere nutrient transformations, it is clear that a comprehensive understanding of
rhizosphere dynamics within agroforestry systems, or any plant-soil system, requires linking soil
biological and chemical properties.
Overall, this research challenges the notion that nutrient availability in the root zone is
governed simply by the balance between uptake and replenishment via mass flow and diffusion.
While bulk soil processes play a key role in mediating nutrient supply, rhizosphere accumulation
of inorganic nutrients across management treatments illustrates an important root-induced effect.
The mechanisms underpinning this phenomenon within this system are not definitively known;
aboveground management, however, through intercropping with a N2-fixing tree, clearly plays a
role. A better understanding of the factors that influence the rhizosphere effect on nutrient
availability will enable the design of more sustainable, efficient agroecosystems. This is
especially true in low-input agricultural systems, in which there is greater crop reliance upon
organic and mineral pools for soluble nutrients.
![Page 77: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/77.jpg)
69
References
Beer J (1988) Litter production and nutrient cycling in coffee (Coffea arabica) or cacao
(Theobroma cacao) plantations with shade trees. Agrofor Syst 7:103-114
Beer J, Bonnemann A, Chavez W, Fassbender HW, Imbach AC, Martel I (1990) Modelling
agroforestry systems of cacao (Theobroma cacao) with laurel (Cordia alliodora) and poro
(Erythrina poeppigiana) in Costa Rica. V. Productivity indices, organic material models
and sustainability over 10 years. Agrofor Syst 12:229-249
Beer J, Muschler R, Kass D, Somarriba E (1998) Shade management in coffee and cacao
plantations. Agrofor Syst 38: 139–164
Borkhataria R, Collazo J, Groom M, Jordan-Garcia A (2012) Shade-grown coffee in Puerto
Rico: Opportunities to preserve biodiversity while reinvigorating a struggling agricultural
commodity. Agric Ecosyst Environ 149:164-170
Buyer JS, Roberts DP, Russek-Cohen E (2002) Soil and plant effects on microbial community
structure. Can J Microbiol 48:955-964
Campbell L (2012) Biophysical drivers of tree crop performance in shade agroforestry systems:
the case of coffee in Costa Rica. MSc thesis, University of Toronto, Canada
Campbell L, Isaac M, Soto G, Virginio Filho E de M (2013) Leaf traits in perennial crop
agroforestry systems: Coffee (Coffea arabica) under shade and fertilization regimes in
Costa Rica. In review
Chapin F, Matson P, Mooney H (2002). Principles of Terrestrial Ecosystem Ecology. Springer-
Verlag, New York
Cavagnaro TR, Jackson LE, Hristova K, Scow KM (2008) Short-term population dynamics of
ammonia oxidizing bacteria in an agricultural soil. Appl Soil Ecol 40:13-18
Chen CR, Condron LM, Davis MR, Sherlock RR (2002) Phosphorus dynamics in the
rhizosphere of perennial ryegrass (Lolium perenne L.) and radiata pine (Pinus radiata D.
Don.). Soil Biol Biochem 34:487-499
Chesney P, Nygren P (2002) Fine root and nodule dynamics of Erythrina poeppigiana in an alley
cropping system in Costa Rica. Agrofor Syst 56:259-269
Collignon C, Calvaruso C, Turpault M-P (2011) Temporal dynamics of exchangeable K, Ca and
Mg in acidic bulk soil and rhizosphere under Norway spruce (Piceaabies Karst.) and beech
(Fagus sylvatica L.) stands. Plant Soil 349:355-366
![Page 78: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/78.jpg)
70
DaMatta FM (2004) Ecophysiological constraints on the production of shaded and unshaded
coffee: a review. Field Crops Res 86:99-114
De Boer W, Kowalchuk GA (2001) Nitrification in acid soils: micro-organisms and mechanisms.
