1

Nucleic AcidsNucleic Acids

Structures of Nucleic Acids

DNA Replication

RNA and Transcription

Nucleic Acids - RNA and DNA

is a complex, high-molecular-weight biochemical macromolecule composed of

chains that convey genetic information.

The most common nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

Nucleic acids are found in all living cells and viruses.

3

Nucleotides

Nucleic acids consist of nucleotides that have a sugar, nitrogen base, and phosphate

nucleoside

Sugar

Base

PO4

Nucleotides

are the building blocks of DNA and RNA.

• Serve as molecules to store energy and reducing power.

• The three major components in all nucleotides are phosphoric acid, pentose (ribose and deoxyribose), and a base (purine or purimidine).

• Two major purines present in nucleotides are adenine (A) and guanine (G), and three major purimidines are thymine (T), cytosine (C) and uracil (U).

Ribonucleotides

• Adenosine triphosphate (ATP) and guanosine triphosphate (GTP), which are the major sources of energy for cell work.

- The phosphate bonds in ATP and GTP are high-energy bonds. - The formation of phosphate bonds or their hydrolysis is the primary means by which cellular energy is stored or used.

• nicotinamide adenine dinucleotide (NAD) and nicotinamide adenine dinucleotide phosphate (NADP).

The two most common carriers of reducing power for biological oxidation-reduction reactions.

Deoxyribonucleic Acid (DNA)

Deoxyribonucleic acid (DNA) is formed by condensation of .

The nucleotides are linked together between the 3’ and 5’ carbons’ successive pentose rings by p r bonds

3

5

- DNA is a very large threadlike macromolecule (MW, 2X109 D in E. coli).

- DNA contains adenine (A) and guanine (G), thymine (T) and cytosine (C).

- DNA molecules are two stranded and have a double-helical three-dimensional structure.

Deoxyribonucleic Acid (DNA)

DNA Double-helical Structure

Double Helical DNA StructureThe main features of double helical DNA structure are as

follows: . - The phosphate and deoxyribose units are on the outer

surface, but the bases point toward the chain center. The plane of the bases are perpendicular to the helix axis.

- The diameter of the helix is 2 nm, the helical structure repeats after ten residues on each chain, at an interval of 3.4 nm.

- The two chains are held together by hydrogen bonding between pairs of bases. Adenine (A) - , guanines (G) - .

- The sequence of bases along a DNA strand is not restricted in any way and carries genetic information, and sugar and phosphate groups perform a structure role.

Regeneration of DNA from original DNA segments.

DNA Replication

http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter14/animations.html#

DNA Replication- DNA helix unzips and forms two separate strands.

- Each strand will form a new double strands.

- The two resulting double strands are identical, and each of them consists of one original and one newly synthesized strand.

- This is called semiconservative replication.

- The base sequences of the new strand are complementary to that of the parent strand.

Ribonucleic Acid (RNA)

• Ribonucleic acid (RNA) is formed by condensation of .

• RNA is a long, unbranched macromolecule and may contain 70 to several thousand nucleotides. RNA molecule is usually single stranded.

• RNA contains adenine (A), guanine (G), cytosine (C) and uracial (U). A-U, G-C in some double helical regions of t-RNA.

Classification of RNAAccording to the function of RNA, it can be classified as:

• RNA: (m-RNA) synthesized on chromosome and carries genetic information to the ribosomes for protein synthesis. It has short half-life.

• RNA (t-RNA) is a relatively small and stable molecule that carries a specific amino acid from the cytoplasm to the site of protein synthesis on ribosomes.

• RNA (r-RNA) is the major component of ribosomes, constituting nearly 65%. r-RNA is responsible for protein synthesis.

• Ribozymes are RNA molecules that have catalytic properties.

Summary of Nucleic Acids

Nucleotides are basic units of nucleic acids DNA and RNA.

• Nucleotides include pentose, base and phosphoric acid.

• Bases include purine or pyrimidine.

• Two major purines present in nucleotides are adenine (A) and guanine (G), and three major pyrimidines are thymine (T), cytosine (C) and uracil (U).

• Ribonucleotides- adenine triphosphate (ATP) stores energy. - NAD and NADP are important carriers of reducing power.

DNA

• DNA contains genetic information.

• DNA contains adenine (A) and guanine (G), and thymine (T), and cytosine (C). A-T G-C

• DNA has a double helical structure.

• The bases in DNA carry the genetic information.

Summary of Nucleic Acids

RNA• RNA functions as genetic information-carrying

intermediates in protein synthesis.

• It contains adenine (A) and guanine (G), and cytosine (C) and uracil (U).

• m-RNA carries genetic information from DNA to the ribosomes for protein synthesis.

• t-RNA transfers amino acid to the site of protein synthesis

• r-RNA is for protein synthesis.

