novel methods for the detection of nucleic acid sequences katrina battle literature presentation...
TRANSCRIPT
![Page 1: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/1.jpg)
Novel Methods for the Detection of Nucleic Acid Sequences
Katrina BattleLiterature Presentation
March 22, 2010
![Page 2: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/2.jpg)
Objective
Provide a comparison of alternative methods for the detection of
hybridized DNA sequences
2
![Page 3: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/3.jpg)
3
• Introductiona) DNA and importance of detectionb) Raman Spectroscopyc) the Quantum Dotd) Comparison of Fluorophores to Quantum Dots
• Detection Approachesa) Use of Quantum dots (QDs) b) Use of Surface-Enhanced Resonance Raman Spectroscopy (SERRS)
• Comparison of methods
• Critiques
• Acknowledgements
• Questions
![Page 4: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/4.jpg)
Deoxyribonucleic Acid (DNA)
4
www.bio.miami.edu/.../gene/c16x6base-pairs.jpghttp://writersforensicsblog.wordpress.com/2009/11/Library.thunkquest.org/18617/data/types/dna.html
•Oligonucleotides are short nucleic acid polymers, typically with twenty or fewer bases
•Readily bind to their respective complementary nucleotide
r respective complementary nucleotide
![Page 5: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/5.jpg)
Importance of Detection
Gene detection
Potential biomarkers
Screening for various infections
Diagnosis and treatment
5
www.pharmaceutical-int.com/images/companies/8www.hemorrhoidinformationcenter.com/wp-conten
www.sciencedaily.com/.../05/050513102615.jpgwww.medicues.com/.../bacteriasalmonella-copy.jpg
![Page 6: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/6.jpg)
Raman Spectroscopy
6
3210
Lowest excited electronic state
ΔE
ΔE
Virtual states
Ground electronic states
E = hνexE = hνex
321
0
Rayleigh scatteringE = hνex
Raman scatteringE = hνex ± ΔE
Stok
es, E
= h
ν ex -
ΔE
anti-
Stok
es, E
= h
ν ex +
ΔE
![Page 7: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/7.jpg)
Resonance Raman Spectroscopy
• Excited electron immediately relaxes into a vibrational level of the ground electronic state, giving up a Stokes photon, νs
• Excitation with wavelengths that closely approach that of the electronic absorption band of an analyte
• Increased selectivity
• Tunable laser required
7
νsνex
Δνr
νflνex
Resonance Raman Fluorescence
![Page 8: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/8.jpg)
Quantum Dots (QDs)• Semiconductor nanocrystals whose
excitons are confined in all three spatial dimensions.
• Nanometer-scale atom clusters comprising a core, shell, and coating.
• Characteristics are closely related to the size and shape of the individual crystal.
• Possess great tunability
• Give narrow emission profile
www.invitrogen.com
![Page 9: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/9.jpg)
Tunability of Quantum Dots
• Possible to have very precise control over the conductive properties of the material
• Available with a choice of surface reactivities
• Can be made biocompatible and can be functionalized for binding specificity (i.e. avidin/biotin)
9Medintz, I. et al., Nature Materials, 2005, 4, 435-446
ΓCdSe core (Å)
λmax em. (nm)
![Page 10: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/10.jpg)
Absorption and Emission Profiles
10Medintz, I. et al., Nature Materials, 2005, 4, 435-446
![Page 11: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/11.jpg)
11
Property Fluorophores Quantum DotsAbsorption Spectra Variable/narrow generally a
mirror of the emission spectraBroad spectra, steadily
increases toward the UV from the first absorption band edge
Emission Spectra Broad, asymmetric red-tailed emission
Narrow-full width at half maximum 25-20 nm for CdSe
core materials
Effective Stokes Shift Generally <100 nm >200 nm possible
Tunable Emission NA Unique to QDs/can be sized tuned from the UV to the IR
Quantum Yield Variable, low to high Generally high, 0.2 to 0.7 in buffer (surface coating)
Fluorescent Lifetime Short < 5ns Long ~10-20 ns or greater
Photostability Variable to poor Excellent, strong resistance to photobleaching
Multiphoton cross section Variable to poor Excellent > 2-3 orders of magnitude that of dyes
FRET capabilities Variable, mostly single donor-single acceptor configurations
Excellent donors (size tuning)
Multi - valent attachment Rare-mostly bis-functional Can attach several molecules
Sapsford, K. et al., Sensors, 2006, 6, 925-953
![Page 12: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/12.jpg)
12
Sun Hee Lim, Philippe Buchy, Sek Mardy, Moon Sik Kang, and Alexey Dan Chin Yu
Anal. Chem. 2010, 82, 886-891
Specific Nucleic Acid Detection Using Photophysical Properties of Quantum Dot Probes
![Page 13: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/13.jpg)
Goal
13
Introduce an approach for single-step labeling and separation free target detection with only
quantum dot (QD) probes using a custom-made portable system and report this application to
avian influenza virus A (H5N1).
