Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

Contents lists available at ScienceDirect

Journal of Molecular and Cellular Cardiology

j ourna l homepage: www.e lsev ie r.com/ locate /y jmcc

Nuclear receptor Nur77 suppresses inflammatory response dependent on COX-2 inmacrophages induced by oxLDL

Qin Shao a,1, Ling-Hong Shen a,1, Liu-Hua Hu a, Jun Pu a, Mei-Yan Qi b, Wen-Qing Li b, Fu-Ju Tian b,Qing Jing b,⁎, Ben He a,⁎a Department of Cardiology, Ren Ji Hospital, Medical School of Shanghai Jiao Tong University, Shanghai, People's Republic of Chinab Key Laboratory of Stem Cell Biology, Institute of Health Sciences, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, People's Republic of China

Abbreviations: oxLDL, oxidized low-density lipoprfactor α; MCP-1, monocyte chemoattractant protein-1;COX-2, cyclooxygenase-2; 6-MP, 6-mercaptopurine;mitogen-activated protein kinase; TAD, transactivatiodomain; LBD, ligand-binding domain.⁎ Corresponding authors. B. He is to be contacted at Re

Shanghai Jiao Tong University, No.1630 Dong Fang RoRepublic of China. Tel.: +86 21 5875 2345; fax: +86 21Health Sciences, Shanghai Institutes for Biological SSciences, No.225 South Chong Qing Road, 200025 ShangTel.: +86 21 63842973; fax: +86 21 63849617.

E-mail addresses: qjing@sibs.ac.cn (Q. Jing), rjheben1 Both authors contributed equally to this work.

0022-2828/$ – see front matter © 2010 Elsevier Ltd. Adoi:10.1016/j.yjmcc.2010.03.023

a b s t r a c t

a r t i c l e i n f o

Article history:Received 9 January 2010Received in revised form 29 March 2010Accepted 30 March 2010Available online 8 April 2010

Keywords:oxLDLNur77MacrophagesCOX-2Atherosclerosis

Oxidized low-density lipoprotein (oxLDL) cross-talks with macrophages, and both play a crucial role in theinitiation and progression of atherosclerosis. Orphan nuclear receptor Nur77 is potently induced inmacrophages by diverse stimuli, suggesting that it may be a key regulator of inflammation in vascular cells.The detailed mechanism of Nur77 activation and subsequent function in macrophages induced by oxLDLremains unclearly. In this study, we demonstrated that Nur77 is upregulated in a dose and time-dependentfashion by oxLDL stimulation in murine macrophages, as detected by real-time PCR and Western blotting.OxLDL activated the phosphorylation ERK1/2 and p38 MAPK, inhibition of p38 MAPK but not ERK1/2attenuated Nur77 expression. Importantly, overexpression of Nur77 suppressed oxLDL-induced proin-flammatory cytokines and chemokines secretion including tumor necrosis factor (TNF)α and monocytechemoattractant protein-1(MCP-1). While knockdown Nur77 expression by specific small interfering RNA(siRNA) resulted in the enhancement of the secretion. Furthermore, exposure of macrophages to oxLDLsignificantly upregulated cyclooxygenase-2(COX-2) expression. However, this could be markedly inhibitedby Nur77 overexpression. Also, Nur77 siRNA increased oxLDL-induced COX-2 expression and 6-mercaptopurine (6-MP) attenuated the increase. The results indicated that Nur77 is induced by oxLDL viap38 MAPK signal pathway and subsequently protects against inflammation by the inhibition ofproinflammatory COX-2 pathway in activated macrophages. Specifically modifying transcription activity ofNur77 may represent a potential molecular target for the prevention and treatment of atherosclerosis.

otein; TNFα, tumor necrosissiRNA, small interfering RNA;IL-1β, interleukin-1β; MAPK,n domain; DBD, DNA-binding

n Ji Hospital, Medical School ofad, 200127 Shanghai, People's6838 3069. Q. Jing, Institute ofciences, Chinese Academy ofhai, People's Republic of China.

@126.com (B. He).

ll rights reserved.

© 2010 Elsevier Ltd. All rights reserved.

1. Introduction

Atherosclerosis is a complex, chronic inflammatory disease of thevessel wall, which may block the normal blood flow and may be amajor life-threatening condition in humans. Oxidized low-densitylipoprotein (oxLDL) cross-talks with macrophages and play a crucialrole in the initiation and progression of atherosclerosis. Macrophagesnot only take up the modified LDL particles to form lipid-loaded foam

cells, but also release proinflammatory cytokines and chemokines,such as monocyte chemoattractant protein-1 (MCP-1), tumornecrosis factor (TNF)α, and interleukin-1β (IL-1β) [1,2], which resultin lesions that are unstable and prone to rupture. Furthermore, oxLDLcould promote macrophages to differentiate into dendritic-like cells,which may contribute to the increase in the inflammatory response[3]. As active inflammation is a major determinant of plaquevulnerability, it is important to know the molecular mechanisminvolved in the gene regulation in oxLDL-activated macrophages.

Emerging data show that expression of Nur77, could be induced bydiverse inflammatory stimuli such as lipopolysaccharide (LPS), TNFα,and IL-1β in macrophages [4]. It is also expressed in early andadvanced human atherosclerotic lesions [5]. Nur77 may be a keyregulator in lipid metabolism, inflammation, and atherosclerosis [6,7].

Nur77 (also known as NR4A1, TR3, NGFI-B), together with Nurr1(NR4A2) and NOR-1 (NR4A3, MINOR), form the nuclear receptorNR4A subfamily. Similar to other nuclear receptors, their structureincludes an N-terminal transactivation domain (TAD), a central DNA-binding domain (DBD), and a C-terminal ligand-binding domain(LBD) [8]. Since classical ligands have not been identified, they arereferred as orphan nuclear receptor. As an early response gene, NR4A

305Q. Shao et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

is implicated in T-cell and cancer-cell apoptosis [9,10], dopaminergicdifferentiation of the neurons [11], and in the proliferation andsurvival of other cells [12,13]. It has been reported that over-expression of Nur77 reduces lipid loading and inflammatory responsein human macrophages [5]. Our preliminary data also show thatNur77 could reduce oxLDL-induced intracellular lipid loading inmacrophages by inhibiting lipid influx and enhancing lipid efflux [14].However, the detailed mechanism of oxLDL-induced Nur77 activationand the subsequent function in regulating the inflammatory responsein macrophages are not fully understood.

