nucleotide sequence of nifd from frankia alni strain ar13

Nucleotide Sequence of nifD from Frankia alni Strain Ar13: Phylogenetic Inferences ’

Philippe Normand, * Manolo Gouy,? Benoit Cournoyer, * and Pascal Simonet * *Laboratoire d’Ecologie Microbienne du Sol and TLaboratoire de BiomCtrie, UniversitC Claude-Bernard-Lyon I

The complete nucleotide sequence of the n&D gene encoding the a subunit of component I of nitrogenase from Frankia alni strain ArI3 was determined. The coding region is 1,458 bp in length and encodes a polypeptide of 486 residues with a predicted molecular weight of 53,500. Phylogenetic inferences with 12 complete published nifD sequences were drawn using a variety of approaches. Frankia nifD clusters with proteobacteria rather than with Clostridium pasteurianum, the other Gram-positive bacterium studied. Extant eubacterial nifgenes seem to have at least three distinct evolutionary origins as a result of ancient gene duplications. Within the Gram-positive bacterial phylum, functional nifgenes descend from different duplicates.

Introduction

The identification and characterization of microbes that have not been isolated in pure culture is still problematical. Frunkiu, for instance, is a nitrogen-fixing acti- nomycetal microsymbiont that establishes root nodules with >20 genera of dicoty- ledonous plants. The first isolation in pure culture occurred in 1959 (Pommer 1959) after nearly a century of unsuccessful attempts. Since then, hundreds of strains have been cultivated from Alnus species, Elaeagnus species, and other actinorhizal plants, but several strains still defy isolation. For instance, host plants Datisca species, Dis- cariaria toumatou, or Dryas species have been investigated repeatedly without yielding Frunkia cultures (authors’ unpublished data). In some cases, marginal growth out of the surface-sterilized plant tissue has been noted but could not be subcultured. The phenotype and ecological characteristics of some of these strains warrant developing tools for identifying the strains in plants and in soils. For example, the establishment of green belts for sand-dune stabilization requires either inoculation with compatible strains or a rapid test to determine the presence of Frankia propagules in soils.

A molecular approach using the 16s ribosomal RNA gene has been used to study the phylogeny and ecology of Frankia strains (Hahn et al. 1989). With polymerase chain reaction (PCR) amplification (Mullis and Falloona 1987 ), part of the 16s gene was sequenced in >30 Frankia strains, and groups of similar sequences corresponded in general with both plant infectivity and results of total DNA/DNA hybridization

1. Key words: n$D, Frunkiu alni, molecular phylogeny. Address for correspondence and reprints: Philippe Normand, Laboratoire d’Ecologie Microbienne du

Sol, UR,4 CNRS 1450, Universitk Claude-Bernard-Lyon I, 43 boul du 11 novembre 19 18,696X? Villeurbanne

Cedex, France.

Mol. Bid. Evol. 9(2):495-506. 1992. 0 1992 by The University of Chicago. All rights reserved 0737-4038/92/0902-OOlO$O2.00

495

Downloaded from https://academic.oup.com/mbe/article-abstract/9/3/495/1037263by gueston 03 April 2018

496 Nomand et al.

analyses (Nazaret et al. 199 1) . In the same study, a Frankia strain that had resisted repeated isolation attempts was characterized directly from one nodule provenance. Sequence analysis related this strain to other &us-infective ones.

The 16s rRNA gene is ubiquitous and evolutionarily highly conserved. These are the main reasons why it has been chosen for phylogenetic studies. However, this implies a problem for ecological studies where it is necessary to discriminate between Frankia and other actinomycetes normally found in actinorhizae (Suyetin et al. 1988 ) that may be very closely related and share 16s rRNA gene sequences with Frankia. Ribosomal RNA genes should therefore be used in conjunction with a second gene. The nifgenes are good candidates for this purpose because they are not present in plants. However, the nifH gene seems to have too few substitutions to discriminate between closely related strains (Normand et al. 1988; Normand and Bousquet 1989 ). This led us to sequence the whole nifD to define targets for PCR amplification of nifD variable regions and of the intergenic nifH-nifD region.