Soil Biol Biochem 33:853-866
Dijkstra FA, Bader NE, Johnson DW, Cheng W (2009) Does accelerated soil organic matter
decomposition in the presence of plants increase plant N availability? Soil Biol Biochem
41:1080-1087
Fontaine S, Mariotti A, Abbadie L (2003) The priming effect of organic matter: a question of
microbial competition? Soil Biol Biochem 35:837-843
Gobran GR, Clegg S (1996) A conceptual model for nutrient availability in the mineral soil-root
system. Can J Soil Sci 76:125-131
Gobran GR, Clegg S, Courchesne F (1998) Rhizospheric processes influencing the
biogeochemistry of forest ecosystems. Biogeochem 42:107-120
Grayston SJ, Vaughan D, Jones D (1996) Rhizosphere carbon flows in trees, in comparison with
annual plants: the importance of root exudation and its impact on microbial activity and
nutrient availability. Appl Soil Ecol 5:29-56
Griffiths BS (1994) Microbial-feeding nematodes and protozoa in soil: Their effects on microbial
activity and nitrogen mineralization and decomposition hotspots and the rhizosphere. Plant
Soil. 164:25-33
Gudmundson L (1995) Peasant, farmer, proletarian: class formation in a smallholder coffee
economy, 1850-1950. In: Roseberry W, Gudmundson L, Kutschbach MS (eds) Coffee,
society, and power in Latin America. The Johns Hopkins University Press, Baltimore, MD,
pp 112-151
Haggar JP, Tanner EVJ, Beer JW, Kass DCL (1993) Nitrogen dynamics of tropical agroforestry
and annual cropping systems. Soil Biol Biochem 25:1363-1378.
Haggar J, Barrios M, Bolaños M, Merlo M, Moraga P, Munguia R, Ponce A, Romero S, Soto G,
Staver C, Virginio EMF (2011) Coffee agroecosystem performance under full sun, shade,
conventional and organic management regimes in Central America. Agrofor Syst 82:285-
301
Haglund L (2006) Hard-pressed to invest: the political economy of public sector reform in Costa
Rica. Revista Centroamericana de Ciencias Sociales 1:5-46
Hamilton EW, Frank DA (2001) Can plants stimulate soil microbes and their own nutrient
supply? Evidence from a grazing tolerant grass. Ecol 82:2397-2402
![Page 79: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/79.jpg)
71
He X, Xu M, Qiu GY, Zhou J (2009) Use of 15N stable isotope to quantify nitrogen transfer
between mycorrhizal plants. J Plant Ecol 2:107-118
Herman DJ, Johnson KK, Jaeger III CH, Schwartz E, Firestone MK (2006). Root influence on
nitrogen mineralization and nitrification in Avena barbata rhizosphere soil. Soil Sci Soc
Am J 70:1504-1511
Hinsinger P, Plassard C, Tang C, Jaillard B (2003) Origins of root-mediated pH changes in the
rhizosphere and their responses to environmental constraints: a review. Plant Soil 248:43-
49
Hinsinger P, Bengough AG, Vetterlein D, Young IM (2009) Rhizosphere: biophysics,
biogeochemistry and ecological relevance. Plant Soil 321:117-152
Hinsinger P, Betencourt E, Bernard L, Brauman A, Plassard C, Shen J, Tang X, Zhang F (2011)
P for two, sharing a scarce resource: soil phosphorus acquisition in the rhizosphere of
intercropped species. Plant Physiol 156:1078-1086
Ingham RE, Trofymow JA, Ingham ER, Coleman DC (1985) Interactions of bacteria, fungi, and
their nematode grazers: effects on nutrient cycling and plant growth. Ecol Monogr 55:119-
140
International Assessment of Agricultural Knowledge, Science and Technology for Development
[IAASTD] (2008) Agriculture at a crossroads: Latin America and the Caribbean (LAC)
report.http://www.agassessment.org/reports/subglobal/Agriculture_at_a_Crossroads_Volu
me_III_Latin_America_and_the_Caribbean_Subglobal_Report.pdf. Accessed 20 March
2012
Isaac ME, Timmer VR, Quashie-Sam J (2007) Shade tree effects in an 8-year-old cocoa
agroforestry system: Biomass and nutrient diagnosis of Theobroma cacao by vector
analysis. Nutr Cycl in Agroecosyst 78:155-165
Isaac ME, Hinsinger P, Harmand JM (2012) Nitrogen and phosphorus economy of a legume
tree-cereal intercropping system under controlled conditions. Sci Total Environ
doi:10.1016/j.scitotenv.2011.12.071
Jackson LE, Burger M, Cavagnaro TR (2008) Roots, nitrogen transformations, and ecosystem
services. Ann Rev Plant Biol 59:341-363
Jalonen R, Nygren P, Sierra J (2009) Transfer of nitrogen from a tropical legume tree to an
associated fodder grass via root exudation and common mycelial networks. Plant Cell
Environ 32:1366-1376.
Jia Z, Conrad R (2009) Bacteria rather than Archaea dominate microbial ammonia oxidation in
an agricultural soil. Environ Microbiol 11:1658-1671.