In this study, we explored the role of Nur77 in activatedmacrophages and its potential mechanism. We demonstrated thatNur77 is induced in response to oxLDL and its expression is involvedin p38 MAPK signal pathway. Nur77 has been found to reduce theexpression of inflammatory cytokines such as MCP-1 and TNFα inactivated macrophages via inhibition of cyclooxygenase-2 (COX-2)expression.

2. Methods

2.1. Materials

2.1.1. AntibodyRabbit polyclonal anti-Nur77, anti-COX-2, anti-ERK1/2, anti-

phosphoERK1/2, anti-p38 mitogen-activated protein kinase(MAPK), anti-phospho p38 MAPK, anti-SAPK/JNK anti-phosphoSAPK/JNK, anti-GAPDH, and anti-β-actin were obtained from CellSignaling Technology Inc. (Beverly, MA).

2.1.2. PlasmidNur77 expression plasmid (pGFP-Nur77) and pGFP-Nur77-

△DBD/deltaDBD were provided by Xiao-kun Zhang (BurnhamInstitute, La Jolla, CA).

2.1.3. Other chemical agentsPD98059 (PD), SB203580 (SB), 6-mercaptopurine (6-MP), NS398

(NS), and G418were obtained from Sigma. Tri Reagent was purchasedfrom Molecular Research Center Inc, and FugeneHD was purchasedfrom Roche Inc (Indianapolis, IN). All the other chemicals wereobtained from commercial sources.

2.2. Isolation and oxidative modification of LDL

LDL (density range 1.019–1.063 g/ml) was isolated from normalhuman plasma by sequential ultracentrifugation, and dialyzed againstPBS at 4 °C. The LDL protein concentration was determined by amodification of the Lowry method with bovine albumin as thestandard. After isolation, LDL was oxidized with CuSO4 at 37 °C for18 h. Then oxLDL was sterilized by filtration membrane and stored at4 °C as described in our previous research and others [3,15].

2.3. Cell culture

Raw264.7 cells (murine macrophage cell line) were obtained fromthe American Type Culture Collection and maintained in Dulbecco'smodified Eagle's medium (DMEM) containing penicillin (100 U/mL),100 μg/mL of streptomycin, and 10% heat-inactivated fetal calf serum(FCS) at 37 °C and 5% CO2. Before stimulation, the non-adherent cellswere removed by washing them twice with DMEM and incubated for24 h under standard conditions. Cells treated with oxLDL (40 μg/mL)were collected at the indicated times. In the experiments withinhibitor, the cells were pretreated with PD, SB, or NS for 1 h, thenadding oxLDL in the media. Finally, the cells were harvested for thefollowing measurements.

2.4. Cell transfection

Plasmids pGFP, pGFP-Nur77 and pGFP-Nur77-△DBD/deltaDBDweretransfected into RAW264.7 cells using FugeneHD (Roche, Indianapolis,IN) according to the manufacturer's instructions, respectively. The cellswere subsequently incubated in the medium containing 500 μg/mL ofG418 for the clones screening. The clones stably expressing pGFP, pGFP-Nur77 pGFP-Nur77-△DBD were maintained in the medium containing200 μg/mL of G418. The clones were confirmed using Western blotting.

2.5. Transfection of siRNA against Nur77

Small interfering RNAs (siRNA) against Nur77 (siGenome Smartpool) and control siRNA were purchased from Dharmacon Research,Inc. The following siRNA sequences were used:

1) Sense sequence: 5′-GCCUAGCACUGCCAAAUUGUU-3′ and 5′-PCAAUUUGGCAGUGCUAGGCUU-3′

2) Sense sequence: 5′-GCUCAGGCCUGGUACUACAUU-3′ and 5′-PUGUAGUACCAGGCCUGAGCUU-3′

3) Sense sequence: 5′-CAGCGGCUCUGAGUACUAUUU-3′ and 5′-PAUAGUACUCAGAGCCGCUGUU-3′

4) Sense sequence: 5′-CCGGUGACGUGCAACAAUUUU-3′ and 5′-PAAUUGUUGCACGUCACCGGUU-3′.

About 20 μM of siRNA and control siRNA were transfected into thecells using Liprofectamine2000 (Invitrogen), according to the manufac-turer's recommendations. 24 h after transfection, cellswere treatedwithoxLDL, the mRNA and protein expression were detected, respectively.

2.6. Real-time RT-PCR analysis

The cells (5×105 cells/well in 12-well plates) were incubatedwith/without oxLDL at the indicated times. The total RNA wasextractedwith Tri (MRC). cDNA synthesis was carried out with 250 ngof total RNA that was primed with random (dT). Quantitative real-time PCR was performed using SYBR Green (Toyobo) master mix andspecific primers for mouse Nur77, MCP-1, TNFα, and COX-2, whichwere designed as follows: Nur77: forward primer, 5′-agcttgggtgttgatgttcc-3′ and reverse primer, 5′-aatgcgattctgcagctctt-3′;MCP-1: forward primer, 5′-catccacgtgttggctca-3′ and reverse primer,5′-gatcatcttgctggtgaatgagt-3′; COX-2: forward primer, 5′-cttcacgcatcagtttttcaag-3′ and reverse primer, 5′-tcaccgtaaatatgatttaagtccac-3′;TNFα: forward primer, 5′-gtccccaaagggatgagaagttc -3′ and reverseprimer, 5′-tccacttggtggtttgctacgac-3′; and GAPDH: forward primer,5′-cccatgtttgtgatgggtgtg-3′ and reverse primer, 5′-tggcatggactgtggt-catga-3′.