In a previous report, the nifH gene of Frankia was compared with those of other nitrogen-fixing bacteria (Normand and Bousquet 1989 ) . In the resulting phylogenetic tree, Frankia nifH genes are not clustered with the nifH genes of Clostridium, the other member of the Gram-positive eubacterial phylum, but with that of Anabaena, a cyanobacterium, and with those of proteobacteria (Stackebrandt et al. 1988 ) , the group earlier defined, by Woese ( 1987 ), as purple bacteria. This result was interpreted as a possible case of lateral gene transfer from an ancestral proteobacterium into Frankia and Anabaena. Here, we further test this surprising hypothesis by comparing a complete Frankia nifD sequence against nifD sequences of other nitrogen fixers.

Material and Methods Source of DNA

The nzjYD gene from’Frankia strain Ar13 was cloned in pBR328, yielding plasmid pFQ148 (Normand et al. 1988). Sequencing of Ar13 was according to the method of Sanger et al. ( 1977 ) and used M 13 mp 18 and mp 19 derivatives ( Yanish-Perron et al. 1985) cloned in Escherichia coli DH5aF’IQ frozen competent cells (BRL, Gaithersburg Md.). Overlapping clones covering both strands were sequenced.

Numerical Analysis

The code name and source of compared nifD sequences are listed in table 1. Sequences (nucleotides and amino acids) were aligned using the multiple-alignment clustal algorithm (Higgins and Sharp 1988) and the lineup program of the University of Wisconsin nucleic acid sequence analysis software (Devereux et al. 1984). Pairwise evolutionary distances between encoded polypeptides were computed (perfect matches only, length of the shorter sequence without gaps as denominator) with the Poisson correction for multiple substitutions (Nei 1987, p. 4 1) . Gap-containing positions were omitted from distance computations (see fig. 2 ) .

Evolutionary comparisons were on encoded protein rather than on nucleic acid sequences, because we have shown previously that a pronounced skew in G+C content results in distance artifacts. Phylogenetic trees were obtained using several distance methods. The distance method of Fitch and Margoliash ( 1967 ), the neighbor-joining (NJ) of Saitou and Nei ( 1987), and the modified UPGMA method of Li ( 198 1) were used to obtain unrooted gene trees that do not assume strict homogeneity of substitution rates among lineages. In computer simulations these methods generally predict to-


Nucleotide Sequence of nifD from Frankia 497

Table 1 List of Compared nQD Sequences

Code Organism Bacterial Phylum= Reference

Mt

Fa

CP Clostridium pasteurianum

An

Rj RP Rc Tf Ac2 Avl

Av3

KP

Methanococcus thermolithotrophicus

Frankia alni

Anabaena

Bradyrhizobium japonicum Rhizobium sp. (from Parasponia) Rhodobacter capsulatus Thiobacillus ferrooxidans Azotobacter chroococcum Azotobacter vinelandii

(nif operon) Azotobacter vinelandii

(anfoperon) Klebsiella pneumoniae

Archaebacteria

Gram positive, high G+C

Gram positive, low G+C

Cyanobacteria

a-Proteobacteria a-Proteobacteria a-Proteobacteria P-Proteobacteria y-Proteobacteria y-Proteobacteria

y-Proteobacteria

y-Proteobacteria

Souillard and Sibold 1989

Present study

Wang et al. 1987

Lammers and Haselkom 1983; Brusca et al. 1989

Kaluza and Hennecke 1984 Weinman et al. 1984 Schumann et al. 1986 Pretorius et al. 1987 Robson et al. 1989 Brigle et al. 1985

Joerger et al. 1989

Arnold et al. 1988

’ According to Woese (1987).

pologies close to the true one. Rooted trees were obtained using the KITSCH algorithm of the Phylogeny Inference Package (PHYLIP, Felsenstein 1985) and the UPGMA (Sneath and Sokal 1973, pp. 182-189) algorithm.

Results Sequence of nifD from Frankia alni Strain Ar13

The sequence of nifD from Frankia alni strain Arl3 is given in figure 1. The protein-coding region is 1,458 nucleotides (nt) in length and encodes a polypeptide of 486 amino acids. A GAGG tetranucleotide 8 bp upstream of the initial ATG provides a ribosome-binding site (RBS) (Shine and Dalgarno 1974). The length of the n$H- nifD intergenic region is 49 nt. The nifD termination codon is followed by a long intergenic sequence with no obvious RBS or ATG motifs to start the niJK gene. The sequence was submitted to the EMBL sequence data library and was given the accession number X57006 (Frankia species nifH and nifD genes).

nifD codon usage is highly skewed toward G- or C-ending codons, as only 26 of 486 codons have A or T in third position, and 12 of these 26 are GGT glycine codons.