![Page 80: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/80.jpg)
72
Junier P, Molina V, Dorador C, Hadas O, Kim O-S, Junier T, Witzel K-P, Imhoff JF (2010)
Phylogenetic and functional marker genes to study ammonia-oxidizing microorganisms
(AOM) in the environment. Appl Microbiol Biotechnol 85:425-440
Kaimowitz D (1993) The role of nongovernmental organizations in agricultural research and
technology transfer in Latin America. World Dev 7:1139-1150.
Kowalchuck GA, Stephen JR (2001) Ammonia-oxidizing bacteria: a model for molecular
microbial ecology. Annu Rev Microbiol 55:485-529
Kurppa M, Leblanc HA, Nygren P (2010) Detection of nitrogen transfer from N2-fixing shade
trees to cacao saplings in 15N labelled soil: ecological and experimental considerations.
Agrofor Syst 80:223-239
Kuzyakov Y, Cheng W (2001) Photosynthesis controls of rhizosphere respiration and organic
matter decomposition. Soil Biol Biochem 33:1915-1925
Muñoz F, Beer J (2001) Fine root dynamics of shaded cacao plantations in Costa Rica. Agrofor
Syst 51:119-130
Martinelli LA, Piccolo MC, Townsend AR, Vitousek PM, Cuevas E, McDowell W, Robertson
GP, Santos OC, Treseder K (1999) Nitrogen stable isotopic composition of leaves and soil:
tropical versus temperate forests. Biogeochem 46:45-65
Mora Garcés A (2011) Characterization of the spatial variability of soil properties and Coffee
fine roots in shade tree- coffee associations under organic and conventional management
practices. MSc thesis CATIE, Costa Rica
Mora A, Beer J (2012) Geostatistical modeling of the spatial variability of coffee fine roots under
Erythrina shade trees and contrasting soil management. Agrofor Syst doi: 10.1007/s10457-
012-9557-x
Muyzer G, Smalla K (1998) Application of denaturing gradient gel electrophoresis (DGGE)
andtemperature gradient gel electrophoresis (TGGE) in microbial ecology. A Van Leeuw J
Microb 73:127-141
Nair PKR, Buresh RJ, Mugendi DN, Latt CR (1998) Nutrient cycling in tropical agroforestry
systems: myths and science. In: Buck LE, Lassoie JP, Fernandes ECM (eds) Agroforestry in
sustainable agriculture. CRC Press, Boca Raton, pp 1-32
Nair SK, Subba Rao NS (1977) Microbiology of the root region of coconut and cacao under mixed
cropping. Plant Soil 46:511-519
Nicol GW, Leininger S, Schleper C, Prosser JI (2008) The influence of soil pH on the diversity,
abundance and transcriptional activity of ammonia oxidizing archaea and bacteria. Environ
Microbiol 10:2966-2978
![Page 81: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/81.jpg)
73
Nygren P, Campos A (1995) Effect of foliage pruning on fine root biomass of Erythrina
poeppigiana (Fabaceae). In: Sinoquet, H (ed) Ecophysiology of intercropping. Paris Institut
National de la Recherche Agronomique (INRA), France, pp 295-302
Nygren P, Fernández MP, Harmand J-M, Leblanc HA (2012) Symbiotic dinitrogen fixation by
trees: an underestimated resource in agroforestry systems? Nutr Cycl Agroecosyst
doi:10.1007/s10705-012-9542-9
Nygren P, Ramirez C (1995) Production and turnover of N2 fixing nodules in relation to foliage
development in periodically pruned Erythrina poeppigiana (Leguminosae) trees. For Ecol
Man 73:59-73
Okano Y, Hristova KR, Leutenegger CM, Jackson LE, Denison RF, Gebreyesus B, Lebauer D,
Scow KM (2004) Application of real-time PCR to study effects of ammonium on
population size of ammonia-oxidizing bacteria in soil. Appl Environ Microbiol 70:1008-
1016
Paterson E (2003) Importance of rhizodeposition in the coupling of plant and microbial
productivity. Eur J Soil Sci 54:741-750
Pausch J, Zhu B, Kuzyakov Y, Cheng W (2013) Plant inter-species effects on rhizosphere
priming of soil organic matter decomposition. Soil Biol Biochem 57:91-99
Paynel F, Murray PJ, Cliquet JB (2001) Root exudates: a pathway for short-term N transfer from
clover and ryegrass. Plant Soil 229:235-243.