The PCR conditions were as follows: preliminary denaturation at50 °C for 2 min; 95 °C for 10 s, 95 °C for 15 s, and 60 °C for 1 min (40cycles). The real-time PCR data were normalized by the levels ofGAPDH mRNA and analyzed using ABI7900 Data Analysis software.

2.7. Western blotting analysis

The cells were seeded (1×106 cells/well) onto a 6-well plate andlysed in a lysis buffer containing 150 mM of NaCl, 10 mM of Tris (pH7.5), 5 mM of EDTA, 1% Triton X-100, 1 mM of PMSF, 10 mg/mL ofleupeptin, 10 mg/mL of pepstatin, and 10 mg/mL of aprotinin for30 min on ice. The protein concentrations were determined by theMicro BCA Protein Assay Reagent (Pierce). The lysates (50 μg) wereelectrophoresed on 10% SDS-PAGE and transferred onto the nitrocel-lulose membranes (Bio-Rad). The membranes were blocked with 5%(w/v) nonfat dried milk in TBST (50 mmol/L of Tris–HCl (pH 7.4),150 mmol/L of NaCl, 0.1% Tween20) for 1 h and then incubated withvarious primary antibodies at a dilution of 1:1000 in TBST, at 4 °Covernight. The membranes were washed thrice with TBST and thenincubated for 2 h at room temperature in TBST containing HRP-linked

306 Q. Shao et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

goat anti-rabbit antibodies (Santa Cruz Biotechnology). Antigendetection was performed with the ECL kit (Millipore).

2.8. Transient transfection and luciferase assays

The mouse COX-2 promoter was cloned by PCR onmouse genomicDNA as a template and cloned into the luciferase report plasmid pGL3-basic. The primers used for PCR were: forward primer tailed with aKpn I restriction site: GCTCGGGGTACC AAATGTCAAGTAGTCT-GAAGGTG; reverse primer tailed with a HindIII restriction site:GTGCCCAAGCTT ACAAATCTACAGAATGATGGT TA. Site-directed mu-tagenesis (Site-Directed Mutagenesis Kit, Stratagene) of the COX-2promoter NBRE site was performed with primer: forward: 5′AGACCCA GATTTAAAAA AAA CATTATT TTAATTAAGTC 3′; R: 5′GACTTAATTAAAATAATGTTTTTTTTAAATCTGGGTCT 3′. The COX-2 lu-ciferase reporter plasmid or mutated reporter was verified bysequencing and then transfected into RAW264.7 cells using FugeneHD(Roche) for measuring COX-2 transcriptional activity. The cells wereseeded (1×105 cells/well) onto a 24-well plate and transfected withreporter or expression plasmids, pGFP, pGFP-Nur77 or pGFP-Nur77-△DBD/deltaDBD. In addition, the cells were co-transfected with aRenilla luciferase plasmid (pRL-SV40, Promega) as an internal control.After transfection, the cells were incubatedwith orwithout 40 μg/mL ofoxLDL for 24 h, and then lysed and subjected to luciferase assays using aDual-Luciferase Reporter Gene Assay system (Promega), according tothe manufacturer's instructions. Luciferase activity was normalized fortransfection efficiency by the luciferase activity of Renilla.

2.9. ELISA for MCP-1, TNFα

Stable clones expressing pGFP, pGFP-Nur77 and pGFP-Nur77-△DBD/deltaDBD were treated with or without 40 μg/mL of oxLDL for

Fig. 1. oxLDL induces Nur77 expression in RAW264.7 cells. (A) Immunoblot of Nur77protein expression in oxLDL-stimulated RAW264.7 cells. Cells were incubated invarying oxLDL doses for 24 h. Bottom figure shows β-actin protein loading control.(B) Quantitative real-time RT-PCR to demonstrate Nur77 mRNA expression afterstimulation with 40 μg/mL of oxLDL at the times indicated. (C) Nur77 protein expressionin RAW264.7 cells stimulatedwith 40 μg/mL of oxLDL at different times as determined byWestern blotting. **Pb0.01 vs time at 0 h. The data represent 3 individual experiments.

Fig. 2. p38 MAPK is mediated by upregulation of Nur77 in response to oxLDL.(A) Raw264.7 cells were treated with oxLDL for the indicated times. Proteins wereanalyzed by Western blotting using anti-p-ERK1/2, anti-ERK1/2, anti-p-p38MAPK,anti-p38, anti-p-JNK, and anti-JNK antibodies. (B) Raw264.7 cells were pretreated with20 μM of PD or 10 μM of SB for 1 h, then stimulated with 40 μg/mL of oxLDL for 1 h, andthe mRNA expression of Nur77 was determined by real-time PCR. (C) Cells werepretreated with PD or SB for 1 h, Nur77 protein expression was also evaluated 24 h afteroxLDL treatment by Western blotting. GAPDH expression served as controls for similarloading of proteins in each lane. PD: PD98059; SB: SB203580; *Pb0.05 vs cellsincubated with oxLDL alone. The data represent 3 independent experiments.

24 h in 6-well plates, respectively. MCP-1 and TNFα protein levels inthe culture supernatants were analyzed using cytokine-specific ELISAkits, according to the manufacturer's instructions (BD BiosciencesPharmingen, San Diego, CA).

2.10. Statistical analysis

The data were expressed as mean±SEM. The statistical signifi-cance of the differences was analyzed using paired Student's t-test. Avalue of Pb0.05 was considered statistically significant.