Comparison with Other Published n$D Sequences

The deduced polypeptide sequence was aligned with those of other published genes (fig. 2). The four conserved cysteine residues (indicated by asterisks in fig. 2) are found in the most conserved regions, as shown by the large number of unvaried sites (denoted by uppercase letters in the consensus sequence shown in fig. 2 ) .

The trees obtained by applying the NJ algorithm to pairwise distances for nifH (Normand and Bousquet 1989 ) , nifD, and combined H and D genes are presented in figure 3. In each tree, the significance of internal branches was assessed by applying


-59

1

61

121

181

241

301

361

421

481

541

601

661

721

781

841

901

961

1021

1081

1141

1201

1261

1321

1381

1441

1501 1561

nifH end RBS CGGTCGCCTGACGATCCCACGCCCACCn;CACCGACACCGC

VA* ATGAcGAcGAcACCGGcAcCCGAGcGGGccGAGAccGAGG

MTTTPAPERAETEAMIAEVL TCTCAGTACCCCAAGAAGGCAGC CAAGTTCCGGGCCAAGCACCTCAAGGCCAACGACCCC

SQYPKKAAKFRAKHLKANDP

SmnI GAGGGGTCGAAGGAGTGCGAGGTCAAGTCCAACATCAAGT

EGSKECEVKSNIKSRPGVMT ATCCGCGGCTGCGCCTACGCCGGTTCCAAGGGCGTGGn;n

IRGCAYAGSKGVVWGPVKDM GTCACCATCAGCCACGGCCCGGTCGGCTGCGGTCAGTACT

VTISHGPVGCGQYSWATRRN

SalI TACGCCCACGGTCACCTTGGCGlXXACAACTICAC~TGCAGATCACGACGGACTTC

YAHGHLGVDNFTAMQITTDF CAGGAGAAGGACATCGTCTTCGGCGGTGACCCCAAGCTGG

QEKDIVFGGDPKLEQVCDEI GTCGAGCTGTTCCCGCl-GGC CAAGGGUTCTCCGTGCAGTCCGAGTGCCCGATCGGTCTG

VELFPLAKGISVQSECPIGL ATCGGTGACGACATCGAGGCCGn;GCCAAGAAGTCCTCCA

IGDDIEAVAKKSSKKLDIPV

NUI ATCCCGGTCCGCTGCGAGGGCTTCCGn;GCGTCAGTCAGTG

IPVRCEGFRGVSQSLGHHIA

N.UI AACGACGCl-GTTCGCGACCACGlGCT!IGGCACCGGTGGCGACTCCTTCGAGCAGACCGAC

NDAVRDHVLGTGGDSFEQTD TACGACGTCGCGCTGATCGGn;ACTACAACATCGGCGGTG

YDVALIGDYNIGGDAWASRR

XhQI ATCCTCGAGGAGnTGGGCCTGCGGGTCATCGCCCAGTGGT

ILEEMGLRVIAQWSGDGTIN GAGATGGCCTCGACGCACCTGTCGAAGCTCAACCTGAlYXACTGCTACCGCTCGAT~C

EMASTHLSKLNLIHCYRSMN TACATCTGCACCACCATGGAGGAGCGCTTCGGCACCCCGTGGACCGAGTTCAACTTCTTC

YICTTMEERFGTPWTEFNFF GGCCCCACGAAGATCATCTCCTCCATGCGCAAGATCGCCG

GPTKIISSMRKIAEFFDDEI

l%UlI AAGGCGAAGACCGAGGCGGCGATCGCCCGGTACCAGGn;C

KAKTEAAIARYQVRFDEITK

XhQI GCGTTCCGGCCGCGGCTCGAGGGCAA GCGCGTCATGCTCGCCGTCGGTGGCClXXXCCCC

AFRPRLEGKRVMLAVGGLRP CGGCACACCATCGGCGCGTACGAGGACCTCGGCATGGAGGTCG’IUXCACCGGCTACGAG

RHTIGAYEDLGMEVVGTGYE

SehI TTCGCCCA~GGACGACTACACCCGGACCTACAGCATGCT~GGAAGGCACCGTCCTC

FAHKDDYTRTYSMLKEGTVL

sstI/xrUI TACGACGACCCGACCGCGTTCGAGCTCGAGG~TTCGCCAAGT!DXTCAAGCCGGACCTG

YDDPTAFELEEFAKFLKPDL ATGGGTGCGGGCGTCAAGGAGAAGTACGTCTlCCACAAGATGGGCATCCCCTTCCGGCAG

MGAGVKEKYVFHKMGIPFRQ

SalI ATGCACTCCTGGGACTAC’DXGGGCCCTACCACGGCGTCGACGGCTTCGCGGTCTTCGCC

MHSWDYSGPYHGVDGFAVFA

SmaI XhQI CGC~C~CCATCAACAGCCCGGCCCC~TCG

RDMDIAINSPAWDLLEAPWS

SmaI AAGGCCGGCGAGGTCGCC~~;ATCCACCGCCCTCCGGGCAC

KAGEVA AGTAGACGGCCACTTGCCGTAGACGGCCACTCGCAGTAGACGGCCACTCGCCGTAGACGG CCACTCGCAGTAGACGGCCACTTGCAGTAGCTGACC

FIG. I.-Complete nucleotide sequence of nifD from Frankia strain ArI3, with its derived amino acid

sequence underneath. The nifD ORF is preceded 8 bp upstream by an underlined ribosomal binding-site

sequence (GAGC), starts at coordinate I ( ATG), and extends for 1,458 nucleotides. Relevant restriction

sites are shown above the nucleotide sequence.