Summary of Nucleic Acids

Summary of Cell Construction

Biopolymers protein Carbohydrates(polysaccharides)

DNA RNA lipids

 subunit        

bonds for subunit linkage

functions

Characteristic three-D structure

Nucleic Acid Chemistry

Where the info is…interpreting the blueprint

Central Dogma

DNA ---------------- RNA-------------- protein

Replication

transcription translation

Central Dogma

• Replication– DNA making a copy of itself

• Making a replica

• Transcription– DNA being made into RNA

• Still in nucleotide language

• Translation– RNA being made into protein

• Change to amino acid language

Replication

• Remember that DNA is self complementary

• Replication is semiconservative– One strand goes to next generation– Other is new

• Each strand is a template for the other– If one strand is 5’ AGCT 3’– Other is: 3’ TCGA 5’

Replica

• Write the strand complementary to:

3’ ACTAGCCTAAGTCG 5’

Answer

Replication is Semiconservative

Replication

• Roles of enzymes– Topoisomerases– Helicase– DNA polymerases– ligase

• DNA binding proteins– DNA synthesis

• Leading strand• Lagging strand

Replication

Replication

• Helix opens– Helicase

• Causes supercoiling upstream– Topoisomerases (gyrase)

• DNA Binding Proteins– Prevent reannealing

Replication

Replication

• Leading strand– 3’ end of template– As opens up, DNA polymerase binds– Makes new DNA 5’ - 3’

• Same direction as opening of helix• Made continuously

Replication

Replication

• Lagging strand– 5’ end of template

• Can’t be made continuously as direction is wrong

– RNA primer– New DNA made 5’ 3’

• Opposite direction of replication• Discontinuous

– Okazaki fragments

• Ligase closes gaps

Transcription

• DNA template made into RNA copy– Uracil instead of Thymine

• One DNA strand is template– Sense strand

• Other is just for replication – Antisense (not to be confused with

nonsense!)

• In nucleus– nucleoli

Transcription

• From following DNA strand, determine RNA sequence

3’ GCCTAAGCTCA 5’

Answer

Transcription

Transcription

• DNA opens up– Enzymes?

• RNA polymerase binds – Which strand?– Using DNA template, makes RNA

• 5’-3’• Raw transcript called hnRNA

Transcription

How does RNA polymerase know where to start?

upstream promotor sequences

Pribnow Box

TATA box

RNA polymerase starts transcription X nucleotides downstream of TATA box

Introns and Exons

• Introns– Intervening sequences– Not all DNA codes for protein– Regulatory info, “junk DNA”

• Exons– Code for protein

Processing of hnRNA into mRNA

• 3 steps– Introns removed

• Self splicing

– 5’ methyl guanosine cap added– Poly A tail added

• Moved to cytosol for translation

Processing of hnRNA into mRNA

Translation

• RNA -- Protein– Change from nucleotide language to amino

acid language

• On ribosomes

• Vectorial nature preserved– 5’ end of mRNA becomes amino terminus of

protein– Translation depends on genetic code

Genetic Code

• Nucleotides read in triplet “codons”– 5’ - 3’

• Each codon translates to an amino acid• 64 possible codons

– 3 positions and 4 possiblities (AGCU) makes 43 or 64 possibilities

– Degeneracy or redundancy of code• Only 20 amino acids• Implications for mutations

Genetic Code

Genetic Code

• Not everything translated

• AUG is start codon– Find the start codon

• Also are stop codons

• To determine aa sequence– Find start codon– Read in threes– Continue to stop codon

Translation

• Steps:– Find start codon (AUG) – After start codon, read codons, in threes– Use genetic code to translate

Translate the following:

GCAGUCAUGGGUAGGGAGGCAACCUGAACCGAC

Answer

Translation Process

• Requires Ribosomes, rRNA, tRNA and, of course, mRNA– Ribosome

• Made of protein and rRNA• 2 subunits• Has internal sites for 2 transfer RNA molecules

Ribosome

Left is cartoon diagram Right is actual picture

Transfer RNA

• Mostly double stranded– Folds back on itself

• Several loops– Anticodon loop

• Has complementary nucleotides to codons

• 3’ end where aa attach

Transfer RNA

Translation

• Initiation– Ribosomal subunits assemble on mRNA– rRNA aids in binding of mRNA

• Elongation– tRNAs with appropriate anticodon loops bind to complex– have aa attached (done by other enzymes)– Amino acids transfer form tRNA 2 to tRNA 1– Process repeats

• Termination– tRNA with stop codon binds into ribosome– No aa attached to tRNA– Complex falls apart

Translation

Translation

• Happening of process (circa 1971)

• http://www.youtube.com/watch?v=u9dhO0iCLww

Translation AnswerFind start codon

GCAGUCAUGGGUAGGGAGGCAACCUGAACCGAC

Read in threes after that:

AUG GGU AGG GAG GCA ACC UGA ACC GAC

Using Genetic code

AUG GGU AGG GAG GCA ACC UGA ACC GAC

G R E A T stop After stop codon…rest is garbage

Back