3. Results

3.1. oxLDL significantly induced expression of Nur77 in RAW264.7 cells

oxLDL has been proposed to be a key factor in the initiation andprogression of atherosclerosis. We explored the expression of Nur77 inRaw264.7 cells in response to oxLDL stimulation. oxLDL dose-dependently induced Nur77 expression, as determined by Westernblotting (Fig. 1(A)). Thus, 40 μg/mL of oxLDL was chosen based on our

307Q. Shao et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

preliminary experiment andpreviously published reports of others [16].oxLDL upregulated Nur77 expression at both mRNA and protein levels.The time course of Nur77 mRNA expression upregulated at early timepoints increased by 25-folds peaking at 1 h (Fig. 1(B)). Likewise, theprotein level of Nur77 was also elevated in a time-dependent fashion,which was analyzed by Western blotting (Fig. 1(C)). We found thatNur77 can be induced in macrophages in response to oxLDL.

3.2. p38 MAPK is mediated upregulation of Nur77 in response to oxLDL

Mitogen-activated protein kinases (MAPKs) are serine/threonineprotein kinases which play an important role in cell proliferation,differentiation and production of several inflammatory genes [17].To further investigate the molecular mechanism involved in oxLDL-induced Nur77 expression, we examined the MAPK inflammatorysignal pathway. First, we carried out time-course experiments ofextracellular signal regulated kinase 1/2 (ERK1/2), p38MAPK, and JunN-terminal kinases/stress-activated protein kinase (JNKs/SAPKs)activation in Raw264.7 cells after oxLDL treatment. Phosphorylation

Fig. 3. Nur77 suppresses proinflammatory cytokine and chemokine expression induced by odeltaDBD was incubated with oxLDL for 24 h, and mRNA expression of MCP-1 and TNFα wtreated with or without oxLDL for 24 h, respectively. Protein levels of MCP-1 (B), TNFα (C) wsiRNA and control siRNA for 48 h, 24 h after transfection cells were treated with or withoutmonitored as controls showed in bottom. (E) After transfection with specific siRNA againadditional 24 h, and the mRNA expression of MCP-1 and TNFαwas determined by real-timefor 24 h. The mRNA was extracted to test the expression of MCP-1 (F) and TNFα (G). Data ashown as mean±SEM. Significant differences from controls or cells treated with oxLDL alo

of ERK1/2, p38 was transiently enhanced, peaking at 1 h, andremained for up to 9 h. However, phosphorylation of JNK slightlyincreased at 3 h as determined by Western blotting (Fig. 2(A)).Meanwhile, oxLDL highly upregulated Nur77 expression at bothmRNA and protein levels, as described previously (Figs. 1(B), C).Subsequently, we detected the effect of ERK1/2-specific inhibitor,PD98059, and p38 MAPK-specific inhibitor, SB203580, on oxLDL-induced Nur77 expression. The incubation of cells with oxLDL for 1 hsignificantly enhanced Nur77mRNA level, while the upregulationwasabrogated by p38 MAPK-specific inhibitor SB (Fig. 2(B), Pb0.05).Aftertreatment for 24 h, oxLDL-induced Nur77 protein expression was alsoinhibited by SB, not by PD (Fig. 2(C)). The results showed that oxLDL-induced Nur77 expression is mediated by p38 MAPK signal pathway.

3.3. Nur77 suppresses proinflammatory cytokine and chemokineexpression induced by oxLDL

Subsequently, we explored the function of Nur77 in regulatinginflammatory response in oxLDL-activated macrophages. We

xLDL. (A) A stable clone expressing pGFP (as a control) , pGFP-Nur77 or pGFP-Nur77-as determined by real-time PCR. Culture supernatants of cell lines were collected afterere detected by ELISA. (D) Cells seeded in six wells were transfected with Nur77-specificoxLDL and analyzed Nur77 expression by Western blotting. GAPDH protein expressionst Nur77 and control siRNA for 24 h, Raw264.7 cells were stimulated with oxLDL forPCR. Cells were incubated with 40 μg/mL oxLDL combined with or without 50 μM 6-MPre expressed as fold difference from control in three independent experiments and arene (F,G): *Pb0.05, **Pb0.01 for MCP-1, and #Pb0.05, ##Pb0.01 for TNFα, respectively.

Fig. 4. COX-2 inhibition blocks oxLDL-induced inflammation cytokines. (A) The proteinexpression of COX-2 at the times indicated in response to oxLDL was determined byWestern blotting, and the GAPDH protein was monitored as a control. Cells werepreincubated with 20 μM of NS398 for 1 h, then stimulated with 40 μg/mL of oxLDL for24 h, and the mRNA expression of MCP-1(B) and TNFα (C) was determined by real-time PCR. NS: NS398. Results are shown as mean±SEM of three independentexperiments. *Pb0.05, for MCP-1, and #Pb0.05, for TNFα, vs cells treated with oxLDLalone, respectively.