Nucleotide Sequence of nifD from Frankia 499

the same tree-building method to 500 bootstrap replicates. Minor differences of topology between nifD trees derived from other methods are seen in places with short branches (data not shown). The KpD position given by UPGMA differs from that given by the modified UPGMA and NJ methods, which may reflect the fact that UPGMA assumes the molecular-clock hypothesis and thus tends to group together sequences that mutate at the same rate. Otherwise, the general topology is stable, whatever the algorithm used. One characteristic that remains constant is that the Ac2 and Av3 sequences are always together. The Rj-Rp cluster is also always present. These two groupings are quite statistically significant because they are supported by 100% of the bootstrap replicates. FaD is always far away from CpD, the other Gram-positive sequence in the survey. The Frankia sequence was found to repeatedly branch outside the proteobacteria-Anabaena cluster.

Discussion

Both the idea of comparing molecular sequences and the mathematical and computer tools used to treat these sequences have changed the way in which we look at bacterial phylogeny ( Woese 1987 ) . For instance, long-established microbial categories such as the Gram-negative sequence have been found to be polyphyletic and split into coherent categories, and cyanobacteria have been repatriated into eubacteria while archaebacteria have been excluded from it and have been regrouped into a new kingdom. Several molecular sequences have been used as yardsticks to compare taxa and to infer phylogenies that can be compared with the standard phylogeny obtained with ribosomal RNA sequences. Sequence comparisons also allow one to define genus- or strain-specific sequences that can be used as molecular probes for bacterial strain identification.

The n&D sequence of Frankia strain Ar13 has a codon usage and high G+C content that are similar to those of nifH (Normand et al. 1988; Normand and Bousquet 1989). The coding sequence has a length close to that of other published sequences. Clostridium pasteurianum nifo. the only other Gram-positive sequence in the study, is noticeably longer because of the insertion of a region encoding -40 amino acids which is present in no other sequence.

Overall, the tree obtained with nifD (fig. 3b) is very similar to the nijH tree (fig. 3a). In both instances Av3 is among the deepest branches, Cp branches out afterward, and a large cluster contains the proteobacterial, cyanobacterial, and Frankia genes. However, there are two main differences between the nifD and nifH trees: ( 1) the most displaced organism between the two trees is Ac2; and (2) Frankia does not belong to the proteobacteria-Anabaena cluster when nifD is used, whereas it is within this cluster when nifH is used. The variant positions of Ac2 in the trees at figure 3a and figure 3b reveal a true difference in the evolutionary histories of genes Ac2D and Ac2H, because in the two trees these genes’ locations are separated by three internal branches each present in >99% of bootstrap replicates.