Investigate the affect of oligonucleotide density and length on the lifetime and quenching-based
hybridization detection.
![Page 14: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/14.jpg)
Avian Influenza• Influenza virus that occurs
naturally among birds. Wild birds worldwide carry the viruses in their intestines
• Most cases of avian influenza infection in humans have resulted from contact with infected poultry (e.g., domesticated chicken, ducks, and turkeys) or surfaces contaminated with secretions/excretions from infected birds.
14
www.ciriscience.org/thumbimage.php?id=85http://www.ehow.com/way_5697386_herbal-cure-bird-flu.htmlhttp://www.cdc.gov/flu/avian/gen-info/facts.htm
![Page 15: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/15.jpg)
DNA Sequences
15
5’ CGGGAGTTCCCTAGCACT 3’18-mer
Probe Sequences
5’ AGTGCTAGGGAACTCGCC 3’18-mer
5’ AGTGCTAGGGAACTCGCCACTGTAG 3’25-mer
5’ CTACAGTGGCGAGTTCCCTAGCAC 3’25-mer
Complementary Target Sequences
Noncomplementary Sequences
18-mer 5’ GTAATACGACTCACTATA 3’25-mer 5’ GTAATACGACTCACTATAGGGCGAA 3’
![Page 16: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/16.jpg)
Experimental
16
![Page 17: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/17.jpg)
17
H3C N
C
N NH
CH3
CH3Cl-
COOH
COOH
COO
H
COO
H
COOH
COOH
COOH
COOH
H3C N N NH
OO
PMMA
CH3
CH3
COO
H
COOHCOOH
COOH
COO
COO
H
COOH
COOH
N
o
o
OH
N
o
o
H3N R
N
o
o
COOH
COO
H
COOH COOH
C
COOH
COOH
COOH
NH
Preparation of QD Probes
R=
C18 Spacer Oligonucleotide
![Page 18: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/18.jpg)
Hybridization of QD Probes and Target DNA
18Lim, S. et. al., Anal. Chem., 2010, 82, 886-891
![Page 19: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/19.jpg)
Portable Detection Device
19
Filter
Detector
Sample Holder
Lens 2
Pulse Generator
Blue LED Lens 1
Lim, S. et. al., Anal. Chem., 2010, 82, 886-891
![Page 20: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/20.jpg)
Dye Intercalation
• Involves the insertion of a planar fused aromatic ring system between DNA base pairs, leading to significant π-electron overlap
• This mode of binding is stabilized by stacking interactions and is thus less sensitive to ionic strength relative to other binding modes
20
www.photobiology.com/.../pierard/intintercal.jpghttp://commons.wikimedia.org/.../DNA_intercalation.jpeghttp://commons.wikimedia.org/wiki/File:PicoGreen_(topological_formula).png
PicoGreen
![Page 21: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/21.jpg)
Verification of Hybridization• 1 µL of 25-mer target DNA was
hybridized with 3 µL of 0.15 nM OD probes in PBS buffer (total volume 50 µL)
• Shaken at 1000 rpm for 3 hrs. at 25 ° C
• Stained with PicoGreen
• Calibration curve obtained for quantitative analysis
• Calculated hybridization efficiency
21Lim, S. et. al., Anal. Chem., 2010, 82, 886-891
Probe Sequence
Target Sequence
![Page 22: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/22.jpg)
Results
22
![Page 23: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/23.jpg)
QD Probe Conjugation Analysis
23Lim, S. et. al., Anal. Chem., 2010, 82, 886-891
![Page 24: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/24.jpg)
QD Probe and Target DNA Hybridization Analysis
24Lim, S. et. al, Anal. Chem. 2010, 82, 886-891
![Page 25: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/25.jpg)
Determination of Hybridization Time
• Performed verification of QD probe and hybridized DNA by using microfiltration to remove unhybridized DNA
• Shows an increase in hybridization of the 25-mer target DNA and 25-mer QD probes
• Hybridization efficiency changed very slightly
25
0.45 nm QD3 µM target DNA
Lim, S. et. al., Anal. Chem., 2010, 82, 886-891
![Page 26: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/26.jpg)
Quantitative Analysis of QD Probe and Target DNA Hybridization
• Obtained a calibration curve by measuring fluorescence of the QD probe/target DNA hybrid after staining (PicoGreen)
• Fluorescence intensity increased rapidly with target concentration.