308 Q. Shao et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

transfected pGFP, pGFP-Nur77, a dominant-negative form of Nur77(pGFP-Nur77-△DBD/deltaDBD) which lacks its DNA-binding domaininto Raw264.7 cells, respectively (Supplementary Fig. 2(A)). Thenscreened the clones by G418 (see Methods). The clones were verifiedby Western blotting and visualized by confocal. GFP-Nur77-ΔDBDprotein was localized to the cells cytosol, whereas Nur77 was incytosol and nucleus, predominately in nucleus (SupplementaryFig. 2(B–C)). First, we tested the mRNA expression of MCP-1 andTNFα in oxLDL-induced macrophages. Stable clones overexpressionof Nur77 when compared with pGFP control group, significantlyreduced oxLDL-induced the mRNA expression of MCP-1 and TNFα, asassayed by real-time PCR (Fig. 3(A), Pb0.01). Whereas, overexpres-sion of dominant-negative Nur77 (Nur77-△DBD), which is defectivein its binding domain, had no effect (Fig. 3(A)). Culture supernatantsof cell lines were collected after treatment with or without oxLDL for24 h, protein concentrations of MCP-1 and TNF-αwere determined byElisa. Similarly, overexpression of Nur77 led to a significant reductionof MCP-1 by 76% (Fig. 3(B), Pb0.05) and TNF-α expression by 31%(Fig. 3(C), Pb0.05), as compared with control group. In contrast,overexpression of Nur77-△DBD slightly increased oxLDL-inducedexpression of MCP-1 and TNF-α. Furthermore, to test the endogenousNur77 function, we performed loss-of-function experiments. We usedthe RNA interference to silence Nur77 expression and the mRNAexpression of Nur77 was assayed by real-time PCR (SupplementaryFig. 3(A)). After transfection with Nur77 special siRNA, cells weretreated in the absence or presence of oxLDL, the protein expression ofNur77 was detected by Western blotting (Fig. 3(D)). Transfectionwith siRNA specific to Nur77 resulted in the upregulation of MCP-1and TNFα mRNA expression approximately to 3.6-fold and 1.8-fold,respectively, as compared with control siRNA, which was alsodetermined by real-time PCR (Fig. 3(E), Pb0.05). Since 6-mercapto-purine(6-MP) could increase Nur77 transactivation via its activatingfunction-1 domain [8,18]. We explored the effect of endogenousNur77 activation by 6-MP on inflammation. Subsequently, cells werestimulated with 40 μg/mL of oxLDL with or without 6-MP for 24 h.Briefly, mRNA expression of MCP-1 was obviously evoked with oxLDLstimuli in cultured RAW264.7 murine macrophages. Meanwhile, theincrease of mRNA expression induced by oxLDL was significantlydecreased by the co-incubation with 6-MP (Fig. 3(F), Pb0.05) and theresults of the mRNA expression of TNFα were similar (Fig. 3(G),Pb0.05). These data further indicate that Nur77 is involved in theregulation of oxLDL-induced inflammatory response in macrophages.

3.4. The mechanism of Nur77 in negatively regulating inflammatoryresponse

3.4.1. oxLDL upregulated expression of COX-2Subsequently, we explored the detailed mechanism underlying

the suppression of inflammatory cytokines by Nur77. The expressionof COX-2 is induced by various stimuli and is involved in manyinflammatory reactions and various physiological processes. Activa-tion of COX-2 has been implicated in the expression of inflammatorycytokines, such as MCP-1 and TNFα, which are involved in theprogression of atherosclerosis [19]. So we detected COX-2 expressionin response to oxLDL. When Raw264.7 cells were exposed to oxLDL,the protein expressions of COX-2 were upregulated in a time-dependent manner (Fig. 4(A)). Subsequently, we detected the effectof COX-2 inhibitor, NS398 on oxLDL-induced inflammatory response.In the cells pretreated with NS398, the mRNA expression of MCP-1and TNFα was significantly reduced (Figs. 4(B) and (C), Pb0.05).These results suggest that COX-2 inhibition could block oxLDL-induced inflammatory cytokines expression.

3.4.2. Nur77 inhibits oxLDL-induced COX-2 upregulationTo further clarify whether the regulation of oxLDL-induced

inflammatory response by Nur77 is related to COX-2, we examined

the effect of Nur77 on COX-2 promoter activity. Nur77 has beenshown to regulate gene transcription through its highly conservedDNA-binding domain which recognizes its response element (NBRE,AAAGGTCA) [20]. Sequence analysis further revealed that COX-2promoter contains a potential Nur77 binding site. First, COX-2promoter containing a potential binding site was cloned by PCR onmurine genomic DNA as a template and cloned into pGL3 basicluciferase vector. Then luciferase report assay was performed(Supplementary Fig. 4(A–B)). The results showed that COX-2promoter activity was inhibited when it was coexpressed withNur77, compared with coexpression with GFP (Fig. 5(A), Pb0.05).To further confirm whether the NBRE site in the COX-2 promoter isresponsible for transactivation mediated by Nur77, subsequently,site-directed mutagenesis of the COX-2 promoter containing amutation of the putative Nur77 binding site (NBRE:AAAGGTCA) toAAAAAACA using site directed mutagenesis was performed andverified by sequencing (Supplementary Fig. 4(C)). Mutation of theputative site abolished the responsiveness of the COX-2 promoter toNur77 (Fig. 5(A), PN0.05), suggesting that the site mediates COX-2transcriptional activity by Nur77. Furthermore, a dominant-negativeform of Nur77(△DBD) which lacks its DNA-binding domain was also

Fig. 5. Nur77 inhibits oxLDL-induced COX-2 expression. Raw264.7 cells were co-transfected with 200 ng of pGL3-COX-2-luc or its mutant, 10 ng of Renilla luciferase plasmid, in thepresence 800 ng of pGFP as a control or pGFP-Nur77 or pGFP-Nur77-deltaDBD. 48 h after transfection, COX-2 luciferase activity was assayed and normalized by Renilla luciferase. Amutant of COX-2 promoter contains a mutation of the putative Nur77 binding site (NBRE: AAAGGTCA) to AAAAAACA using site directed mutagenesis. Pb0.05 vs control. (B) Cellswere transfected with 200 ng of pGL3-COX-2-luc, 10 ng of Renilla luciferase plasmid, and 800 ng of either pGFP or pGFP-Nur77 or pGFP-Nur77-deltaDBD, then were treated with orwithout 40 μg/mL of oxLDL for an additional 24 h. COX-2 activity was determined by luciferase assays. The data represent at least 3 individual experiments. Pb0.05 vs control.(C)mRNA expression of COX-2 in cell lines expressing pGFP or pGFP-Nur77, treated with oxLDL or without oxLDL, was evaluated by real-time PCR. (D) Cell lines expressing pGFP as acontrol, pGFP-Nur77 or pGFP-Nur77-deltaDBD(△DBD), treated with oxLDL or without oxLDL, protein expression of COX-2 was evaluated by Western blotting. GAPDH expressionserved as controls for similar loading of proteins in each lane. (E) After transduction with Nur77-specific siRNA and control siRNA for 24 h, Raw264.7 cells were stimulatedwith oxLDL for an additional 24 h, and the mRNA expression of COX-2 was assayed by real-time PCR. (F) 24 h after transfection with siRNA or control siRNA, cells were treated with40 μg/mL of oxLDL at the times indicated. The protein expression of COX-2 was detected by Western blotting using anti-COX-2 antibody. Significant differences from controls:*Pb0.05 vs cells treated with oxLDL alone. Results are shown as mean±SEM of three independent experiments.