Three types of nif gene products can be biochemically distinguished. Type 1 enzymes use a molybdenum-based cofactor; they are the most ubiquitous nifenzymes. Type 2 enzymes use a vanadium-based cofactor; the operon that encodes them is called vnf they are represented here by genes Ac2D and Ac2H. Type 3 enzymes (having the anf encoding operon) use an iron-based cofactor; they are represented here by genes Av3D and Av3H. The displacement of Ac2 genes between nifH and


Nucleotide Sequence of nifD from Frunkia 503

nifD trees most likely reveals that Ac2H is derived from the molybdenum nif operon while Ac2D is derived, much earlier than gene H, from the anf operon. This interpretation, already suggested by Joerger et al. ( 1989), is in line with the vanadium vnf operon structure, where the H gene is separated from D, G, and K by -2.5 kb. This would mean that the vnf structural gene cluster has a mosaic origin, being derived in part from the conventional or ubiquitous sequences (nif yielding vnfH) and in part from genes for the rare and ancient iron-based enzymes (anf yielding vnfDK) (Joerger et al. 1989).

When nifH is used, Frankia appears to belong to the proteobacteria- Anabaena cluster, whereas it is placed out of this cluster in the nifD tree. The topology of the nifH tree, particularly the Frankiu-Anabaena grouping supported by 99% of bootstrap replicates, previously suggested a transfer of the nifH gene from an ancestral proteobacterium into Frankiu ( Normand and Bousquet 1989 ) , but we felt that further support for that hypothesis was necessary. This second gene positions Frankia outside proteobacteria, at a position compatible with results of rRNA analyses. Young ( 1992) states that the position of Frankia when nifH is used is as expected from rRNA analyses while that of Clostridium is unexpected and probably due to a paralogous origin. This hypothesis is further strengthened by the present nzfD results, because Clostridium nifD is also far from other type 1 genes. Frunkia’s location outside the proteobacteria- Anabaena cluster when nifD is used is supported by only 55% of bootstrap replicates. In the nifH tree, the internal branch that clusters Frankia with proteobacteria is supported by only 80% of bootstrap replicates. Therefore, the variation of Frankiu’s location between the nifH and nifD trees is within statistical fluctuations associated with evolutionary inferences. Overall, within the proteobacteria-Anabaena cluster the only grouping that is statistically solid on the basis of nifD data (fig. 3b) is Rj-Rp, which is also shown by mfH data (fig. 3a).

The absence of statistically significant differences between nifH and nifD trees, when Ac2 is excluded, justifies investigating the evolutionary history of the combined H+D genes after Ac2 genes are removed (fig. 3~). Within eubacteria, three sets of nifH and nifD genes-i.e., three different evolutionary origins-can be distinguished: ( 1) the type 3 genes of Azotobacter vinelandii (Av3 ) , ( 2) the type 1 genes of Clostridium, and (3) the type 1 genes of proteobacteria, Frankia, and Anabaena. In addition, the type 2 genes of Azotobacter chroococcum (not shown in the tree) have a mosaic origin, with gene H being duplicated from a type 1 gene copy and with gene D deriving from a gene related to the type 3 Av3D gene. These three evolutionary origins are quite well resolved, since 100% of bootstrap replicates and long internal branches separate each gene set. Conversely, the divergence of the three bacterial phyla defined by rRNA sequence analysis (Woese 1987)-i.e., proteobacteria, Gram-positive, and cyanobacteria-is poorly resolved in figure 3c because Frunkia and the cyanobacterium Ana- baena are clustered with proteobacteria. This poor resolution is in line both with the short length of most internal branches of this cluster and with the low score of bootstrap replicates in support of most internal branches. Such a result is to be expected, given both the length of molecules analyzed here (639 sites) and the bushlike nature of the interphyla divergence (see Woese 1987, fig. 11). The deep divergence between Clos- tridium nif genes and other type 1 genes is therefore not the result of the evolutionary split between the three phyla. It is evidence of the survival of different gene duplicates in two lineages of Gram-positive bacteria: Frankia and Clostridium. The long insertion


504 Normand et al.

unique to Clostridium nifD (encoding sites 4 18-474 in fig. 2 ) is in line with a different origin for this gene. This interpretation is more parsimonious than one involving lateral gene transfer, because multiple gene copies do exist in Azotobacter and Clos- tridium. Gene transfer involving two different bacterial phyla (Frankia and Anabaena) would have to be hypothesized in the second interpretation. Furthermore, several high-G+C, Gram-positive, nitrogen-fixing bacteria other than Frankia have been de- scribed recently (Jurtshuk et al. 1990)) thus increasing the likelihood of an ancient evolutionary origin for nifgenes.