26
0.45 nm QD3 µM target DNA
Lim, S. et. al., Anal. Chem., 2010, 82, 886-891
![Page 27: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/27.jpg)
Effect of Oligonucleotide Density• Density of conjugated oligonucleotides
on the QDs using 500, 1000, and 2000 pmol of oligonucleotides were 3.5, 15.6, and 71 molecules/QD
• Change in photophysical properties of the QDs was negligible when oligonucleotide density was low
• With an increase in oligonucleotide density, target capturing rate also increased.
• Hybridization efficiency dropped with very high probe density
27
0.45 nm QD400 µM target DNA
Lim, S. et. al., Anal. Chem., 2010, 82, 886-891
![Page 28: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/28.jpg)
Effect of Probe Length
• 18-mer QD probes show a 40% lifetime reduction and 50 % fluorescence quenching when hybridized with the 25-mer complementary target DNA
• However, the 25-mer QD probes show a 30% lifetime reduction and a 40% fluorescence quenching
28
0.45 nm QD400 target DNA µM
Lim, S. et. al., Anal. Chem., 2010, 82, 886-891
![Page 29: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/29.jpg)
Quantitative Analysis of QD Probes and DNA Hybridization in a Portable
Device
29Lim, S. et. al., Anal. Chem., 2010, 82, 886-891
![Page 30: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/30.jpg)
Conclusions
• Single-step hybridization for detection• Simple and fast compared to conventional methods• Portable target detection system• Single-label and wash-free platform using the QD
photophysical properties of fluorescence lifetime and quenching
• QD probes were proved to be stable and homogenous• Applicable to biological samples
30
![Page 31: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/31.jpg)
DNA Sequence Detection Using Surface-Enhanced Resonance Raman Spectroscopy in a Homogeneous Multiplexed Assay
31
Alexandra MacAskill, David Crawford, Duncan Graham, and Karen Faulds
Anal. Chem. 2009, 81, 8134-8140
![Page 32: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/32.jpg)
Goal
32
Detect different strains of hospital-acquired infections (HAI) based on specific
DNA identification using a SERRS-based assay
![Page 33: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/33.jpg)
Surface-Enhanced Raman Spectroscopy (SERS)
33
Corrugated metal surface
PlasmaResonance
Pump
Molecule
SERS Signal
![Page 34: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/34.jpg)
Combining Resonance Raman and SERS(Surface-Enhanced Resonance Raman)
• Increase in signal intensity is roughly the product of the intensity produced by each of the techniques
• Extends Raman Spectroscopy into a wide variety of interfacial systems that were previously inaccessible due to lack of sensitivity
• Because the technique has the same capabilities as conventional Raman Spectroscopy, structural information can also be provided
34
![Page 35: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/35.jpg)
Hospital Acquired Infections (HAIs)
• The Centers for Disease Control and Prevention estimates that HAIs roughly, cause or contribute to 99,000 deaths each year.