309Q. Shao et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

utilized. Our findings showed that it also abrogated the responsive-ness of the COX-2 promoter (Fig. 5(A), PN0.05). Next, aftertransfection with COX-2 promoter, Renilla luciferase plasmid, andeither pGFP or pGFP-Nur77 or pGFP-Nur77-△DBD, then cells weretreated with or without 40 μg/mL of oxLDL for an additional 24 h.Overexpression of Nur77 significantly inhibited both basal and oxLDL-induced COX-2 promoter activities (Fig. 5(B), Pb0.05), whereasNur77-△DBD had no such effect. Likewise, Nur77 overexpres-sion attenuated mRNA expression of COX-2 in response to oxLDL(Fig. 5(C), Pb0.05). Similarly, overexpression of Nur77, but notNur77-△DBD, significantly attenuated oxLDL-induced COX-2 expres-sion, as indicated by Western blotting (Fig. 5(D)). On the other hand,Nur77-specific siRNA significantly enhanced oxLDL-induced COX-2mRNA expression by 30-fold, as compared with control group (Fig. 5(E), Pb0.05). Furthermore, we determined the effect of siRNA againstNur77 on oxLDL-induced expression of COX-2 byWestern blotting. Incontrol siRNA group, the time course of COX-2 expression, whenincubated with 40 μg/mL oxLDL, was upregulated following thetreatment after 3 h, peaking up at 12 h. While in Nur77 knock downgroup, oxLDL increased COX-2 expression at 3 h, remained up to 24 h.Moreover, the COX-2 expressionwasmuch stronger than control groupat the times indicated (Fig. 5(F)).On the other hand, cells were treatedwith oxLDL, combined with or without 50 μM 6-MP for 1 h, activationof endogenous Nur77 by 6-MP also suppressed oxLDL-induced COX-2mRNA expression (Fig. 6(A), Pb0.05). Similarly, COX-2 proteinexpression in response to oxLDL was also inhibited by co-incubation

with 6-MP (Fig. 6(B)). These findings indicate that Nur77 couldattenuate COX-2 expression in oxLDL-induced macrophages.

4. Discussion

In this study, we found that orphan nuclear receptor, Nur77, wasactivated in response to inflammatory stimuli of oxLDL, and thatoverexpression of Nur77, but not dominant-negative Nur77(Nur77-△DBD), attenuated the secretion of proinflammatory cytokines, suchas MCP-1 and TNFα, while knockdown Nur77 expression by specificsiRNA resulted in the enhancement of the secretion of proinflamma-tory cytokines. We presented a novel mechanism that oxLDL-inducedNur77 expression is through p38 MAPK signal pathway, and thatNur77 could negatively regulate the inflammatory response bysuppressing COX-2 expression. Thus, it can be concluded that Nur77may play a protective role in activated macrophages by suppressingthe proinflammatory cytokines.

Atherosclerosis is thought of not only as a lipid metabolismdisturbance, but also an inflammation condition of the vascular system.It seems essential to know how atherotic lesions are initiated, how theyprogress, and most importantly, how these lesions develop intovulnerable plaques which cause serial clinical events. Exploring themolecularmechanismof gene regulation involved in inflammationmayprovide a potential target for inflammatory vascular disorder.

Recent data suggest that Nur77 is implicated in vascularhomeostasis and inflammation by regulating the vascular cells. In

Fig. 6. Nur77 activity attenuates COX-2 expression. (A) RAW264.7 cells were stimulatedwith oxLDL combined with or without 6-MP for 1 h, and the mRNA was extracted todetermine the expression of COX-2 by real-time PCR. (B) After 24 h of oxLDL incubation,the protein samples were immunoblotted with anti-COX-2 antibody. The data representmean±SEM of 3 independent experiments. *Pb0.05 vs cells treated with oxLDL alone.

310 Q. Shao et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

smooth muscle cells (SMCs), Nur77 has been shown to inhibit SMCsproliferation and prevent the formation of vascular lesion in carotidartery ligation of transgenic mice model [21]. Enhancement of theactivity of Nur77 by 6-MP has also been observed to reduce SMCproliferation and SMC-rich neointima formation [22,23]. In endothe-lial cells, Nur77 has been reported to regulate VEGF-A-inducedendothelial cell proliferation, tube formation in vitro, and exhibitpro-angiogenesis effect in vivo [24]. Recently, it has been revealedthat Nur77 suppresses cytokine-induced expression of VCAM-1 andICAM-1 through the induction of IkBα expression in human ECs [25].As it has been established that atherosclerotic lesions are active sitesof inflammation and immune response, cytokines mediate the chronicdevelopment of atherosclerosis [26,27]. Much attention has beenfocused on themacrophages. It has been found that Nur77 is markedlyinduced by diverse inflammatory stimuli, and is expressed in humanatherosclerotic lesion macrophages that exhibit the important role ofNur77 in plaque progression [4,5].

In this study, we found that Nur77 was induced by oxLDL.Subsequently, we investigated the mechanism involved in oxLDL-induced Nur77 expression. First, we explored the upstream signalingpathway that regulates Nur77 expression on oxLDL stimulation. Ininflammatory stimuli triggered proinflammatory signal transductioncascade, MAPKs which consist of p38 MAPK, ERK, JNK, play a key rolein regulating cell growth, differentiation and the expression ofproinflammatory protein and cytokines [28,29]. It has been reportedthat ERK1/2 and p38 MAPK are involved in oxLDL-induced macro-phage proliferation [30]. In this study, our results indicated that oxLDLactivated the phosphorylation of ERK1/2 and p38 MAPK. Inhibitingp38 MAPK but not ERK blocked the upregulation of Nur77 in mRNAand protein level, which suggests that oxLDL-induced Nur77expression is through p38 MAPK signal pathway.