The trees of figure 3 have been rooted a priori by the archaebacterial sequences (i.e., Mt) because archaebacteria belong to a different kingdom than do eubacteria (Woese 1987). This rooting is uncertain, depending on the relationships between archaebacterial nif genes and the three evolutionarily defined groups of eubacterial genes. The above conclusions are based on the clear-cut separations between the three gene groups within eubacteria. These conclusions hold for any rooting of the trees, except for obviously unrealistic rootings that disrupt the proteobacteria- Frankia- Anabaena cluster.

Acknowledgments

Thanks are expressed to Laurence Vergnaud for help with molecular biology techniques and to UMR CNRS 106 for use of scientific instruments. Part of the project was supported by Cooperation France-Quebec and CRSNG (Canada).

LITERATURE CITED

ARNOLD, W., A. RUMP, W. KLIPP, U. B. PRIEFER, and A. PUHLER. 1988. Nucleotide sequence of a 24 206-base-pair DNA fragment carrying the entire nitrogen fixation gene cluster of Klebsiella pneumoniae. J. Mol. Biol. 203~7 15-738.

BRIGLE, K. E., W. E. NEWTON, and D. R. DEAN. 1985. Complete nucleotide sequence of the Azotobacter vinelandii nitrogenase structural gene cluster. Gene 37~37-44.

BRUSCA, J. S., M. A. HALE, C. D. CARRASCO, and J. W. GOLDEN. 1989. Excision of an 1 l- kilobase-pair DNA element from within the niJD gene in Anabaena variabilis heterocysts. J. Bacterial. 171:4138-4145.

DEVEREUX, J., P. HAEBERLI, and 0. SMITHIES. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395.

PELSENSTEIN, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783-79 1.

FITCH, W. M., and E. MARGOLIASH. 1967. Construction of phylogenetic trees. Science 155: 279-284.

HAHN, D., M. P. LECHEVALIER, A. FISCHER, and E. STACKEBRANDT. 1989. Evidence for a close phylogenetic relationship between members of the genera Frankia, Geodermatophilus and “Blastococcus” and emendation of the family Frankiaceae. Syst. Appl. Microbial. 11: 236-242.

HIGGINS, D. G., and P. M. SHARP. 1988. Clustal: a package for performing multiple alignment on a microcomputer. Gene 73~237-244.

JOERGER, R. D., M. R. JACOBSON, R. PREMAKUMAR, E. D. WOLRNGER, and P. E. BISHOP. 1989. Nucleotide sequence and mutational analysis of the structural genes (anfHDGK) for the second alternative nitrogenase from Azotobacter vinelandii. J. Bacterial. 171: 1075-1086.

JURTSHUK P., R. KNAPP, and M. P. LECHEVALIER. 1990. Taxonomic assessment of 2 free-


Nucleotide Sequence of ni/D from Frankia 505

living diazotrophic actinomycete isolates, strains NPLC and OTLC. Abstracts of the annual meeting. ASM, Washington, D.C.

KALUZA, K., and H. HENNECKE. 1984. Fine structure analysis of the nifDK operon encoding the a and b subunits of dinitrogenase from Rhizobium japonicum. Mol. Gen. Genet. 196: 35-42.

LAMMERS, P. J., and R. HASELKORN. 1983. Sequence of the nifD gene coding for the a-subunit of dinitrogenase from the cyanobacterium Anabaena. Proc. Natl. Acad. Sci. USA 80:4723- 4727.

LI, W. T. 198 1. Simple method for constructing phylogenetic trees from distance matrices. Proc. Natl. Acad. Sci. USA 78:1085-1089.

MULLIS, K. B., and F. A. FALOONA. 1987. Specific synthesis of DNA in vitro via a polymerase- catalyzed chain reaction. Methods Enzymol. 155:335-350.

NAZARET, S., B. COURNOYER, P. NORMAND, and P. SIMONET. 199 1. Phylogenetic relationships among Frankia genomic species determined by use of amplified 16s rDNA sequences. J. Bacterial. 173:4072-4078.