Perfecto I, Rice R, Greenberg R, Van Der Voort M (1996) Shade coffee: a disappearing refuge
for biodiversity. Biosci 8:598-608
Perfecto I, Vandermeer J, Mas A, Soto Pinto L (2005) Biodiversity, yield, and shade coffee
certification. Ecol Econ 54:435-446
Petchers S, Harris S (2008) The roots of the coffee crisis. In: Bacon CM, Méndez VE, Gliessman
SR, Goodman D, Fox JA (eds) Confronting the coffee crisis: fair trade, sustainable
livelihoods and ecosystems in Mexico and Central America. The MIT Press, Cambridge,
MA, pp 43-69
Phillips RP, Fahey TJ (2006) Tree species and myccorhizal associations influence the magnitude
of rhizosphere effects. Ecol 87:1302-1313
Phillips RP, Fahey TJ (2008) The influence of soil fertility on rhizosphere effects in northern
hardwood forest soils. Soil Sci Soc Am J 72:453-461
Rao MR, Nair PKR, Ong CK (1998) Biophysical interactions in tropical agroforestry systems.
Agrofor Syst 38:3-50
![Page 82: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/82.jpg)
74
Rengel Z, Marschner P (2005) Nutrient availability and management in the rhizosphere:
exploiting genotypic differences. New Phytol 168:305-312.
Richardson AE, Barea J-M, McNeill AM, Prigent-Combaret C (2009) Acquisition of phosphorus
and nitrogen in the rhizosphere and plant growth promotion by microorganisms. Plant Soil
321:305-339
Ricketts TH, Dally GC, Ehrlich PR, Michener CD (2004) Economic value of tropical forest to
coffee production. PNAS 34:12579-12582.
Rotthauwe J-H, Witzel K-P, Liesack W (1997) The ammonia monooxygenase structural gene
amoA as a functional marker: molecular fine-scale analysis of natural ammonia-oxidizing
populations. Appl Environ Microbiol 63:4704-4712
Samper M (2010) Costa Rica’s response to the coffee crisis. Lat Amer Perspect 2:72-92
Schroth G, Lehmann J, Rodrigues MRL, Barros E, Macêdo JLV (2001) Plant-soil interactions
in multistrata agroforestry in the humid tropics. Agrofor Syst 53:85-102
Seligson MA (1980) Peasants of Costa Rica and the development of agrarian capitalism.
University of Wisconsion Publishing, Madison, WI
Sick D (1997) Coping with crisis: Costa Rican households and the international coffee market.
Ethnology 3:255-275
Sick D (2008) Coffee, farming families, and fair trade in Costa Rica: new markets, same old
problems? Lat Amer Res Rev 3:193-208
Sierra J, Nygren P (2006) Transfer of N fixed by a legume tree to the associated grass in a tropical
silvopastoral system. Soil Biol Biochem 38:1893-1903.
Smith SE, Jakobsen I, Grønlund M, Andrew Smith F (2011) Roles of arbuscular mycorrhizas in
plant phosphorus nutrition: interactions between pathways of phosphorus uptake in
arbuscular mycorrhizal roots have important implications for understanding and
manipulating plant phosphorus acquisition. Plant Physiol 156:1050-1057
Snoeck D, Zapata F, Domenach A-M (2000) Isotopic evidence of the transfer of nitrogen fixed
by legumes to coffee trees. Biotechnol Agron Soc Environ 4:95-100
Turpault MP, Utérano C, Boudot J-P, Ranger J (2005) Influence of mature douglas fir roots on
the solid soil phase of the rhizosphere and its solution chemistry. Plant Soil 275:327-336
Vaast P, Zasoski RJ (1992) Effects of VA-mycorrhizae and nitrogen sources on rhizosphere soil
characteristics, growth and nutrient acquisition of coffee seedlings (Coffea arabica L.).
Plant Soil 147:31-39
![Page 83: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/83.jpg)
75
van Schöll L, Hoffland E, van Breemen N (2005) Organic anion exudation by ectomycorrhizal
fungi and Pinus sylvestris in response to nutrient deficiencies. New Phytol 170:153-163
Waldrop MP, Balser TC, Firestone MK (2000) Linking microbial community composition to
function in a tropical soil. Soil Biol Biochem 32:1837-1846
Wang X, Zabowski D (1998) Nutrient composition of douglas-fir rhizosphere and bulk soil
solutions. Plant Soil 200:13-20
Winson A (1989) Coffee and democracy in modern Costa Rica. Between The Lines, Toronto,
ON
Yanai RD, Majdi H, Park BB (2003) Measured and modelled differences in nutrient
concentrations between rhizosphere and bulk soil in a Norway spruce stand. Plant Soil
257:133-142
Zhao Q, Zeng D-H, Fan Z-P (2010) Nitrogen and phosphorus transformations in the rhizospheres
of three tree species in a nutrient-poor sandy soil. Appl Soil Ecol 46:341-346
![Page 84: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/84.jpg)
76
Appendix
Mean coffee plant height under full sun with conventional fertilization (FS-C), shade with
conventional fertilization (S-C) and shade with organic fertilization (S-O; n=9 per treatment).