Subsequently, we investigated the role of Nur77 in activatedmacrophages. It has been shown that Nur77 could reduce lipidloading and inflammatory response in human macrophages afterstimulation with lipopolysaccharide (LPS) and TNFα [5]. However, ithas also been reported that overexpression of Nur77 in murinemacrophages potentiates the inflammatory gene and cell cycle gene

expression, such as MARCKs, cyclinD2, and IKKi in response to LPS[31]. In this study, we demonstrated that overexpression of Nur77suppressed the expression of proinflammatory cytokines, such asMCP-1 and TNFα. The discrepancy may be explained by the differentinflammatory stimuli.

Following that, we tried to explore the detailed mechanism ofNur77 in regulating the inflammatory response. Previous study hasshown that oxLDL could induce COX-2 expression by the activation ofERK1/2 [17], and that COX-2 is expressed in the atheroscleroticlesions and could promote inflammation. In macrophages, COX-2expression was found to contribute to atherogenesis in LDLR−/−mice [32]. Furthermore, LPS-activated COX-2(−/−) had decreasedexpression of MCP-1 and TNFα [19]. Thus, we speculate that theregulation of proinflammatory cytokine secretion by Nur77 may belinked with COX-2. In this study, our results suggest that oxLDL alsoinduced COX-2 expression in a time-dependent manner, while COX-2inhibition blocked oxLDL-induced inflammatory cytokines release. Toinvestigate whether Nur77 directly affects COX-2 transcriptionalactivity, a luciferase report construct containing a putative Nur77response element sequence from −2140 bp to +930 bp of COX-2was cloned. As shown in Fig. 5(A), a significant inhibition of COX-2promoter activity was observed following cotransfection with Nur77,but not Nur77-△DBD. However, this effect was also not observed aftermutation AAAGGTCA sequence in the NBRE site to AAAAAACA of theCOX-2 promoter. These results indicated that NBRE site is essential forNur77-mediated transactivation of COX-2 promoter activity. Furtherstudy indicated that overexpression of Nur77 inhibited both basal andoxLDL-induced COX-2 promoter activity and mRNA expression.Similarly, overexpression of Nur77, but not Nur77-△DBD, significant-ly attentuated oxLDL-induced COX-2 protein expression. Enhance-ment of the activity of Nur77 by 6-MP also suppressed oxLDL-inducedCOX-2 mRNA and protein expression. On the other hand, Nur77-specific siRNA significantly enhanced COX-2 mRNA and proteinexpression upon stimulation, as compared with control group.These findings indicated that Nur77 could attenuate COX-2 expres-sion, which may negatively regulate the inflammatory response inoxLDL-induced macrophages. The detailed mechanism of oxLDL-induced Nur77 expression and its role in regulating the inflammatoryresponse is described as follows: Macrophages activation by inflam-matory stimuli of oxLDL could activate both proinflammatorypathway of COX-2 and anti-inflammatory pathway of Nur77. WhileNur77 exerts anti-inflammatory properties which attenuates COX-2expression, balances of these pathways and protects against inflam-matory injury in activated macrophages. However, it would beinteresting to further investigate whether other pathways areinvolved in regulating the inflammatory response by Nur77 inoxLDL-induced macrophages.

In summary, our data suggest that Nur77 suppresses the secretionof inflammatory cytokines, which exhibits anti-inflammatory role inoxLDL-induced macrophages. We have also presented a novelmolecular mechanism through which Nur77 could negatively regu-late the inflammatory response in activated macrophages viainhibition of COX-2 expression. Thus, Nur77 may be a novel targetfor the prevention and treatment of atherosclerosis.

Conflict of interest

Nothing to declare.

Acknowledgments

This work was supported by grants from the National NaturalScience Foundation of China (30670880, 30600242 and 30971185);Shanghai Municipal Natural Science Foundation (08XD14026,08ZR1413500 and 09JC1409400); Vascular Biology, Vascular BenefitFoundation (07060670075); and Shanghai Renji Hospital (ZD0705).We

311Q. Shao et al. / Journal of Molecular and Cellular Cardiology 49 (2010) 304–311

thank X.K. Zhang from the Burnham Institute for Medical Research inCalifornia, USA, for his generous help and excellent technical assistance.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.yjmcc.2010.03.023.

References

[1] Hansson GK. Inflammation, atherosclerosis, and coronary artery disease. N Engl JMed 2005;352:1685–95.

[2] Kirii Hirokazu, Niwa Tamikazu, Yamada Yasuhiro. Lack of Interleukin-1β decreasesthe severity of atherosclerosis in ApoE-deficient mice. Arterioscler Thromb VascBiol 2003;23:656–60.

[3] Shen LH, Zhou L, Wang BY, Pu J, Hu LH, Chai DJ, et al. Oxidized low-densitylipoprotein induces differentiation of RAW264.7 murine macrophage cell line intodendritic-like cells. Atherosclerosis 2008;199:257–64.

[4] Pei L, Castrillo A, Chen M, Hoffmann A, Tontonoz P. Induction of NR4A orphannuclear receptor expression in macrophages in response to inflammatory stimuli.J Biol Chem 2005;280:29256–62.

[5] Bonta PI, van Tiel CM, Vos M, Pols TW, van Thienen JV, Ferreira V, et al. Nuclearreceptors Nur77, Nurr1, and NOR-1 expressed in atherosclerotic lesion macro-phages reduce lipid loading and inflammatory responses. Arterioscler ThrombVasc Biol 2006;26:2288–94.

[6] Bensinger SJ, Tontonoz P. Integration of metabolism and inflammation by lipid-activated nuclear receptors. Nature 2008;454:470–7.

[7] Evans Paul C. Nur77 orphaned at birth but adopted by the nuclear factor kBsignaling pathway. Circ Res 2009;104:707–9.