NEI, M. 1987. Molecular evolutionary genetics. Columbia University Press, New York. NORMAND, P., and J. BOUSQUET. 1989. Phylogeny of nifH sequences in Frankia and in other

nitrogen-fixing microorganisms. J. Mol. Evol. 29:436-447. NORMAND, P., P. SIMONET, and R. BARDIN. 1988. Conservation of nifsequences in Frankia.

Mol. Gen. Genet. 213:238-246. POMMER, E. H. 1959. Uber die Isolierung des Endophyten aus den WurzelknGllchen Alnus

glutinosa Gaertn. und uber erfolgreiche Re-Infektionsversuche. Ber. Dtsch. Botanischen Ges. 72:138-150.

PRETORIUS, I. M., D. E. RAWLINGS, E. G. O’NEILL, W. A. JONES, R. KIRBY, and D. R. WOODS. 1987. Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus

ferrooxidans. J. Bacterial. 169:367-370. ROBSON, R. L., P. R. WOODLEY, R. N. PAU, and R. R. EADY. 1989. Structural genes for the

vanadium nitrogenase from Azotobacter chroococcum. EMBO J. 8: 12 17- 1224. SAITOU, N., and M. NEI . 1987. The’ neighbor-joining method: a new method for reconstructing

phylogenetic trees. Mol. Biol. Evol. 4~406-425. SANGER, F., S. NICKLEN, and A. R. COULSON. 1977. DNA sequencing with chain-terminating

inhibitor. Proc. Natl. Acad. Sci. USA 74:5463-5467. SCHUMANN, J. P., G. M. WAITCHES, and P. A. SCOLNIK. 1986. A DNA fragment hybridizing

to a n ifprobe in Rhodobacter capsulatus is homologous to a 16s rRNA gene. Gene 48:8 l- 92.

SHINE, J., and L. DALGARNO. 1974. The 3’-terminal sequence ofEscherichia coli 16s ribosomal RNA: complementary to nonsense triplets and ribosome binding sites. Proc. Natl. Acad. Sci. USA 71: 1342-l 346.

SNEATH, P. H. A., and R. R. SOKAL. 1973. Numerical taxonomy. W. H. Freeman, San Francisco. SOUILLARD, N., and L. SIBOLD. 1989. Primary structure, functional organization and expression

of nitrogenase structural genes of the thermophilic archaebacterium Methanococcus thermolithotrophicus. Mol. Microbial. 3~54 l-55 1.

STACKEBRANDT, E. R., G. E. MURRAY, and H. G. TRIPPER. 1988. Proteobacteria, classis nav., a name for the phylogenetic taxon that includes the “purple bacteria and their relatives.” Int. J. Syst. Bacterial. 38~321-325.

SUYETIN, S. O., L. S. SHARAYA, A. N. PARIYSKAYA, and L. V. KALAKOUTSK~I. 1988. Penetration of Streptomyces globisporus into the root cells of Alnus glutinosa (L.) Gaertn. Mikrobiologiya 57~132-136.

WANG, S.-Z., J.-S. CHEN, and J. L. JOHNSON. 1987. Nucleotide sequence and deduced amino acid sequences of ntfD encoding the a-subunit of nitrogenase MoFe protein of Clostridium pasteurianum. Nucleic Acids Res. 15:3935.


506 Nomand et al.

WEINMAN, J. J., F. F. FELLOWS, P. M. GRESSHOFF, J. SHINE, and K. F. SCOTT. 1984. Structural analysis of the genes encoding the molybdenum-iron protein of nitrogenase in the Parasponia Rhizobium strain ANU289. Nucleic Acids Res. 12:8329-8344.

WOESE, C. R. 1987. Bacterial evolution. Microbial. Rev. 51:22 l-27 1. YANISCH-PERRON, C., J. VIEIRA, and J. MESSING. 1985. Improved M 13 phage cloning vectors

and host strains: nucleotide sequences of the M 13mp 18 and pUC 19 vectors. Gene 33: 103- 119.

YOUNG, J. P. W. 1992. Classification of nitrogen-fixing organisms. Pp. 43-86 in G. STACEY, R. BURRIS, and H. EVANS, eds. Biological nitrogen fixation. Chapman & Hall, New York.

BARRY G. HALL, reviewing editor

Received April 1, 199 1; revision received July 29, 199 1

Accepted August 2, 199 1


nucleotide sequence of nifd from frankia alni strain ar13

Documents