Management treatment Mean coffee plant height (cm)
FS-C
1.96 ± 0.04 a
S-C 2.05 ± 0.04 aA
S-O 2.19 ± 0.04 B
a – mean values are not significantly different with same lower case letter when fertilization is
held constant (t-test; P <0.05)
A – mean values are not significantly different with same upper case letter when shade is held
constant (t-test; P <0.05)
![Page 85: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/85.jpg)
77
Pearson correlation coefficient (r) values between bulk soil chemical parameters (n=18; pooled
by fertilization treatment (FS-C and S-C)).
NO3-
(mg kg-1)
NH4+
(mg kg-1)
PO43+
(mg kg-1)
Ca2+
(cmol+ kg-1)
Mg2+
(cmol+ kg-1)
K+
(cmol+ kg-1)
pH
NO3-
1 -0.0745 -0.2807 0.05303 0.17508 0.02196 -0.2943
NH4+ 1 0.16163 -0.0995 0.06338 -0.4643 0.08889
PO43+ 1 0.27281 0.36765 -0.5726 0.35357
Ca2+ 1 0.62121 -0.2178 0.50045
Mg2+ 1 -0.569 0.47275
K+ 1 -0.3446
pH 1
Significant effects (at P <0.05) are in bold
![Page 86: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/86.jpg)
78
Pearson correlation coefficient (r) values between rhizosphere soil chemical parameters (n=18;
pooled by fertilization treatment (FS-C and S-C)).
NO3-
(mg kg-1)
NH4
(mg kg-1)
PO43+
(mg kg-1)
Ca2+
(cmol+ kg-1)
Mg2+
(cmol+ kg-1)
K+
(cmol+ kg-1)
pH
NO3-
1 0.55011 0.10882 0.17179 0.42417 0.11161 -0.22282
NH4+ 1 0.49916 -0.12397 0.12819 -0.02109 -0.33176
PO43+ 1 -0.06278 0.09449 -0.33473 -0.27938
Ca2+ 1 0.48012 0.24736 0.67962
Mg2+ 1 -0.04218 0.21697
K+ 1 0.13913
pH 1
Significant effects (at P <0.05) are in bold
![Page 87: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/87.jpg)
79
Pearson correlation coefficient (r) values between bulk soil chemical parameters under shade
with organic fertilization (S-O; n=9).
NO3-
(mg kg-1)
NH4
(mg kg-1)
PO43+
(mg kg-1)
Ca2+
(cmol+ kg-1)
Mg2+
(cmol+ kg-1)
K+
(cmol+ kg-1)
pH
NO3-
1 -0.79274 0.62024 -0.81306 -0.41942 -0.07712 -0.29691
NH4+ 1 -0.64407 0.76023 0.17923 0.29607 0.30358
PO43+ 1 -0.58677 0.26629 -0.05018 -0.62828
Ca2+ 1 0.34838 0.37153 0.35152
Mg2+ 1 0.26420 -0.53372
K+ 1 0.03744
pH 1
Significant effects (at P < 0.05) are in bold
![Page 88: Nutrient Availability in the Rhizosphere of Coffee: Shade ... · Mean percentage rhizosphere effect ([(Rhizosphere - Bulk)/Bulk]*100%) of coffee grown under FS-C, S-C, and S-O management](https://reader034.vdocuments.site/reader034/viewer/2022051911/600191215ed5b96d9c679280/html5/thumbnails/88.jpg)
80
Pearson correlation coefficient (r) values between rhizosphere soil chemical parameters under
shaded coffee with organic fertilization (S-O; n=9).
NO3-
(mg kg-1)
NH4
(mg kg-1)
PO43+
(mg kg-1)
Ca2+
(cmol+ kg-1)
Mg2+
(cmol+ kg-1)
K+
(cmol+ kg-1)
pH
NO3-
1 -0.58932 0.62415 -0.74326 -0.45598 -0.08478 -0.36907
NH4+ 1 -0.28171 0.57896 0.41631 0.59330 0.49666
PO43+ 1 -0.80018 -0.17478 -0.02270 -0.29468
Ca2+ 1 0.63220 0.20431 0.47169
Mg2+ 1 0.29146 0.29624
K+ 1 0.31200
pH 1
Significant effects (at P < 0.05) are in bold