• Can cause severe pneumonia, infections of the urinary tract, and the bloodstream
35
“The patient in the next bed is highly infectious. Thank God for these curtains.”
http://postmanpatel.blogspot.com/2008_07_27_archive.html
![Page 36: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/36.jpg)
Experimental
36
![Page 37: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/37.jpg)
Silver Nanoparticle (NP) Synthesis
• EDTA was added to 2000mL of distilled H2O and heated on a hot plate. NaOH was added prior to boiling.
• At 100 °C, silver nitrate was added and the solution boiled for 30 minutes
• NP solution allowed to cool at room temperature and was analyzed using UV-Vis
• Concentration of EDTA-reduced silver NPs was calculated to be 1.16 x 10-10 mol/L and average particle size was 36.8 nm
37
EDTA/H2O
+ NaOH
At 100 °C
+ AgNO3
UV-Vis
DilutionCool at room temp.
MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140
![Page 38: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/38.jpg)
Locked Nucleic Acid
• Modified RNA nucleotide in which the ribose moiety has been modified with an extra bridge connecting the 2’ oxygen and 4’ carbon
• The bridge “locks” the ribose in the 3’-endo conformation
• Enhances base-stacking and backbone preorganization
• Increase in hybridization specificity
38http://www.renatamusic.it/LNA.gif
![Page 39: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/39.jpg)
Polymerase Chain Reaction (PCR)
39
![Page 40: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/40.jpg)
Preparation of PCR Product
• PCR products for femA-SA, femA-SE, and mecA were prepared using 4 µL of template DNA and a master mix of enzyme polymerase, nucleotides, and hybridization buffer, 4 µL each of 100 nM forward and reverse primers, and 38 µL of PCR grade water.
• Repeated for 30 cycles 1 x 109 copies of the DNA template
40MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140
![Page 41: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/41.jpg)
ASSAY with PCR Products
• Dilution series prepared by varying the concentration of complementary PCR product to a fixed concentration of probe.
• 1.8 µL of 1 µM probe was added to 18.2 µL of 100 nM PCR product (complementary or noncomplementary)
• PCR product was further diluted with PCR product that contained no template DNA to obtain the dilution series.
• Performed a triplex reaction using femA-SA FAM, femA-SE TAMRA, and mecA HEX LNA probes
• Stock solutions of the LNA probes and complementary DNA sequences were prepared at concentrations of 1.0 x 10-6 mol dm-3
• The multiplexing samples were prepared using 10 µL of each of the 3 dye-labeled probes
• 12 µL of each of the complementary sequences was then added or replaced with distilled H2O if absent.
• 34 µL of PBS hybridization buffer was added
41
Multiplexing
MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140
![Page 42: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/42.jpg)
Enhancing the Surface
• Silver NPs are compatible with solution-based approaches to DNA detection by SERRS and can be readily prepared by the reduction of the corresponding metal salt using a reducing agent (i.e. citrate or EDTA)
• Results in overall negative charge on the silver NPs
42
Silver Nanoparticle
Citrate or EDTA
surface layer
Sperminesurface layer
MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140
![Page 43: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/43.jpg)
SERRS Detection Assay
43MacAskill, A., et al., Anal. Chem. 2009, 81, 8134-8140
![Page 44: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/44.jpg)
Results
44
![Page 45: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/45.jpg)
Producing the SERRS-active Probe
• Evaluated fluorescently labeled DNA sequences where every fourth base was modified to be an LNA residue
• 3 different sequences used, either as DNA only or with the LNA
• 3 different labels, FAM, HEX, and TAMRA were used for the identification of the sequences
45
LNA and DNA Sequences Used and the Corresponding Labels
Raman Shift, cm-1
SERR
S Pe
ak In
tens
ity
LNA Probe
LNA Probe + Nonsense DNA
LNA Probe + Complementary DNA
MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140
![Page 46: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/46.jpg)
EDTA-reduced NPs• Citrate-reduced NPs gave more intense signals, however, the difference in
signal between complementary and noncomplementary DNA was more marked when EDTA-reduced silver NPs were used.
• Hybridization buffer had to be PBS-based to obtain the highest SERRS signal while maintaining quantitative and reproducible detection of the target DNA
• The silver NPs were diluted to 50% within the SERRS sample
• Tween 20 was also added to minimized nonspecific adsorption of the labeled single-stranded probes.
46MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140
(mol/L)
![Page 47: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/47.jpg)
Discrimination of Target DNA (femA-SA)
• Comparison of complete DNA probe and LNA probe
• Discrimination of target DNA was examined a function of concentration
• LNA probe showed greater discrimination between complementary (Red Line) and noncomplementary target (Blue Line)
47MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140
LNA
DNAConc. Of DNA (mol/L)
Conc. Of DNA (mol/L)
![Page 48: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/48.jpg)
Versatility and Applicability to Biological Samples
• femA-SA, femA-SE, and mecA were used and have 142, 162, and 99 base pairs, respectively
• PCR products were mixed with appropriate probe and underwent hybridization cycle
• FAM-labeled and LNA and DNA probes containing the same base sequence were used for comparison
48MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140
LNA DNA
Red-NC-PCRBlue-Com-PCR
Conc. of PCR Product (mol/L) Conc. of PCR Product (mol/L)
![Page 49: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/49.jpg)
Multiplexing
• Authors wanted to detect species commonly present in an HAI swab.
• DNA sequences used correspond to the femA gene in S. aureus (femA-SA) which will identify the presence of S. aureus, and the mecA gene, which codes for methicillin resistance in MRSA.
• The sequence for the femA-SE gene in methicillin resistant S. epidermidis (MRSE) was also detected.
49MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140
![Page 50: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/50.jpg)
Spectra of Labeled LNA Probe Sequences
50
femA-SE TAMRA
Triplex Spectrum
femA-SA FAM
mecA HEX
1649 cm-1
645 cm-1
747 cm-1
MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140
![Page 51: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/51.jpg)
Hybridization Assay
• Detect three types of DNA sequences simultaneously, by using threes different dye-labeled probes.
• Eight samples were prepared in total
• Peaks that correspond to each of the probes were monitored: femA-SA FAM (645 cm-1), mecA HEX (747 cm-1), and femA-SE TAMRA (1649 cm-1)
51MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140
![Page 52: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/52.jpg)
Results of Hybridization Assay
52MacAskill, A. et al., Anal. Chem. 2009, 81, 8134-8140
![Page 53: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/53.jpg)
Conclusions
• Assay gives high discrimination between nonsense and complementary DNA when the probe sequence contains LNA bases
• Shows high selectivity and affinity due to the use of the LNA bases
• Discrimination is very well observed after a change in the dye label of the probe
• Capable of multiplex detection• Applicable to biological samples• Identification can be confirmed within a few hours (vs. 48 hrs
plus required for culturing methods)
53
![Page 54: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/54.jpg)
Assay Comparison
+ Fast
+ Applicable to biological samples
+ Selective (QD Probe very specific for target DNA)
+ QD probes are very stable
+ Single-step hybridization
+ Separation free
+ Portable target detection device
+ Applicable to biological samples
+ Very sensitive (detection limits in pmol range)
+ Very selective (Raman signal low when target is present)
+ Separation free
+ Fast (compared to methods that require culturing)
+ Hybridization of long oligonucleotide sequences
+ Simultaneous detection54
Quantum Dot Probes SERRS
![Page 55: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/55.jpg)
Critiques
+ Questionable concentration used for hybridization kinetics
+ No degradation studies shown
+ Device used for detection was not compared to any other devices
+ Failed to show how they calculated the amount of oligonucleotides per QD
+ Dynamic Range
+ Assay requires the use of PCR, the actual time for the PCR is not included
+ Degradation of probes
+ How homogeneous is the silver NP surface?
+ How long is the laser in contact with the sample?
55
Quantum Dot Probes SERRS
![Page 56: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/56.jpg)
Acknowledgements
Dr. Robin L. McCarleyDr. Steven Soper
Soper Research GroupNational Science
FoundationSeminar Audience
56
![Page 57: Novel Methods for the Detection of Nucleic Acid Sequences Katrina Battle Literature Presentation March 22, 2010](https://reader038.vdocuments.site/reader038/viewer/2022110206/56649d0a5503460f949dc73d/html5/thumbnails/57.jpg)
57www.themillionairesecrets.net/.../questions.gif