[8] Bonta PI, Pols TW, deVries CJ. NR4A nuclear receptors in atherosclerosis and vein-graft disease. Trends Cardiovasc Med 2007;17:105–11.

[9] Cheng LE, Chan FK, Cado D, Winoto A. Functional redundancy of the Nur77 andNor-1 orphan steroid receptors in T-cell apoptosis. EMBO J 1997;16:1865–75.

[10] Lin B, Kolluri SK, Lin F, Liu W, Han YH, Cao X, et al. Conversion of Bcl-2 fromprotector to killer by interaction with nuclear orphan receptor Nur77/TR3. Cell2004;116:527–40.

[11] Zetterstrom RH, Solomin L, Jansson L, Hoffer BJ, Olson L, Perlmann T. Dopamineneuron agenesis in Nurr1-deficient mice. Science 1997;276:248–50.

[12] Martinez-Gonzalez J, Badimon L. The NR4A subfamily of nuclear receptors: newearly genes regulated by growth factors in vascular cells. Cardiovasc Res 2005;65:609–18.

[13] Hsu HC, Zhou T, Mountz JD. Nur77 family of nuclear hormone receptors. Curr DrugTargets-Inflamm Allergy 2004;3:413–23.

[14] Hu LH, He B, Shen LH, Zhou L, Pu J, Jiang LS, et al. Nuclear receptor Nur77 inhibitsoxidized low density lipoprotein induced lipid loading in macrophages. ZhonghuaXin Xue Guan Bing Za Zhi 2008;36:1032–6.

[15] Steinbrecher UP, Parthasarathy S, Leake DS, Witztum JL, Steinberg D. Modificationof low density lipoprotein by endothelial cells involves lipid peroxidation and

degradation of low density lipoprotein phospholipids. Proc Natl Acad Sci 1984;81:3883–7.

[16] Taketa K, Matsumura T, Yano M, Ishii N, Senokuchi T, Motoshima H, et al. Oxidizedlow density lipoprotein activates peroxisome proliferator-activated receptor-α(PPARα) and PPARγ through MAPK-dependent COX-2 expression in macro-phages. J Biol Chem 2008;283:9852–62.

[17] Johnson GL, Lapadat R. Mitogen-activated protein kinase pathways mediated byERK, JNK, and p38 protein kinases. Science 2002;298:1911–2.

[18] Wansa KD, Harris JM, Yan G, Ordentlich P, Muscat GE. The AF-1 domain of theorphan nuclear receptor NOR-1 mediates trans-activation, coactivator recruit-ment, and activation by the purine anti-metabolite, 6-mercaptopurine. J BiolChem 2003;278:24776–90.

[19] Burleigha ME, Babaevb VR, Yanceyb PG, Majorb AS, McCalebb JL, Oatesa JA, et al.Cyclooxygenase-2 promotes early atherosclerotic lesion formation in ApoE-deficient and C57BL/6 mice. J Mol Cell Cardiol 2005;39(3):443–52.

[20] Wilson TE, Fahrner TJ, Johnston M, Milbrandt J. Identification of the DNA bindingsite for NGFI-B by genetic selection in yeast. Science 1991;252:1296–300.

[21] Arkenbout EK, de Waard V, van Bragt M, van Achterberg TA, Grimbergen JM,Pichon B, et al. Protective function of transcription factor TR3 orphan receptor inatherogenesis: decreased lesion formation in carotid artery ligation model in TR3transgenic mice. Circulation 2002;106:1530–5.

[22] de Waard V, Arkenbout EK, Vos M, Mocking AI, Niessen HW, Stooker W, et al. TR3nuclear orphan receptor prevents cyclic stretch-induced proliferation of venoussmooth muscle cells. Am J Pathol 2006;168:2027–35.

[23] Pires NM, Pols TW, de Vries MR, van Tiel CM, Bonta PI, Vos M, et al. Activation ofnuclear receptor Nur77 by 6-mercaptopurine protects against neointimaformation. Circulation 2007;115:493–500.

[24] Zeng H, Qin L, Zhao D, Tan X, Manseau EJ, Van Hoang M, et al. Orphan nuclearreceptor TR3/Nur77 regulates VEGF-A-induced angiogenesis through its tran-scriptional activity. J Exp Med 2006;203:719–29.

[25] You B, Jiang Y-Y, Chen S, Yan G, Sun J. The orphan nuclear receptor Nur77suppresses endothelial cell activation through induction of IkBα expression. CircRes 2009;104:742–9.

[26] Blake GJ, Ridker PM. Inflammatory bio-markers and cardiovascular risk prediction.J Intern Med 2002;252:283–94.

[27] Tabas I. Apoptosis and plaque destabilization in atherosclerosis: the role ofmacrophage apoptosis induced by cholesterol. Cell Death Differ 2004;11:s12–6.

[28] Nakashima S. Protein kinase C alpha (PKC alpha): regulation and biologicalfunction. J Biochem 2002;132:669–75.

[29] Tsatsanis C, Androulidaki A, Venihaki M, Margioris AN. Signalling networksregulating cyclooxygenase-2. Int J Biochem Cell Biol 2006;38:1654–61.

[30] Senokuchi T, Matsumura T, Sakai M, Matsuo T, Yano M, Kiritoshi S, et al.Extracellular signal-regulated kinase and p38 mitogen-activated protein kinasemediate macrophage proliferation induced by oxidized low-density lipoprotein.Atherosclerosis 2004;176:233–45.

[31] Pei L, Castrillo A, Tontonoz P. Regulation of macrophage inflammatory geneexpression by the orphan nuclear receptor Nur77. Mol Endocrinol 2006;20:786–94.

[32] Burleigh ME, Babaev VR, Oates JA, Harris RC, Gautam S, Riendeau D, et al.Cyclooxygenase2 promotes early atherosclerotic lesion formation in LDL receptor-deficient mice. Circulation 2002;105:1816–23.